Parathyroid hormone induces the NR4A family of nuclear orphan receptors in vivo

www.elsevier.com/locate/ybbrc

Biochemical and Biophysical Research Communications 332 (2005) 494–503

BBRC

Parathyroid hormone induces the NR4A family of nuclearorphan receptors in vivo q

Flavia Q. Pirih a, Tara L. Aghaloo a, Olga Bezouglaia a, Jeanne M. Nervina b,Sotirios Tetradis a,c,*

a Division of Diagnostic and Surgical Sciences, UCLA School of Dentistry, Los Angeles, CA 90095, USAb Section of Orthodontics, UCLA School of Dentistry, Los Angeles, CA 90095, USA

c UCLA Molecular Biology Institute, Los Angeles, CA 90095, USA

Received 15 April 2005Available online 5 May 2005

Abstract

Parathyroid hormone (PTH) has both anabolic and catabolic effects on bone metabolism, although the molecular mechanismsmediating these effects are largely unknown. Among the transcription factors induced by PTH in osteoblasts are the nerve growthfactor-inducible factor B (NR4A; NGFI-B) family of orphan nuclear receptors: Nurr1, Nur77, and NOR-1. PTH induces NR4Amembers through the cAMP-protein kinase A (PKA) pathway in vitro. We report here that PTH rapidly and transiently inducedexpression of all three NR4A genes in PTH-target tissues in vivo. In calvaria, long bones, and kidneys, NR4A induction was max-imal 0.5–1 h after a single intraperitoneal (i.p.) injection of 80 lg/kg PTH. Nur77 demonstrated the highest expression, followed, inorder, by Nurr1 and NOR-1. In calvaria and long bone, PTH-induced expression of each NR4A gene was detectable at 10 lg/kg i.p.with maximum induction at 40–80 lg/kg. PTH (3–34) did not induce NR4A mRNA levels in calvaria, long bone, and kidney invivo, confirming our in vitro results that NR4A genes are induced primarily through the cAMP-PKA pathway. The magnitudeof PTH-induced NR4A expression was comparable in vivo and in vitro. However, NR4A mRNA levels peaked and returned tobaseline faster in vivo. Both in vivo and in vitro, PTH induced NR4A pre-mRNA levels suggesting that induction of these genesis, at least in part, through activation of mRNA synthesis. The in vivo induction of the NR4A family members by PTH suggeststheir involvement in, at least some, PTH-induced changes in bone metabolism.� 2005 Elsevier Inc. All rights reserved.

Keywords: NR4A; NGFI-B; Nuclear orphan receptors; Osteoblasts; PTH; In vivo

Parathyroid hormone (PTH) has diverse effects onbone metabolism [1]. Continuous high doses of PTH dif-ferentially increase recruitment of bone-resorbing osteo-clasts compared to bone-forming osteoblasts [2,3] andPTH decreases osteoprotegerin (opg) but increasesRANK ligand (RANKL) expression in osteoblasts [4].

0006-291X/$ - see front matter � 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.bbrc.2005.04.132

q This study was supported by NIH/NIDCR Grant R01-DE1331.F. Pirih was supported by NIH/NIDCR Grant T32 DE-007296-08.* Corresponding author. Fax: +1 310 206 6485.E-mail addresses: fqpirih@ucla.edu (F.Q. Pirih), taghaloo@ucla.

edu (T.L. Aghaloo), obezougl@ucla.edu (O. Bezouglaia), jnervina@ucla.edu (J.M. Nervina), sotirist@dent.ucla.edu (S. Tetradis).

Opg and RANKL are osteoblastic genes that, respec-tively, inhibit and promote osteoclast differentiationand function [5]. The net result is that the increased boneturnover seen with continuous PTH is weighted towardbone resorption and overall bone loss [6–9]. In contrast,intermittent low PTH exhibits anabolic effects [2,10,11],including increased bone mass [12–14], decreased risk ofbone fracture [14,15], and prevention of bone loss inestrogen deficiency [16]. Despite the well-characterizedeffects on bone homeostasis, PTH�s molecular mecha-nism of action in vivo is still controversial [17–19].

Interestingly, despite intermittent PTH�s robustanabolic effects in vivo, only few successful reports

F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503 495

replicating these invivoeffectshavebeenreportedutilizinginvitro culture systems [20–23].This variability inPTHre-sponses seems todependon the cell type, age,degreeofdif-ferentiation in culture, and growth medium preparations[23,24]. This apparent discrepancy between in vivo andin vitro anabolic PTH effects warrants caution whenutilizing in vitro data to extrapolate in vivo significance.

We have recently reported the PTH induction of thenerve growth factor-inducible factor B (NR4A; NGFI-B) family members utilizing primary mouse osteoblastsand calvaria organ cultures [25–27]. The NR4A familyis composed of three members: Nurr1, Nur77, andNOR-1. The three NR4A members share 90% homol-ogy in their DNA-binding domain and 58–65% homol-ogy in the ligand-binding domain [28]. They bind tothe DNA consensus sequence known as the NGFI-B re-sponse element (NBRE; AAAGGTCA) [29]. Involve-ment of Nurr1 in regulation of osteopontin andosteocalcin gene expression in osteoblasts was reportedrecently [30,31]. Furthermore, Nurr1 and Nur77involvement in vitamin D, retinoic acid, and thyroidhormone signaling has been hypothesized [32].

Based on our data on PTH-induced NR4A geneexpression in osteoblastic and calvariae organ cultures[25–27], and the potential involvement of NR4A genesin secondary osteoblastic gene expression [30,31], weinvestigated whether PTH induced expression of NR4Agenes in classic target tissues in vivo. We report here thatPTH injections rapidly and transiently induced expres-sion of all NR4A genes in PTH-target tissues in vivo,with maximum induction between 0.5 and 1 h. Thisinduction was mediated primarily through the cAMP-PKA pathway. The in vivo induction was faster andmore transient when compared to in vitro induction inprimary mouse osteoblast (MOB) cultures. Both in vivoand in vitro, NR4A gene induction was at least partlymediated by activation of NR4AmRNA synthesis. Theirin vivo induction supports NR4A gene involvement in,at least some, of the PTH effects on bone metabolism.

Materials and methods

Reagents. All reagents were purchased from Sigma (Saint Louis,MO). Bovine PTH (1–34) fragment was used for all experiments except

Table 1Primers used for PCR assays

Primer Forward

Nurr1 exon/exon GATGAGTGGAGATGATACCCNur77 exon/exon GGTGTTGATGTTCCCGCCTTNOR-1 exon/exon GAACTCAAGCCCTCCTGCCTGAPDH exon/exon ATTGTCAGCAATGCATCCTGNurr1 intron/exon GGTCAGAGAGAGGTTTANur77 intron/exon TTAGAACAGTGTGGAGCNOR-1 exon/intron CGACAACGCTGCCTGCCAOsteocalcin exon/exon TCTCTCTGACCTCACAGATGCCOsteopontin exon/exon CCATCTCAGAAGCAGAATCTCC

for the PTH analog experiment, where amide bovine PTH (3–34) wasused.

Animals and cell culture. Primary calvariae osteoblasts from 7-day-old CD-1 neonatal mice (Charles River Laboratories, Boston, MA)were collected and maintained in culture as previously described [25].For in vivo studies 1-, 3-, and 5-month-old CD-1 mice (Charles RiverLaboratories, Boston, MA) received i.p. injections of vehicle or PTHand were sacrificed at different time points. Animals used in this studywere sacrificed according to the protocol approved by the UCLAAnimal Research Committee.

RNA extraction. For in vitro experiments, total RNA extractionwas performed using Trizol reagent (Life Technologies, Grand Island,NY) according to the manufacturer�s protocol.

For in vivo experiments, following treatment, sacrifice, and tissuecollection, kidney, heart, liver, and brain were frozen immediately indry ice and stored at �80 �C. Calvariae and long bone were kept inRNA Later (Ambion, Austin, TX) at 4 �C overnight. The followingday, total RNA was extracted from each tissue using Trizol reagentaccording to manufacturer�s protocol. PTH induction of NR4A geneswas observed only in bones and kidney, while the remaining tissues didnot demonstrate a PTH-induced NR4A gene expression (data notshown).

Semi-quantitative reverse transcriptase-polymerase chain reaction

(SQ-RT-PCR). Three micrograms of total RNA was reverse-tran-scribed with RNA-dependent polymerase Moloney murine leukemiavirus (Promega, Madison, WI) according to manufacturer�s protocol.The semi-quantitative PCR contained 1.5 ll cDNA, 1· PCR buffer,1.5 mM magnesium chloride, 1.5 U Taq DNA polymerase (Promega),1 lCi [a32P]dCTP, and 0.5 lg primers specific to each NR4A gene orGAPDH (Table 1). The amplification program was set for one cycle of94 �C for 3 min, 23 cycles for NR4A genes and 17 cycles for GAPDHof 94 �C for 45 s, 54 �C for 20 s, 72 �C for 30 s, and one cycle at 72 �Cfor 5 min.

PCR products were resolved by 7% PAGE. Gel was dried andexposed to X-Omat film. Quantitation was determined by phosphor-imaging (Molecular Dynamics, Sunnyvale, CA) using ImageQuantsoftware. Intensity of NR4A bands was normalized to GAPDH and tothe number of cytosine nucleotides in the PCR amplicon (Nur77 58,Nurr1 55, and NOR-1 69). Data are presented as percent maximuminduction of the most highly induced NR4A gene.

Real-time PCR. One microliter (1 ng) of reverse-transcribed prod-uct was amplified with iQ SYBR Green master mix (Bio-Rad, Her-cules, CA) and osteopontin, osteocalcin, or GAPDH specific primers(Table 1) using the iCycler System and iCycler iQ Optical Systemsoftware (Bio-Rad). Osteopontin and osteocalcin primers used areincluded in Table 1. The amplification program was set for 1 cycle of95 �C for 3 min followed by 45 cycles of 95 �C, 30 s; 60 �C, 20 s; and72 �C, 30 s. Relative osteopontin and osteocalcin induction wasdetermined by the 2�DDCt method using GAPDH for normalization[33].

Statistical analysis. Data were analyzed using one-way ANOVAand Dunnett�s multiple comparison test or two-way ANOVA andBonferroni post test.

Reverse Size (bp)

CAGGTCAGCAAAGCCAGGGA 89GACAGCTAGCAATGCGATTCT 115CTGCTGTTGCTGGTGGTGGT 118ATGGACTGT GGTCATGAGCC 102CAGGTCAGCAAAGCCAGGGA 253GACAGCTAGCAATGCGATTCT 250TTACACCCACTTAGATGC 143TACCTTATTGCCCTCCTGCTTG 80ATCGTCATCATCGTCGTCCC 132

496 F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503

Results

PTH induced NR4A gene mRNA expression in calvaria,

long bone, and kidney

To determine whether PTH induces NR4A membersin vivo, 30-day-old male mice received a single i.p.injection of vehicle or 80 lg/kg PTH. When given dai-ly, single i.p. injections of PTH are anabolic in vivo[18,34]. Tissues were collected at 0–6 h. In calvaria,long bone, and kidney, mRNA levels for all NR4Agenes peaked at 0.5–1 h, returned to basal levels within2 h after PTH injection (Fig. 1), and remained at basallevels for the next 4 h (data not shown). Nur77 demon-strated the highest expression level in all tissues, fol-lowed, in order, by Nurr1 and NOR-1. Nurr1expression was more prominent in calvariae and longbones than in kidney.

Fig. 1. Time course of PTH induced NR4A gene expression in vivo.Mice were sacrificed 0–2 h after a single i.p. injection of PTH (80 lg/kg). Representative SQ-RT-PCR of NR4A genes in (A) calvaria, (C)long bone, and (E) kidney. Quantitation of normalized experiments for(B) calvaria, (D) long bones, and (F) kidney. Data are means ± SEMfor at least three experiments. *p < 0.05 compared to respective 0 h.+p < 0.05 compared to respective NOR-1 time point. #p < 0.05compared to respective Nurr1 time point.

mRNA expression of NR4A genes was detectable at

10 lg/kg PTH

To test the dose response of NR4A gene induction inbone, 30-day-old male mice received a single i.p. injec-tion of various PTH doses. Tissues were collected 0.5 hafter injection. In calvaria and long bones, PTH-in-duced expression of each NR4A gene was detectableat 10 lg/kg with maximum induction at 40–80 lg/kg(Fig. 2). Nur77 demonstrated the highest induction fol-lowed by Nurr1 and NOR-1. In the kidney, only Nur77and Nurr1 induction was statistically significant at10 lg/kg. However, all three NR4A genes were signifi-cantly induced in all three tissues at 40 and 80 lg/kg.

PTH induced NR4A gene expression mainly through the

cAMP-PKA pathway

PTH binds to the PTHR1 receptor and activatescAMP-PKA, protein kinase C (PKC), and calcium path-ways [35,36]. We have previously demonstrated that thePTH-induced NR4A member expression in vitro is

Fig. 2. Dose response of PTH induced NR4A gene expression in vivo.Mice were sacrificed 30 min after a single i.p. injection of PTH 0–80 lg/kg. Representative SQ-RT-PCR of NR4A genes in (A) calvaria,(C) long bone, and (E) kidney. Quantitation of normalized data fromthree experiments for (B) calvaria, (D) long bones, and (F) kidney.Data are means ± SEM for at least three experiments. *p < 0.05compared to respective 0 h. +p < 0.05 compared to respective NOR-1time point. #p < 0.05 compared to respective Nurr1 time point.

Fig. 3. PTH induced NR4A gene expression primarily through cAMP signaling. Mice were sacrificed 30 min after a single i.p. injection of vehicle,80 lg/kg PTH (1–34) or 10–80 lg/kg PTH (3–34). Representative SQ-RT-PCR of NR4A genes in (A) calvaria, (C) long bone, and (E) kidney.Quantitation of normalized data from three experiments for (B) calvaria, (D) long bones, and (F) kidney. Data are means ± SEM for at least threeexperiments *p < 0.05 compared to control.

Fig. 4. PTH similarly induced NR4A gene expression in mice ofvarious ages. One-, 3-, and 5-month-old mice received a single i.p.injection of PTH (80 lg/kg) and were sacrificed after 0–2 h. SQ-RT-PCR of NR4A members and GAPDH from calvaria is shown. Similardata were obtained using total RNA extracted from long bone andkidney (data not shown).

F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503 497

primarily mediated through cAMP-PKA signaling [25–27]. To delineate which pathway mediates PTH-inducedNR4A gene expression in vivo, 30-day-old mice receiveda single i.p. injection of 80 lg/kg PTH (1–34) or 10–80 lg/kg PTH (3–34) and were sacrificed 0.5 h after injection.Deletion of the two N-terminal amino acids abolishesPTH�s ability to activate cAMP/PKA pathway, but re-tains the activation of PKC and calcium pathways [37].PTH (3–34) at all doses failed to induce NR4Amembers�mRNA levels in calvaria, long bone, and kidney (Fig. 3).

PTH similarly induced expression of NR4A genes at

different ages

To determine if age affects PTH-induced NR4AmRNA expression, 1-, 3-, and 5-month-old mice re-ceived a single i.p. injection of 80 lg/kg PTH for0–2 h. In calvariae (Fig. 4), long bones, and kidney (data

not shown), PTH induced a similar pattern of NR4AmRNA levels in all three genes with peak induction be-tween 0.5 and 1 h, and return to baseline by 2 h.

498 F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503

PTH-induced NR4A expression is more rapid and

transient in vivo vs. in vitro

PTH induced expression of NR4A genes in vivo (Fig.1) and in vitro [25–27]. To determine if the magnitudeand pattern of PTH-induced NR4A mRNA geneexpression varies in vitro vs. in vivo, we performedSQ-RT-PCR utilizing PTH doses that confer maximumNR4A induction (10 nM PTH in vitro [25–27] and80 lg/kg in vivo) (Fig. 2). Maximal PTH inductionwas comparable between in vitro vs. in vivo. However,in vivo NR4A mRNA levels peaked and returned tobaseline faster when compared to those in vitro (Fig. 5).

PTH-induced NR4A gene expression both in vivo and in

vitro is mediated partly through transcriptional activation

To determine whether the increased NR4A mRNAlevels in PTH-treated mice or in cultured osteoblastswere due to increased mRNA synthesis, SQ-RT-PCRwas performed using primers that correspond to exon–intron boundaries of the NR4A genes to amplify nuclearpre-mRNA molecules. Pre-mRNA processing, including5 0 end capping, polyadenylation and, importantly, splic-ing, occurs while the nascent RNA chain is being synthe-sized [38,39]. Thus, pre-mRNA amplification has beenused to determine the rate of RNA synthesis and reflecttranscriptional activation in various systems [40–42].Thirty-day-old male mice received a single i.p. injectionof 80 lg/kg PTH and total RNA was extracted from cal-variae 0 to 4 h after injection. In addition, confluent

Fig. 5. PTH induction of NR4A genes is faster and more transient in vivo vs(80 lg/kg). MOBs were cultured with 10 nM PTH for 0–4 h. SQ-RT-PCR of Ndata for Nur77 (B), Nurr1 (C), and NOR-1 (D). Data are means ± SEM fo

MOB cells were treated with 10 nM PTH for 0–4 hand then total RNA was extracted. PTH induced Nurr1,Nur77, and NOR-1 pre-mRNA at 0–0.5 h (Fig. 6). Asexpected, pre-mRNA levels peaked earlier than mRNAlevels (compare Figs. 5 and 6). Interestingly, while invivo pre-mRNA levels returned to baseline at 1 h forall NR4A genes, in vitro NR4A pre-mRNA levels re-mained above control for 1 h for Nur77 and for 2 hfor Nurr1 and NOR-1.

One week intermittent PTH induced osteocalcin and

osteopontin gene expression

Since Nurr1 enhances osteocalcin and osteopontinpromoter activity [30,31], we examined the osteocalcinand osteopontin mRNA expression following 1 weekof intermittent PTH administration. Mice received adaily injection of vehicle or 80 lg/kg PTH for 1 week.Then, total RNA from calvariae or long bones was ex-tracted, reverse-transcribed, and subjected to real-timePCR analyses utilizing osteocalcin, osteopontin, andGAPDH specific primers. In calvaria, both osteocalcinand osteopontin were significantly induced after 1 weekintermittent PTH, while in long bone only osteopontinwas significantly increased (Fig. 7).

Discussion

We report here that all three members of the NR4Anuclear orphan receptor family—Nurr1, Nur77, and

. in vitro. Mice were sacrificed 0–4 h after a single i.p. injection of PTHR4A members and GAPDH is shown (A). Quantitation of normalizedr at least three experiments *p < 0.05 compared to respective 0 h.

Fig. 6. PTH induces pre-mRNA levels of all NR4A genes in vivo and in vitro. Mice were sacrificed 0–4 h after a single i.p. injection of PTH (80 lg/kg). MOBs were cultured with 10 nM PTH for 0–4 h. SQ-RT-PCR of NR4A members was performed by utilizing primers that amplified exon–intronboundaries of pre-mRNA molecules (A). Quantitation of normalized data from three experiments for Nur77 (B), Nurr1 (C), and NOR-1 (D).Maximum in vivo and in vitro PTH induction was set as 100%. Data are means ± SEM for at least three experiments. *p < 0.05 compared torespective control.

F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503 499

NOR-1—are rapidly and transiently induced by a singlePTH injection in target tissues in vivo. PTH-inducedNR4A gene expression in vivo was mediated primarilythrough the cAMP-PKA pathway. These results are inagreement with our previously published data thatPTH induces NR4A members in osteoblast culturesmainly through the cAMP/PKA pathway [25–27].

NR4A members were induced in mice at 0.5–1 hreturning to basal levels by 2 h after a single i.p. injec-tion of 80 lg/kg PTH (Fig. 1). These results are compa-rable to the in vivo induction of c-fos, jun-b, c-jun, andfra-2 in mice [17], and to UBP41 and ADAMTS in rats[43,44]. In contrast, opg message in rats decreased by80% within 1 h and returned to baseline by 3 h [45].

NR4A genes are expressed in several tissues includingtestes, brain, muscle [46–48], adrenal gland, and lung[46]. In addition, they are induced by numerous stimuliincluding growth factors [49], membrane depolarization,nerve growth factor [46,47], cytokines [50], and PMA/ionomycin [51,52]. Not surprisingly then, NR4A geneexpression is activated through different signaling path-ways including PKA, PKC, and MAPK [50,53,54]. Todecipher the signaling pathways that mediate the PTHregulation of NGFI-B gene expression, we utilizedPTH (3–34) as a partial agonist. PTH (3–34) does notactivate protein kinase A but retains its ability to initiatePKC and calcium signaling [37]. PTH (3–34) did not in-duce NR4A gene expression at any dose tested (Fig. 3).This result is consistent with other studies suggestingthat PTH�s actions in vivo are primarily mediated by

protein kinase A pathway [43,44,55]. Nurr1 and NOR-1 induction through this pathway is anticipated becausetheir promoters contain cAMP response elements(CREs) [56–58]. Although, the Nur77 promoter doesnot have a CRE, it has four AP-1 sites that closelyresemble the CRE-binding site [57,59,60]. In addition,PC-12 cells overexpressing a constitutively active formof the transcription factor CREB demonstrated highNur77 expression [61].

mRNA levels of all three NR4A genes peaked earlierand were more transient in vivo vs. in vitro (Fig. 5).This is rather surprising, given that in vitro PTH shouldinitiate signaling cascades almost instantaneously.mRNA levels are determined by the rate of mRNA syn-thesis and mRNA degradation. PTH-induced NR4Agene expression was due, at least in part, to increasein mRNA synthesis, since PTH induced pre-mRNA lev-els of all three genes both in vivo and in vitro (Fig. 6).Interestingly, pre-mRNA levels in vitro peaked at thesame time as in vivo but were sustained at higher levelsfor longer duration. This suggests that PTH causes afaster return to baseline transcription levels in vivo.This faster return potentially explains the observed ear-lier and more transient induction of NR4A mRNA lev-els in vivo vs. in vitro. It is plausible that the temporaldifferences of PTH-induced gene expression, as exempli-fied by the NR4A members, might contribute to thedifficulty in developing an in vitro model system thatrecapitulates the anabolic effect of PTH in vivo[24,62,63]. To date, only few reports of in vitro systems

Fig. 7. Mice received i.p. injections of vehicle or 80 lg/kg PTH for 1week. Total RNA from calvariae or long bones was isolated andsubjected to real-time PCR utilizing osteocalcin, osteopontin, orGAPDH specific primers. Quantitation of normalized experiments isshown. Data are means ± SEM of four experiments. *p < 0.05compared to vehicle.

500 F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503

mimic PTH�s anabolic effects on osteoblastic function[20–23].

NR4A genes are involved in a wide variety of biolog-ical functions including cellular proliferation, differenti-ation, and apoptosis [51,52,64–66]. Nur77 plays a role inregulating the hypothalamus–pituitary–adrenal (HPA)-axis [67,68], Nurr1 and Nur77 affect adrenal aldosteroneproduction [69], and Nur77 and NOR-1 are involved inT-cells and thymocyte apoptosis [51,52,64].

Nur77-deficient mice are phenotypically normal de-spite Nur77�s regulatory role in the HPA-axis [67,68].One possible explanation for this is that Nurr1 compen-sates for Nur77 deletion. Indeed, Nurr1 levels in theNur77-deficient adrenal glands are upregulated three-fold after lipopolysaccharide administration [70,71].This compensation appears to be unidirectional asNurr1-deficient mice lack normal development of mid-brain dopaminergic neurons and die soon after birth[66]. Two strikingly different lines of NOR-1 knockoutmice have been generated. In one, deletion of the

20-amino acids upstream of NOR-1�s DNA-bindingdomain produces an inner ear defect [65]. In the other,loss of 37% of the N-terminal transactivation and firstzinc finger domains produces early embryonic lethalitydue to disruption of primitive streak formation [72].

Although no overt skeletal phenotype is apparent inany of the single NR4A knockout mice, our confirma-tion that NR4A genes are PTH-induced in vivo suggeststhat these nuclear orphan receptors nonetheless partici-pate in PTH-induced late gene expression. Indeed, com-puter analysis reveals potential NGFI-B responseelements (NBREs) in promoters of several osteoblastgenes including alkaline phosphatase, bone sialoprotein,osteocalcin, type I (a)1 and type I (a)2 collagen, insulingrowth factor I, and collagenase [31]. Importantly, re-cent studies have demonstrated that the promoters ofosteopontin and osteocalcin genes contain NBREs andthat Nurr1 binds to these sites and regulates the activityof these promoters in osteoblastic cells [30,31]. In agree-ment with these in vitro studies, 1 week intermittentPTH treatment significantly increased osteocalcin andosteopontin mRNA levels in calvaria and osteopontinmRNA levels in long bones. Although 1 week intermit-tent PTH did not increase osteocalcin expression in longbones, Dobnig and Turner [73] had reported that ovari-ectomized female rats had a significant increase in oste-ocalcin mRNA expression in long bone following 1week of intermittent PTH. In addition, Iida-Klein etal. [74] have demonstrated an increase in osteocalcinafter 3 weeks of PTH treatment. Additionally, Nurr1and Nur77 heterodimerize with RXR, a specific receptorfor 9-cis-retinoic acid [32]. RXR is a transcriptionalpartner with several nuclear receptors including vitaminD and thyroid hormone [75], which are important forskeletal development and osteoblastic function [76,77].Taken together, these data suggest that NR4A nuclearreceptors may target important genes that affect osteo-blast differentiation and function.

In conclusion, we demonstrate that a single PTHinjection rapidly and transiently induced expression ofall NR4A members in target tissues in vivo. This induc-tion appears to be mediated mainly through activationof cAMP-PKA signaling and at least in part by increasein NR4A mRNA synthesis. In light of these and recentlypublished data of Nurr1 regulation of osteoblastic geneexpression [30,31], we hypothesize that NR4A genesmay be critical mediators of PTH�s downstream effectson osteoblasts.

References

[1] S. Lotinun, J.D. Sibonga, R.T. Turner, Differential effects ofintermittent and continuous administration of parathyroid hor-mone on bone histomorphometry and gene expression, Endocrine17 (2002) 29–36.

F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503 501

[2] R. Podbesek, C. Edouard, P.J. Meunier, J.A. Parsons, J. Reeve,R.W. Stevenson, J.M. Zanelli, Effects of two treatment regimeswith synthetic human parathyroid hormone fragment on boneformation and the tissue balance of trabecular bone in grey-hounds, Endocrinology 112 (1983) 1000–1006.

[3] P.H. Watson, L.J. Fraher, M. Kisiel, D. DeSousa, G. Hendy,A.B. Hodsman, Enhanced osteoblast development after continu-ous infusion of hPTH(1–84) in the rat, Bone 24 (1999) 89–94.

[4] Y.L. Ma, R.L. Cain, D.L. Halladay, X. Yang, Q. Zeng, R.R.Miles, S. Chandrasekhar, T.J. Martin, J.E. Onyia, Cataboliceffects of continuous human PTH (1–38) in vivo is associated withsustained stimulation of RANKL and inhibition of osteoproteg-erin and gene-associated bone formation, Endocrinology 142(2001) 4047–4054.

[5] Y. Wittrant, S. Theoleyre, C. Chipoy, M. Padrines, F. Blanchard,D. Heymann, F. Redini, RANKL/RANK/OPG: new therapeutictargets in bone tumours and associated osteolysis, Biochim.Biophys. Acta 1704 (2004) 49–57.

[6] S. Lotinun, G.L. Evans, J.T. Bronk, M.E. Bolander, T.J.Wronski, E.L. Ritman, R.T. Turner, Continuous parathyroidhormone induces cortical porosity in the rat: effects on boneturnover and mechanical properties, J. Bone Miner. Res. 19 (2004)1165–1171.

[7] R. Kitazawa, Y. Imai, M. Fukase, T. Fujita, Effects of continuousinfusion of parathyroid hormone and parathyroid hormone-related peptide on rat bone in vivo: comparative study byhistomorphometry, Bone Miner. 12 (1991) 157–166.

[8] H.H. Malluche, D. Sherman, W. Meyer, E. Ritz, A.W. Norman,S.G. Massry, Effects of long-term infusion of physiologic doses of1–34 PTH on bone, Am. J. Physiol. 242 (1982) F197–F201.

[9] C.S. Tam, J.N. Heersche, T.M. Murray, J.A. Parsons, Parathy-roid hormone stimulates the bone apposition rate independentlyof its resorptive action: differential effects of intermittent andcontinuous administration, Endocrinology 110 (1982) 506–512.

[10] C.P. Jerome, D.B. Burr, T. Van Bibber, J.M. Hock, R.Brommage, Treatment with human parathyroid hormone (1–34)for 18 months increases cancellous bone volume and improvestrabecular architecture in ovariectomized cynomolgus monkeys(Macaca fascicularis), Bone 28 (2001) 150–159.

[11] M.R. Rubin, J.P. Bilezikian, New anabolic therapies in osteopo-rosis, Curr. Opin. Rheumatol. 14 (2002) 433–440.

[12] J.M. Hock, I. Gera, Effects of continuous and intermittentadministration and inhibition of resorption on the anabolicresponse of bone to parathyroid hormone, J. Bone Miner. Res.7 (1992) 65–72.

[13] J.M. Alexander, I. Bab, S. Fish, R. Muller, T. Uchiyama, G.Gronowicz, M. Nahounou, Q. Zhao, D.W. White, M. Chorev,D. Gazit, M. Rosenblatt, Human parathyroid hormone 1–34reverses bone loss in ovariectomized mice, J. Bone Miner. Res. 16(2001) 1665–1673.

[14] R. Lindsay, J. Nieves, C. Formica, E. Henneman, L. Woelfert, V.Shen, D. Dempster, F. Cosman, Randomised controlled study ofeffect of parathyroid hormone on vertebral-bone mass andfracture incidence among postmenopausal women on oestrogenwith osteoporosis, Lancet 350 (1997) 550–555.

[15] D.W. Dempster, F. Cosman, E.S. Kurland, H. Zhou, J. Nieves,L. Woelfert, E. Shane, K. Plavetic, R. Muller, J. Bilezikian, R.Lindsay, Effects of daily treatment with parathyroid hormone onbone microarchitecture and turnover in patients with osteoporo-sis: a paired biopsy study, J. Bone Miner. Res. 16 (2001) 1846–1853.

[16] J.S. Finkelstein, A. Klibanski, E.H. Schaefer, M.D. Hornstein, I.Schiff, R.M. Neer, Parathyroid hormone for the prevention ofbone loss induced by estrogen deficiency, N. Engl. J. Med. 331(1994) 1618–1623.

[17] D. Stanislaus, V. Devanarayan, J.M. Hock, In vivo comparisonof activated protein-1 gene activation in response to human

parathyroid hormone (hPTH)(1–34) and hPTH(1–84) in the distalfemur metaphyses of young mice, Bone 27 (2000) 819–826.

[18] E. Kaiser, M. Sato, J.E. Onyia, S. Chandrasekhar, Parathyroidhormone (1–34) regulates integrin expression in vivo in ratosteoblasts, J. Cell. Biochem. 83 (2001) 617–630.

[19] P. McClelland, J.E. Onyia, R.R. Miles, Y. Tu, J. Liang, A.K.Harvey, S. Chandrasekhar, J.M. Hock, J.P. Bidwell, Intermittentadministration of parathyroid hormone (1–34) stimulates matrixmetalloproteinase-9 (MMP-9) expression in rat long bone, J. Cell.Biochem. 70 (1998) 391–401.

[20] C.G. Bellows, H. Ishida, J.E. Aubin, J.N. Heersche, Parathyroidhormone reversibly suppresses the differentiation of osteoprogen-itor cells into functional osteoblasts, Endocrinology 127 (1990)3111–3116.

[21] R.M. Locklin, S. Khosla, R.T. Turner, B.L. Riggs, Mediators ofthe biphasic responses of bone to intermittent and continuouslyadministered parathyroid hormone, J. Cell. Biochem. 89 (2003)180–190.

[22] E. Canalis, M. Centrella, W. Burch, T.L. McCarthy, Insulin-like growth factor I mediates selective anabolic effects ofparathyroid hormone in bone cultures, J. Clin. Invest. 83(1989) 60–65.

[23] P.C. Schiller, G. D�Ippolito, B.A. Roos, G.A. Howard, Anabolicor catabolic responses of MC3T3-E1 osteoblastic cells to para-thyroid hormone depend on time and duration of treatment, J.Bone Miner. Res. 14 (1999) 1504–1512.

[24] D.W. Dempster, F. Cosman, M. Parisien, V. Shen, R. Lindsay,Anabolic actions of parathyroid hormone on bone, Endocr. Rev.14 (1993) 690–709.

[25] S. Tetradis, O. Bezouglaia, A. Tsingotjidou, Parathyroid hormoneinduces expression of the nuclear orphan receptor Nurr1 in bonecells, Endocrinology 142 (2001) 663–670.

[26] S. Tetradis, O. Bezouglaia, A. Tsingotjidou, A. Vila, Regulationof the nuclear orphan receptor Nur77 in bone by parathyroidhormone, Biochem. Biophys. Res. Commun. 281 (2001) 913–916.

[27] F.Q. Pirih, J.M. Nervina, L. Pham, T. Aghaloo, S. Tetradis,Parathyroid hormone induces the nuclear orphan receptor NOR-1in osteoblasts, Biochem. Biophys. Res. Commun. 306 (2003) 144–150.

[28] K. Maruyama, T. Tsukada, N. Ohkura, S. Bandoh, T. Hosono,K. Yamaguchi, The NGFI-B subfamily of the nuclear receptorsuperfamily (review), Int. J. Oncol. 12 (1998) 1237–1243.

[29] T.E. Wilson, T.J. Fahrner, M. Johnston, J. Milbrandt, Identifi-cation of the DNA binding site for NGFI-B by genetic selection inyeast, Science 252 (1991) 1296–1300.

[30] J. Lammi, J. Huppunen, P. Aarnisalo, Regulation of the osteo-pontin gene by the orphan nuclear receptor NURR1 in osteo-blasts, Mol. Endocrinol. 18 (2004) 1546–1557.

[31] F.Q. Pirih, A. Tang, I.C. Ozkurt, J.M. Nervina, S. Tetradis,Nuclear orphan receptor Nurr1 directly transactivates theosteocalcin gene in osteoblasts, J. Biol. Chem. 279 (2004)53167–53174.

[32] T. Perlmann, L. Jansson, A novel pathway for vitamin Asignaling mediated by RXR heterodimerization with NGFI-Band NURR1, Genes Dev. 9 (1995) 769–782.

[33] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(�Delta DeltaC(T)) method, Methods 25 (2001) 402–408.

[34] J.E. Onyia, J. Bidwell, J. Herring, J. Hulman, J.M. Hock, In vivo,human parathyroid hormone fragment (hPTH 1–34) transientlystimulates immediate early response gene expression, but notproliferation, in trabecular bone cells of young rats, Bone 17(1995) 479–484.

[35] A. Fujimori, S.L. Cheng, L.V. Avioli, R. Civitelli, Structure–function relationship of parathyroid hormone: activation ofphospholipase-C, protein kinase-A and -C in osteosarcoma cells,Endocrinology 130 (1992) 29–36.

502 F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503

[36] A.B. Abou-Samra, H. Juppner, T. Force, M.W. Freeman, X.F.Kong, E. Schipani, P. Urena, J. Richards, J.V. Bonventre, J.T.Potts Jr., et al., Expression cloning of a common receptor forparathyroid hormone and parathyroid hormone-related peptidefrom rat osteoblast-like cells: a single receptor stimulates intra-cellular accumulation of both cAMP and inositol trisphosphatesand increases intracellular free calcium, Proc. Natl. Acad. Sci.USA 89 (1992) 2732–2736.

[37] A. Fujimori, S.L. Cheng, L.V. Avioli, R. Civitelli, Dissociationof second messenger activation by parathyroid hormone frag-ments in osteosarcoma cells, Endocrinology 128 (1991) 3032–3039.

[38] M.S. Jurica, M.J. Moore, Pre-mRNA splicing: awash in a sea ofproteins, Mol. Cell 12 (2003) 5–14.

[39] D.A. Zorio, D.L. Bentley, The link between mRNA processingand transcription: communication works both ways, Exp. CellRes. 296 (2004) 91–97.

[40] Y.-F. Huang, J.R. Harrison, J.A. Lorenzo, B.E. Kream, Para-thyroid hormone induces interleukin-6 heterogeneous nuclear andmessenger RNA expression in murine calvarial organ cultures,Bone 23 (1998) 327–332.

[41] S. Rydziel, A.M. Delany, E. Canalis, Insulin-like growth factor Iinhibits the transcription of collagenase 3 in osteoblast cultures, J.Cell. Biochem. 67 (1997) 176–183.

[42] R.S. Gilbert, S.T. Reddy, D.A. Kujubu, W. Xie, S. Luner, H.R.Herschman, Transforming growth factor beta 1 augments mito-gen-induced prostaglandin synthesis and expression of the TIS10/prostaglandin synthase 2 gene both in Swiss 3T3 cells and inmurine embryo fibroblasts, J. Cell. Physiol. 159 (1994) 67–75.

[43] R.R. Miles, J.P. Sluka, D.L. Halladay, R.F. Santerre, L.V. Hale,L. Bloem, S.R. Patanjali, R.J. Galvin, L. Ma, J.M. Hock, J.E.Onyia, Parathyroid hormone (hPTH 1–38) stimulates the expres-sion of UBP41, an ubiquitin-specific protease, in bone, J. Cell.Biochem. 85 (2002) 229–242.

[44] R.R. Miles, J.P. Sluka, D.L. Halladay, R.F. Santerre, L.V. Hale,L. Bloem, K. Thirunavukkarasu, R.J. Galvin, J.M. Hock, J.E.Onyia, ADAMTS-1: A cellular disintegrin and metalloproteasewith thrombospondin motifs is a target for parathyroid hormonein bone, Endocrinology 141 (2000) 4533–4542.

[45] J.E. Onyia, R.R. Miles, X. Yang, D.L. Halladay, J. Hale, A.Glasebrook, D. McClure, G. Seno, L. Churgay, S. Chandrase-khar, T.J. Martin, In vivo demonstration that human parathyroidhormone 1–38 inhibits the expression of osteoprotegerin in bonewith the kinetics of an immediate early gene, J. Bone Miner. Res.15 (2000) 863–871.

[46] J. Milbrandt, Nerve growth factor induces a gene homologous tothe glucocorticoid receptor gene, Neuron 1 (1988) 183–188.

[47] S.W. Law, O.M. Conneely, F.J. DeMayo, B.W. O�Malley,Identification of a new brain-specific transcription factor,NURR1, Mol. Endocrinol. 6 (1992) 2129–2135.

[48] Y. Labelle, J. Zucman, G. Stenman, L.G. Kindblom, J. Knight,C. Turc-Carel, B. Dockhorn-Dworniczak, N. Mandahl, C. Des-maze, M. Peter, et al., Oncogenic conversion of a novel orphannuclear receptor by chromosome translocation, Hum. Mol. Genet.4 (1995) 2219–2226.

[49] T.G. Hazel, D. Nathans, L.F. Lau, A gene inducible by serumgrowth factors encodes a member of the steroid and thyroidhormone receptor superfamily, Proc. Natl. Acad. Sci. USA 85(1988) 8444–8448.

[50] I. Garcia, C. Pipaon, S. Alemany, A. Perez-Castillo, Induction ofNGFI-B gene expression during T cell activation. Role of proteinphosphatases, J. Immunol. 153 (1994) 3417–3425.

[51] J.D. Woronicz, B. Calnan, V. Ngo, A. Winoto, Requirement forthe orphan steroid receptor Nur77 in apoptosis of T-cell hybrid-omas, Nature 367 (1994) 277–281.

[52] J.D. Woronicz, A. Lina, B.J. Calnan, S. Szychowski, L. Cheng,A. Winoto, Regulation of the Nur77 orphan steroid receptor in

activation-induced apoptosis, Mol. Cell. Biol. 15 (1995) 6364–6376.

[53] J.-I. Satoh, Y. Kuroda, The constitutive and inducible expressionof Nurr1, a key regulator of dopaminergic neuronal differentia-tion, in human neural and non-neural cell lines, Neuropathology22 (2002) 219–232.

[54] D. Kovalovsky, D. Refojo, A.C. Liberman, D. Hochbaum, M.P.Pereda, O.A. Coso, G.K. Stalla, F. Holsboer, E. Arzt, Activationand induction of NUR77/NURR1 in corticotrophs by CRH/cAMP: involvement of calcium, protein kinase A, and MAPKpathways, Mol. Endocrinol. 16 (2002) 1638–1651.

[55] R.R. Miles, J.P. Sluka, R.F. Santerre, L.V. Hale, L. Bloem, G.Boguslawski, K. Thirunavukkarasu, J.M. Hock, J.E. Onyia,Dynamic regulation of RGS2 in bone: potential new insights intoparathyroid hormone signaling mechanisms, Endocrinology 141(2000) 28–36.

[56] T. Ohkubo, N. Ohkura, K. Maruyama, K. Sasaki, K. Nagasaki,H. Hanzawa, T. Tsukada, K. Yamaguchi, Early induction ofthe orphan nuclear receptor NOR-1 during cell death of thehuman breast cancer cell line MCF-7, Mol. Cell. Endocrinol. 162(2000) 151–156.

[57] S.O. Castillo, Q. Xiao, M.S. Lyu, C.A. Kozak, V.M. Nikodem,Organization, sequence, chromosomal localization, and promoteridentification of the mouse orphan nuclear receptor Nurr1 gene,Genomics 41 (1997) 250–257.

[58] O. Saucedo-Cardenas, J.D. Quintana-Hau, W.D. Le, M.P. Smidt,J.J. Cox, F. De Mayo, J.P. Burbach, O.M. Conneely, Nurr1 isessential for the induction of the dopaminergic phenotype and thesurvival of ventral mesencephalic late dopaminergic precursorneurons, Proc. Natl. Acad. Sci. USA 95 (1998) 4013–4018.

[59] M.R. Montminy, K.A. Sevarino, J.A. Wagner, G. Mandel, R.H.Goodman, Identification of a cyclic-AMP-responsive elementwithin the rat somatostatin gene, Proc. Natl. Acad. Sci. USA 83(1986) 6682–6686.

[60] M.A. Watson, J. Milbrandt, The NGFI-B gene, a transcription-ally inducible member of the steroid receptor gene superfamily:genomic structure and expression in rat brain after seizureinduction, Mol. Cell. Biol. 9 (1989) 4213–4219.

[61] D.M. Fass, J.E. Butler, R.H. Goodman, Deacetylase activity isrequired for cAMP activation of a subset of CREB target genes, J.Biol. Chem. 278 (2003) 43014–43019.

[62] T. Ishizuya, S. Yokose, M. Hori, T. Noda, T. Suda, S. Yoshiki,A. Yamaguchi, Parathyroid hormone exerts disparate effects onosteoblast differentiation depending on exposure time in ratosteoblastic cells, J. Clin. Invest. 99 (1997) 2961–2970.

[63] Y. Isogai, T. Akatsu, T. Ishizuya, A. Yamaguchi, M. Hori, N.Takahashi, T. Suda, Parathyroid hormone regulates osteoblastdifferentiation positively or negatively depending on the differen-tiation stages, J. Bone Miner. Res. 11 (1996) 1384–1393.

[64] L.E.-C. Cheng, F.K.-M. Chan, D. Cado, A. Winoto, Functionalredundancy of the Nur77 and Nor-1 orphan steroid receptors inT-cell apoptosis, EMBO J. 16 (1997) 1865–1875.

[65] T. Ponnio, Q. Burton, F.A. Pereira, D.K. Wu, O.M. Conneely,The nuclear receptor Nor-1 is essential for proliferation of thesemicircular canals of the mouse inner ear, Mol. Cell. Biol. 22(2002) 935–945.

[66] R.H. Zetterstrom, L. Solomin, L. Jansson, B.J. Hoffer, L. Olson,T. Perlmann, Dopamine neuron agenesis in Nurr1-deficient mice,Science 276 (1997) 248–250.

[67] A. Philips, S. Lesage, R. Gingras, M. Maira, Y. Gauthier, P.Hugo, J. Drouin, Novel dimeric Nur77 signaling mechanism inendocrine and lymphoid cells, Mol. Cell. Biol. 17 (1997) 5946–5951.

[68] A. Philips, M. Maira, A. Mullick, M. Chamberland, S. Lesage,P. Hugo, J. Drouin, Antagonism between Nur77 and glucocor-ticoid receptor for control of transcription, Mol. Cell. Biol. 17(1997) 5952–5959.

F.Q. Pirih et al. / Biochemical and Biophysical Research Communications 332 (2005) 494–503 503

[69] M.H. Bassett, T. Suzuki, H. Sasano, P.C. White, W.E. Rainey,The orphan nuclear receptors NURR1 and NGFIB regulateadrenal aldosterone production, Mol. Endocrinol. 18 (2004) 279–290.

[70] S.L. Lee, R.L. Wesselschmidt, G.P. Linette, O. Kanagawa, J.H.Russell, J. Milbrandt, Unimpaired thymic and peripheral T celldeath in mice lacking the nuclear receptor NGFI-B (Nur77),Science 269 (1995) 532–535.

[71] P.A. Crawford, Y. Sadovsky, K. Woodson, S.L. Lee, J. Mil-brandt, Adrenocortical function and regulation of the steroid 21-hydroxylase gene in NGFI-B-deficient mice, Mol. Cell. Biol. 15(1995) 4331–4336.

[72] R.A. DeYoung, J.C. Baker, D. Cado, A. Winoto, The orphansteroid receptor Nur77 family member Nor-1 is essential for earlymouse embryogenesis, J. Biol. Chem. 278 (2003) 47104–47109.

[73] H. Dobnig, R.T. Turner, Evidence that intermittent treatmentwith parathyroid hormone increases bone formation in adult rats

by activation of bone lining cells, Endocrinology 136 (1995) 3632–3638.

[74] A. Iida-Klein, H. Zhou, S.S. Lu, L.R. Levine, M. Ducayen-Knowles, D.W. Dempster, J. Nieves, R. Lindsay, Anabolic actionof parathyroid hormone is skeletal site specific at the tissue andcellular levels in mice, J. Bone Miner. Res. 17 (2002) 808–816.

[75] V. Giguere, Orphan nuclear receptors: from gene to function,Endocr. Rev. 20 (1999) 689–725.

[76] G.R. Williams, R. Bland, M.C. Sheppard, Retinoids modifyregulation of endogenous gene expression by vitamin D3 andthyroid hormone in three osteosarcoma cell lines, Endocrinology136 (1995) 4304–4314.

[77] N. Yagishita, Y. Yamamoto, T. Yoshizawa, K. Sekine, Y.Uematsu, H. Murayama, Y. Nagai, W. Krezel, P. Chambon, T.Matsumoto, S. Kato, Aberrant growth plate development inVDR/RXR{gamma} double null mutant mice, Endocrinology142 (2001) 5332–5341.