Transcript
Page 1:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Table S1.

Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease)OMIM# Disease Gene Manifestation

categories

102700Severe combined immunodeficiency due to ADA deficiency

ADA Immunology; Oncologic

124000 Mitochondrial complex III deficiency, nuclear type 1 BCS1L

Otolaryngologic; Biochemical; Dermatologic; Gastrointestinal; Genitourinary; Neurologic; Ophthalmologic; Renal

133540 Cockayne syndrome, type B ERCC6

Otolaryngologic; Craniofacial; Dermatologic; Musculoskeletal; Neurologic; Ophthalmologic

145900 Dejerine-Sottas disease MPZ Neurologic145900 Dejerine-Sottas disease PRX Neurologic

148820 Waardenburg syndrome, type 3 PAX3

Otolaryngologic; Craniofacial; Dermatologic; Musculoskeletal; Ophthalmologic

180105 Retinitis pigmentosa 10 IMPDH1 Ophthalmologic

182230 Septooptic dysplasia HESX1Endocrine; Neurologic; Ophthalmologic

188055 Thrombophilia due to activated protein C resistance F5 Hematologic

200100 Abetalipoproteinemia MTTP

Gastrointestinal; Hematologic; Neurologic; Ophthalmologic

200150 Choreoacanthocytosis VPS13AHematologic; Musculoskeletal; Neurologic

200990 Acrocallosal syndrome KIF7

Craniofacial; Gastrointestinal; Musculoskeletal; Neurologic; Renal; Ophthalmologic

201000 Carpenter syndrome RAB23 Otolaryngologic;

1

1

Page 2:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Cardiovascular; Craniofacial; Dental; Endocrine; Genitourinary; Musculoskeletal; Neurologic

201450 Acyl-CoA dehydrogenase, medium chain, deficiency of ACADM

Biochemical; Musculoskeletal; Neurologic

201470 Acyl-CoA dehydrogenase, short-chain, deficiency of ACADS Biochemical;Musculo

skeletal; Neurologic

201475 VLCAD deficiency ACADVL

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic; Renal

201710 Lipoid adrenal hyperplasia STAREndocrine; Genitourinary; Oncologic

201910 Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency CYP21A2

Cardiovascular; Endocrine; Genitourinary; Oncologic

202370 Peroxisome biogenesis disorder 2B PEX5

Biochemical; Craniofacial; Gastrointestinal; Genitourinary; Musculoskeletal; Neurologic; Renal

202400 Afibrinogenemia, congenita FGA Hematologic202400 Afibrinogenemia, congenital FGB Hematologic

203100 Albinism, oculocutaneous, type IA TYR Dermatologic;

Ophthalmologic

203200 Albinism, oculocutaneous, type II OCA2 Dermatologic; Ophthalmologic

203290 Albinism, oculocutaneous, type III TYRP1 Dermatologic;

Ophthalmologic

203300 Hermansky-Pudlak syndrome 1 HPS1

Immunology; Dermatologic; Gastrointestinal; Hematologic; Ophthalmologic; Pulmonary

203500 Alkaptonuria HGD

Biochemical; Cardiovascular; Musculoskeletal; Renal

203700 Mitochondrial DNA depletion syndrome 4A (Alpers type) POLG

Gastrointestinal; Musculoskeletal; Neurologic

2

Page 3:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

203750 Alpha-methylacetoacetic aciduria ACAT1 Biochemical; Neurologic

203780 Alport syndrome, autosomal recessive COL4A3

Otolaryngologic; Ophthalmologic; Renal

203780 Alport syndrome, autosomal recessive COL4A4

Otolaryngologic; Ophthalmologic; Renal

203800 Alstrom syndrome ALMS1

Otolaryngologic; Cardiovascular; Endocrine; Gastrointestinal; Ophthalmologic; Renal

204000 Leber congenital amaurosis 1 GUCY2D Ophthalmologic204100 Leber congenital amaurosis 2 RPE65 Ophthalmologic

204200 Ceroid lipofuscinosis, neuronal, 3 CLN3Biochemical; Neurologic; Ophthalmologic

204300 Ceroid lipofuscinosis, neuronal, Kufs type, adult onset CLN6

Biochemical; Neurologic; Ophthalmologic

204500 Ceroid lipofuscinosis, neuronal, 2 TPP1 Neurologic; Ophthalmologic

206700 Gillespie syndrome PAX6 Neurologic; Ophthalmologic

207800 Argininemia ARG1 Biochemical; Neurologic

207900 Argininosuccinic aciduria ASLBiochemical; Dermatologic; Neurologic

208000 Arterial calcification, generalized, of infancy, 1 ENPP1

Cardiovascular; Dermatologic; Musculoskeletal

208085 Arthrogryposis, renal dysfunction, and cholestasis 1 VPS33B N/A

208150 Fetal akinesia deformation sequence RAPSN Musculoskeletal;

Neurologic

208400 Aspartylglucosaminuria AGA

Immunology; Biochemical; Cardiovascular; Craniofacial; Dermatologic; Musculoskeletal; Neurologic

208540 Renal-hepatic-pancreatic dysplasia 1 NPHP3 Gastrointestinal;

Renal

208920Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia

APTX Gastrointestinal; Neurologic

3

Page 4:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

210200 3-Methylcrotonyl-CoA carboxylase 1 deficiency MCCC1 Biochemical;

Neurologic

210210 3-Methylcrotonyl-CoA carboxylase 2 deficiency MCCC2 Biochemical;

Neurologic

210370 Bietti crystalline corneoretinal dystrophy CYP4V2 Ophthalmologic

210600 Seckel syndrome 1 ATR

Craniofacial; Dental; Dermatologic; Musculoskeletal; Neurologic

212065 Congenital disorder of glycosylation, type Ia PMM2

Biochemical; Cardiovascular; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic; Renal

212066 Congenital disorder of glycosylation, type IIa MGAT2

Otolaryngologic; Biochemical; Craniofacial; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic

212550 Microphthalmia with cataract 2 SIX6 Ophthalmologic

212720 Martsolf syndrome RAB3GAP2

Cardiovascular; Craniofacial; Endocrine; Genitourinary; Musculoskeletal; Neurologic; Ophthalmologic

213300 Joubert syndrome 1 INPP5E

Genitourinary; Neurologic; Ophthalmologic; Renal

214100 Peroxisome biogenesis disorder 1A (Zellweger) PEX1

Biochemical; Craniofacial; Gastrointestinal; Genitourinary; Musculoskeletal; Neurologic; Renal

214150 Cerebrooculofacioskeletal syndrome 1 ERCC6

Otolaryngologic; Craniofacial; Dermatologic; Musculoskeletal; Neurologic; Ophthalmologic

214450 Griscelli syndrome, type 1 MYO5A Dermatologic;

4

Page 5:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Neurologic

214950 Bile acid synthesis defect, congenital, 4 AMACR Biochemical;

Gastrointestinal

215100 Rhizomelic chondrodysplasia punctata, type 1 PEX7

Otolaryngologic; Craniofacial; Dermatologic; Musculoskeletal; Neurologic; Ophthalmologic

215140 Greenberg skeletal dysplasia LBRCraniofacial; Hematologic; Musculoskeletal

215150 Otospondylomegaepiphyseal dysplasia COL2A1

Otolaryngologic; Craniofacial; Musculoskeletal

215700 Citrullinemia ASS1Biochemical; Gastrointestinal; Neurologic

216340 Yunis-Varon syndrome FIG4 Neurologic

216360 COACH syndrome CC2D2A

Gastrointestinal; Genitourinary; Neurologic; Ophthalmologic; Pulmonary; Renal

216360 COACH syndrome TMEM67Gastrointestinal; Neurologic; Renal; Ophthalmologic

216400 Cockayne syndrome, type A ERCC8Dermatologic; Musculoskeletal; Neurologic

217090 Plasminogen deficiency, type I PLG

Dermatologic; Gastrointestinal; Hematologic; Neurologic; Ophthalmologic; Pulmonary

217700 Corneal endothelial dystrophy 2, autosomal recessive SLC4A11 Ophthalmologic

217800 Macular corneal dystrophy CHST6 Ophthalmologic

218000 Agenesis of the corpus callosum with peripheral neuropathy SLC12A6

Craniofacial; Musculoskeletal; Neurologic

218800 Crigler-Najjar syndrome, type I UGT1A1 Gastrointestinal

219000 Fraser syndrome FRAS1

Craniofacial; Gastrointestinal; Genitourinary; Musculoskeletal; Neurologic; Ophthalmologic; Renal

5

Page 6:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

219000 Fraser syndrome FREM2

Craniofacial; Gastrointestinal; Genitourinary; Musculoskeletal; Neurologic; Ophthalmologic; Renal

219700 Cystic fibrosis CFTRGastrointestinal; Genitourinary; Pulmonary

219800 Cystinosis, nephropathic CTNS

Biochemical; Endocrine; Musculoskeletal; Ophthalmologic; Renal

220111 Leigh syndrome, French-Canadian type LRPPRC

Biochemical; Craniofacial; Musculoskeletal; Neurologic

220290 Deafness, autosomal recessive 1A GJB2 Otolaryngologic

220290

Deafness, autosomal recessive 1A;;Deafness, digenic GJB2/GJB6;;Deafness, digenic, GJB2/GJB3

GJB3Otolaryngologic; Dermatologic; Neurologic

221750 Pituitary hormone deficiency, combined, 3 LHX3

Otolaryngologic; Endocrine; Musculoskeletal; Neurologic

222300 Wolfram syndrome WFS1

Otolaryngologic; Endocrine; Neurologic; Ophthalmologic; Renal

222448 Donnai-Barrow syndrome LRP2

Otolaryngologic; Craniofacial; Musculoskeletal; Ophthalmologic; Renal

222600 Diastrophic dysplasia SLC26A2 Craniofacial; Musculoskeletal

223900 Dysautonomia, familial IKBKAP Craniofacial; Neurologic; Renal

224050Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1

VLDLR Neurologic

224230 Dyskeratosis congenita, autosomal recessive 1

NOP10 Immunology; Dental; Dermatologic; Endocrine; Gastrointestinal; Hematologic;

6

Page 7:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Neurologic; Oncologic; Pulmonary

225280Ectodermal dysplasia, ectrodactyly, and macular dystrophy

CDH3Dermatologic; Musculoskeletal; Ophthalmologic

225320 Ehlers-Danlos syndrome, cardiac valvular form COL1A2

Cardiovascular; Dermatologic; Musculoskeletal

225400 Ehlers-Danlos syndrome, type VI PLOD1

Cardiovascular; Dermatologic; Musculoskeletal; Ophthalmologic; Renal

225410 Ehlers-Danlos syndrome, type VIIC ADAMTS2

Craniofacial; Dermatologic; Musculoskeletal; Obstetric

225750 Aicardi-Goutieres syndrome 1, dominant and recessive TREX1

Dermatologic; Gastrointestinal; Hematologic; Neurologic; Ophthalmologic

226600 Epidermolysis bullosa dystrophica, AR COL7A1 Dermatologic

226650 Epidermolysis bullosa, junctional, non-Herlitz type COL17A1 Dermatologic

226700 Epidermolysis bullosa, junctional, Herlitz type LAMB3 Dermatologic

226700 Epidermolysis bullosa, junctional, Herlitz type LAMC2 Dermatologic

226700 Epidermolysis bullosa, junctional, Herlitz type LAMA3 Otolaryngologic;

Dental; Dermatologic

226730 Epidermolysis bullosa, junctional, with pyloric atresia ITGA6 Dermatologic;

Gastrointestinal

226730 Epidermolysis bullosa, junctional, with pyloric atresia ITGB4

Dermatologic; Gastrointestinal; Renal

226980 Wolcott-Rallison syndrome EIF2AK3

Cardiovascular; Dental; Dermatologic; Endocrine; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Renal

227400 Factor V deficiency F5 Hematologic227645 Fanconi anemia, complementation

group CFANCC Otolaryngologic;

Immunology; Dermatologic; Gastrointestinal; Hematologic;

7

Page 8:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Musculoskeletal; Neurologic; Oncologic; Ophthalmologic; Renal

227646 Fanconi anemia, complementation group D2 FANCD2

Otolaryngologic; Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic; Renal

227650 Fanconi anemia, complementation group A FANCA

Otolaryngologic; Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic; Renal

228520 Fibrochondrogenesis COL11A1

Otolaryngologic; Craniofacial; Musculoskeletal; Ophthalmologic

228930 Fuhrmann syndrome WNT7A Dermatologic; Musculoskeletal

229200 Brittle cornea syndrome 1 ZNF469 Musculoskeletal; Ophthalmologic

229300 Friedreich ataxia FXN

Cardiovascular; Endocrine; Musculoskeletal; Neurologic; Ophthalmologic

229600 Fructose intolerance ALDOBBiochemical; Gastrointestinal; Neurologic; Renal

230000 Fucosidosis FUCA1

Biochemical; Dermatologic; Musculoskeletal; Neurologic

230400 Galactosemia GALT Biochemical; Endocrine; Gastrointestinal; Hematologic; Neurologic; Obstetric;

8

Page 9:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Ophthalmologic; Renal

230500 GM1-gangliosidosis, type I GLB1

Biochemical; Cardiovascular; Craniofacial; Dermatologic; Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic

230800 Gaucher disease, type I GBA

Biochemical; Cardiovascular; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic

231050 Geleophysic dysplasia 1 ADAMTSL2

Biochemical; Cardiovascular; Craniofacial; Gastrointestinal; Musculoskeletal

231670 Glutaricaciduria, type I GCDHBiochemical; Cardiovascular; Neurologic

231680 Glutaric acidemia II ETFA

Biochemical; Gastrointestinal; Musculoskeletal; Neurologic; Renal

231680 Glutaric acidemia II ETFB

Biochemical; Gastrointestinal; Musculoskeletal; Neurologic; Renal

231680 Glutaric acidemia II ETFDH

Biochemical; Gastrointestinal; Musculoskeletal; Neurologic; Renal

232200 Glycogen storage disease Ia G6PC

Biochemical; Cardiovascular; Gastrointestinal; Hematologic; Musculoskeletal; Oncologic; Renal

232220 Glycogen storage disease Ib SLC37A4Biochemical; Gastrointestinal; Renal

232300 Glycogen storage disease II GAA Biochemical; Cardiovascular; Musculoskeletal; Neurologic;

9

Page 10:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Pulmonary

232400 Glycogen storage disease III AGL

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic

232500 Glycogen storage disease IV GBE1

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic

232600 McArdle disease PYGMBiochemical; Musculoskeletal; Renal

233650 Combined cellular and humoral immune defects with granulomas RAG1

Immunology; Dermatologic; Gastrointestinal

233650 Combined cellular and humoral immune defects with granulomas RAG2

Immunology; Dermatologic; Gastrointestinal

234200 Neurodegeneration with brain iron accumulation 1 PANK2

Gastrointestinal; Neurologic; Ophthalmologic

235200 Hemochromatosis HFECardiovascular; Endocrine; Gastrointestinal

235800 Histidinemia HAL Biochemical

236200 Thrombosis, hyperhomocysteinemic CBS

Biochemical; Cardiovascular; Dermatologic; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic

236250 Homocystinuria due to MTHFR deficiency MTHFR Neurologic

236670

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1

POMT1Musculoskeletal; Neurologic; Ophthalmologic

236680 Hydrolethalus syndrome HYLS1

Cardiovascular; Craniofacial; Genitourinary; Musculoskeletal; Neurologic; Pulmonary

236700 McKusick-Kaufman syndrome MKKS Cardiovascular; Gastrointestinal; Genitourinary; Musculoskeletal;

10

Page 11:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Neurologic; Renal

237300 Carbamoylphosphate synthetase I deficiency CPS1 Biochemical;

Neurologic

237310 N-acetylglutamate synthase deficiency NAGS Biochemical;

Neurologic

238970Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome

SLC25A15Biochemical; Gastrointestinal; Neurologic

239500 Hyperprolinemia, type I PRODH Biochemical; Neurologic

239510 Hyperprolinemia, type II ALDH4A1 Biochemical; Neurologic

241200 Bartter syndrome, type 2 KCNJ1 Renal

241410 Hypoparathyroidism-retardation-dysmorphism syndrome TBCE

Endocrine; Musculoskeletal; Neurologic

241510 Hypophosphatasia, childhood ALPLDental; Endocrine; Musculoskeletal; Neurologic

241520 Hypophosphatemic rickets, AR DMP1 Endocrine

243500 Isovaleric acidemia IVDBiochemical; Cardiovascular; Neurologic

243800 Johanson-Blizzard syndrome UBR1

Otolaryngologic; Craniofacial; Dental; Dermatologic; Cardiovascular; Endocrine; Gastrointestinal; Hematologic; Neurologic; Ophthalmologic

245200 Krabbe disease GALC Biochemical; Neurologic

245400Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria)

SUCLG1Biochemical; Musculoskeletal; Neurologic

246200 Leprechaunism INSR

Immunology; Craniofacial; Dermatologic; Endocrine; Musculoskeletal; Oncologic; Renal

246450 HMG-CoA lyase deficiency HMGCL Biochemical; Neurologic

246900 Dihydrolipoamide dehydrogenase deficiency DLD Biochemical;

Neurologic

248190 Hypomagnesemia 5, renal, with ocular involvement CLDN19 Ophthalmologic;

Renal248200 Stargardt disease 1 ABCA4 Ophthalmologic

11

Page 12:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

248200 Stargardt disease 1 CNGB3 Ophthalmologic

248360 Malonyl-CoA decarboxylase deficiency MLYCD

Biochemical; Cardiovascular; Neurologic

248370 Mandibuloacral dysplasia LMNA

Otolaryngologic; Craniofacial; Dermatologic; Endocrine; Musculoskeletal

248500 Mannosidosis, alpha-, types I and II MAN2B1

Immunology; Otolaryngologic; Biochemical; Musculoskeletal; Neurologic; Ophthalmologic

248600 Maple syrup urine disease BCKDHA Biochemical; Neurologic

248600 Maple syrup urine disease BCKDHB Biochemical; Neurologic

248600 Maple syrup urine disease DBT Biochemical; Neurologic

248800 Marinesco-Sjogren syndrome SIL1

Endocrine; Musculoskeletal; Neurologic; Ophthalmologic

249000 Meckel syndrome 1 MKS1

Cardiovascular; Craniofacial; Endocrine; Gastrointestinal; Genitourinary; Neurologic; Musculoskeletal; Ophthalmologic; Renal

249100 Familial Mediterranean fever, AR MEFVDermatologic; Musculoskeletal; Renal

249900 Metachromatic leukodystrophy due to SAP-b deficiency PSAP Musculoskeletal;

Neurologic

250100 Metachromatic leukodystrophy ARSA Biochemical; Neurologic

250620 3-hydroxyisobutryl-CoA hydrolase deficiency HIBCH Biochemical;Neurolog

ic

250850 Methionine adenosyltransferase deficiency, autosomal recessive MAT1A Biochemical;

Neurologic

250950 3-methylglutaconic aciduria, type I AUH Biochemical;

Neurologic251000 Methylmalonic aciduria, mut(0)

typeMUT Biochemical;

Hematologic; Cardiovascular;

12

Page 13:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Neurologic; Ophthalmologic

251100 Methylmalonic aciduria, vitamin B12-responsive MMAA

Biochemical; Hematologic; Neurologic; Ophthalmologic

251110

Methylmalonic aciduria, vitamin B12-responsive, due to defect in synthesis of adenosylcobalamin, cblB complementation type

MMAB

Biochemical; Hematologic; Neurologic; Ophthalmologic

251120 Methylmalonyl-CoA epimerase deficiency MCEE

Biochemical; Neurologic; Ophthalmologic

251200 Microcephaly 1, primary, autosomal recessive MCPH1 Neurologic

251880 Mitochondrial DNA depletion syndrome 3 (hepatocerebral type) DGUOK

Biochemical; Gastrointestinal; Musculoskeletal; Neurologic

252150 Molybdenum cofactor deficiency A MOCS1

Biochemical; Neurologic; Ophthalmologic

252160 Molybdenum cofactor deficiency B MOCS2 Biochemical;

Neurologic

252500 Mucolipidosis II alpha/beta GNPTAB

Biochemical; Cardiovascular; Musculoskeletal; Neurologic

252650 Mucolipidosis IV MCOLN1Biochemical; Neurologic; Ophthalmologic

252900 Mucopolysaccharidisis type IIIA (Sanfilippo A) SGSH Biochemical;

Neurologic

252930 Mucopolysaccharidosis type IIIC (Sanfilippo C) HGSNAT

Otolaryngologic; Biochemical; Gastrointestinal; Neurologic; Ophthalmologic

252940 Mucopolysaccharidosis type IIID GNSBiochemical; Musculoskeletal; Neurologic

253010 Mucopolysaccharidosis type IVB (Morquio) GLB1

Biochemical; Cardiovascular; Craniofacial; Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic

253200 Mucopolysaccharidosis type VI (Maroteaux-Lamy)

ARSB Biochemical; Cardiovascular;

13

Page 14:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Musculoskeletal; Ophthalmologic

253220 Mucopolysaccharidosis VII GUSB

Biochemical; Cardiovascular; Craniofacial; Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic

253250 Mulibrey nanism TRIM37

Cardiovascular; Craniofacial; Dermatologic; Endocrine; Gastrointestinal; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic

253260 Biotinidase deficiency BTD

Immunology; Biochemical; Dermatologic; Neurologic; Ophthalmologic

253280

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3

POMGNT1

Craniofacial; Musculoskeletal; Neurologic; Ophthalmologic

253300 Spinal muscular atrophy-1 SMN1 Musculoskeletal; Neurologic

253310 Lethal congenital contracture syndrome 1 GLE1

Craniofacial; Musculoskeletal; Neurologic

253600 Muscular dystrophy, limb-girdle, type 2A CAPN3 Musculoskeletal

253601 Muscular dystrophy, limb-girdle, type 2B DYSF Musculoskeletal

253700 Muscular dystrophy, limb-girdle, type 2C SGCG Musculoskeletal

253800

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4

FKTN

Cardiovascular; Musculoskeletal; Neurologic; Ophthalmologic

254110 Muscular dystrophy, limb-girdle, type 2H TRIM32

Craniofacial; Musculoskeletal; Neurologic

254130 Miyoshi muscular dystrophy 1 DYSF Musculoskeletal

254800 Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) CSTB Neurologic

255120 CPT deficiency, hepatic, type IA CPT1A Biochemical; Cardiovascular;

14

Page 15:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Gastrointestinal; Musculoskeletal; Neurologic; Renal

255125 Myopathy with lactic acidosis, hereditary ISCU

Cardiovascular; Musculoskeletal; Renal

255320 Minicore myopathy with external ophthalmoplegia RYR1 Musculoskeletal

255700 Myotonia congenita, recessive CLCN1 Musculoskeletal

255800 Schwartz-Jampel syndrome, type 1 HSPG2 Craniofacial;

Musculoskeletal

256030 Nemaline myopathy 2, autosomal recessive NEB Musculoskeletal

256050 Atelosteogenesis II SLC26A2 Craniofacial; Musculoskeletal

256300 Nephrotic syndrome, type 1 NPHS1 Renal256600 Infantile neuroaxonal dystrophy 1 PLA2G6 Neurologic

256730 Ceroid lipofuscinosis, neuronal, 1 PPT1Biochemical; Neurologic; Ophthalmologic

256731 Ceroid lipofuscinosis, neuronal, 5 CLN5Biochemical; Neurologic; Ophthalmologic

256800 Insensitivity to pain, congenital, with anhidrosis NTRK1 Immunology;

Neurologic

256810 Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) MPV17

Biochemical; Gastrointestinal; Musculoskeletal; Neurologic; Oncologic

256850 Giant axonal neuropathy-1 GANDermatologic; Musculoskeletal; Neurologic

257200 Niemann-Pick disease, type A SMPD1

Gastrointestinal; Neurologic; Ophthalmologic; Pulmonary

257220 Niemann-Pick disease, type C1 NPC1

Biochemical; Gastrointestinal; Neurologic; Ophthalmologic

257270Night blindness, congenital stationary (complete), 1B, autosomal recessive

GRM6 Ophthalmologic

257320 Lissencephaly 2 (Norman-Roberts type) RELN Craniofacial;

Neurologic

257850 Oculodentodigital dysplasia, autosomal recessive GJA1

Craniofacial; Dental; Musculoskeletal; Ophthalmologic

15

Page 16:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

257980 Odontoonychodermal dysplasia WNT10A Dental; Dermatologic258100 Oguchi disease-1 SAG Ophthalmologic

258501 3-methylglutaconic aciduria, type III OPA3

Biochemical; Neurologic; Ophthalmologic

258870Gyrate atrophy of choroid and retina with or without ornithinemia

OAT

Biochemical; Musculoskeletal; Neurologic; Ophthalmologic

259700 Osteopetrosis, autosomal recessive 1 TCIRG1

Otolaryngologic; Musculoskeletal; Ophthalmologic

259720 Osteopetrosis, autosomal recessive 5 OSTM1 Musculoskeletal

259730Osteopetrosis, autosomal recessive 3, with renal tubular acidosis

CA2 Musculoskeletal; Neurologic; Renal

259770 Osteoporosis-pseudoglioma syndrome LRP5 Musculoskeletal;

Ophthalmologic

259775 Raine syndrome FAM20CCraniofacial; Dental; Musculoskeletal; Neurologic; Renal

259900 Hyperoxaluria, primary, type 1 AGXT Biochemical; Cardiovascular; Renal

260000 Hyperoxaluria, primary, type II GRHPR Biochemical; Renal

260370 Pancreatic agenesis 1 PDX1 Endocrine; Gastrointestinal

260400 Shwachman-Bodian-Diamond syndrome SBDS

Immunology; Gastrointestinal; Hematologic; Musculoskeletal; Oncologic

260920 Hyper-IgD syndrome MVK

Immunology; Dermatologic; Biochemical; Gastrointestinal

261515 D-bifunctional protein deficiency HSD17B4

Otolaryngologic; Biochemical; Endocrine; Genitourinary; Musculoskeletal; Neurologic; Obstetric

261600 Phenylketonuria PAHBiochemical; Dermatologic; Neurologic

262000 Bjornstad syndrome BCS1L

Otolaryngologic; Dermatologic; Genitourinary; Neurologic; Ophthalmologic

16

Page 17:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

262190 Rabson-Mendenhall syndrome INSRCraniofacial; Dental; Dermatologic; Endocrine

262600 Pituitary hormone deficiency, combined, 2 PROP1 Endocrine

263200 Polycystic kidney and hepatic disease PKHD1

Immunology; Endocrine; Gastrointestinal; Renal

264350 Pseudohypoaldosteronism, type I SCNN1A Immunology; Pulmonary; Renal

264350 Pseudohypoaldosteronism, type I SCNN1B Immunology; Pulmonary; Renal

264350 Pseudohypoaldosteronism, type I SCNN1G Immunology; Pulmonary; Renal

264470 Peroxisomal acyl-CoA oxidase deficiency ACOX1

Otolaryngologic; Biochemical; Craniofacial; Neurologic; Ophthalmologic

265800 Pycnodysostosis CTSKBiochemical; Craniofacial; Musculoskeletal

266130 Glutathione synthetase deficiency GSS

Biochemical; Hematologic; Neurologic; Ophthalmologic

266150 Pyruvate carboxylase deficiency PC Biochemical; Neurologic

266200 Pyruvate kinase deficiency PKLR Hematologic

266265 Congenital disorder of glycosylation, type IIc SLC35C1

Immunology; Biochemical; Neurologic

266500 Refsum disease PHYH

Otolaryngologic; Biochemical; Cardiovascular; Dermatologic; Musculoskeletal; Neurologic; Ophthalmologic

266510 Peroxisome biogenesis disorder 3B PEX12

Biochemical; Craniofacial; Gastrointestinal; Genitourinary; Musculoskeletal; Neurologic; Renal

267430 Renal tubular dysgenesis ACE Renal267430 Renal tubular dysgenesis AGT Renal267430 Renal tubular dysgenesis AGTR1 Renal267430 Renal tubular dysgenesis REN Renal

17

Page 18:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

267750 Knobloch syndrome, type 1 COL18A1

Craniofacial; Musculoskeletal; Neurologic; Ophthalmologic

268100 Enhanced S-cone syndrome NR2E3 Ophthalmologic

268300 Roberts syndrome ESCO2

Cardiovascular; Craniofacial; Musculoskeletal; Neurologic; Ophthalmologic

268800 Sandhoff disease, infantile, juvenile, and adult forms HEXB

Biochemical; Neurologic; Ophthalmologic

269000 SC phocomelia syndrome ESCO2

Cardiovascular; Craniofacial; Musculoskeletal; Neurologic; Ophthalmologic

269250 Schneckenbecken dysplasia SLC35D1 Musculoskeletal

269700 Lipodystrophy, congenital generalized, type 2 BSCL2

Cardiovascular; Endocrine; Neurologic

269920 Sialic acid storage disorder, infantile SLC17A5

Biochemical; Cardiovascular; Gastrointestinal; Neurologic

270400 Smith-Lemli-Opitz syndrome DHCR7

Biochemical; Cardiovascular; Craniofacial; Endocrine; Genitourinary; Musculoskeletal; Neurologic; Renal

270550 Spastic ataxia, Charlevoix-Saguenay type SACS

Cardiovascular; Musculoskeletal; Neurologic; Ophthalmologic

270700 Spastic paraplegia 15, autosomal recessive ZFYVE26 Neurologic

271245 Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) C10orf2

Otolaryngologic; Biochemical; Endocrine; Musculoskeletal; Neurologic

271900 Canavan disease ASPA Neurologic; Ophthalmologic

271930 Striatonigral degeneration, infantile NUP62 Neurologic

271980 Succinic semialdehyde dehydrogenase deficiency ALDH5A1 Biochemical;

Neurologic

18

Page 19:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

272300 Sulfite oxidase deficiency SUOXBiochemical; Neurologic; Ophthalmologic

272430 Cold-induced sweating syndrome 1 CRLF1 Musculoskeletal;

Neurologic

272750 GM2-gangliosidosis, AB variant GM2ABiochemical; Neurologic; Ophthalmologic

272800 Tay-Sachs disease HEXABiochemical; Neurologic; Ophthalmologic

274270 Renal tubular dysgenesis DPYD General

275100 Hypothryoidism, congenital, nongoitrous 4 TSHB Endocrine

275200 Hypothyroidism, congenital, nongoitrous, 1 TSHR Endocrine

275210 Restrictive dermopathy, lethal ZMPSTE24 Dental; Dermatologic; Musculoskeletal

275900 Troyer syndrome SPG20 Musculoskeletal; Neurologic

276600 Tyrosinemia, type II TAT

Biochemical; Dermatologic; Neurologic; Ophthalmologic

276700 Tyrosinemia, type I FAH

Biochemical; Gastrointestinal; Musculoskeletal; Oncologic; Renal

276710 Tyrosinemia, type III HPD Biochemical; Neurologic

276820 Ulna and fibula, absence of, with severe limb deficiency WNT7A

Dermatologic; Genitourinary; Musculoskeletal

276900 Usher syndrome, type 1B MYO7A Otolaryngologic; Ophthalmologic

276901 Usher syndrome, type 2A USH2A Otolaryngologic; Ophthalmologic

276902 Usher syndrome, type 3A CLRN1 Otolaryngologic; Ophthalmologic

276904 Usher syndrome, type 1C USH1C Otolaryngologic; Ophthalmologic

277300 Spondylocostal dysostosis 1, autosomal recessive DLL3 Musculoskeletal

277400 Methylmalonic aciduria and homocystinuria, cblC type MMACHC

Biochemical; Cardiovascular; Dermatologic; Hematologic; Neurologic; Ophthalmologic; Renal

19

Page 20:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

277410 Methylmalonic aciduria and homocystinuria, cblD type MMADHC

Biochemical; Hematologic; Neurologic; Ophthalmologic

277440 Rickets, vitamin D-resistant, type IIA VDR

Dermatologic; Endocrine; Musculoskeletal

277470 Pontocerebellar hypoplasia type 2A TSEN54 Neurologic

277580 Waardenburg syndrome, type 4A EDNRB

Otolaryngologic; Dermatologic; Gastrointestinal; Ophthalmologic

277900 Wilson disease ATP7B

Biochemical; Gastrointestinal; Neurologic; Ophthalmologic

278700 Xeroderma pigmentosum, group A XPA

Dermatologic; Neurologic; Oncologic

278730 Xeroderma pigmentosum, group D ERCC2

Dermatologic; Neurologic; Ophthalmologic

278740 Xeroderma pigmentosum, group E, DDB-negative subtype DDB2

Dermatologic; Oncologic; Ophthalmologic

278760 Xeroderma pigmentosum, group F ERCC4

Otolaryngologic; Craniofacial; Dermatologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic

278780 Xeroderma pigmentosum, group G ERCC5

Craniofacial; Dermatologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic

300029 Retinitis pigmentosa 3 RPGR Ophthalmologic

300055 Mental retardation, X-linked, syndromic 13 MECP2 Neurologic

300068 Androgen insensitivity AR Genitourinary; Oncologic

300200Adrenal hypoplasia, congenital, with hypogonadotropic hypogonadism

NR0B1Endocrine; Genitourinary; Obstetric; Oncologic

300209 Simpson-Golabi-Behmel syndrome, type 2

OFD1 Craniofacial; Dermatologic; Genitourinary;

20

Page 21:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Musculoskeletal; Neurologic; Pulmonary; Renal

300299 Neutropenia, severe congenital, X-linked WAS

Immunology; Dermatologic; Hematologic

300322 Lesch-Nyhan syndrome HPRT1

Biochemical; Hematologic; Musculoskeletal; Neurologic; Renal

300323 HPRT-related gout HPRT1

Biochemical; Hematologic; Musculoskeletal; Neurologic; Renal

300352 Cerebral creatine deficiency syndrome 1 SLC6A8

Otolaryngologic; Biochemical; Craniofacial; Gastrointestinal; Musculoskeletal; Neurologic

300400 Severe combined immunodeficiency, X-linked IL2RG Immunology

300472Corpus callosum, agenesis of, with mental retardation, ocular coloboma and micrognathia

IGBP1

Otolaryngologic; Craniofacial; Musculoskeletal; Neurologic; Ophthalmologic

300500 Ocular albinism, type I, Nettleship-Falls type GPR143 Ophthalmologic

300555 Dent disease 2 OCRLNeurologic; Ophthalmologic; Renal

300661 Phosphoribosylpyrophosphate synthetase superactivity PRPS1

Otolaryngologic; Biochemical; Neurologic; Renal

300673 Encephalopathy, neonatal severe MECP2 Neurologic

300696 Myopathy, X-linked, with postural muscle atrophy FHL1 Cardiovascular;

Musculoskeletal300751 Anemia, sideroblastic, X-linked ALAS2 Hematologic300755 Agammaglobulinemia, X-linked 1 BTK Immunology

300804 Joubert syndrome 10 OFD1

Craniofacial; Musculoskeletal; Neurologic; Pulmonary; Renal

300895 Ohdo syndrome, X-linked MED12

Craniofacial; Gastrointestinal; Musculoskeletal; Neurologic

301000 Wiskott-Aldrich syndrome WAS Immunology; Dermatologic;

21

Page 22:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Hematologic

301310 Anemia, sideroblastic, with ataxia ABCB7 Hematologic; Neurologic

301830 Spinal muscular atrophy, X-linked 2, infantile UBA1 Musculoskeletal;

Neurologic

302950 Chondrodysplasia punctata, X-linked recessive ARSE

Craniofacial; Musculoskeletal; Neurologic

303350 MASA syndrome L1CAM Musculoskeletal; Neurologic

304400 Deafness, X-linked 2 POU3F4 Otolaryngologic304500 Deafness, X-linked 1 PRPS1 Otolaryngologic

304700 Mohr-Tranebjaerg syndrome TIMM8A

Otolaryngologic; Musculoskeletal; Neurologic; Ophthalmologic

305000 Dyskeratosis congenita, X-linked DKC1

Immunology; Dermatologic; Endocrine; Gastrointestinal; Hematologic; Neurologic; Oncologic; Pulmonary

305100 Ectodermal dysplasia 1, hypohidrotic, X-linked EDA

Immunology; Craniofacial; Dental; Dermatologic

305620 Frontometaphyseal dysplasia FLNA

Otolaryngologic; Cardiovascular; Craniofacial; Genitourinary; Musculoskeletal; Neurologic; Pulmonary; Renal

306700 Hemophilia A F8 Hematologic306900 Hemophilia B F9 Hematologic

307200 Agammaglobulinemia and isolated hormone deficiency BTK Immunology

308205 IFAP syndrome with or without BRESHECK syndrome MBTPS2

Craniofacial; Dermatologic; Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic; Renal

308230 Immunodeficiency, X-linked, with hyper-IgM CD40LG

Immunology; Hematologic; Oncologic

308240 Lymphoproliferative syndrome, X-linked, 1 SH2D1A

Immunology; Hematologic; Oncologic

22

Page 23:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

308350 Epileptic encephalopathy, early infantile, 1 ARX Craniofacial;

Neurologic

309400 Menkes disease ATP7A

Cardiovascular; Dermatologic; Musculoskeletal; Neurologic

309520 Lujan-Fryns syndrome MED12Craniofacial; Musculoskeletal; Neurologic

309900 Mucopolysaccharidosis II IDS Biochemical; Cardiovascular

310200 Duchenne muscular dystrophy DMD

Cardiovascular; Musculoskeletal; Neurologic; Ophthalmologic

310300 Emery-Dreifuss muscular dystrophy 1, X-linked EMD Cardiovascular;

Musculoskeletal

310400 Myotubular myopathy, X-linked MTM1

Gastrointestinal; Hematologic; Musculoskeletal; Renal

310500Night blindness, congenital stationary (complete), 1A, X-linked

NYX Ophthalmologic

311070 Charcot-Marie-Tooth disease, X-linked recessive, 5 PRPS1 Otolaryngologic;

Neurologic

311250 Ornithine transcarbamylase deficiency OTC

Biochemical; Gastrointestinal; Neurologic

312080 Pelizaeus-Merzbacher disease PLP1 Neurologic; Ophthalmologic

312170 Pyruvate dehydrogenase E1-alpha deficiency PDHA1 Biochemical;

Neurologic312600 Retinitis pigmentosa 2 RP2 Ophthalmologic

312920 Spastic paraplegia 2, X-linked PLP1Musculoskeletal; Neurologic; Ophthalmologic

313900 Thrombocytopenia, X-linked WASImmunology; Dermatologic; Hematologic

314250 Dystonia-Parkinsonism, X-linked TAF1 Neurologic600060 Deafness, autosomal recessive 2 MYO7A Otolaryngologic

600105 Retinitis pigmentosa-12, autosomal recessive CRB1 Ophthalmologic

600118 Warburg micro syndrome 1 RAB3GAP1

Craniofacial; Endocrine; Genitourinary; Musculoskeletal; Neurologic; Ophthalmologic

23

Page 24:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

600121 Rhizomelic chondrodysplasia punctata, type 3 AGPS

Biochemical; Musculoskeletal; Neurologic

600132 Retinitis pigmentosa 14 TULP1 Ophthalmologic

600142 CARASIL syndrome HTRA1Cardiovascular; Dermatologic; Neurologic

600143 Ceroid lipofuscinosis, neuronal, 8 CLN8Biochemical; Neurologic; Ophthalmologic

600316 Deafness, autosomal recessive 3 MYO15A Otolaryngologic

600501 ABCD syndrome EDNRB

Otolaryngologic; Dermatologic; Gastrointestinal; Ophthalmologic

600649 CPT deficiency, hepatic, type II CPT2

Biochemical; Cardiovascular; Gastrointestinal; Neurologic

600721 D-2-hydroxyglutaric aciduria D2HGDHBiochemical; Cardiovascular; Neurologic

600737 Inclusion body myopathy, autosomal recessive GNE Musculoskeletal;

Neurologic

600791 Deafness, autosomal recessive 4, with enlarged vestibular aqueduct SLC26A4 Otolaryngologic;

Endocrine

600802 SCID, autosomal recessive, T-negative/B-positive type JAK3 Immunology

600901 Fanconi anemia, complementation group E FANCE

Otolaryngologic; Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic; Renal

600971 Deafness, autosomal recessive 6 TMIE Otolaryngologic

600972 Achondrogenesis Ib SLC26A2 Craniofacial; Musculoskeletal

600974 Deafness, autosomal recessive 7 TMC1 Otolaryngologic

601067 Usher syndrome, type 1D CDH23 Otolaryngologic; Ophthalmologic

601071 Deafness, autosomal recessive 9 OTOF Otolaryngologic

601072 Deafness, autosomal recessive 8/10 TMPRSS3 Otolaryngologic

601186 Microphthalmia, syndromic 9 STRA6 Cardiovascular; Craniofacial; Gastrointestinal;

24

Page 25:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Genitourinary; Musculoskeletal; Neurologic; Ophthalmologic; Pulmonary; Renal

601382 Charcot-Marie-Tooth disease, type 4B1 MTMR2 Neurologic

601386 Deafness, autosomal recessive 12 CDH23 Otolaryngologic

601455 Charcot-Marie-Tooth disease, type 4D NDRG1 Neurologic

601553 Hypotrichosis, congenital, with juvenile macular dystrophy CDH3 Dermatologic;

Ophthalmologic

601559Stuve-Wiedemann syndrome/Schwartz-Jampel type 2 syndrome

LIFR Musculoskeletal; Neurologic

601596 Charcot-Marie-Tooth disease, type 4C SH3TC2 Neurologic

601678 Bartter syndrome, type 1 SLC12A1 Renal

601705T-cell immunodeficiency, congenital alopecia, and nail dystrophy

FOXN1 Immunology; Dermatologic

601718 Retinitis pigmentosa 19 ABCA4 Ophthalmologic

601780 Ceroid lipofuscinosis, neuronal, 6 CLN6Biochemical; Neurologic; Ophthalmologic

601813 Exudative vitreoretinopathy 4 LRP5 Musculoskeletal; Ophthalmologic

601954 Muscular dystrophy, limb-girdle, type 2G TCAP Cardiovascular;

Musculoskeletal

602083 Usher syndrome, type 1F PCDH15 Otolaryngologic; Ophthalmologic

602450Severe combined immunodeficiency, Athabascan type

DCLRE1C Immunology

602473 Ethylmalonic encephalopathy ETHE1

Biochemical; Cardiovascular; Gastrointestinal; Neurologic

602522 Bartter syndrome, type 4a BSND Otolaryngologic; Renal

602579 Congenital disorder of glycosylation, type Ib MPI

Biochemical; Gastrointestinal; Hematologic

602771 Muscular dystrophy, rigid spine, 1 SEPN1 Musculoskeletal602772 Retinitis pigmentosa 25 EYS Ophthalmologic603147 Congenital disorder of

glycosylation, type IcALG6 Biochemical;

Endocrine; Gastrointestinal; Hematologic;

25

Page 26:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Neurologic; Ophthalmologic

603194 Meckel syndrome 2 TMEM216

Gastrointestinal; Musculoskeletal; Ophthalmologic; Renal

603278 Glomerulosclerosis, focal segmental, 1 ACTN4 Renal

603358 GRACILE syndrome BCS1L Biochemical; Gastrointestinal

603471 Citrullinemia, adult-onset type II SLC25A13

Biochemical; Gastrointestinal; Hematologic; Neurologic; Oncologic

603554 Omenn syndrome DCLRE1CImmunology; Dermatologic; Gastrointestinal

603554 Omenn syndrome RAG1Immunology; Dermatologic; Gastrointestinal

603585 Congenital disorder of glycosylation, type IIf SLC35A1

Immunology; Hematologic; Neurologic

603629 Deafness, autosomal recessive 21 TECTA Otolaryngologic603720 Deafness, autosomal recessive 16 STRC Otolaryngologic

603903 Sickle cell anemia HBB

Immunology; Cardiovascular; Hematologic; Neurologic; Pulmonary

604004Megalencephalic leukoencephalopathy with subcortical cysts

MLC1 Neurologic

604116 Cone-rod dystrophy 3 ABCA4 Ophthalmologic604129 Epidermolysis bullosa pruriginosa COL7A1 Dermatologic

604131 Thalassemia, alpha- HBA1;HBA2 Hematologic

604168 Congenital cataracts, facial dysmorphism, and neuropathy CTDP1

Cardiovascular; Endocrine; Musculoskeletal; Neurologic; Ophthalmologic; Renal

604250 Hemochromatosis, type 3 TFR2

Biochemical; Cardiovascular; Endocrine; Gastrointestinal; Hematologic

604286 Muscular dystrophy, limb-girdle, SGCB Cardiovascular;

26

Page 27:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

type 2E Musculoskeletal

604317Microcephaly 2, primary, autosomal recessive, with or without cortical malformations

WDR62 Neurologic

604320 Neuronopathy, distal hereditary motor, type VI IGHMBP2 Neurologic

604360 Spastic paraplegia 11, autosomal recessive SPG11 Neurologic

604369 Salla disease SLC17A5 Neurologic604393 Leber congenital amaurosis 4 AIPL1 Ophthalmologic

604563 Charcot-Marie-Tooth disease, type 4B2 SBF2

Otolaryngologic; Neurologic; Ophthalmologic

604804 Microcephaly 3, primary, autosomal recessive

CDK5RAP2

Otolaryngologic; Neurologic

605253 Neuropathy, congenital hypomyelinating EGR2 Neurologic

605355 Nemaline myopathy 5, Amish type TNNT1 Musculoskeletal

605407 Segawa syndrome, recessive TH Biochemical; Neurologic

605472 Usher syndrome, type 2C GPR98 Otolaryngologic; Ophthalmologic

605472

Usher syndrome, type 2C;;Usher syndrome, type 2C, GPR98/PDZD7 digenic;;Usher syndrome, type IIC, GPR98/PDZD7 digenic

PDZD7 Otolaryngologic; Ophthalmologic

605588 Charcot-Marie-Tooth disease, type 2B1 LMNA Musculoskeletal;

Neurologic

605589 Charcot-Marie-Tooth disease, type 2B2 MED25 Neurologic

605724 Fanconi anemia, complementation group D1 BRCA2

Hematologic; Oncologic; Ophthalmologic; Renal

605814 Citrullinemia, type II, neonatal-onset SLC25A13

Biochemical; Gastrointestinal; Hematologic

605899 Glycine encephalopathy AMTBiochemical; Neurologic; Ophthalmologic

605899 Glycine encephalopathy GCSHBiochemical; Neurologic; Ophthalmologic

605899 Glycine encephalopathy GLDCBiochemical; Neurologic; Ophthalmologic

606002 Ataxia-ocular apraxia-2 SETX Neurologic

27

Page 28:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

606054 Propionicacidemia PCCA

Immunology; Biochemical; Cardiovascular; Hematologic; Neurologic

606054 Propionicacidemia PCCB

Immunology; Biochemical; Cardiovascular; Hematologic; Neurologic

606574 Albinism, oculocutaneous, type IV SLC45A2 Dermatologic;

Ophthalmologic

606593 LIG4 syndrome LIG4Immunology; Craniofacial; Neurologic

606612

Muscular dystrophy-dystroglycanopathy (congenital with or without mental retardation), type B, 5

FKRP Musculoskeletal; Neurologic

606812 Fumarase deficiency FHBiochemical; Dermatologic; Neurologic

606943 Usher syndrome, type 1G USH1G Otolaryngologic; Ophthalmologic

606996 Senior-Loken syndrome 4 NPHP4 Ophthalmologic; Renal

607039 Deafness, autosomal recessive 22 OTOA Otolaryngologic607084 Deafness, autosomal recessive 31 DFNB31 Otolaryngologic

607091 Congenital disorder of glycosylation, type IId B4GALT1

Biochemical; Hematologic; Musculoskeletal; Neurologic

607101 Deafness, autosomal recessive 30 MYO3A Otolaryngologic

607236 HARP syndrome PANK2Hematologic; Neurologic; Ophthalmologic

607259 Spastic paraplegia 7, autosomal recessive SPG7 Neurologic

607330 Lathosterolosis SC5DL

Biochemical; Craniofacial; Gastrointestinal; Musculoskeletal; Neurologic

607361 Meckel syndrome 3 TMEM67

Gastrointestinal; Neurologic; Musculoskeletal; Renal

607426 Coenzyme Q10 deficiency, primary, 1 COQ2

Biochemical; Musculoskeletal; Neurologic; Renal

28

Page 29:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

607475 Bothnia retinal dystrophy RLBP1 Ophthalmologic

607616 Niemann-Pick disease, type B SMPD1

Gastrointestinal; Neurologic; Ophthalmologic; Pulmonary

607624 Griscelli syndrome, type 2 RAB27A

Immunology; Dermatologic; Hematologic; Neurologic; Oncologic

607625 Niemann-pick disease, type C2 NPC2Biochemical; Gastrointestinal; Neurologic

607706 Charcot-Marie-Tooth disease, axonal, with vocal cord paresis GDAP1 Neurologic

607734 Charcot-Marie-Tooth disease, type 1F NEFL Neurologic

607821 Deafness, autosomal recessive 37 MYO6 Otolaryngologic

607832 Glomerulosclerosis, focal segmental, 3 CD2AP Renal

607855 Muscular dystrophy, congenital merosin-deficient LAMA2 Musculoskeletal;

Neurologic

608013 Gaucher disease, perinatal lethal GBA

Biochemical; Cardiovascular; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic

608091 Joubert syndrome 2 TMEM216

Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic; Renal

608093 Congenital disorder of glycosylation, type Ij DPAGT1

Biochemical; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic; Genitourinary

608099 Muscular dystrophy, limb-girdle, type 2D SGCA Cardiovascular;

Musculoskeletal608265 Deafness, autosomal recessive 39 HGF Otolaryngologic608380 Retinitis pigmentosa 26 CERKL Ophthalmologic

608393 Microcephaly 6, primary, autosomal recessive CENPJ

Craniofacial; Musculoskeletal; Neurologic

608540 Congenital disorder of glycosylation, type Ik

ALG1 Biochemical; Gastrointestinal; Hematologic;

29

Page 30:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Neurologic; Renal608553 Leber congenital amaurosis 9 NMNAT1 Ophthalmologic608565 Deafness, autosomal recessive 35 ESRRB Otolaryngologic

608612 Mandibuloacral dysplasia with type B lipodystrophy ZMPSTE24 Dental; Dermatologic;

Musculoskeletal

608629 Joubert syndrome-3 AHI1Neurologic; Ophthalmologic; Renal

608643 Aromatic L-amino acid decarboxylase deficiency DDC Biochemical;

Neurologic

608688 AICA-ribosiduria due to ATIC deficiency ATIC

Biochemical; Dermatologic; Neurologic; Ophthalmologic

608716 Microcephaly 5, primary, autosomal recessive ASPM Neurologic

608728 Spondyloepimetaphyseal dysplasia MATN3 Musculoskeletal

608747Growth retardation with deafness and mental retardation due to IGF1 deficiency

IGF1Otolaryngologic; Endocrine; Neurologic

608782 Pyruvate dehydrogenase phosphatase deficiency PDP1 Biochemical;

Neurologic

608799 Congenital disorder of glycosylation, type Ie DPM1

Biochemical; Craniofacial; Neurologic; Ophthalmologic

608804 Leukodystrophy, hypomyelinating, 2 GJC2 Neurologic

608840Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6

LARGEMusculoskeletal; Neurologic; Ophthalmologic

608890 Waardenburg syndrome, type 2D SNAI2 Otolaryngologic; Ophthalmologic

608931Myasthenic syndrome, congenital, associated with acetylcholine receptor deficiency

RAPSN Musculoskeletal; Neurologic

609006 Deafness, autosomal recessive 36 ESPN Otolaryngologic

609015 Trifunctional protein deficiency HADHB

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic

609016 LCHAD deficiency HADHA

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic

30

Page 31:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

609033 Ataxia, posterior column, with retinitis pigmentosa FLVCR1 Neurologic;

Ophthalmologic

609053 Fanconi anemia, complementation group I FANCI

Otolaryngologic; Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic; Renal

609054 Fanconi anemia, complementation group J BRIP1 Hematologic;

Oncologic;

609060 Combined oxidative phosphorylation deficiency 1 GFM1

Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic

609241 Schindler disease, type I NAGA Neurologic

609242 Kanzaki disease NAGABiochemical; Dermatologic; Neurologic

609254 Senior-Loken syndrome 5 IQCB1 Ophthalmologic; Renal

609304 Epileptic encephalopathy, early infantile, 3 SLC25A22 Neurologic

609308Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 1

POMT1Cardiovascular; Musculoskeletal; Neurologic

609311 Charcot-Marie-Tooth disease, type 4H FGD4 Neurologic

609528Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome

SNAP29 Dermatologic; Neurologic

609533 Deafness, autosomal recessive 23 PCDH15 Otolaryngologic609549 Nanophthalmos 2 MFRP Ophthalmologic

609560 Mitochondrial DNA depletion syndrome 2 (myopathic type) TK2 Biochemical;

Musculoskeletal

609583 Joubert syndrome 4 NPHP1Neurologic; Ophthalmologic; Renal

609638 Epidermolysis bullosa, lethal acantholytic DSP Dermatologic

609814 Complement factor H deficiency CFH

Immunology; Hematologic; Ophthalmologic; Renal

609823 Deafness, autosomal recessive 28 TRIOBP Otolaryngologic610006 2-methylbutyrylglycinuria ACADSB Biochemical

31

Page 32:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

610090 Pyridoxamine 5'-phosphate oxidase deficiency PNPO Biochemical;

Neurologic

610127 Ceroid lipofuscinosis, neuronal, 10 CTSD

Biochemical; Neurologic; Ophthalmologic

610153 Deafness, autosomal recessive 49 MARVELD2 Otolaryngologic

610156Mental retardation, truncal obesity, retinal dystrophy, and micropenis

INPP5EGenitourinary; Neurologic; Ophthalmologic

610188 Joubert syndrome 5 CEP290

Genitourinary; Neurologic; Ophthalmologic; Pulmonary; Renal

610189 Senior-Loken syndrome 6 CEP290Gastrointestinal; Neurologic; Ophthalmologic

610198 3-methylglutaconic aciduria, type V DNAJC19

Biochemical; Cardiovascular; Gastrointestinal; Genitourinary; Hematologic; Neurologic; Ophthalmologic

610220 Deafness, autosomal recessive 59 DFNB59 Otolaryngologic610265 Deafness, autosomal recessive 67 LHFPL5 Otolaryngologic610282 Retinitis pigmentosa 35 SEMA4A Ophthalmologic610356 Retinal cone dystrophy 3B KCNV2 Ophthalmologic

610370 Diarrhea 4, malabsorptive, congenital NEUROG3 Endocrine;

Gastrointestinal

610377 Mevalonic aciduria MVK

Immunology; Dermatologic; Biochemical; Gastrointestinal

610498 Combined oxidative phosphorylation deficiency 2 MRPS16

Biochemical; Gastrointestinal; Neurologic

610505 Combined oxidative phosphorylation deficiency 3 TSFM

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic

610532 Leukodystrophy, hypomyelinating, 5 FAM126A Neurologic;

Ophthalmologic

610539 Gaucher disease, atypical PSAP

Biochemical; Gastrointestinal; Musculoskeletal; Neurologic

610599 Retinitis pigmentosa 36 PRCD Ophthalmologic610651 Xeroderma pigmentosum, group ERCC3 Dermatologic;

32

Page 33:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

B

Endocrine; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic

610682 Osteogenesis imperfecta, type VII CRTAP Musculoskeletal; Ophthalmologic

610688 Joubert syndrome 6 TMEM67Gastrointestinal; Neurologic; Renal; Ophthalmologic

610725 Nephrotic syndrome, type 3 PLCE1 Renal

610832 Fanconi anemia, complementation group N PALB2

Cardiovascular; Dermatologic; Hematologic; Musculoskeletal; Oncologic; Renal

610915 Osteogenesis imperfecta, type VIII LEPRE1 Musculoskeletal

610951 Ceroid lipofuscinosis, neuronal, 7 MFSD8Biochemical; Neurologic; Ophthalmologic

610992 Phosphoserine aminotransferase deficiency PSAT1 Biochemical;

Neurologic611022 Deafness, autosomal recessive 24 RDX Otolaryngologic611038 Microphthalmia, isolated 3 RAX Ophthalmologic611040 Microphthalmia, isolated 5 MFRP Ophthalmologic

611067 Spinal muscular atrophy, distal, autosomal recessive, 4 PLEKHG5 Musculoskeletal;

Neurologic

611126 ACAD9 deficiency ACAD9

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic

611131 Retinitis pigmentosa 37 NR2E3 Ophthalmologic

611228 Charcot-Marie-Tooth disease, type 4J FIG4 Neurologic

611263 Short-rib thoracic dysplasia 2 with or without polydactyly IFT80 Musculoskeletal

611307 Muscular dystrophy, limb-girdle, type 2L ANO5 Immunology;

Musculoskeletal611451 Deafness, autosomal recessive 63 LRTOMT Otolaryngologic

611490 Osteopetrosis, autosomal recessive 4 CLCN7

Immunology; Otolaryngologic; Hematologic; Musculoskeletal; Ophthalmologic

611560 Joubert syndrome 7 RPGRIP1L Craniofacial; Musculoskeletal; Neurologic;

33

Page 34:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Ophthalmologic; Renal

611561 Meckel syndrome 5 RPGRIP1L

Gastrointestinal; Musculoskeletal; Neurologic; Ophthalmologic; Renal

611588Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 4

FKTN Musculoskeletal; Neurologic

611705 Myopathy, early-onset, with fatal cardiomyopathy TTN Cardiovascular;

Musculoskeletal

611719 Combined oxidative phosphorylation deficiency 5 MRPS22

Biochemical; Cardiovascular; Renal; Musculoskeletal; Neurologic

611721 Combined SAP deficiency PSAP Gastrointestinal; Neurologic

611809 Bestrophinopathy, autosomal recessive BEST1 Ophthalmologic

611881 Glycogen storage disease XII ALDOA

Biochemical; Hematologic; Musculoskeletal; Neurologic; Renal

612016 Coenzyme Q10 deficiency, primary, 4 ADCK3 Biochemical;

Neurologic612067 Dystonia 16 PRKRA Neurologic612095 Retinitis pigmentosa 41 PROM1 Ophthalmologic

612138 Epidermolysis bullosa simplex with pyloric atresia PLEC

Dermatologic; Gastrointestinal; Musculoskeletal

612233 Leukodystrophy, hypomyelinating, 4 HSPD1 Neurologic

612285 Joubert syndrome 9 CC2D2A Neurologic; Ophthalmologic

612291 Joubert syndrome 8 ARL13BNeurologic; Ophthalmologic; Renal

612416 Factor XI deficiency, autosomal recessive F11 Hematologic

612541 Neutropenia, severe congenital 4, autosomal recessive G6PC3

Immunology; Otolaryngologic; Cardiovascular; Craniofacial; Endocrine; Gastrointestinal; Genitourinary; Hematologic; Neurologic; Renal

34

Page 35:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

612572 Retinitis pigmentosa 46 IDH3B Ophthalmologic612645 Deafness, autosomal recessive 1B GJB6 Otolaryngologic

612703 Microcephaly 7, primary, autosomal recessive STIL Neurologic

612712 Leber congenital amaurosis 13 RDH12 Ophthalmologic

612736 Cerebral creatine deficiency syndrome 2 GAMT Biochemical;

Neurologic

612932 Glycogen storage disease XIII ENO3 Biochemical; Musculoskeletal

612933 Glycogen storage disease XI LDHA

Biochemical; Dermatologic; Musculoskeletal; Renal

613027 Glycogen storage disease IXc PHKG2

Biochemical; Gastrointestinal; Musculoskeletal; Neurologic

613038 Pituitary hormone deficiency, combined, 1 POU1F1 Cardiovascular;

Endocrine613079 Deafness, autosomal recessive 77 LOXHD1 Otolaryngologic613093 Cone dystrophy 4 PDE6C Ophthalmologic

613150

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2

POMT2Musculoskeletal; Neurologic; Ophthalmologic

613151Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 3

POMGNT1

Craniofacial; Musculoskeletal; Neurologic; Ophthalmologic

613154

Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6

LARGEMusculoskeletal; Neurologic; Ophthalmologic

613155Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 1

POMT1

Cardiovascular; Musculoskeletal; Neurologic; Ophthalmologic

613156Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 2

POMT2

Cardiovascular; Musculoskeletal; Neurologic; Ophthalmologic

613157Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3

POMGNT1Musculoskeletal; Neurologic; Ophthalmologic

613158Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 2

POMT2Cardiovascular; Musculoskeletal; Neurologic

613194 Retinitis pigmentosa-50 BEST1 Ophthalmologic613265 Waardenburg syndrome, type 4B EDN3 Otolaryngologic;

35

Page 36:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Dermatologic; Gastrointestinal; Ophthalmologic

613285 Deafness, autosomal recessive 25 GRXCR1 Otolaryngologic613307 Deafness, autosomal recessive 79 TPRN Otolaryngologic

613312 Hypophosphatemic rickets, autosomal recessive, 2 ENPP1 Musculoskeletal;

Renal613341 Leber congenital amaurosis 14 LRAT Ophthalmologic

613390 Fanconi anemia, complementation group O RAD51C

Cardiovascular; Gastrointestinal; Musculoskeletal; Renal

613490 Emphysema due to AAT deficiency SERPINA1 Gastrointestinal;

Pulmonary

613550 Nephronophthisis 11 TMEM67Gastrointestinal; Neurologic; Renal; Ophthalmologic

613575 Retinitis pigmentosa 55 ARL6 Ophthalmologic613581 Retinitis pigmentosa 56 IMPG2 Ophthalmologic613582 Retinitis pigmentosa 57 PDE6G Ophthalmologic613660 Cone-rod dystrophy 15 CDHR1 Ophthalmologic613731 Retinitis pigmentosa 4 RHO Ophthalmologic613756 Retinitis pigmentosa 49 CNGA1 Ophthalmologic613767 Retinitis pigmentosa 45 CNGB1 Ophthalmologic613769 Retinitis pigmentosa 44 RGR Ophthalmologic613779 C3 deficiency C3 Immunology; Renal613794 Retinitis pigmentosa 20 RPE65 Ophthalmologic613801 Retinitis pigmentosa-40 PDE6B Ophthalmologic613810 Retinitis pigmentosa 43 PDE6A Ophthalmologic

613812 Bile acid synthesis defect, congenital, 3 CYP7B1 Gastrointestinal

613823 Seckel syndrome 5 CEP152Craniofacial; Musculoskeletal; Neurologic

613829 Leber congenital amaurosis 7 CRX Ophthalmologic

613830Night blindness, congenital stationary (complete), 1D, autosomal recessive

SLC24A1 Ophthalmologic

613835 Leber congenital amaurosis 8 CRB1 Ophthalmologic613843 Leber congenital amaurosis 15 TULP1 Ophthalmologic613861 Retinitis pigmentosa 59 DHDDS Ophthalmologic613862 Retinitis pigmentosa 38 MERTK Ophthalmologic613865 Deafness, autosomal recessive 61 SLC26A5 Otolaryngologic613951 Fanconi anemia, complementation

group PSLX4 Otolaryngologic;

Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal;

36

Page 37:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Neurologic; Oncologic; Ophthalmologic; Renal

613985 Thalassemias, beta- HBBHematologic; Musculoskeletal; Neurologic

613987 Dyskeratosis congenita, autosomal recessive 2 NHP2

Immunology; Dermatologic; Endocrine; Gastrointestinal; Hematologic; Neurologic; Oncologic; Pulmonary

613989 Dyskeratosis congenita, autosomal recessive 4 TERT

Cardiovascular; Dental; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Pulmonary

614035 Deafness, autosomal recessive 29 CLDN14 Otolaryngologic

614082 Fanconi anemia, complementation group G FANCG

Otolaryngologic; Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic; Renal

614083 Fanconi anemia, complementation group L FANCL

Otolaryngologic; Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic; Ophthalmologic; Renal

614087 Fanconi anemia, complementation group M

FANCM Otolaryngologic; Immunology; Dermatologic; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Oncologic;

37

Page 38:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Ophthalmologic; Renal

614120 Hydrolethalus syndrome 2 KIF7Craniofacial; Musculoskeletal; Neurologic

614134 Stickler syndrome, type IV COL9A1

Otolaryngologic; Craniofacial; Musculoskeletal; Ophthalmologic

614175 Meckel syndrome 10 B9D2Gastrointestinal; Musculoskeletal; Neurologic; Renal

614180 Retinitis pigmentosa 61 CLRN1 Ophthalmologic614181 Retinitis pigmentosa 62 MAK Ophthalmologic614186 Leber congenital amaurosis 16 KCNJ13 Ophthalmologic

614284 Stickler syndrome, type V COL9A2 Otolaryngologic; Ophthalmologic

614307 Alpha-methylacyl-CoA racemase deficiency AMACR

Biochemical; Endocrine; Neurologic; Ophthalmologic

614565Night blindness, congenital stationary (complete), 1E, autosomal recessive

GPR179 Ophthalmologic

614651 Coenzyme Q10 deficiency, primary, 2 PDSS1

Otolaryngologic; Biochemical; Cardiovascular; Endocrine; Gastrointestinal; Hematologic; Musculoskeletal; Neurologic; Renal

614652 Coenzyme Q10 deficiency, primary, 3 PDSS2 Biochemical;

Neurologic; Renal

614750 Myasthenic syndrome, congenital, with tubular aggregates 2 DPAGT1

Hematologic; Musculoskeletal; Neurologic; Ophthalmologic

614852 Microcephaly 9, primary, autosomal recessive CEP152

Craniofacial; Musculoskeletal; Neurologic

614867 Peroxisome biogenesis disorder 5B PEX2

Biochemical; Craniofacial; Gastrointestinal; Genitourinary; Musculoskeletal; Neurologic; Renal

614872 Peroxisome biogenesis disorder 7A (Zellweger)

PEX26 Biochemical; Craniofacial; Gastrointestinal;

38

Page 39:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Genitourinary; Musculoskeletal; Neurologic; Renal

614895 Charcot-Marie-Tooth disease, type 4F PRX Neurologic

614921 Congenital disorder of glycosylation, type It PGM1

Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic; Renal

615158 Mitochondrial complex III deficiency, nuclear type 3 UQCRB Biochemical;

Gastrointestinal

615159 Mitochondrial complex III deficiency, nuclear type 4 UQCRQ Biochemical;

Neurologic

39

12

Page 40:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Table S2.Inter- and intra-run performance consistence of the targeted gene sequencing

run1-replicate1

run1- replicate2

run2-replicate1

run2-replicate2

Target size 1805816 1805816 1805816 1805816Mean sequencing depth

434,558 344,946 251,002 259,119

Coverage of targeted region>1 X 99,29% 99,27% 99,66% 99,67%> 20X 98,23% 98,09% 98,29% 98,68%

Detected Variants 1020 1019 1023 1022

indel 35 31 34 33SNV 985 988 989 989Genotypes consistence with genotypingYH_genotypingRef allele (negative allele) 3577 3577 3577 3577

non-ref allele (positive allele) 867 867 867 867

NGS-panel sequencingTrue positive 865 865 864 865True negative 3577 3577 3575 3577False positive 0 0 0 0False negative 2 2 3 2nocall-ref 0 0 2 0sensitivity 99,77% 99,77% 99,65% 99,77%Specificity 100,00% 100,00% 100,00% 100,00%Accuracy 99,96% 99,96% 99,93% 99,96%

40

12

Page 41:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Table S3.Consistency of sequencing coverage and variants detection between replicates

run1-replicate 1

run1-replicate 2

run2-replicate 1

run2-replicate 2

sequence coveragerun1-replicate

1 - 99,999%a 99,999% a 99,999% a

run1-replicate 2 99,742% b - 99,999% a 99,999% a

run2-replicate 1 98,797% b 98,705% b - 99,999% a

run2-replicate 2 99% b 99% b 99% b -

Variant detectionrun1-replicate

1 - 99,51% 98,26% 98,36%

run1-replicate 2 - 98,64% 98,74%

run2-replicate 1 - 99,51%

run2-replicate 2 -

Note: a >1x, b >20x

41

12

Page 42:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Table S4.

Target mutation: 3283 potential pathogenic mutations

Gene Mutation No. Detail Transcript Methods

ABCA4 36

2616_2617delCT,2888delG,IVS40+5G>A,A1762D,G1961E,3540_3555delGTCTAAGGGTTTCTCC,IVS38-10T>C,1225delA,R1898H,L1971R,R2107H,R2030*,A1038V,R1108C,Y340D,P1780A,L1970F,L2027F,G863A,R212C,3210_3211dupGT,L1940P,R18W,A1028V,E1036K,P1380L,R572Q,E1122K,IVS5-2A>G,W855*,R1129L,V2050L,V931M,IVS13-1G>A,1848delA,IVS30+1G>T

NM_000350.2 NGS

ABCB7 3 I401M,V412L,E434K NM_004299.3 NGSACAD9 4 R532W,F44I,R417C,R266Q NM_014049.4 NGSACADM 2 Y67H,K329E NM_000016.4 NGSACADS 1 R107C NM_000017.2 NGSACADSB 3 E387K,L255F,T148I NM_001609.3 NGSACADVL 3 T260M,V283A,G441D NM_000018.3 NGS

ACAT1 11

Q145E,Q272*,A380T,I312T,1083dupA,A333P,2T>A,G379V,1035_1037delAGA,N93S,G183R

NM_000019.3 NGS

ACE 4 R496*,1319_1322delTGGA,R791*,Y266* NM_000789.3 NGS

ACOX1 4 R148*,G178C,M278V,Q309R NM_004035.6 NGS

ACTN4 3 K255E,T259I,S262P NM_004924.4 NGSADA 4 A329V,R211H,R76W,L107P NM_000022.2 NGSADAMTS2 2 Q225*,W795* NM_014244.4 NGS

ADCK3 9

1750_1752delACC,G272V,1813_1814insG,993C>T,R213W,E551K,G549S,Y514C,G272D

NM_020247.4 NGS

AGA 5 A101V,C163S,S72P,G302R,800dupT NM_000027.3 NGS

AGL 13

W680*,R1228*,W1327*,Q6*,Y1510*,IVS31-12A>G,1999delC,18_19delGA,R408*,R864*,4456delT,3965delT,G1448R

NM_000642.2 NGS

AGPS 2 T309I,T568M NM_003659.3 NGS

42

Page 43:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

AGT 2 Q202*,1290delT NM_000029.3 NGSAGTR1 1 215dupT NM_031850.3 NGS

AGXT 12

I244T,G170R,S187F,R233C,G82E,F152I,G156R,S205P,W108R,33_34insC,G41R,W246*

NM_000030.2 NGS

AHI1 10R351L,R329*,V443D,R435*,R351*,R589*,R723Q,K791*,R495H,3263_3264delGG

NM_017651.4 NGS

AIPL1 5 H82Y,C239R,R302L,W278*,A197P NM_014336.3 NGS

ALAS2 4 D190V,T388S,R452C,I476N NM_000032.4 NGSALDH4A1 1 S352L NM_003748.3 NGSALDH5A1 3 R412*,W204*,G409D NM_001080.3 NGSALDOA 2 E207K,D129G NM_000034.3 NGS

ALDOB 7A150P,360_363delCAAA,C240*,R60*,R4*,N335K,A175D

NM_000035.3 NGS

ALG1 3 S150R,G145D,M377V NM_019109.4 NGS

ALG6 3 A333V,897_899delAAT,S478P NM_013339.3 NGS

ALMS1 6Q3817*,Q2795*,Q3495*,10775delC,11316_11319delAGAG,R2722*

NM_015120.4 NGS

ALPL 20

F327L,G249V,R71C,D294A,A179T,G456R,Q207P,E191K,1559delT,D378V,A33V,R272C,A116T,E298K,Y436H,N417S,G334D,A176T,R136H,R71P

NM_000478.4 NGS

AMACR 2 S52P,L107P NM_014324.5 NGSAMT 3 R320H,G47R,H42R NM_000481.3 NGS

ANO5 6191_192insA,2311_2312delCA,IVS14+5G>A,A432G,G231V,R758C

NM_213599.2 NGS

APTX 7H201R,320delC,IVS8-1G>A,V263G,167delT,W279*,P206L

NM_175073.2 NGS

AR 10

K884*,L174*,Q114*,K591*,IVS2-11T>A,Q799E,E2K,W797*,R856H,W719*

NM_000044.3 NGS

ARG1 7 I11T,W122*,R21*,R291*,T290S,G235R,G138V NM_000045.3 NGS

ARL13B 3 W82*,R79Q,R200C NM_182896.2 NGSARSA 12 T411I,IVS7+1G>A,S98F,P42

8L,R86Q,A214V,IVS2+1G>A,1401_1411delGTTAGACGCAG,D257H,G247R,I181S,

NM_000487.5 NGS

43

Page 44:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

G101D

ARSB 6 Y210C,C117R,G137V,L236P,H393P,C405Y NM_000046.3 NGS

ARSE 6 W581*,G137A,G137V,P578S,I40S,T481M NM_000047.2 NGS

ARX 2 P353L,Y27* NM_139058.2 NGS

ASL 8 Q286R,V178M,Q116*,R385C,R12Q,R379C,Q354*,R95C NM_000048.3 NGS

ASPA 7C218*,IVS2-2A>G,E285A,R71H,Y231*,Y288C,A305E

NM_000049.2 NGS

ASPM 64

9685delA,R1599*,9677dupG,6337_6338delAT,8844delC,7491_7495delTATTA,R797*,S1176*,4858_4859delAT,3477_3481delCGCTA,R3233*,L1063*,Y2063*,R3244*,E456*,Y1712*,1406_1413delATCCTAAA,Q2632*,Y2587*,E1266*,Q3060*,K3199*,8131_8132delAA,1729_1730delAG,I1717*,V335*,K3080*,Q193*,1959_1962delCAAA,Q3180P,R1271*,719_720delCT,R3064*,440delA,1154_1155delAG,7782_7783delGA,S3186*,Y3353*,Q2890*,1260_1266delTCAAGTC,R1019*,1179delT,G1028R,9159delA,Y3263*,Q664*,R980*,Y3164*,W989*,R3107*,9754delA,8378delT,S1237*,8508_8509delGA,9747_9748delCT,4195dupA,3663delG,9115_9118dupCATT,6732delA,V531*,7860_7861delGA,W1326*,R117*,4583delA

NM_018136.4 NGS

ASS1 14

G14S,R86H,R279*,IVS13+5G>A,R265H,R157H,R363W,G362V,IVS6-2A>G,G390R,G324S,R304W,S180N,W179R

NM_000050.4 NGS

ATIC 1 K426R NM_004044.6 NGS

ATP7A 7 N1304S,R201*,S637L,R980*,P1386S,T994I,G1019D NM_000052.5 NGS

ATP7B 19 H1069Q,G869R,L936*,L1120*,P992L,T766R,N1270S,A874V,T935M,W779*,M645R,3402delC,L708P,R969Q,IVS8-

NM_000053.3 NGS

44

Page 45:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

2A>G,G691R,G1266R,R778L,R919G

ATR 1 D1879Y NM_001184.3 NGS

AUH 5 R197*,G187S,K331*,IVS8-1G>A,G217D NM_001698.2 NGS

B4GALT1 1 1031dupC NM_001497.3 NGSB9D2 1 S101R NM_030578.3 NGSBCKDHA 3 117delC,G290R,Y438N NM_000709.3 NGS

BCKDHB 6G278S,R183P,V119G,IVS9-7_1039delTCTG,H206Y,E372*

NM_183050.2 NGS

BCS1L 12G35R,R184C,R183H,S78G,R56*,S277N,R183C,P99L,R45C,V353M,T50A,R155P

NM_004328.4 NGS

BEST1 5 R141H,L41P,R200*,V317M,L140V NM_004183.3 NGS

BRCA2 8

E1550*,S1946*,658_659delGT,IVS19-1G>A,IVS7+1G>A,IVS7+2T>G,9900dupA,7691_7692insAT

NM_000059.3 NGS

BRIP1 2 A349P,R798* NM_032043.2 NGS

BSCL2 5 R138*,R275*,IVS6-3C>G,IVS6+5G>A,A212P NM_032667.6 NGS

BSND 8 R8L,G47R,1A>T,R8W,G10S,3G>A,I12T,E4* NM_057176.2 NGS

BTD 8R79C,G34S,A171T,R538C,98_104delGCGGCTGinsTCC,Q456H,T532M,D252G

NM_000060.2 NGS

BTK 30

R520Q,G613D,A607D,Y361C,Y425*,R562P,R28H,L408P,R562W,E636*,Q15*,E589G,R288W,R255*,C502*,W581R,E240*,Y591*,R13*,W252*,R525Q,R520*,K430E,Y334S,V113D,T33P,R307G,2T>C,L542P,Y375*

NM_000061.2 NGS

C10orf2 5 K319E,T457I,1287C>T,A318T,Y508C NM_021830.4 NGS

C3 5IVS9-2A>T,IVS18+1G>A,3116dupT,W552*,IVS10+1G>T

NM_000064.2 NGS

CA2 3 Y40*,H107Y,IVS2+1G>A NM_000067.2 NGS

CAPN3 9

550delA,1795_1796insA,R110*,2362_2363delAGinsTCATCT,R769Q,R572Q,S86F,R490Q,P319L

NM_000070.2 NGS

CBS 13 D444N,A114V,E144K,P145L,V168M,T191M,T353M,G3

NM_000071.2 NGS

45

Page 46:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

07S,P422L,R369C,R266K,S466L,K384E

CC2D2A 6 R1528C,D1556V,P1122S,3289delG,R950*,R1049*

NM_001080522.2 NGS

CD2AP 2 IVS6-1delGinsCT,R612* NM_012120.2 NGS

CD40LG 9T254M,G227V,M36R,W140G,L155P,T211N,A123E,W140*,A235P

NM_000074.2 NGS

CDH23 14

D1341N,P240L,R301Q,D2148N,F1888S,IVS46-9G>A,Q1496H,IVS51+5G>A,R1502*,R1746Q,193delC,R2608H,IVS4+1G>A,R3189W

NM_022124.5 NGS

CDH3 4 N322I,R503H,830delG,981delG NM_001793.4 NGS

CDHR1 3 338delG,1463delG,524dupA NM_033100.2 NGSCDK5RAP2 6 R1481*,R1558*,Y82*,524_5

28delAGGCA,E234*,E1516* NM_018249.4 NGS

CENPJ 3 3243_3246delTCAG,18delC,E1235V NM_018451.4 NGS

CEP152 2 Q265P,Y678* NM_014985.3 NGS

CEP290 8W7C,G1890*,4656delA,L750*,K1575*,3185delT,R205*,384_387delTAGA

NM_025114.3 NGS

CERKL 4 K200*,R257*,780delT,420delT NM_201548.4 NGS

CFTR 152 1397C>A,IVS5+1G>T,S1251N,S466*,Q1313*,1911delG,IVS9+1G>A,I336K,S945L,Q890*,IVS3+1G>A,3276C>A,3744delA,E822*,948delT,R75*,F1052V,D110H,IVS12-1G>A,IVS13+1G>A,1A>G,W1282*,2052delA,Y122*,2988G>A,IVS16+5G>A,P67L,G622D,1156_1157insTA,2453delT,E1104*,2583delT,531delT,E60*,D1152H,1327_1330dupGATA,IVS13+3A>G,R851*,IVS2+12T>C,M1101K,Y1092*,L927P,IVS23+1G>A,Y515*,L1077P,3536_3539delCCAA,IVS3+3A>C,IVS11-8G>A,325_327delTATinsG,2538G>A,4077_4080delTGTTinsAA,IVS4+1G>T,R1066H,S1196*,IVS19-26A>G,IVS22+4A>G,IVS10-

NM_000492.3 NGS

46

Page 47:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

1G>A,4251delA,E92K,S489*,Q359K,P205S,C524*,R117C,262_263delTT,1130_1131insA,Q39*,P750L,R352Q,3659delC,S1255*,Q98*,A559T,G85E,W846*,W401*,R117H,T360K,1022_1023insTC,K710*,2052_2053insA,1203G>A,IVS13+1G>T,3889_3890insT,W1204*,Q220*,R560K,E831*,S549R,IVS18+1G>A,1081delT,Q1238*,R1162*,G542*,1923_1931delCTCAAAACTinsA,H199Y,442delA,IVS5+3A>G,R709*,Q552*,R1066C,2051_2052delAAinsG,IVS14+1G>A,L206W,N1303K,T338I,3611G>A,W1089*,R560T,L732*,IVS11-1G>A,IVS5-1G>T,Q493*,R258G,805_806delAT,IVS13+5G>T,S492F,1645A>C,V520F,2215delG,E217G,A455E,2875delG,IVS3-1G>A,IVS8+1G>A,S549N,G330*,IVS18-1G>A,G480C,R764*,2175_2176insA,R347H,P574H,E92*,1519_1521delATC,R553*,R347P,L671*,722_743delGGAGAATGATGATGAAGTACAG,803delA,G551D,2039delC,3528delC,G1244E,L1065P,1521_1523delCTT,3773_3774insT,2869_2870insG,IVS5+5G>A,R1158*,R334W,E585*

CHST6 2 L200R,D203E NM_021615.4 NGS

CLCN1 5 F167L,F413C,M485V,E291K,R894* NM_000083.2 NGS

CLCN7 3 R762Q,Q555*,L766P NM_001287.5 NGSCLDN14 3 G101R,398delT,V85D NM_144492.2 NGSCLDN19 3 Q57E,G20D,L90P NM_148960.2 NGS

CLN3 2 Y199*,E295K NM_001042432.1 NGS

CLN5 2 Y392*,E352* NM_006493.2 NGS

CLN6 6 L47F,L67P,R103Q,Y221*,316_317insC,E72* NM_017882.2 NGS

CLN8 5 R204L,A30P,R24G,W263C,8 NM_018941.3 NGS

47

Page 48:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

8delG

CLRN1 9459_461delATT,C40G,Y63*,N48K,Y176*,L150P,M120K,P31L,L154W

NM_174878.2 NGS

CNGA1 3 K143*,S320F,1972delA NM_000087.3 NGSCNGB1 2 G993V,IVS32+1G>A NM_001297.4 NGSCNGB3 2 R403Q,1148delC NM_019098.4 NGSCOL11A1 2 G784R,1750dupG NM_001854.3 NGS

COL17A1 15

R1226*,R145*,G633D,IVS31-2A>G,4003_4004delGG,1706delC,2944_2947+1delGAAGG,R795*,520_521delAG,L855*,2965delA,R1303Q,4150_4151insG,Q1023*,IVS31-1G>T

NM_000494.3 NGS

COL18A1 2 3618_3619delGG,3517_3518delCC NM_030582.3 NGS

COL1A2 5 IVS24+1G>A,IVS24+1G>C,E1201*,R99*,IVS11+5G>A NM_000089.3 NGS

COL4A3 3 R1481*,S1524*,4420_4424delCTTTT NM_000091.4 NGS

COL4A4 5 R1377*,S1238*,G1201S,C1641*,P1572L NM_000092.4 NGS

COL7A1 28

Q2827*,G1347R,5819delC,G2749R,IVS70-1G>A,R2471*,IVS35+1G>T,3861delG,2471_2472insG,R2069C,K142R,IVS3-2A>G,IVS64+1G>A,R2063W,7787delG,G2031S,Y311*,R1630*,IVS95-1G>A,6527_6528insC,G1595R,6266_6269delCCCC,G2287R,R1763*,R236*,G1815R,R2814*,M2798K

NM_000094.3 NGS

COL9A1 1 R295* NM_001851.4 NGSCOQ2 3 Y297C,N228S,R197H NM_015697.7 NGS

CPS1 5 Q44*,T544M,G982D,R787*,H337R NM_001875.4 NGS

CPT1A 6 G709E,D454G,Y498C,E360G,Q100*,A414V NM_001876.3 NGS

CPT2 13

P227L,S113L,D553N,R631C,E174K,D213G,R151Q,Q413*,Y120C,Y628S,R124*,R503C,F383Y

NM_000098.2 NGS

CRB1 10C948Y,I1100R,E1333*,C896*,R764C,E995*,I1100T,C1181R,K801*,M1041T

NM_201253.2 NGS

CRLF1 12 Q180*,R277*,303delC,P138 NM_004750.4 NGS

48

Page 49:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

L,IVS3+5G>A,W284C,708_709delCCinsT,R312H,845_846delTG,713_714insC,W76G,676dupA

CRTAP 2 Y187*,Q276* NM_006371.4 NGSCRX 2 529delG,R90W NM_000554.4 NGSCSTB 2 Q71P,R68* NM_000100.3 NGS

CTNS 11

N323K,397_398delAT,IVS10-3C>G,V42I,357_360delCAGC,W138*,G110V,G339R,S139F,L158P,G95*,

NM_004937.2 NGS

CTSD 2 F229I,W383C NM_001909.4 NGS

CTSK 5 R241*,G79E,K52*,990A>G,L309P NM_000396.3 NGS

CYP21A2 10

[I237N;V238E;M240K], V282L, 292+5G>T, Q319X, R356W, P454S, P31L, 293-13A/C>G(655A/C>G), L308ffsX6, I172N

NM_000500.5

PCR+Sanger sequencing

CYP4V2 2 IVS8-2A>G,IVS2+1G>A NM_207352.3 NGSCYP7B1 3 Y275*,R63*,R388* NM_004820.3 NGSD2HGDH 3 N439D,I147S,IVS4-2A>G NM_152783.3 NGS

DBT 5 I98M,1448G>T,S194*,H452R,F276C NM_001918.3 NGS

DCLRE1C 6Y199*,IVS11+1G>C,IVS5+1G>T,IVS10+1G>A,IVS9+1delG,2T>C

NM_001033855.1 NGS

DDB2 4 D307Y,R313*,K244E,R273H NM_000107.2 NGSDDC 2 S250F,G102S NM_000790.3 NGSDFNB31 1 Q273* NM_015404.3 NGS

DFNB59 7 726delT,T54I,R183W,R167*,122delA,113dupT,988delG

NM_001042702.3 NGS

DGUOK 4 E227K,R142K,D255Y,R105* NM_080916.2 NGS

DHCR7 20

H119L,R242C,V326L,G303R,R404C,T93M,IVS8-1G>C,W248C,W151*,R352W,R446Q,R352Q,F302L,R242H,S169L,G244R,IVS7-1G>C,G410S,E448K,1A>G

NM_001360.2 NGS

DHDDS 1 K42E NM_024887.3 NGS

DKC1 7 F36V,K39E,Q31E,T49M,I38T,L72Y,T66A NM_001363.3 NGS

DLD 3 105_106insA,G229C,R495G NM_000108.3 NGSDLL3 2 G504D,R238* NM_016941.3 NGS

DMD 5 R2905*,R3391*,R3190*,S3127*,Q45* NM_004006.2 NGS

DMP1 3 IVS2-1G>C,362delC,1A>G NM_004407.3 NGSDNAJC19 1 IVS3-1G>C NM_145261.3 NGS

49

Page 50:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

DPAGT1 4 V117I,L120M,V264G,Y170C NM_001382.3 NGS

DPM1 2 R92G,628delC NM_003859.1 NGSDPYD 1 IVS14+1G>A NM_000110.3 NGSDSP 2 6370_6371delCT,R1934* NM_004415.2 NGS

DYSF 12

Q605*,R1905*,G299W,W999C,R1046H,R2042C,G519R,P791R,G299R,V67D,D625Y,E1734G

NM_003494.3 NGS

EDA 9Y61*,R156C,A349T,R156H,725delG,R276C,573_574insT,R69L,R155C

NM_001399.4 NGS

EDN3 1 262_263delGCinsT NM_207034.1 NGSEDNRB 3 R201*,A183G,W276C NM_000115.3 NGSEGR2 1 I268N NM_000399.3 NGSEIF2AK3 2 R588Q,E332* NM_004836.5 NGSEMD 2 631_635delCGTGC,P183T NM_000117.2 NGSENO3 2 G156D,G374E NM_053013.3 NGS

ENPP1 8Y371F,P305T,Y261*,D538H,E893*,G342V,Y901S,G266V

NM_006208.2 NGS

ERCC2 4 S541R,R683W,L485P,Q726* NM_000400.3 NGSERCC3 3 R425*,F99S,Q545* NM_000122.1 NGS

ERCC4 4 Y577*,2281_2284delTTTG,C236R,R589W NM_005236.2 NGS

ERCC5 13

A874T,1494delA,Q176*,P72H,E960*,L858P,2972delT,2170delT,2751delA,Q136*,A792V,R263*,1115_1118delGGAA

NM_000123.3 NGS

ERCC6 6 W517*,R735*,R453*,3592_3593insGA,R683*,R1288* NM_000124.2 NGS

ERCC8 3 Y322*,A160V,E13* NM_000082.3 NGS

ESCO2 14

1111_1112insG,1597dupT,308_309delAA,751dupG,745_746delGT,876_879delCAGA,764_765delTT,879_880delAG,W539G,R169*,Q202*,760_761insA,W423*,760delA

NM_001017420.2 NGS

ESRRB 2 1018_1024dupGAGTTTG,V342L NM_004452.3 NGS

ETFA 3 V157G,T266M,G116R NM_000126.3 NGSETFB 2 R164Q,D128N NM_001985.2 NGS

ETFDH 7 P483L,R175H,L377P,A84T,R175L,L127H,2T>C NM_004453.2 NGS

ETHE1 5604dupG,L185R,440_450delACAGCATGGCC,R163W,Y74*

NM_014297.3 NGS

EYS 3 IVS28- NM_001142800 NGS

50

Page 51:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

2A>G,6714delT,E1953* .1

F11 6 C56R,IVS14+1G>A,F301L,C146*,K270I,E135* NM_000128.3 NGS

F5 5 I387T,Y1730C,Q801*,R2102C,E147*,R534Q NM_000130.4 NGS

F8 27

Intron1 inversion,Intron22 inversion, R2169H, V181M, Y450N, R1708H, M1842I, W2248C, D2093G, R2326*, G1769R, R2178C, S596P, L431F, R2016W,E409G,R2323C,R391H,S2138Y,E739K,N1941S,Y492C,A1853V,R2228*,R550C,Y1699F,F2120L

NM_000132.3

NGS;Long-PCR+Electrophoresis

F9 8I344T,R298*,R379Q,R294Q,R43W,C28R,R384*,IVS3+2T>C

NM_000133.3 NGS

FAH 13

G343W,W262*,E364*,Q279R,R381G,IVS6-1G>T,P261L,E357*,A35T,D233V,IVS12+5G>A,N16I,G337S

NM_000137.2 NGS

FAM126A 1 L53P NM_032581.3 NGS

FAM20C 6 D451N,L388R,G365R,R549W,G280R,I258N NM_020223.3 NGS

FANCA 51115_1118delTTGG,233_236delTTGA,S1377*,3788_3790delTCT,S858R

NM_000135.2 NGS

FANCC 6 L496R,R548*,R185*,Q13*,67delG,IVS5+4A>T NM_000136.2 NGS

FANCE 3 IVS5-8G>A,Q119*,R141* NM_021922.2 NGS

FANCG 8

IVS7-2A>G,637_643delTACCGCC,IVS11+1G>C,IVS3+1G>C,Q356*,1183_1192delGAGGTGTTTT,1795_1804delTGGATCCGTC,E105*

NM_004629.1 NGS

FANCI 2 R1285Q,R1285* NM_001113378.1 NGS

FANCL 2 1096_1099dupATTA,1007_1009delTAT NM_018062.3 NGS

FANCM 1 S724* NM_020937.2 NGS

FGA 3 1359dupC,Q347*,IVS4+1G>T NM_021871.2 NGS

FGB 3 P265L,L383R,G430D NM_005141.4 NGS

FGD4 7R275*,1628_1629delAG,M298R,R224*,G586*,R442H,M298T

NM_139241.2 NGS

FH 2 Q376P,P174R NM_000143.3 NGS

51

Page 52:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

FHL1 4 IVS679G>A,C209R,C224W,C104R NM_001449.4 NGS

FIG4 5I41T,R183*,831_838delTAAATTTG,1260_1261delGT,G104D

NM_014845.5 NGS

FKTN 5 A114T,F176S,R307Q,A170E,Y371C

NM_001079802.1 NGS

FLNA 2 S1186L,D1159A NM_001456.3 NGS

FLVCR1 4 G493R,N121D,A241T,C192R NM_014053.3 NGS

FOXN1 1 R255* NM_003593.2 NGS

FRAS1 76991_6992insGG,S1424*,5605_5606insT,Q3005*,IVS53+1G>T,Q1267*,Q2868*

NM_025074.6 NGS

FREM2 2 IVS14+1G>A,E1972K NM_207361.4 NGS

FUCA1 6 L410R,Q82*,W387*,Y216*,E380*,Q427* NM_000147.4 NGS

FXN 5 L106*,W173G,I154F,G130V,IVS3-2A>G NM_000144.4 NGS

G6PC 12

380_381insTA,Q347*,R83C,A124T,W77R,G184E,R83H,R295C,E110K,G188R,V166G,D38V

NM_000151.3 NGS

G6PC3 7 G260R,R253H,Y47*,M116V,935_936insT,G262R,L185P NM_138387.3 NGS

GAA 18

R854*,R725W,A237V,D645E,M439K,W746C,IVS1-32-13T>G,P545L,H372L,S529V,G293R,525delT,G643R,M318T,G219R,E521K,L355P,IVS10-3C>G

NM_000152.3 NGS

GALC 5 E385*,T529M,D544N,G286D,I599S NM_000153.3 NGS

GALT 18

F171S,Q188R,IVS2-2A>G,S135L,L74P,R333G,K285N,1138T>C,F194L,Q169K,R333W,Y209C,H319Q,P183T,M142K,E203K,V44M,L195P

NM_000155.3 NGS

GAMT 1 C169Y NM_000156.5 NGS

GAN 7 E169K,E486K,R201*,R477*,R138H,Q483*,I423T NM_022041.3 NGS

GBA 27

N409S,84dupG,R170L,D448V,P161S,H350R,T362I,G416S,N227S,Y251H,R398*,R392G,F255Y,P440L,R434P,V54L,K118N,D448H,IVS3+1G>A,L483P,P454R,L410V,G85E,R159Q,W351C,R502C,V433L

NM_001005741.2 NGS

52

Page 53:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

GBE1 10R524Q,Y329S,R515C,H628R,W548*,L224P,F257L,R524*,E592*,Y329C

NM_000158.3 NGS

GCDH 7 R227P,V400M,R402W,E365K,A421V,Y295H,A293T NM_000159.2 NGS

GDAP1 5 S194*,R282C,L239F,Q163*,W31* NM_018972.2 NGS

GFM1 3 M496R,R250W,R47* NM_024996.5 NGS

GJB2 18

E47*,N206S,299_300delAT,310_323delAGGAAGTTCATCAA,W24*,270dupA,W77R,IVS1-22-2A>C,51_62delCACCAGCATTGGinsA,167delT,35delG,235delC,176_191delGCTGCAAGAACGTGTG,L90P,R143W,R184P,W77*,V37I

NM_004004.5 NGS

GLB1 20

R457*,R457Q,T82M,R59H,Y591N,Y591C,R49C,R201C,R351*,Y316C,I51T,R208C,R482H,R68W,W509C,W273L,G438E,R482C,Q408P,T500A

NM_000404.2 NGS

GLDC 6 S564I,R739H,A802V,A569T,R515S,A389V NM_000170.2 NGS

GLE1 2 V617M,I684T NM_001003722.1 NGS

GM2A 4 262_264delAAG,410delA,E54*,C138R NM_000405.4 NGS

GNE 6 G576E,V572L,M712T,R246Q,C303*,V696M NM_005476.5 NGS

GNPTAB 6 S1058*,W894*,S399F,Q104*,3503_3504delTC,R1189* NM_024312.4 NGS

GNS 4 1169delA,R355*,1226dupG,Q390* NM_002076.3 NGS

GPR143 6397T>C,T232K,992_993insCG,W133R,S152N,816_829delGCAAACAGATATCA

NM_000273.2 NGS

GPR179 6 984delC,278delC,187delC,R200*,IVS8+1G>A,H603Y

NM_001004334.2 NGS

GPR98 8

17668_17669delAT,8713_8716dupAACA,Y6044C,2258_2270delAAGTGCTGAAATC,8790delC,17137delG,5357_5358delAA,Q2301*

NM_032119.3 NGS

GRHPR 3 103delG,R99*,403_404+2delAAGT NM_012203.1 NGS

GRM6 7Q708*,E781K,I405T,727_728insG,C522Y,R621*,719_720insG

NM_000843.3 NGS

GRXCR1 4 IVS2- NM_001080476 NGS

53

Page 54:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

9C>A,R138C,IVS2+19A>T,Q77* .2

GSS 6 R283C,4delG,D219A,D219G,R267W,R164Q NM_000178.2 NGS

GUCY2D 3 622delC,2945delG,F565S NM_000180.3 NGS

GUSB 15

W446*,Y495C,P148S,R216W,R611W,A619V,W507*,R357*,W627C,K350N,R577L,L176F,A354V,R382C,IVS7+1G>A

NM_000181.3 NGS

HADHA 5 E510Q,Q378*,R560*,2132_2133insC,1793_1794delAT NM_000182.4 NGS

HADHB 2 V455G,R444K NM_000183.2 NGS

HBB 22

27dupG,IVS1-21G>A,135delC,E27K,K18*,A28S,IVS1+5G>C,V127E,IVS2-197C>T,126_129delCTTT,N20S,E7V,112delT,IVS1+5G>A,-50-u28A>G,IVS2+1G>A,85_86insC,217dupA,Q40*,E122K,E7K,E122Q

NM_000518.4 NGS

HESX1 5 IVS2+2T>C,Q6H,R160C,450_451delCA,I26T NM_003865.2 NGS

HEXA 32

IVS9+1G>A,W485R,L39R,IVS6+1G>A,R504H,D258H,W26*,IVS12+1G>C,R499H,1A>G,R137*,E482K,W329*,G250D,R170Q,Y180*,R393*,R170W,1274_1277dupTATC,R504C,R178C,R499C,W392*,G269S,W420C,915_917delCTT,1510delC,IVS7+1G>A,R178L,R178H,R249W,R247W

NM_000520.4 NGS

HEXB 4 Y456S,965delT,P417L,R284* NM_000521.3 NGS

HFE 4 C282Y,S65C,Q283P,H63D NM_000410.3 NGS

HGD 12

G270R,1111_1112insC,IVS5+1G>A,R58*,V300G,457_458insG,G161R,P230S,M368V,IVS1-1G>A,C120W,175delA

NM_000187.3 NGS

HGF 1 495G>A NM_000601.4 NGS

HGSNAT 81345dupG,P283L,525dupT,S518F,R344C,L321*,IVS3-2A>G,IVS4+1G>A

NM_152419.2 NGS

HIBCH 3 Y122C,IVS3-9T>G,IVS2-3C>G NM_014362.3 NGS

HMGCL 2 E279K,R41Q NM_000191.2 NGS

54

Page 55:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

HPD 3 Y200*,I335M,Y258* NM_002150.2 NGS

HPRT1 8L65F,D201G,D80V,S110L,R170*,212_213insG,M57T,R48H

NM_000194.2 NGS

HPS1 6

972delC,1472_1487dupCCAGCAGGGGAGGCCC,IVS5+5G>A,972_973insC,E133*,E666*

NM_000195.3 NGS

HSD17B4 5 423_424delGA,G16S,Y217C,N457Y,R106P NM_000414.3 NGS

HSPG2 2 C1532Y,IVS64+4A>G NM_005529.5 NGSHTRA1 4 R370*,R302*,V297M,A252T NM_002775.4 NGSHYLS1 1 D211G NM_145014.2 NGSIDH3B 2 589delA,L132P NM_006899.3 NGS

IDS 10W475*,R468W,M488I,R443*,R468L,R468Q,S333L,R172*,C422G,G489A

NM_000202.5 NGS

IFT80 3 H105Q,1646_1648delTAT,A701P NM_020800.2 NGS

IGF1 1 V92M NM_000618.3 NGS

IGHMBP2 7 H213R,R788*,L236*,675delT,V580I,Q41*,IVS13+1G>T NM_002180.2 NGS

IKBKAP 3 R696P,IVS20+6T>C,P914L NM_003640.3 NGS

IL2RG 10I153N,S308*,C62*,K119*,IVS3+1G>A,C115R,R222C,L151P,R285Q,R289*

NM_000206.2 NGS

IMPDH1 1 D311N NM_000883.3 NGSIMPG2 3 R906*,S212*,R964* NM_016247.3 NGS

INPP5E 5 R563H,R378C,R435Q,R515W,Q627* NM_019892.4 NGS

INSR 6 R372*,L233P,G58R,K460E,W1227S,R1027* NM_000208.2 NGS

IQCB1 4 Q357*,E346*,R489*,R461* NM_001023570.2 NGS

ISCU 1 G50E NM_213595.2 NGSITGA6 1 S264* NM_000210.2 NGS

ITGB4 14

C38R,C562R,R1281W,W1478*,L156P,4410delG,IVS31-19T>A,3801_3802insT,R1225H,1150delG,IVS30+1G>A,R554*,C61Y,G931D

NM_001005731.1 NGS

IVD 5 A314V,1188delT,R53C,G202V,L45P NM_002225.3 NGS

JAK3 4 C565*,R445*,Y100C,1172_1173insG NM_000215.3 NGS

KCNJ1 8 Y79*,S219R,A198T,W27*,A214V,N124K,D108H,G167E NM_000220.3 NGS

KCNJ13 2 R166*,L241P NM_002242.4 NGSKCNV2 10 F164S,8_11delAACA,Q109* NM_133497.3 NGS

55

Page 56:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

,S256W,G459D,E143*,Q76*,357_358insC,1016_1024delACCTGGTGG,E306*

KIF7 4 2896_2897delGC,687delG,Q1001*,R154* NM_198525.2 NGS

L1CAM 14

924C>T,D598N,C264Y,G452R,P240L,S1194L,I179S,V752M,G370R,R184Q,IVS15+5G>A,IVS25-1G>C,3489_3490delTG,IVS18-19A>C

NM_000425.3 NGS

LAMA2 10

8314delA,825delC,R2383*,2049_2050delAG,Q1240*,R3085*,R2578*,C967*,R1549*,2098_2099delTT

NM_000426.3 NGS

LAMA3 4 R706*,R661*,335delG,Q1379* NM_000227.3 NGS

LAMB3 10

R42*,904delT,1587_1588delAG,R635*,1438_1442delCCGTG,Q243*,Q166*,W610*,E210K,Q936*

NM_000228.2 NGS

LAMC2 8

3512_3513insA,2137_2143delCAGAACC,IVS8-1G>A,Y355*,C553*,IVS3-1G>A,R245*,R95*

NM_005562.2 NGS

LARGE 3 E509K,S331F,W495R NM_004737.4 NGS

LBR 3 R583Q,1402delT,32_35delTGGT NM_002296.3 NGS

LDHA 2 640_641delCT,IVS2+1G>A NM_005566.3 NGS

LEPRE1 6IVS5+1G>T,R368*,1365_1366delAGinsC,747delC,IVS9+1G>T,Y552*

NM_022356.3 NGS

LHFPL5 4 L84*,Y127C,649delG,T165M NM_182548.3 NGS

LHX3 3 Y116C,W229*,A215V NM_014564.3 NGS

LIFR 4 653dupT,2013_2014insT,171_174delTAAC,R597* NM_002310.5 NGS

LIG4 4 R580*,G469E,R814*,R278H NM_002312.3 NGS

LMNA 7 V440M,R527H,R527C,A529V,K542N,R471C,R298C NM_170707.3 NGS

LOXHD1 2 R670*,R1572* NM_144612.6 NGSLRAT 2 217_218delAT,S175R NM_004744.3 NGS

LRP2 13

R3399*,8519_8522delATTT,11469_11472delTTTG,IVS7-2A>G,R365*,IVS18-1G>A,IVS44+1G>A,9484_9485delGT,13139_13140insC,9358_9359delAG,IVS11+2T>G,D2054N,Y2522H

NM_004525.2 NGS

56

Page 57:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

LRP5 14

E485*,1468delG,W734*,IVS7+1G>A,2305delG,R494Q,R570W,Q853*,R428*,804_813delGGGGAAGAGG,R752G,E1367K,R570Q,G610R

NM_002335.2 NGS

LRPPRC 2 C1277*,A354V NM_133259.3 NGS

LRTOMT 5 R81Q,W105R,Y111*,E110K,IVS5+4A>C

NM_001145308.4 NGS

MAK 4 R166H,N130H,Q240*,G13S NM_001242957.1 NGS

MAN2B1 7 H72L,P356R,Q639*,IVS14+1G>C,R760*,L809P,R750W NM_000528.3 NGS

MARVELD2 5

IVS4+2T>C,IVS4+2_1331+5delTGAG,IVS4+1G>A,R500*,IVS3-1G>A

NM_001038603.2 NGS

MAT1A 10

R264C,G336R,A55D,L305P,I322M,1043_1044delTG,538_539insTG,R264H,P357L,827_828insG

NM_000429.2 NGS

MATN3 1 C304S NM_002381.4 NGSMBTPS2 4 R429H,W226L,F475S,M87I NM_015884.3 NGSMCCC1 4 L437P,V694*,D532H,I460M NM_020166.3 NGS

MCCC2 8R155Q,E99Q,I437V,517_518insT,P310R,V339M,R268T,D280Y

NM_022132.4 NGS

MCEE 2 R47*,K60Q NM_032601.3 NGS

MCOLN1 5 R322*,R102*,IVS3-2A>G,D362Y,R403C NM_020533.2 NGS

MCPH1 5 427_428insA,S25*,566_567insA,S72L,S101* NM_024596.3 NGS

MECP2 6 A140V,E137G,G428S,P322S,P225L,E394* NM_004992.3 NGS

MED12 4 H1729N,S1165P,R1148H,N1007S NM_005120.2 NGS

MED25 1 A335V NM_030973.3 NGS

MEFV 15

2040G>C,F479L,M680I,R653H,M694I,K695R,P369S,M694V,V726A,T267I,R761H,E167D,A744S,2076_2078delAAT,E148Q

NM_000243.2 NGS

MERTK 6R775*,IVS16+1G>T,R651*,IVS1+1G>A,2070_2074delAGGAC,IVS10-2A>G

NM_006343.2 NGS

MFRP 5 Q175*,498delC,I182T,1150_1151insC,499_500insC NM_031433.2 NGS

MFSD8 6 G429D,G310D,Y298*,T294K,P412L,Y121C NM_152778.2 NGS

MGAT2 3 S290F,H262R,C339* NM_002408.3 NGSMKKS 3 A242S,Y37C,H84Y NM_018848.3 NGS

57

Page 58:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

MKS1 2 51_55dupCCGGG,IVS1+2T>C NM_017777.3 NGS

MLC1 8

N141S,P92S,S93L,S280L,IVS2-10T>A,S69L,N141K,135_136insC

NM_015166.3 NGS

MLYCD 1 S187* NM_012213.2 NGSMMAA 4 503delC,R145*,Q95*,Y207C NM_172250.2 NGSMMAB 3 H183L,R186W,R190H NM_052845.3 NGS

MMACHC 6 271dupA,R132*,G147A,R111*,R161Q,L116P NM_015506.2 NGS

MMADHC 7 Y249C,L259P,R250*,T182N,R54*,Y140*,S20* NM_015702.2 NGS

MOCS1 2 R319Q,R73W NM_005943.5 NGSMOCS2 3 Q6*,*487A>C,*422G>A NM_176806.2 NGS

MPI 4 R219Q,S102L,M138T,R295H NM_002435.1 NGS

MPV17 5 N166K,R50W,R50Q,G24W,W120* NM_002437.4 NGS

MRPS16 1 R111* NM_016065.3 NGSMRPS22 2 L215P,R170H NM_020191.2 NGS

MTHFR 7 M581I,W339G,L323P,R183*,A222V,R377C,N324S NM_005957.4 NGS

MTM1 4 R241C,141_144delAGAA,R224*,R69C NM_000252.2 NGS

MTMR2 3 Q426*,E276*,Q482* NM_016156.5 NGSMTTP 3 R540H,S590I,G865* NM_000253.2 NGS

MUT 10G717V,R694W,W105R,N219Y,R369C,R93H,G623R,R108C,G215S,R228*

NM_000255.3 NGS

MVK 8 I268T,R277C,V377I,H20P,P165L,A334T,N301T,V310M NM_000431.2 NGS

MYO15A 9

9958_9961delGACT,3336delG,IVS4+1G>T,E1105*,10573delA,G1831V,Q1229*,Q2716H,IVS50-1G>C

NM_016239.3 NGS

MYO3A 3 Y1043*,IVS8-2A>G,IVS17-12G>A NM_017433.4 NGS

MYO5A 1 R778* NM_000259.3 NGSMYO6 3 E216V,R1166*,36dupT NM_004999.3 NGS

MYO7A 13

R212C,R212H,R150*,6025delG,C628*,R666*,R1743W,IVS27-1G>C,R244P,M599I,3596dupT,IVS3-2A>G,R395H

NM_000260.3 NGS

NAGA 4 R329W,E193*,R329Q,E325K NM_000262.2 NGS

NAGS 6 W324*,IVS3-2A>T,1025delG,E433D,1307

NM_153006.2 NGS

58

Page 59:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

dupT,L430PNDRG1 2 R148*,IVS8-1G>A NM_006096.3 NGS

NEB 3 19119_19120delGA,18318_18319delAG,E6536* NM_004543.4 NGS

NEFL 2 E210*,E140* NM_006158.3 NGSNEUROG3 2 R107S,R93L NM_020999.3 NGSNHP2 2 460T>A,Y139H NM_017838.3 NGS

NMNAT1 9E257K,L153V,N273D,V9M,R207W,R237L,V151F,W169*,838T>C

NM_022787.3 NGS

NOP10 1 R34W NM_018648.3 NGS

NPC1 17

R978C,N1156S,C177Y,R958Q,A1035V,G992W,3611_3614delTTAC,P1007A,Y1088C,IVS23+1G>A,C113R,T1036M,3662delT,R1059*,I1061T,G992R,V950M

NM_000271.4 NGS

NPC2 11

IVS2+5G>A,S67P,27delG,111delG,Q146*,IVS1+2T>C,E20*,E118*,IVS4+1G>A,V39M,P120S

NM_006432.3 NGS

NPHP1 2 IVS18+1G>T,L27* NM_000272.3 NGSNPHP3 3 R577*,IVS13+5G>A,Q1114* NM_153240.4 NGSNPHP4 2 Q779*,R658* NM_015102.3 NGS

NPHS1 10

R1109*,3250_3251insG,3250delG,1307_1308dupAC,D819V,1481delC,C265R,121_122delCT,V822M,R1160*

NM_004646.3 NGS

NR0B1 22

Y271*,Y197*,L263*,W235*,N440I,W105C,Y91*,W171*,W369*,1169delA,Q283*,I439S,Y380D,388_389delTA,W291C,Q395*,R267P,Q37*,L381H,L297P,K382N,Y399*

NM_000475.4 NGS

NR2E3 5IVS1-2A>C,R311Q,R76Q,R76W,L345*

NM_014249.2 NGS

NTRK1 9

Y359C,G571R,M581V,P689L,IVS7-33T>A,1709delT,1908_1909insT,A612S,R774P

NM_001012331.1 NGS

NUP62 1 Q391P NM_153719.3 NGSNYX 1 W350* NM_022567.2 NGSOAT 25 W391*,W275*,P199Q,159de

lC,Y209*,Y299*,G401*,192_193delAG,C93F,3G>A,R426*,Q90E,V332M,C394R,E318K,A226V,H319Y,L402P,952delG,R180T,P417L,R396*,I

NM_000274.3 NGS

59

Page 60:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

VS7-2A>G,W178*,R271K

OCA2 9G27R,W679C,IVS17+1G>T,P743L,N489D,M394I,V443I,A481T,1960delG

NM_000275.2 NGS

OCRL 2 166_167delAT,R844* NM_000276.3 NGS

OFD1 3 2844_2850delAGACAAA,2767delG,2126_2129dupAAAG NM_003611.2 NGS

OPA3 1 IVS1-1G>C NM_025136.3 NGSOSTM1 1 415_416delAG NM_014028.3 NGS

OTC 14

R129H,IVS7+2T>C,E87K,G50*,R277W,M206R,P225L,E154*,R26Q,L45P,L111P,R40H,Q216E,R40C

NM_000531.5 NGS

OTOA 1 IVS12+2T>C NM_144672.3 NGS

OTOF 8

1778delT,2348delG,I515T,L1011P,IVS8-2A>G,Q829*,Y1497*,R1939Q

NM_194248.2 NGS

PAH 32

F161S,R243*,L48S,Y204C,R408W,R413P,Y414C,I65T,IVS4+5G>T,E280K,R53H,IVS12+1G>A,284_286delTCA,F299C,R158Q,R111*,R408Q,IVS11+1G>A,IVS2+5G>A,R243Q,R252W,A403V,T380M,722delG,L255S,R261Q,1197A>T,IVS4-1G>A,Y356*,IVS10-11G>A,P281L,F39L

NM_000277.1 NGS

PALB2 4 Q988*,3116delA,Y1183*,Y551* NM_024675.3 NGS

PANK2 7 R264W,S178*,Y190*,T528M,G521R,R481*,IVS4-1G>T NM_153638.2 NGS

PAX3 2 S84F,Y90H NM_181457.3 NGS

PC 4 R156Q,R583L,V145A,A610T NM_000920.3 NGS

PCCA 3 G631R,A138T,R288* NM_000282.3 NGS

PCCB 9T428I,1540_1541insCCC,R410W,G246V,R499*,1173_1174insT,E168K,R512C,Y435C

NM_000532.4 NGS

PCDH15 8G262D,R134G,V528D,R3*,1088delT,S647*,IVS27-2A>G,R245*

NM_033056.3 NGS

PDE6A 4 V685M,R102S,W561*,Y583* NM_000440.2 NGS

PDE6B 4 Q298*,R531*,H557Y,L527P NM_000283.3 NGSPDE6C 12 R29W,Y819*,E211D,256_25

7insAG,IVS11-2A>G,R276*,E790K,IVS1-

NM_006204.3 NGS

60

Page 61:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

12T>A,H602L,Y323N,Y561*,M455V

PDE6G 1 IVS3+1G>T NM_002602.3 NGSPDHA1 2 D258A,R263G NM_000284.3 NGSPDP1 2 851_853delTTC,E93* NM_018444.3 NGSPDSS1 1 D308E NM_014317.3 NGSPDSS2 2 Q322*,S382L NM_020381.3 NGSPDX1 3 E178K,E178G,E164D NM_000209.3 NGS

PEX1 4 2097_2098insT,L664P,2916delA,G843D NM_000466.2 NGS

PEX12 3 K231*,R180*,S320F NM_000286.2 NGSPEX2 2 E55K,R119* NM_000318.2 NGS

PEX26 5 254dupT,G89R,34_35insC,R98W,2T>C NM_017929.5 NGS

PEX5 2 R427*,N526K NM_001131025.1 NGS

PEX7 7H285R,IVS9+1G>C,R232*,G217R,W206*,L292*,A218V

NM_000288.3 NGS

PGM1 4 G121R,R503*,IVS7-1G>C,T115A NM_002633.2 NGS

PHKG2 1 R44* NM_000294.2 NGS

PHYH 13

164delT,IVS5-2A>G,N269H,IVS6-1G>T,R275W,R275Q,IVS2-1G>C,IVS6+5G>T,R245Q,IVS2-2A>G,G204S,D177G,IVS6+2T>G

NM_006214.3 NGS

PKHD1 73766delC,9689delA,3761_3762delCCinsG,R496*,V3471G,5895dupA,T36M

NM_138694.3 NGS

PKLR 8Q421K,R559*,R510Q,T384M,R479H,G37E,R163C,R486W

NM_000298.5 NGS

PLA2G6 6 R632W,V310E,K545T,R37*,A80T,Y790* NM_003560.2 NGS

PLCE1 8S1484L,R321*,Q1616*,3846delG,Q1854*,R1246*,R1116*,R493*

NM_016341.3 NGS

PLEC 4 R3029*,R2319*,Q305*,12043_12044insG NM_000445.3 NGS

PLEKHG5 1 F647S NM_020631.4 NGS

PLG 6 R235H,K38E,W616*,V374F,E479*,693_695delGAA NM_000301.3 NGS

PLOD1 5 Y511*,R319*,G678R,R670*,W612C NM_000302.3 NGS

PLP1 4 A242V,3G>A,D57Y,R137W NM_000533.3 NGSPMM2 21 R141H,D223E,D188G,P113L NM_000303.2 NGS

61

Page 62:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

,C241S,V231M,N216I,L32R,F207S,R162W,D65Y,T226S,G117R,V44A,C9Y,V129M,T237R,R123Q,I132T,F119L,Y106F

PNPO 2 R229W,784T>C NM_018129.3 NGS

POLG 18

R232H,3630dupC,N864S,W748S,R3P,R627W,P1073L,L304R,T251I,Q497H,G737R,R227W,A467T,H932Y,R853W,2T>C,G848S,E873*

NM_002693.2 NGS

POMGNT1 91864delC,R311Q,W475*,IVS17+1G>A,IVS17+1G>T,R63*,IVS7+1G>A,C490Y,R605P

NM_017739.3 NGS

POMT1 9A200P,Y721*,W582C,A669T,G65R,R514*,Q590H,G76R,Q303*

NM_007171.3 NGS

POMT2 11Y666C,W748R,W647*,G482V,T184M,W748S,V373F,R413P,G353S,G726E,R638*

NM_013382.5 NGS

POU1F1 11E230K,F135C,W193R,R143Q,E250*,R271W,A158P,R172Q,P239S,R172*,K145*

NM_000306.2 NGS

POU3F4 7 L317W,R167*,R330S,K202*,R323G,A312V,K334E NM_000307.3 NGS

PPT1 7 D79G,R151*,L10*,T75P,169_170insA,R122W,G108R NM_000310.3 NGS

PRCD 2 C2Y,R22* NM_001077620.2 NGS

PRKRA 2 P222L,267_268delTA NM_003690.4 NGSPROM1 2 1841delG,Q576* NM_006017.2 NGS

PROP1 17

F88S,R120C,157delA,Q83*,IVS1+1G>T,112_124delTCGAGTGCTCCAC,R125W,F117I,150delA,301_302delAG,IVS2-11C>G,R73H,469_470insT,2T>C,310delC,R99*,R73C

NM_006261.4 NGS

PRPS1 8 A87T,D65N,I290T,G306R,L152P,Q133P,M115T,E43D NM_002764.3 NGS

PRX 8C715*,R1070*,D651N,2098delG,R196*,R953*,R368*,247delC

NM_181882.2 NGS

PSAP 7 1A>T,Q430*,C382F,C382G,L349P,C241S,N215H NM_002778.2 NGS

PSAT1 1 D100A NM_058179.2 NGS

PYGM 13

1827G>A,Y85*,1A>G,2128_2130delTTC,Y574*,E541*,W798R,R50*,G205S,K543T,E655K,A365V,R576*

NM_005609.2 NGS

62

Page 63:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

RAB23 1 L145* NM_183227.1 NGS

RAB27A 5 W73G,Q118*,A87P,L130P,A152P NM_004580.4 NGS

RAB3GAP1 5 Y470*,W578*,IVS8+1G>A,I

VS10+1G>A,R671* NM_012233.2 NGS

RAB3GAP2 1 G1052C NM_012414.3 NGS

RAD51C 1 R258H NM_058216.1 NGS

RAG1 10R561H,R561C,C328Y,R314W,E722K,R776W,R778Q,E774*,R975W,Y938*

NM_000448.2 NGS

RAG2 4 G451A,T77N,R229Q,R39G NM_000536.3 NGS

RAPSN 6 A189V,R164C,N88K,L283P,E162K,Y269* NM_005055.4 NGS

RAX 3 Y303*,R192Q,Q147* NM_013435.2 NGS

RDH12 13

G127*,L99I,Q189*,806_810delCCCTG,H151N,A126V,H151D,S175P,R62*,T49M,T155I,Y226C,I51N

NM_152443.2 NGS

RDX 3 1405dupG,D578N,Q155* NM_002906.3 NGSRELN 1 IVS37-1G>A NM_005045.3 NGSREN 4 R230K,S135Y,R43*,R49* NM_000537.3 NGS

RGR 1 S66R NM_001012720.1 NGS

RHO 3 M207R,E249*,E150K NM_000539.3 NGSRLBP1 1 R234W NM_000326.4 NGS

RP2 7 R120*,453delC,305_306insT,R118L,R118H,Q26*,Y151* NM_006915.2 NGS

RPE65 11R234*,K303*,Y431C,1067delA,L341S,A132T,R515W,P363T,V452G,R91W,Y368H

NM_000329.2 NGS

RPGR 11

G60V,G275S,654_655delGA,T99N,F130C,G173R,173_174insA,674_675delCC,1433_1436delTGAC,P235S,846_847delAA

NM_001034853.1 NGS

RPGRIP1L 10Q253*,2269delA,S659P,T615P,K233*,R805*,Q684*,Q872*,Q345*,R132*

NM_015272.2 NGS

RYR1 17

P3527S,V4849I,M2423K,R109W,S3448F,IVS99-2A>T, 1739_1742dupATCA, 5726_5727delAG, H2035L, IVS59+1G>T, C3402G, E4494*, R3539H,M402T,S1778*,Y246*,R1469W

NM_000540.2 NGS

SACS 4 8844delT,R2502*,Q4054*,R3636Q NM_014363.4 NGS

63

Page 64:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

SAG 5 R193*,R175*,926delA,R292*,E306* NM_000541.4 NGS

SBDS 7R218*,IVS2+1G>C,120delG,183_184delTAinsCT,R126T,IVS2+2T>C,R169C

NM_016038.2 NGS

SBF2 3 R487*,R1196*,Q959* NM_030962.3 NGSSC5DL 1 R29Q NM_006918.4 NGSSCNN1A 1 R508* NM_001038.5 NGSSCNN1B 1 G37S NM_000336.2 NGSSCNN1G 2 1627delG,IVS12-1G>A NM_001039.3 NGSSEMA4A 2 D345H,F350C NM_022367.3 NGS

SEPN1 6 W453S,G315S,U462G,R466Q,U462*,G273E NM_020451.2 NGS

SERPINA1 10D280V,I116N,S77F,R63C,P393S,G91E,L65P,E288V,E366K,G139S

NM_000295.4 NGS

SETX 7 L1976R,R1363*,R332W,Q868*,P2213L,R1294C,E343* NM_015046.5 NGS

SGCA 5 R98H,R77C,R284C,R192*,V247M NM_000023.2 NGS

SGCB 7 L108R,R91L,Y184*,T151R,S114F,R91P,M100K NM_000232.4 NGS

SGCG 2 E263K,C283Y NM_000231.2 NGS

SGSH 10R206P,R150Q,E447K,R433Q,R74C,R245H,E369K,S298P,S66W,P128L

NM_000199.3 NGS

SH2D1A 8 R32T,R55L,3G>T,P101L,385T>A,Q58*,T68I,R55* NM_002351.4 NGS

SH3TC2 20

R904*,Y169H,2491_2492delAG,1747_1748delAG,L661P,217_227delGCTGCTCGGAGinsCCAGTAA,R954*,W307*,E657K,R1109P,R658C,IVS5-2A>G,R1109*,Y943*,28delG,Q1201*,R529H,IVS10-1G>A,3341delC,2191delG

NM_024577.3 NGS

SIL1 3 R111*,L457P,Q438* NM_022464.4 NGSSLC12A1 3 D648N,V272F,W625* NM_000338.2 NGS

SLC12A6 5R207C,IVS18+1delG,R1011*,1584_1585delCTinsG,R675*

NM_133647.1 NGS

SLC17A5 5 P334R,H183R,Y306*,K136E,R39C NM_012434.4 NGS

SLC24A1 1 1613_1614delTT NM_004727.2 NGSSLC25A13 12 R605*,852_855delTATG,IV

S11+1G>A,IVS6+1G>C,Y600*,E601*,IVS6+5G>A,G531D,E601K,IVS13+1G>A,S225

NM_014251.2 NGS

64

Page 65:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

*,R360*

SLC25A15 11G220R,R275Q,G27R,T272I,L71Q,R179*,M37R,T32R,E180K,562_564delTTC,G190D

NM_014252.3 NGS

SLC25A22 2 P206L,G236W NM_024698.5 NGS

SLC26A2 12

N425D,R178*,G678V,1020_1022delTGT,R279W,A715V,T512K,G255E,IVS1-26+2T>C,Q454P,1724delA,C653S

NM_000112.3 NGS

SLC26A4 18

V659L,G209V,T721M,R409H,E384G,L676Q,S90L,IVS15+5G>A,G197R,T416P,IVS7-2A>G,N392Y,916dupG,H723R,L236P,T410M,IVS8+1G>A,T94I

NM_000441.1 NGS

SLC26A5 3 W70*,R130S, -53-2A>G NM_198999.2 NGSSLC35A1 1 277_280delGTGCinsTG NM_006416.4 NGSSLC35C1 2 T308R,R147C NM_018389.4 NGSSLC35D1 3 W311*,T65P,R107* NM_015139.2 NGS

SLC37A4 91108_1109delCT,E377*,R28H,W118R,R437*,G361D,W96*,G361C,706_708delGTG

NM_001164278.1 NGS

SLC45A2 3 1121delT,986delC,D157N NM_016180.3 NGS

SLC4A11 14

S213P,M856V,R605*,L843P,353_356delAGAA,G464D,2240_2240+1insTATGACAC,R869C,R755Q,2233_2240dupTATGACAC,R488K,S489L,R869H,473_480delGCTTCGCC

NM_032034.3 NGS

SLC6A8 9

G132V,G381R,P544L,1222_1224delTTC,C337W,321_323delCTT,R514*,C491W,P554L

NM_005629.3 NGS

SLX4 5IVS5+3_1163+4insT,IVS5+2T>A,286delA,1093delC,514delC

NM_032444.2 NGS

SMN1 1 EX7 del NM_000344 Q-PCR

SMPD1 81829_1831delGCC,R443*,H423Y,R498L,M384I,996delC,L304P,L263*

NM_000543.4 NGS

SNAP29 1 487dupA NM_004782.3 NGS

SPG11 8

R2034*,733_734delAT,IVS39-1G>C,529_533delATATT,Q1875*,K825*,IVS2+1G>C,Q40*

NM_025137.3 NGS

SPG20 2 1110delA,364_365delAT NM_015087.4 NGS

65

Page 66:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

SPG7 10

S692T,2216_2217insA,850_851delTTinsC,W583C,L78*,1742_1744delTGG,1617delC,784_785delGC,G349S,A510V

NM_003119.2 NGS

STAR 8R182H,R188C,R193*,R182L,W250*,R217T,V187M,Q258*

NM_000349.2 NGS

STIL 4 IVS15+1G>A,Q1239*,V1219*,L798V NM_003035.2 NGS

STRA6 12

R655C,W23*,277_278insCC,147delC,G304K,T644M,527_528insG,P293L,IVS16-1G>A,52_53delTAinsC,R655H,D560H

NM_022369.3 NGS

SUCLG1 3 IVS1+3G>C,152_153delAT,A209E NM_003849.3 NGS

SUOX 2 A265D,R217Q NM_000456.2 NGS

TAT 5 R57*,R417*,G362V,S223*,IVS2-5A>G NM_000353.2 NGS

TBCE 2 C371*,66_67delAG NM_003193.3 NGSTCAP 1 Q53* NM_003673.3 NGS

TCIRG1 4 C464*,G405R,IVS18+1G>A,R444L NM_006019.3 NGS

TECTA 3 651_652insC,IVS9+1G>A,6037delG NM_005422.2 NGS

TERT 3 R901W,P704S,R811C NM_198253.2 NGS

TFR2 14

L490R,M172K,Y250*,1861_1872delGCCGTGGCCCAG,IVS17-1G>A,88_89insC,G792R,1235_1237delACA,R105*,A444T,Q317*,1665delC,Q690P,R396*

NM_003227.3 NGS

TH 6 R202H,L205P,T463M,Q381K,R306H,T245P NM_000360.3 NGS

TIMM8A 3 Q38*,R80*,C66W NM_004085.3 NGS

TK2 5 T108M,H121N,R90C,I212N,I53M NM_004614.4 NGS

TMC1 4 M654V,R34*,C515R,R389* NM_138691.2 NGS

TMEM216 5 R73L,R73H,G77A,R85*,L114R

NM_001173990.2 NGS

TMEM67 11I833T,F590S,Q44*,M252T,Y513C,Q376P,R208*,C615R,G821R,G821S,W290L

NM_153704.5 NGS

TMIE 3 R81C,W57*,R84W NM_147196.2 NGS

TMPRSS3 4 R216L,W251C,P404L,208delC NM_024022.2 NGS

TNNT1 1 E180* NM_003283.4 NGS

66

Page 67:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

TPP1 8R447H,N286S,IVS5-1G>C,C365Y,R208*,C365R,R206C,G284V

NM_000391.3 NGS

TPRN 2 W413*,1427delC NM_001128228.2 NGS

TREX1 2 R114H,R164* NM_033629.3 NGSTRIM32 3 1560delC,R394H,D487N NM_012210.3 NGS

TRIM37 14

2212delG,838_842delACTTT,C109S,1037_1040dupAGAT,S287N,G322V,R686*,L76P,R471*,855_860+2delTTTCAGGT,Q249*,1894_1895delGA,1346_1347insA,496_500delAGGAA

NM_015294.3 NGS

TRIOBP 6 R347*,R788*,R1117*,Q581*,Q297*,R1068*

NM_001039141.2 NGS

TSEN54 3 A307S,Q343*,Q246* NM_207346.2 NGS

TSFM 1 R333W NM_001172696.1 NGS

TSHB 3 Q69*,E32*,G49R NM_000549.3 NGS

TSHR 13

Q324*,A553T,C600R,C41S,I167N,P162A,D410N,W546*,C390W,F525L,R310C,R109Q,P68S

NM_000369.2 NGS

TULP1 8

R420P,1511_1521delTGCAGTTCGGC,F491L,IVS2+1G>A,I459K,R482W,E402*,R400W

NM_003322.3 NGS

TYR 30

N382K,C244*,1164delT,R217Q,V275F,T373K,1467dupT,C89R,W236*,G47D,1012_1013insC,R217W,C91Y,P81L,R403S,R422Q,P406L,G446S,G419R,1501dupC,R299H,572delG,C55Y,D383N,A206T,D448N,W178*,R77Q,1A>G,286dupA

NM_000372.4 NGS

TYRP1 6 R374*,S166*,L36*,1057_1060delAACA,R356Q,1103delA NM_000550.2 NGS

UBA1 3 M539I,S547G,1731C>T NM_003334.3 NGSUBR1 2 H136R,Q513* NM_174916.2 NGS

UGT1A1 5 V225G,R341*,L175Q,L15R,Q331* NM_000463.2 NGS

UQCRB 1 306_309delAAAA NM_006294.4 NGSUQCRQ 1 S45F NM_014402.4 NGSUSH1C 1 238_239insC NM_153676.3 NGSUSH1G 5 W38*,L48P,394_395insG,83

2_851delTCGGACGAGGACAGCGTCTC,186_187delC

NM_173477.2 NGS

67

Page 68:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

A

USH2A 15

R4935*,L260*,2898delG,2299delG,Y1992C,C3267R,R737*,4338_4339delCT,R4192C,G3142*,C759F,W3955*,920_923dupGCCA,W2994*,C319Y

NM_206933.2 NGS

VDR 7 H305Q,G46D,V346M,R30*,Q152*,R80Q,Y295*

NM_001017535.1 NGS

VLDLR 3 R448*,R257*,2339delT NM_003383.3 NGSVPS13A 2 I90K,R208* NM_033305.2 NGSVPS33B 3 R532*,R438*,L30P NM_018668.3 NGS

WAS 11R86L,R86H,R34*,S82P,L270P,S272P,I294T,A56V,I481N,T45M,P58R

NM_000377.2 NGS

WDR62 5 Q470*,D511N,R438H,W224S,V65M

NM_001083961.1 NGS

WFS1 6 W648*,G695V,P724L,Q226*,P504L,Q819* NM_006005.3 NGS

WNT10A 5 C107*,R128Q,D217N,F228I,E233* NM_025216.2 NGS

WNT7A 3 G204S,R292C,A109T NM_004625.3 NGSXPA 4 R207*,C108F,Y116*,R228* NM_000380.3 NGS

ZFYVE26 4IVS28-1G>A,Q1808*,R1438*,Q493*

NM_015346.3 NGS

ZMPSTE24 81085_1086insT,54dupT,E239*,1085_1086insT,W340R,P248L,W450*,Q41*

NM_005857.4 NGS

ZNF469 1 E1392* NM_001127464.1 NGS

HBA1/HBA2 5 aa/-a3.7, aa/-a4.2, aa/-aSEA,

aa/-aFIL, aa/-aTHAINM_000558.3/ NM_000517.4

Gap-PCR+Electrophoresis

ABCD1

12

N148S,R464*,R401Q,R418W,R518W,1415_1416delAG,1552delC,E477*,E291K,G266R,P484R,R389G

NM_000033.3 NGS

RS1 3 E72Q,G74V,G109R NM_000330.3 NGS

IDUA 8 L346R,W402*,R619G,R89Q,1960T>G,R621*,Q70*,Y64* NM_000203.3 NGS

ABCA12 . . NM_173076.2 NGSCFH . . NM_000186.3 NGSFANCD2 . . NM_033084.3 NGSADAMTSL2 . . NM_001145320

.1 NGS

ESPN . . NM_031475.2 NGSHSPD1 . . NM_002156.4 NGS

68

Page 69:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

FKRP . . NM_001039885.2 NGS

GJA1 . . NM_000165.3 NGSCOL2A1 . . NM_001844.4 NGSGJC2 . . NM_020435.3 NGSSTRC . . NM_153700.2 NGS

TTN . . NM_001267550.1 NGS

MPZ . . NM_000530.6 NGSARL6 . . NM_032146.3 NGSCOL9A2 . . NM_001852.3 NGSCTDP1 . . NM_004715.4 NGSGCSH . . NM_004483.4 NGSGJB3 . . NM_024009.2 NGS

GJB6 . . NM_001110219.2 NGS

IGBP1 . . NM_001551.2 NGSPAX6 . . NM_000280.4 NGSPRODH . . NM_016335.4 NGSSIX6 . . NM_007374.2 NGSSNAI2 . . NM_003068.4 NGSTAF1 . . NM_004606.3 NGSHAL . . NM_002108.3 NGS

PDZD7 . . NM_001195263.1 NGS

69

12

Page 70:  · Web viewTable S1. Recessive diseases/genes included in NGS-based carrier screening (548 genes; 623 disease) OMIM# Disease Gene Manifestation categories 102700 Severe combined

Table S5

Performance for variant detection in simulation for 3283 targeted pathogenic mutations

TP TN FP FN Sensitivity Specificity Accuracy

total 328854 328897 3 46 99,99% 100,00% 99,99%snp 275866 275897 3 34 99,99% 100,00% 99,99%ins 14096 14100 0 4 99,97% 100,00% 99,99%del 37293 37300 0 7 99,98% 100,00% 99,99%delins 1599 1600 0 1 99,94% 100,00% 99,97%*The simulation is based on pIRS Simulator which can simulate Illumina Paid-End reads with real error and quality distributions and coverage bias, and for each of 3289 targeted mutations, we simulate 100 cases and an average sequencing depth of 200X each case.

70

12345


Recommended