Genomic Medicine in the NICU

© The Children's Mercy Hospital, 2014. 11/14

Center for Genomic Medicine Center for Genomic Medicine

Joshua E. Petrikin, MDJoshua E. Petrikin, MD

Director of Neonatal GenomicsDirector of Neonatal Genomics

Genomic Medicine in the NICUGenomic Medicine in the NICU


2


DisclosuresDisclosures

• I have no conflicts of interest to disclose

• I will not be discussing off label medication uses


3


OverviewOverview

• Discuss past and current genetic testing

• Define Genomic Medicine

• Speculate on future directions for genomics

• Elucidate some ethical considerations in Neonatal genomic testing


4


Genetic TestingGenetic Testing

• The analysis of human DNA, RNA, chromosomes, proteins, and certain metabolites in order to detect heritable disease-related genotypes, mutations, phenotypes or karyotypes for clinical purposes.

• Prenatal, newborn, and carrier screening included.


5


http://www.indiana.edu/~oso/lessons/Genetics/MyFamily2.html


6


Genetic Testing:Genetic Testing:Chromosome KaryotypeChromosome Karyotype


7


ExampleExamplePatient #1 is a 10 year old girl with short stature and a broad neckPatient #1 is a 10 year old girl with short stature and a broad neck


8


Microarrays aka “CHIPS”

• Short oligos are attached to a solid support (microarray).

• Hybridize with fluorescently labeled PCR products containing SNP of interest.

• Can analyze many mutations at once

• Currently > 740k SNP per chip


9


Array-CGH (comparative genomic hybridization)


10


Deletion on array

Muscular Dystrophy

• Since 65-85% of cases are due to deletions, start with deletion testing.

• The lab we use for dystrophin deletion testing uses an “exon array” with high density probes spanning entire dystrophin gene.

• Case 4 patient has a deletion including exons 44-48 (not shown here).

• If no deletion detectable, sequence entire DMD gene (79 exons!).


11


Genomic MedicineGenomic Medicine

• A structured approach to disease diagnosis & management that prominently features genome sequence information.

• Decoding Genomes to diagnose diseases better and help choose the best treatments


12


Monogenic DiseasesMonogenic Diseases

J Clin Invest. 2008;118:1590-1605. doi:10.1172/JCI34772.

http://dx.doi.org/10.1172/JCI34772


13


7,700 monogenic diseases7,700 monogenic diseases

• 4,174 causal genes known• Affect 4% of children• Cause 20% of infant deaths• Cause 17% of pediatric hospitalizations

• Genome Variants determine phenotype• Genome variants = individual changes in the DNA

sequence from “normal”• Proving ground for genomic medicine

• 20 year experience with sequence-based diagnosis • 1-gene-at-a-time• Slow (months – years)• Expensive ($2500 - $10,000)• Requires right gene to be nominated


14


Neonatal Intensive CareNeonatal Intensive Care

• 4.1 million babies born in US / year• 1 in 20 admitted to NICU

• 220,000 (5.4%) NICU admissions/year• 30% due to congenital abnormalities

• 19,000 neonatal deaths/year• 6.8/1000 • 22% due to congenital abnormalities

• $3,000 - $8,000 per day


15


Neonatal Diseases are UniqueNeonatal Diseases are Unique

• Emergencies• Rapid results can guide management

• Largely stereotyped presentation• Broad differential diagnosis workups

• Considerable genetic heterogeneity• Molecular diagnoses almost never made


16


Neonatal Genomic Medicine

NICU

$3,000 - $8,000 per day

Rapid Genome Sequence• Test for things too rare and/or

heterogeneous to be considered• Identification of genotype before

phenotype fully manifests• Diagnose or rule out known

mutations• Reduce unnecessary tests &

empiric therapies• Improve prognostic assessment,

genetic counseling

• Unique opportunity to intervene before irreversible disease processes manifests with irreversible symptoms


17


Genomic Sequencing – Sanger


18


Human GenomeHuman Genome

3.2 billion base pairs, 6.4 billion ntEqual to typing 60 words/min x 8hrs/day x 50 years

20,000 genes (just 2% of genome) which encode 100,000 proteins

7700 Monogenic diseases


19



20


Primary Analysis – Base CallingPrimary Analysis – Base Calling

• In Illumina sequencing, each sequencing cycle produces 4 images, one for each base, where clusters that show that base are lit up

• Base calling done by• detecting the coordinates of each cluster• measuring the intensity of the signal at each cluster for each base• determining which base has the strongest signal• strength of call results in a quality score for each base

Whiteford N et al. Bioinformatics 2009;25:2194-2199

http://www.clinchem.org/content/55/4/641/F4.large.jpg


21


Shotgun SequencingShotgun Sequencing

• Shotgun sequencing techniques rely on breaking long strands of DNA into fragments and then sequencing them individually

• NextGen Sequencing is massively parallel, ultra high throughput• HiSeq 2500 run produces 1 trillion base pairs in 8 billion 125 bp reads

• Interpreting an individual’s DNA sequence means taking all the pieces and putting them together into some meaningful context


22


Sequence Alignment – Read MappingSequence Alignment – Read Mapping

AGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTCAAGCTATTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATA TTTATGACCATGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATG

GACCATGATTTTTCTTTTTTTATTTTTTCCATNTAAGATAAGATGGAGAC TGATTTTTCTTTTTTTATTTTTTCCATATAAGATAAGATNGAGACGGTCT TTTCTTTTTTTATTTTTTCCATATAAGATCAGATGAAGACGGTCTTTTCTTG CCATATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTG TATAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTAT TAAGATAAGATGGAGACGGTCTTTTCTTGTGAGTCTGTTTTTCTGTATTC

• Most human sequence analysis is done by mapping reads to the human reference genome

• Alignment results are stored in a compact standard file format called Sequence Alignment Map (SAM) or its binary version BAM

• Each alignment records:• read position in reference (e.g. chr10:1000-1125)• mismatch between read and reference• strand read aligned to• mapping quality score


23


Alignment Visualization in the Alignment Visualization in the Integrative Genomics Viewer (IGV)Integrative Genomics Viewer (IGV)

• Red reads pointing right aligned to the forward strand• Blue reads pointing left aligned to the complement strand


24


SubstitutionsSubstitutions


25


DeletionsDeletions


26


Infant CMH487

Diagnosis!

Bioinformatic Filter 5


27


Newborn TestingNewborn Testing

• ““If medical or psychosocial benefits of genetic test will not accrue until adulthood, as in case of carrier status or adult-onset diseases, genetic testing should be deferred…”

• Guides gene analysis/interpretation• Do not analyze newborns for carrier status or

adult conditions or off-target diseases


28


Secondary Secondary Findings

• Also called incidental or unanticipated findings

• Highly likely, if not inevitable, whenever WGS/WES is performed

• Examples include:• finding of a previously unsuspected high risk of

future disease • discovery of a disorder in an asymptomatic

individual• detection of carrier status


29


Incidental Findings in Incidental Findings in Neonates?Neonates?

• Mandate to avoid violating a child’s right to an open future?

• Considerations• Parents of critically-ill children “just tell me where

to sign”• Feasibility of reporting secondary findings -

accuracy, expectations, defining the scope• Impacts:

• Test design (SSAGA)• Consent• Communication of results


30


Francis Collins, Director of the NIH, Francis Collins, Director of the NIH, Wall Street Journal, July 8, 2014

"Over the course of the next few decades, the availability of cheap, efficient DNA sequencing technology will lead to a medical landscape in which each baby's genome is sequenced, and that information is used to shape a lifetime of personalized strategies for disease prevention, detection and treatment."


31


Not quite inexpensive enough for generalized newborn screening—but right up there for diagnosis of ill infants in the NICU


32


Adapted from Sir George Poste, circa1999


33


Take Home PointsTake Home Points

• Genomic Medicine hold promise, but is not the final answer• Proteinomics, metabolomics, epigenetics

• WGS compares most of a patient’s genome against a reference genome• Deletions, insertions, triplet repeats

centrimeric anomalies undetected• The focus on care will shift from disease

centered to patientcentered


34


Take Home PointsTake Home Points

• Whole genome sequencing is not ready for prime time use for newborn screening

• Don’t invest in WGS equipment and bioinformatics tools yet

• Ethical questions arise as to the use of WGS for NBS

• Adult onset disorders

• Variants of unknown significance

• Paternity


35


Children’s Mercy HospitalCenter for Pediatric Genomic Medicine

Supported ByClements

FoundationMarion Merrell Dow

FoundationNational Institutes of

HealthWT Kemper FoundationPatton Trust

Director Dr. Stephen Kingsmore

Healthcare

Genomic Medicine in the NICU