THE QUESTION:THE QUESTION:
SHOULD I GET A FLU SHOT SHOULD I GET A FLU SHOT EACH YEAR?EACH YEAR?
““KILLER FLU”KILLER FLU”
LEADING CAUSES OF DEATH, UNITED STATES, 1995 Rank Condition Number of Deaths 1 Heart Disease 737,563 2 Cancer 538,455 3 Cerebrovascular disease 157,991 4 Chronic obstructive lung disease 102,899 5 Unintentional injury 93,320 6 Pneumonia and Influenza 82,923 7 Diabetes 59,254 8 HIV and AIDS 43,115 9 Suicide 31,284 10 Chronic liver diseases 25,222
Modified from: National Center for Health Statistics, Health, United States, 1996-97 and Injury Chartbook, Hyattsville, Maryland: 1997 p.117.
What Causes the Flu?What Causes the Flu?
Click on the link below Click on the link below and scroll down to the and scroll down to the influenza virus graphicinfluenza virus graphic
Where are the Where are the Hemagglutinin receptors Hemagglutinin receptors on the virus?on the virus?
What type of nuclear What type of nuclear material do you find in the material do you find in the ‘flu’ virus?‘flu’ virus?
Can you find the binding Can you find the binding sites on the sites on the Hemagglutinin receptor?Hemagglutinin receptor?
What cells in your body What cells in your body does this virus like to does this virus like to enter?enter?
How does the virus enter How does the virus enter cells?cells?
What happens inside the What happens inside the host cell?host cell?
Flu Graphic
Susceptibility, symptoms and Susceptibility, symptoms and spreadspread
How is the virus spread?How is the virus spread? What are the symptoms of What are the symptoms of
the flu?the flu? Is there a sector of the Is there a sector of the
population more population more susceptible to death upon susceptible to death upon infection?infection?
What might the economic What might the economic impact of influenza virus impact of influenza virus be?be?
Open the “weekly Open the “weekly pneumonia and influenza pneumonia and influenza mortality chart”. mortality chart”.
Discuss the significance Discuss the significance of the peaks in this graph.of the peaks in this graph.
How might this graph be How might this graph be different if it was different if it was monitoring mortality as a monitoring mortality as a % of Australian deaths? % of Australian deaths?
Influenza
Factors Affecting the Spread of Factors Affecting the Spread of InfluenzaInfluenza
Use the Influenza simulation model to explore factors Use the Influenza simulation model to explore factors that affect the spread of Influenza within populations.that affect the spread of Influenza within populations.
Mac users must open this in SafariMac users must open this in Safari
What recommendations can you propose to control What recommendations can you propose to control the spread of Influenza in a population?the spread of Influenza in a population?
Simulation Model
click here and then select flu_sim.ppt from the attachments menu for simulation instructions
Should we monitor Influenza virus affecting other Should we monitor Influenza virus affecting other animals such as pigs and chickens?animals such as pigs and chickens?
Update on avian influenza in Asia (17.03.04) The avian influenza outbreak has claimed its 8th victim in
Thailand a 39-year-old factory worker who contracted the deadly virus from a neighbor's sick fighting cocks, the health ministry said on Tue 16 Mar 2004. The woman died last Friday, 12 days after she was initially treated for diarrhea, the ministry said in a statement. This 8th death in Thailand brings the total number of human fatalities from avian influenza A (H5N1) virus infection in East Asia to 23. There have been 11 laboratory-confirmed cases of infection in Thailand and 22 confirmed cases in Viet Nam, making the overall total 33. So far 15 of the Vietnamese cases have died.
From: ProMED-mail Source: Reuters News online, Tue 16 Mar 2004 [edited].
Discuss methods that authorities Discuss methods that authorities could employ to control the could employ to control the
spread of virus between animals spread of virus between animals and humans?and humans?
Mutations in the Mutations in the Hemagglutinin geneHemagglutinin gene
No antigenic shifts occurred between 1957 ("Hong Kong") and 1968 ("Asian"). So what accounts for the epidemics of 1962 and 1964?
Missense mutations in the hemagglutinin (H) gene.
Flu infections create a strong antibody response. After a pandemic or major epidemic, most people will be immune to the virus strain that caused it. The flu virus has two options:
wait until a new crop of susceptible young people comes along
change the epitopes on the hemagglutinin molecule so that they are no longer recognized by the antibodies circulating in the bodies of previous victims.
Evading the Immune SystemEvading the Immune System
Read about evading immunity, shift and drift, to discover Read about evading immunity, shift and drift, to discover why we don’t keep immunity against the influenza virus.why we don’t keep immunity against the influenza virus.
Discuss weather shift or drift in influenza is of major Discuss weather shift or drift in influenza is of major concern to flu watch centres and health organisations concern to flu watch centres and health organisations around the world?around the world?
View the animation: Genetic reassortment between human View the animation: Genetic reassortment between human and nonhuman influenza A viruses. Discuss the and nonhuman influenza A viruses. Discuss the significance of this event for human populations.significance of this event for human populations.
Evading Immunity
Why get a flu shot every year?Why get a flu shot every year?
You are a member of a You are a member of a vaccine development vaccine development team. Brainstorm the team. Brainstorm the issues and strategies issues and strategies involved in preparing involved in preparing this years vaccine this years vaccine
Use the World Health Use the World Health Organisation site for Organisation site for guidance guidance
WHO
Exploring the Genome for Exploring the Genome for InfluenzaInfluenza
When viruses are isolated and sequenced, scientists submit the information into libraries such as GenBank. Nomenclature is based on the parameters shown in the table above.
A SINGAPORE 6 86 H1N1
Type of
Influenza
Town where first
isolated
Number of
isolates
Year of
isolation
Major type of HA and
NA
Phylogenetic TreesPhylogenetic Trees
Scientists analyse nucleotide sequences of influenza strains to construct phylogenetic trees and study relationships between these strains
Use the phylogenetic tree for influenza A on the following page to discuss the following questions.
Which strain of influenza A is more closely related to the A/Scotland/122/2001 strain? A/Beijing/262/95 OR A/HongKong/52/95
How would phylogenetic trees assist health organisations to prepare influenza vaccines?
Phylogenetic tree of influenza A H1N1 and H1N2 virus HA1 nucleotide sequences
Constructing Your Own TreeConstructing Your Own Tree
Use Phylogenetic Tree Constructor to explore Use Phylogenetic Tree Constructor to explore Hemagglutinin nucleotide sequences from Hemagglutinin nucleotide sequences from Human influenza virus, Chicken infuenza Human influenza virus, Chicken infuenza virus and pig influenza virusvirus and pig influenza virus
View data setPhylogenetic Tree Constructor
Still to come….Still to come….
Using BLAST to compare and contrast Using BLAST to compare and contrast nucleotide sequences for human influenza nucleotide sequences for human influenza A H1N1 from the 1918 epidemic and from A H1N1 from the 1918 epidemic and from a 2003 isolate a 2003 isolate
Translating Nucleotide SequencesTranslating Nucleotide Sequences
The nucleotide The nucleotide sequence on the right sequence on the right is a fragment of the is a fragment of the Hemagglutinin gene. Hemagglutinin gene. Use the codon table to Use the codon table to crack the code and crack the code and find the protein find the protein sequence.sequence.
http://www.zerobio.com/toxin/codon.htm
AAACAACTCAACCGAAAACAACTCAACCGACACTGTTGACACAGTCACTGTTGACACAGTACTTGAGAAAAACGTACTTGAGAAAAACGTGACAGTGACACACTCGACAGTGACACACTCAGTCAACCTACTTGAAGTCAACCTACTTGAGAACAGTCAGAACAGTCA
Now from the second Now from the second nucleotide. Does the nucleotide. Does the amino acid sequence amino acid sequence change?change?
Translating the Hemagglutinin GeneTranslating the Hemagglutinin Gene
Use Biology Workbench to find the Use Biology Workbench to find the complete amino acid sequence for the complete amino acid sequence for the Hemagglutinin gene.Hemagglutinin gene.
Translation Instructions Biology Workbench
Still to come…..Still to come…..
Compare and contrast Hemagglutinin Compare and contrast Hemagglutinin structure in CN-3Dstructure in CN-3D