View
1.141
Download
1
Tags:
Embed Size (px)
DESCRIPTION
This presentation accompanies a webinar at: https://www1.gotomeeting.com/register/367952841 === Hitachi Solutions has partnered with OpGen to offer MapIt® Optical Mapping Services to our customers. Trevor Wagner, Senior Applications Scientist Manager from OpGen will be our guest presenter. Trevor was part of the team that developed, tested, and released OpGen’s first major product, the Argus Optical Mapping System in 2010. This webinar will describe: 1. How Optical Mapping technology will benefit you in the following application areas: -Strain Typing -Comparative Genomics -Whole-genome Sequence Assembly 2. How the MapIt Service works.
Citation preview
1
www.miraibio.com | [email protected] | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
Robert Lynde Deputy Director, Hitachi SolutionsErin Newburn Field Applications Scientist, OpGen Inc.
Webinar: How can Optical Mapping accelerate my research?
August 10th, 2011
Please note: This presentation accompanies the webinar recording at: https://www1.gotomeeting.com/register/367952841
www.miraibio.com | [email protected] | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
• Part of the Hitachi family of companies that have been around for more than 100 years
• #47 on the Global 500• Everything from bullet trains to life science software
and services• MasterPlex has been on the
market for over 8 years• Introducing MapIt® Optical Mapping Services
Hitachi Solutions America, Ltd.
www.miraibio.com | [email protected] | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
• A leading innovator in rapid, accurate genomic and DNA analysis systems.
• Its Optical Mapping technology is being used by leading genomic research centers, public health agencies, biodefense organizations, academic institutions, biotechnology companies, and clinical research organizations worldwide to help rapidly analyze microbial genomes.
• In 2010, OpGen released its Optical Mapping System to allow individuals another method to access the Optical Mapping technology.
OpGen, Inc.
www.miraibio.com | [email protected] | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
What is Optical Mapping and how is it used?
Optical Mapping—Solutions for Whole Genome Analysis
Erin N. Newburn, Ph.D.
Field Applications Scientist
OpGen Inc.
Webinar Agenda
• Optical Mapping technology overview
• Optical Mapping applications– Strain typing– Comparative genomics– Whole genome sequence assembly
• Argus®Optical Mapping System
• Future applications for larger genomes
What is Optical Mapping?
Whole genome, ordered restriction maps
• Whole genome analysis of bacteria, yeast, fungi– High level of precision– Eliminates high cost of sequencing
• De novo process, no sequencing required
Optical Mapping
acagctctcgagaggatcctcgtcgggatccctcgcgctcgagatcgcgtagcgctagagcgctctagaggctcgcggagagctcgcgcgagtgcgtcggggacacattcgaggatccagttagagatcggctcgtgctagaggcctgctcgtagagacacagatagacagatagagcggctcgctctcgctgctcggaagtcgctcgcgtaagttcgcgctggatcccacagctcgcgctgacacagtcgcgtagagatgcggctgagcgctggcgctgaggctggacagtgctgctgagctcggacagctcgtgtggcgcggatccgtgctcggcggatcctagggcgtgtcgcgtgctggatgcgctggtgggccccagtttggcggcgctcgcggctcggctgctggtcgcctgcttt
These patterns are specific to individual organisms- identify, compare microbial isolates
Locates and measures distance between restriction sites
After staining with intercalating dye digestion reveals restriction cleavage sites as “gaps”, under fluorescent microscopy
How Optical Mapping WorksCells gently lysed to extract long genomic DNA molecules, pieces of microbial chromosomes
DNA is captured in parallel arrays of single DNA molecules using microfluidic device
Image Analysis and Markup
Overlapping single molecule restriction maps are aligned to produce a map assembly covering an
entire chromosome
40
.52
1.5
6
51
.99
8.0
8
24
.45
58
.94
17
.93
8.8
9
45
.26
28
.99
7.2
0
46
.25
5.5
2
27
.52
Map Assembly
Map Assembly
consensus map
Overlapping single molecule restriction maps are aligned to produce a map assembly covering an entire
chromosome
Patterns of restriction sites highly informative~ 500 sites per Salmonella genome
Characteristic of microbial species and individual isolatesUse to identify samples to strain level
Application Overview
Optical Mapping
Single molecule approach generates whole-genome, ordered restriction maps
Optical Maps are compared to perform high resolution epidemiology, discover genetic variation, and accelerate sequence assembly
Comparative Genomics
Strain Typing
Sequence Assembly
Strain Typing
Strain TypingHigh Resolution Epidemiology with Optical Mapping
Traditional technologies (PFGE, ribotyping & Rep-PCR) provide limited information, are unreliable for distinguishing closely related isolates, do not relate to sequencing data
Strain TypingOptical Mapping Compared to PFGE
USA-400(MW2)GLMC-10
SSCMec VS-alpha PhiSA2 (PVL)
GLMC-10
Optical Mapping detects absence of SSCmec, VS-α, PhiSA2/PVL
USA 400
Strain Typing: Ongoing E coli Outbreak
• E coli O104:H4 outbreak reported in Germany, May 2011
– Shiga toxin positive (rare for O104:H4)
– High incidence of hemolytic uremic syndrome (HUS)
– Similar to Enteroaggregative E coli (EAEC) which normally produces mild illness
• Reports spread to 12 countries, including US, Canada
• Over 3,000 cases reported by June 13, including 35 deaths
Current Outbreak
2001 HUS outbreak
EAEC Seq. Reference
• Whole genome maps available in 48 hours
• Indicated outbreak was clonal – single source
• Identified genomic islands unique to the outbreak
Strain Typing: Ongoing E. coli Outbreak
Outbreak Specific Conserved Region 3
stx2 tehAOutbreak Specific
Conserved Region 1
Outbreak Specific Conserved Region 2
Strain Typing: Ongoing E coli Outbreak
Current Outbreak
Strain Typing: Publication Example
Kotewicz et al (2008) Microbiology 154: 3518-3528
2006 E. coli O157:H7 “Spinach” Outbreak
• 51% hospitalizations v typical 10-20%• 15% kidney failure v typical 2-7% (and 3 deaths)• FDA CFSAN used Optical Mapping to identify 13
chromosomal markers that define the outbreak strain• Outbreak strain contained prophage insertions
carrying extra Shiga toxin genes resulting in increased pathogenicity
• “Most of the chromosomal changes found by optical mapping would not have been detected by microarray-based techniques”
• “Optical mapping ….. provides insights into chromosomal changes and gene acquisitions that neither PFGE nor microarray analysis allow”
Strain Typing Summary
• Optical Mapping provides required resolution to differentiate closely related strains: > 90% sequence similarity
• Other technologies lack resolution and typically focus on a few loci, may not relate to sequencing
Comparative Genomics
Comparative Genomics Background
Definition:Analysis and comparison of genomes from different strains and different species to better understand gene function and relatedness.
Involves:• Sequence similarity• Gene location and synteny (order of genes)• Conserved and non-conserved regions of the genome
Comparative Genomics
Comparative analysis of US Vancomycin-resistant Staphylococcus aureus strains
Comparative Genomics
VRSA-6 has direct repeat
Comparative analysis of US Vancomycin-resistant Staphylococcus aureus strains
Comparative Genomics: Enterococcus faecalis
• E. faecalis isolates are diverse at whole genome level with differences from 0% to 35%
• Strain V583 is whole genome DNA sequence
• ATCC 49477 is 2.9% different at the whole-genome level from V583 using Optical Map
Comparative Genomics: Enterococcus faecalis
V583
ATCC49477
• van genes are responsible for vancomycin resistance in Enterococcus faecalis1
• Optical Mapping can draw attention to insertions that confer antibiotic resistance
1Evers & Courvalin (1996). J Bacteriol 178(5):1302-9.
SequenceAssembly
Anne Buboltz, Microbial Genomics Conference (2009)
Sequence AssemblyRe-sequencing Validation
Alignment with MapSolver™
Four Misassemblies
Anne Buboltz, Microbial Genomics Conference (2009)
Sequence AssemblyRe-sequencing Validation
Anne Buboltz, Microbial Genomics Conference (2009)
Sequence AssemblyRe-sequencing Validation
Contig Breakage and Alignment
Anne Buboltz, Microbial Genomics Conference (2009)
Sequencing AssemblyInversion Identified
Sequence Validation:Optical Mapping Finished Genomes
• Finished whole-genome DNA sequences are considered the gold standard (Chain et al. 2009)
• Finished whole-genome DNA sequences provide valuable insights into organization and structure of the genome that draft quality sequences cannot offer (Fraser et al. 2002)
• However, currently no strict quality or validation requirement for submitting a finished whole-genome to GenBank or peer-reviewed journal
Sequence Validation:Optical Mapping Finished Genomes
• Purpose– Produce Optical Maps of published and peer-reviewed
finished bacterial genomes to validate quality of the finished genome
• Hypothesis– Optical Mapping will identify at least one finished
genome to contain a discrepancy.
Sequence Validation:Optical Mapping Finished Genomes
• Methodology– Select organisms with finished genomes that are linked to a
specific ATCC submission– Generate Optical Maps using Argus® Optical Mapping System– Compare Optical Maps to in silico maps of finished genomes
Sequence Validation:Optical Mapping Finished Genomes
13 ATCC isolates selected for validation
Sequence Validation:Optical Mapping Finished Genomes
Relative in silico Insertion Discrepancy Example
Finished whole-genome DNA sequence contained 131 Kb extra DNA that should not be in ATCC 17978
Sequence Validation:Optical Mapping Finished GenomesRelative in silico Deletion Discrepancy Example
• Finished whole-genome DNA sequence missed a 375 Kb repetitive region, most likely a ribosomal repeat that the sequence assembler compressed
• Optical Mapping can span these large regions by using >150 Kb single molecule restriction maps
Sequence Validation:Optical Mapping Finished Genomes
Relative in silico Inversion Discrepancy Example
• The first V. cholerae finished genome published in 1999 contains a putative inverted misassembly
Sequence Validation:Optical Mapping Finished Genomes
• Optical Map of N16961 compared to finished genome of V. cholerae M66-2 published in 2009
• M66-2 contains a putative inverted misassembly at the same locus as the DNA sequence of N16961, and is probably a resequencing error propagated into M66-2
Identify
Order&
Orient
Gaps
Overlaps
Optical Mapping Complements Sequence Assembly
gggtcagtcgtctaaaggtcgctacgtcagctgatcgtgacgcccctttttaacagtgcagctatgtggacgtacgtagctagcatcgttgcagtcgatgcaaggcgcggctcgcgcggggaaaattttttcgatcgatcgatcgatcgatgcgatcgatttcgcgtatcgatcgatcgtcgatcgatcggcgcgctagaaagagagagctcgcgcgtacatatcgcgtcccttggaggatcgatatagcgctacgagctacgatcgactgatcgat
DNA Sequence
Sequence Assembly: Summary
• Maximum value in contig alignment & gap closure as well as independently validating sequence
• Optical Mapping works best with larger contigs: >40 Kb
Argus® MapCard Processor Argus® Optical MapperArgus® Mapping Work StationArgus® Oil Applicator
Argus® MapCardArgus® QCard
Argus® Sample Preparation Kit HMWArgus® Stain KitArgus® Enzyme Kits
MapManagerMapSolver™
Instrumentation
Optical Mapping Cards
Reagents
Software
Four Key Components
Optical Mapping Cards
QCard• Performs DNA Quality Check• DNA Concentration optimization
MapCard• MapCard and Argus® MapCard
Surface assembled and CFD placed• DNA deposited • Enzymatic reaction performed
CFD(Channel Forming Device) MapCard
Micro Fluidic Channels
Top View of CFD
Bottom View of CFD
Reagent Reservoirs
Argus® MapCard Surface
+
MapCard Setup
Place CFD on Map Card
Deposit DNA
Remove CFD
Add Cap
MapCard—Stretching DNA Molecules
Load Argus® MapCard Reagents
Place MapCard in MapCard Processor
Result: RE Digested and Stained Single Molecules
MapCard Processing
Place MapCard in Optical Mapper
Optical MapperProcessing
Image & Data Acquisition
Single Molecule Restriction Map Linear Assembly
Consensus Optical Map
Optical Mapper Assembly Process
Future Directions:
Large Genome Application
Large Genome Application
• Focus on Super-scaffolding– Order and orientate contigs or scaffolds by creating
Super-scaffolds with mapping information
• Hybrid approach combining draft sequence and Optical Mapping
• Uses Argus® System to produce mapping information with cluster-based data pipeline
OpGen Application Accelerates Workflow
OPTICAL MAPPING
1 WEEK
Optical Map SUPER-SCAFFOLD
1 WEEK
Review sequence data in SS context
DONE
PCR, PE libraries if need more seq info
WEEKS
Construct Fosmid librarySequence runs
Construct BAC Library
Sequence runs
MarkerAnalysis
WEEKS MONTHSYEARS
Bioinformatics
Library Prep Shotgun
seq
Multiple Paired-end, Mate-Pair Libraries
Sequence runs
Bioinformatics
Bioinformatics
Bioinformatics
Bioinformatics
Library Prep Shotgun
seq
Multiple Paired-end, Mate-Pair Libraries
Sequence runs
Bioinformatics
Multiple rounds
Multiple rounds
Sequence Scaffold
In Silico Map + Single Molecule
Maps
Sequence Driven Map Alignment
Sequence Driven Map Alignment
Scaffolding Process
Scaffolding Process
Extended Scaffolds
Super-scaffolding
Pair-wise Alignment
Final Scaffold
Goat Genome
Collaboration with BGI, representing the Goat Genome Consortium
BGI Original Input Before O.M. Data*
Result After O.M. Data
N50 (MB) 2.29 16.89N80 (MB) 0.91 6.23N90 (MB) 0.52 2.83
Scaffolds (90% Genome Coverage) 1236 181Gap closed (from scaffolds > 200 kb) N/A 1284
Results presented at Plant and Animal Genome Conference January, 2011
*Illumina HiSeq
www.miraibio.com | [email protected] | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
How does the MapIt service work?
www.miraibio.com | [email protected] | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
Q & A
www.miraibio.com | [email protected] | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
• Learn more: http://www.miraibio.com/mapit/optical-map-service• Support: [email protected] or 1-650-615-7680• Sales: [email protected] or 1-424-237-8524• MiraiBio Support Menu
• Community• Knowledge Base
• Blog http://www.MiraiBio.com/blog• Webinars: http://www.MiraiBio.com/Webinars• Online Store http://store.MiraiBio.com
Resources
62