View
216
Download
0
Category
Preview:
Citation preview
8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
1/38
and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
The Author 2012. Published by Oxford University Press on behalf of the Society for Molecular Biology
1
An ancestral miR-1304 allele present in Neanderthals regulates genes involved
in enamel formation and could explain dental differences with modern humans
Paper submitted as Research Article
Maria Lopez-Valenzuela1, Oscar Ramrez1, Antonio Rosas2, Samuel Garca-Vargas2,
Marco de la Rasilla3, Carles Lalueza-Fox1 and Yolanda Espinosa-Parrilla1
1Institut de Biologia Evolutiva (UPF-CSIC), CEXS-UPF-PRBB. C/ Dr. Aiguader, 88,
08003 Barcelona, Catalonia, Spain
2Paleoanthropology Group, Department of Paleobiology, Museo Nacional de
Ciencias Naturales, CSIC. C/ Jos Gutierrez Abascal, 2, 28006 Madrid, Spain
3rea de Prehistoria, Departamento de Historia, Universidad de Oviedo. C/ Teniente
Alfonso Martnez s/n. 33011 Oviedo, Spain
Corresponding author: Yolanda Espinosa-Parrilla. Institut de Biologia Evolutiva
(UPF-CSIC), CEXS-UPF-PRBB. C/ Dr. Aiguader, 88, 08003, Barcelona, Spain. Tel:
+34 93 316 0845. Fax: +34 93 316 0901. E-mail: yolespinosa@gmail.com
Keywords: Neanderthal, gene regulation, miR-SNP, microRNA, miR-1304, tooth
development
Running Head: An ancestral miR-1304 allele regulates dental genes
MBE Advance Access published January 27, 2012
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
2/38
2
ABSTRACT
Genetic changes in regulatory elements are likely to result in phenotypic effects that
might explain population-specific as well as species-specific traits. MicroRNAs are
post-transcriptional repressors involved in the control of almost every biological
process. These small non-coding RNAs are present in various phylogenetic groups
and a large number of them remain highly conserved at the sequence level.
MicroRNA-mediated regulation depends on perfect matching between the 7
nucleotides of its seed region and the target sequence usually located at the 3'UTR
of the regulated gene. Hence, even single changes in seed regions are predicted to
be deleterious as they may affect microRNA target specificity. In accordance to this,
purifying selection has strongly acted on these regions. Comparison between the
genomes of present-day humans from various populations, Neanderthal and other
non-human primates showed a microRNA, miR-1304, that carries a polymorphism on
its seed region. The ancestral allele is found in Neanderthal, non-human primates, at
low frequency (~5%) in modern Asian populations and rarely in Africans. Using
microRNA target site prediction algorithms we found that the derived allele increases
the number of putative target genes for the derived microRNA more than tenfold,
indicating an important functional evolution for miR-1304. Analysis of the predicted
targets for derived miR-1304 indicates an association with behavior and nervous
system development and function. Two of the predicted target genes for the
ancestral miR-1304 allele are important genes for teeth formation, enamelin and
amelotin. MicroRNA over-expression experiments using a luciferase-based assay
showed that the ancestral version of miR-1304 reduces the enamelin and amelotin
associated reporter gene expression by 50%, whereas the derived miR-1304 does
not have any effect. Deletion of the corresponding target sites for miR-1304 in these
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
3/38
3
dental genes avoided their repression, which further supports their regulation by the
ancestral miR-1304. Morphological studies described several differences in the
dentition of Neanderthals and present-day humans like slower dentition timing and
thicker enamel for present-day humans. The observed miR-1304 mediated-regulation
of enamelin and amelotin could at least partially underlie these differences between
the two Homo species as well as other still-unraveled phenotypic differences among
modern human populations.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
4/38
4
INTRODUCTION
Investigating the genetic differences associated with phenotypic diversity among
hominins is a crucial step towards the understanding of human adaptation and
evolution. Genetic and genomic alterations in regulatory regions are a significant
source of phenotypic diversity underlying important inter-individual and inter-species
differences (Carroll 2008; Hindorff et al. 2009). This record has been recently
confirmed in primates by the discovery that the human loss of specific regulatory
DNA, in particular the loss of non-coding RNA with enhancer function, associates
with the appearance of specific human traits such as the expansion of specific brain
regions (McLean et al. 2011). Increasing evidence supports that allelic changes
involving either microRNAs (miRNAs) or their regulatory machinery are major
contributors to phenotypic diversity in human populations and may thus be important
sources of phenotypic variation and have a role in the pathophysiology of several
disorders (Borel and Antonorakis 2008).
miRNAs are small non-coding RNAs of 1925 nucleotides in length in their mature
form, processed from a longer hairpin structure, that act as post-transcriptional
regulators of gene expression by either mRNA degradation or translational
repression (Krol et al. 2010). It is estimated that miRNAs regulate more than 30% of
all protein-coding genes, building complex regulatory networks that control almost
every cellular process (Filipowicz et al. 2008). miRNAs act by means of partial
complementarity to miRNA binding sites usually located in the 3-UTR regions of their
target genes (Bartel 2004). Perfect complementarity between the target sequence of
the regulated messenger RNA and the so-called seedregion -nucleotides 2 through
7 or 8 from the 5 end of the mature miRNA- is thought to determine successful
binding and, together with the stability of the RNA hybrids, are the basis of many
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
5/38
5
miRNA target site prediction algorithms (Brennecke et al. 2005; Lewis et al. 2005).
Strong purifying selection acts on the mature miRNA and particularly on nucleotides
corresponding to the seed region, where no mutation is tolerated as it would most
likely produce a change in the target spectrum that could give rise to the emergence
of a novel miRNA (Chen and Rajewsky 2006; Liu et al. 2008; Quach et al. 2009).
Conservation of miRNAs through evolution is well documented and has been used
for the discovery of homologous miRNAs across different phylogenetic groups. It is
assumed that conserved miRNA may have high functional relevance and hence
many previous research efforts focused on finding and characterizing those miRNAs
(Grad et al. 2003; Berezikov et al. 2005; Chen and Rajewsky 2006). Nonetheless, the
identification of species-specific miRNAs may help to understand evolutionary
novelties among different phylogenetic groups. Several studies reach the conclusion
that miRNAs are strongly conserved among primates, but still there is a set of
miRNAs that are found only in present-day humans and thus are good candidates to
contribute to human specific phenotypes (Bentwich et al. 2005; Berezikov et al. 2005;
Liu et al. 2008; Brameier 2010; Lin et al. 2010). The first published draft of the
Neanderthal genome revealed that present-day humans differ from Neanderthals by
a nucleotide substitution in the seed region of microRNA miR-1304 (Green el al.
2010) that therefore it is likely to change the spectrum of target genes for miR-1304.
Neanderthals are the closest known evolutionary relatives of modern humans. They
inhabited parts of Europe and Western Asia during a succession of climatic cycles,
exhibiting both behavioural and morphological adaptations probably related to cold
climates, until their extinction around 30,000 years ago (Mellars 2004; Finlayson et
al. 2006). The morphological features that distinguish Neanderthals from other
humans, including specific cranio-facial and dental traits, first appear in the European
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
6/38
6
fossil record around 400,000 years ago (Stringer and Hublin 1999; Hublin 2009).
Estimated from genomic data, these Homo populations diverged between 440,000 to
270,000 years ago (Endicott et al. 2010; Green et al. 2010). The analysis of the
Neanderthal genome has revealed that about 80 protein-coding genes show fixed
amino acid changes between Neanderthals and modern humans (Green et al. 2010).
Phenotypes evolve by functional differences in proteins but also do largely through
mutations in regulatory regions (Carroll 2008); thus it seems clear that genetic
differences related to the distinctive Neanderthal phenotype should not be restricted
to a set of protein coding genes and that the analysis shall be broadened to
incorporate gene regulation as well.
Here we analyze the primate specific miR-1304 by studying genetic variation of the
human miR-1304 locus and the spectrum of target genes predicted for the derived
and ancestral versions of this miRNA. By means of functional studies we show
repression of a cluster of dental genes by the ancestral version of miR-1304
illustrating how a single nucleotide change in a regulatory element may underlie
particular phenotypic differences.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
7/38
7
MATERIAL AND METHODS
Sequencing of chimpanzee miR-1304 and NeanderthalAMTN3UTR
miR-1304 was PCR-amplified from genomic DNA of 3 chimpanzee individuals using
primers listed in supplementary table 1. Eight clones per individual were sequenced
using standard procedures.
The target site for miR-1304 on the 3UTR of the Neanderthal AMTN was PCR-
amplified in a Neanderthal specimen (SD-1253) from El Sidrn site (Asturias, Spain),
and 55 clones were sequenced (supplementary fig 1) following a previously
described methodology (Lalueza-Fox et al. 2007) using specific primers
(supplementary table 1). This bone sample has been used to retrieve ~14,000
protein-coding positions (Krause et al. 2007; Lalueza-Fox et al. 2008, 2009; Burbano
et al. 2010), as well as 0.1% of the nuclear genome (Green et al. 2010) and the
complete mitochondrial genome (Briggs et al. 2009). The degree of contamination
has been estimated to be 0.27-0.29% for the mtDNA and 2% upper bound for
autosomal DNA capture (Krause et al. 2007; Lalueza-Fox et al. 2008); these low
figures render this specimen one of the most suitable Neanderthal samples for
targeted paleogenetic analysis.
Firefly luciferase constructs and Mutagenesis
The 3UTRs of ENAM, AMTN and GAD1 were PCR-amplified from genomic DNA
with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, California), using primers
containing an XbaI restriction site at the 5 end (supplementary table 1). PCR
fragments were later purified, XbaI-digested and cloned into pGL4.13 vector
(Promega, Madison, Wisconsin) downstream of the firefly luciferase reporter gene.
Mutant reporter plasmids were generated as previously described (Muios-Gimeno
et al. 2009) with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla,
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
8/38
8
California), using either the AMTN or ENAM pGL4.13 construct as a template and
primers carrying the desired deletions (supplementary table 1).
Cell culture and transfection
HeLa cells were maintained in Dulbeccos Modified Eagles Medium supplemented
with 10% fetal bovine serum, 100 units/ml penicillin and 100 g/ml Streptomycin
(GIBCO, Invitrogen). Co-transfection optimization has been previously described
(Guidi et al. 2010). Briefly, HeLa cells were seeded at 1.3 x 104 cells/well in 96-well
plates and co-transfected 24 h later with the Firefly reporter constructs described
above or the empty pGL4.13 vector (24 ng), the Renilla reporter plasmid pGL4.75 (3
ng) and 10nM miRNA mimic for derived miR-1304, ancestral miR-1304 and negative
controls #2 and #4 (miRIDIAN, Dharmacon, Lafayette, Colorado) using
Lipofectamine 2000 (Invitrogen).
Luciferase activity assay
The activity of Firefly and Renilla luciferases was determined 24 h after transfection
using the Dual-Glo Luciferase Assay System (Promega). Relative reporter activity
was obtained by normalization to the Renilla luciferase activity. In order to correct for
vector-dependent unspecific effects, each relative reporter activity was normalized to
the empty vector co-transfected with the corresponding miRNA (Guidi et al. 2010).
Results were then compared to the mean of the two negative controls. Each
experiment was done in triplicate and at least three independent experiments were
performed for each miRNA. Statistical significance was determined using Students t
test (p
8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
9/38
9
Computational methods
Targets were predicted using the web-based prediction methods TargetScan
(www.targetscan.org, release 5.1 (Friedman et al. 2009)) and TargetRank
(www.hollywood.mit.edu/targetrank, (Nielsen et al. 2007)) on the human genome
assembly (NCBI36/hg18, March 2006). Genomic coordinates are according to the
following assemblies: Homo sapiens GRCh37/hg19, Pan troglodytes CHIMP2,
Gorilla gorilla gorGor3, Pongo pygmaeus PPYG2, Macaca mulatta MMUL_1.
Sequences, unless sequenced by ourselves, were obtained from the University of
California Santa Cruz (UCSC) Genome Browser (http://www.genome.ucsc.edu) and
Ensembl Genome Browser release 61 (www.ensembl.org). Pathway analysis was
performed with the Ingenuity Pathway Analysis Software (IPA) version 6.3
(www.ingenuity.com). Human genetic variation on miR-1304 was assessed using
genotypes for 1094 individuals in the June 2011 Data Release of the 1000 Genomes
Project (www.1000genomes.org). Exploration for natural selection signatures in the
human genome was performed by the analysis of data from HapMap, using the
UCSC browser, and from the 53 populations of the Human Genome Diversity Panel
(HGDP), using the HGDP selection browser (http://hgdp.uchicago.edu/)(Pickrell et al.
2009).
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
10/38
10
RESULTS
Conservation of miR-1304 among primates
As noted by Green et al (2010), the Neanderthal draft genome sequence differs from
the reference genome of present-day humans in one base in the seed region of the
primate specific miRNA miR-1304 (fig 1). The corresponding genomic sequence for
Neanderthals is GCCTCGA and GCCTCAA for the reference human sequence. We
took advantage of the recently completed genome sequencing of four primates
Macaca mulatta, Pan troglodytes,Gorilla gorilla and Pongo pygmaeus- to compare
primate sequences orthologous to human miR-1304 (fig 1). The sequence alignment
confirmed that the reference human genome bear the derived state at this nucleotide
position while Neanderthal and other non-human primates share the ancestral state.
The rest of the hairpin sequence was identical between Neanderthals and the
reference human genome and showed few changes in the other four primates. In the
case of chimpanzee, the published shotgun assembly (March 2006 Pan_troglodytes-
2.1 6x) showed a deletion of 26 nucleotides together with an insertion that set apart
the two resting parts of the miRNA. To verify the possibility that chimpanzee had lost
this miRNA we sequenced three chimpanzees DNAs and, after analysis of eight
clones per individual, identified a consensus sequence identical to the gorilla miR-
1304 sequence that differs in only one nucleotide position from the ancestral miR-
1304 (fig 1) indicating that chimpanzees likely also have a functional copy of miR-
1304.
Analysis of the genetic variation of miR-1304 in human populations
We checked for genetic variation at the miR-1304 locus among human populations
using the dbSNP database. We found one Single Nucleotide Polymorphism (SNP),
rs79759099, at this particular position in the seed region indicating that this change is
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
11/38
11
not fixed in human populations. Using the new release of the 1000 Genomes Project
(June 2011 data release) with 1094 individuals representing 14 populations
worldwide we found that while all the individuals in the European (GBR, FIN, IBS,
CEU and TSI), Colombian (CLM), Mexican (MXL) and Kenyan (LWK) populations
only presented the derived allele, the ancestral allele of miR-1304 was present as the
minor allele in the Asian Japanese (JPT, MAF=0.067) and Chinese (CHB,
MAF=0.072; CHS, MAF=0.05) populations and, at very low frequency, in the
Yoruban (YRI, MAF=0.028); Puerto Rican (PUR, MAF=0.009) and African American
(ASW, MAF=0.008) populations (supplementary table 2). Furthermore, since this
different allelic distribution could be the result of selective sweeps within recent
human populations we looked for signatures of selection for the derived miR-1304 by
the study and comparison of linkage disequilibrium (integrated haplotype score, iHS),
population differentiation (Fst) and the frequency of rare variants (Tajimas D) along
the genomic region using public data from HapMap and HGDP. However, neither a
significant excess of rare variants nor significant population differentiation indexes
compatibles with a selective sweep were found in the region.
Analysis of target gene predictions for miR-1304
To assess the variation in the target gene spectrum for the ancestral and derived
miR-1304, we used different prediction algorithms based on seed sequence
matching, namely TargetScan and TargetRank. For the ancestral miR-1304,
TargetRank predicted 35 target genes and TargetScan predicted only four genes
(LCORL, RIMBP2, EDF1 and TCF4, the last two being common to both prediction
programs, table 1). A limitation of these predictions is that they were performed on
the modern human genome, thus we checked if predicted target genes had identical
binding sites for the ancestral miR-1304 in the chimpanzee and Neanderthal
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
12/38
8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
13/38
13
putative targets was interesting, particularly given that the best-described differences
between Neanderthals and modern humans are related to cranial and dental traits.
Thus, among the predicted target genes, we focused on the study of the ENAMand
AMTNgenes.
Analysis of the 3UTR region of the ENAMandAMTNgenes in Neanderthal
Because the human genome was used as a reference for predicting the role of the
ancestral variant of miR-1304 in the regulation of ENAMandAMTN, it is necessary
that Neanderthals match humans in the target site sequences for these genes. In the
case of the ENAMNeanderthal gene, the sequence corresponding to the target site
for this miRNA is identical to the modern human sequence and the 3UTR exhibits
only two changes in its vicinity (fig 2A). The first is a C to G substitution
corresponding to a common SNP also present in modern humans (rs7664896)
located seven bp from the seed region binding site. The second is a G to A
nucleotide change, which is among the most common forms of post-mortem DNA
damage and may be considered an artefact induced by cytosine deamination
occurring in the complementary strand (Hofreiter, et al. 2001; Briggs et al. 2007).
Neither of these changes is predicted to interfere with the correct binding of the
miRNA. In the case of the AMTN gene, the sole available read from Vindija
Neanderthal ends up at the beginning of the target sequence for miR-1304 and
displays two G to A nucleotide changes that, as stated before, could be an artifact
due to post-mortem DNA damage (fig 2A). To ascertain if the extinct Homo had a
complete binding site for the ancestral miR-1304 atAMTN3'UTR, we sequenced part
of this region in a Neanderthal specimen (SD-1253) from El Sidrn site (Asturias,
Spain) dated to about 49,000 years ago and extracted under controlled conditions
(Rosas et al. 2006; Lalueza-Fox et al. 2011). The analysis of 55 clones showed that
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
14/38
14
the recognition site for miR-1304 in the AMTN gene is identical in both hominin
groups (supplementary fig 1). The 3'UTRs of ENAM and AMTN are also highly
conserved among other primates studied (chimpanzee, gorilla, orangutan and rhesus
monkey) and all but the rhesus monkey carry the exact matching sequence for the
ancestral miR-1304 seed region (fig 2). Accordingly, the seed region of this version of
miR-1304 presents perfect complementarity with its predicted target site region at the
3UTR of ENAMand AMTN (fig 2B) and might be regulating both dental genes in
Neanderthal as well as in other non-human primates and humans carrying the
ancestral allele of miR-1304.
Functional screening of miR-1304 target sites in ENAMandAMTN
To investigate the interaction between ENAM and AMTN mRNA and the different
versions of miR-1304, functional validation of the predicted ancestral miR-1304 target
site was performed using a dual-luciferase assay in HeLa cells. A luciferease reporter
pGL4.13 construct carrying the 3'UTR of either the ENAMorAMTNgenes was co-
transfected with the corresponding miRNA mimic: ancestral miR-1304, derived miR-
1304 or 2 different control miRNAs. As shown in fig 3A, a statistically significant
reduction of the luciferase activity was observed for ENAM and AMTN when co-
transfected with the ancestral miR-1304 as compared with the modern miR-1304
(p
8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
15/38
15
AMTN pGL4.13 constructs and co-transfected the plasmids with the respective
miRNAs. A statistically significant recovery of the luciferase activity was observed
when the ancestral miR-1304 was co-transfected with the deleted ENAMandAMTN
plasmids in comparison with the wild type constructs, reaching levels of recovery of
about 100% (fig 3B). The observed rescue of the quantitative phenotype further
supports the predicted repression of these two dental genes by this version of miR-
1304.
Analysis of the genetic variation ofENAMandAMTNin human populations
To further characterize the gene-miRNA interaction we analyzed genetic variation on
the ENAM and AMTN miR-1304 target site sequences in present-day populations
using the 1000 Genomes Project data. While we did not find genetic variation in the
target site of AMTN, the ENAM target site harbors the SNP rs117342040 (G/A with A
being the minor allele). Interestingly, the affected nucleotide in the target site of
ENAM is located exactly matching the described change in the miR-1304 seed
region in such a way that the minor allele of rs117342040 would interfere with the
proper binding of the ancestral allele of miR-1304. Moreover, the allele frequencies
for this SNP are differentially distributed among human populations being absent in
European populations, very rare in Africans (one carrier of African origin from Kenya)
and present in about 2.5% of Asian individuals (Supplementary table 2). As this
variant is found in populations where the ancestral version of miR-1304 is also
detected, we studied if they were correlated using and hypergeometric test and
observed that, for the total of 1094 individuals analyzed, our finding of 3 individuals
having both minor alleles was significant (p=0.0162) meaning that there are more
carriers of both minorENAMand miR-1304 alleles than expected by chance.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
16/38
16
DISCUSSION
The main basis of miRNA action is its sequence complementarity with the target
regions of the genes that they regulate. Functional SNPs that create or disrupt these
miRNA target sites have been shown to have diverse phenotypic implications
contributing sometimes to human disease susceptibility (Borel and Antonarakis
2008). Since one miRNA can have multiple targets, SNPs located on the miRNA
regions important for target recognition would be expected to exhibit a broader
biological effect than SNPs on the target sequences. So far, very few functional
variants in miRNA genes have been described and only a small number of studies
have been devoted to describe their functional consequences (Jazdzewski K et al.
2008; Sun et al. 2009; Vinci et al. 2011).
Analysis of the Neanderthal genome sequence led to the detection of a miRNA, miR-
1304, that differs from the reference human miR-1304 sequence at one nucleotide
position in the seed region (Green et al. 2010). Interestingly, analysis of 1000
genomes project data revealed that this nucleotide change is not fixed in present-day
human populations and it turned out to be a SNP (rs79759099) present in Asian
populations (allele frequency of about 0.06). In European and East-African
populations, the ancestral allele was not found and populations with West-African
origin carry the ancestral allele but at very low frequencies. Since this distribution
schema could be the result of selective sweeps within recent human populations
compatible with a beneficial role for the new derived miR-1304 allele, we looked for
signatures of selection along the region using HapMap and HGDP data but no
evidences for a selective sweep, such as an excess rare allele variants or a block of
extensive linkage disequilibrium, could be found. Other explanation for the presence
of the ancestral allele in Asian populations could be that it was reintroduced through
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
17/38
17
admixture with Neanderthals; however, because Neanderthal admixture is restricted
to non-African populations (Green et al. 2010) and given the presence of the
ancestral miR-1304 in some Africans and its low frequency in Asia, the distribution of
the ancestral miR-1304 could not solely be explained in terms of introgression.
Furthermore, miR-1304 is not included into the 13 regions that have been identified
as candidate gene flow regions between Neanderthals and modern humans that
were described through the analysis on extended Neanderthal haplotype blocks in
modern human genomes (Green et al. 2010). In this scenario, a combination of
admixture in Asia such as the described by Skoglund (Skoglund and Jakobsson
2011) with rs79759099 being a retained ancient polymorphism in Africa could be the
most plausible explanation.
miR-1304 is a relatively novel primate specific miRNA that was recently discovered at
very low levels in human embryonic stem cells and after differentiation of these cells
into embryonic bodies (Morin et al. 2008). Since then deep RNA sequencing studies
have found miR-1304, also lowly expressed, in diverse tissues such as peripheral
blood, brain cortex and melanoma (Mart et al. 2010; Stark et al. 2010; Vaz et al.
2010) but its targets and function remain largely unknown. The in silico approach
based on target site predictions performed in this work allowed us to gain insights
into the putative functional differences between the two versions of miR-1304. One of
the main restrictions to find target genes for the ancestral miR-1304 was the dearth
of good quality Neanderthal sequence data. The use of the modern humans genome
for target gene predictions may have lead us to disregard Neanderthal target genes
that diverged from human genes in their 3UTRs; nevertheless, we did not find false
positive as all target genes for the ancestral miR-1304 that could be tested (33 out of
37, 89%) have an identical and conserved binding site in the Neanderthal and human
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
18/38
18
genomes.
Remarkably, we observed a significant difference in the number of predicted target
genes between both miRNAs: the derived version of miR-1304 has more than 14
times more predicted targets than the ancestral one, which is indicative of a critical
functional evolution for miR-1304. Interestingly, the analysis performed using the
Ingenuity software associated the predicted targets of derived miR-1304 with
biological processes and disorders related to central nervous system development
and function which suggests that the evolutionary change of miR-1304 may affect
aspects of human brain functioning and cognition. Previous work showed that SNP
variants in the vicinity of miR-22, miR-148a and miR-488 associate with panic
disorder and that these miRNAs effectively repress candidate genes for anxiety
(Muios-Gimeno et al. 2011). In this context, involvement of miR-1304 in brain
function regulation raises the interesting possibility of particular neurological
phenotypes being associated with one miR-1304 allele or the other. On the other
hand, comparison of the Neanderthal genome and modern humans genomes
identified a number of genomic regions that may have been affected by positive
selection in ancestral modern humans, including regions involved in cognitive abilities
like NRG3, a gene involved in schizophrenia (Green et al. 2010). Taken together
these data suggest that human cognition has been an important target of recent
human evolution that could have been shaped in part by miRNAs.
Among the few predicted target genes for the ancestral miR-1304, CD24 and the
transcription factor 4 (TCF4) are of interest for their involvement in neurological
disorders in humans. CD24 has been associated with multiple sclerosis (Zhou et al.
2003) and TCF4 (predicted by TargetRank and TargetScan) has been recently
associated with a range of neuropsychiatric phenotypes including schizophrenia,
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
19/38
19
impaired verbal learning and Pitt-Hopkins syndrome (Amiel et al. 2007; Stefansson et
al. 2009; Lennertz et al. 2011). Two other noteworthy target genes are ENAMand
AMTN, both involved in odontogenesis. We focused on these genes due to the
known dental differences between Neanderthals and modern humans, and
demonstrated the conservation of their 3'UTRs among primates as well as their
differential response after transfection with either the derived or the ancestral miR-
1304. These two genes are involved in teeth formation and map near each other in
an interesting cluster on chromosome 4 together with other genes also involved in
dental formation as well as salivary proteins such as ameloblastin (AMBN) or mucin 7
(MUC7).
Tooth enamel, the hardest substance in vertebrates, is formed by epithelium-derived
ameloblasts. As ameloblasts differentiate, they deposit specific proteins necessary
for enamel formation, including amelogenin, ameloblastin and enamelin, in the
organic enamel matrix. Enamelin is the largest protein in the enamel matrix of
developing teeth. It is involved in the mineralization and structural organization of
enamel. Amelotin was discovered in mouse, where it is specifically expressed in
maturation-stage ameloblasts. It has been hypothesized that it functions as a
protease helping the processing of the enamel matrix at this stage (Iwasaki et al.
2005). We can only speculate about the function of the ancestral miR-1304 in
Neanderthals but, given the involvement ofENAMandAMTNin odontogenesis, their
observed repression by the ancestral miR-1304 could implicate this miRNA, acting
together with other divergent genes, in a range of differences related to Neanderthal
and modern humans dentition (Macchiarelli et al. 2006; Olejniczak et al. 2008). For
example, the union surface between dentine and enamel was more complex in
Neanderthals than it is in Homo sapiens. Additionally, the volume of coronal dentine
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
20/38
20
was larger in the extinct Homo and, since enamel volume is similar in both species,
this results in significantly thinner cuspal enamel in Neanderthals (Ramirez Rozzi and
Bermudez De Castro 2004; Olejniczak et al. 2008). Moreover it is believed that
enamel cusps formed faster in Neanderthals as evidenced by a significantly lower
periodicity of their enamel growth marks (Retzius marks or perikymata) (Aiello and
Dean 1990), a fact that has often lead to overestimation of Neanderthal's age at
death (Olejniczak et al. 2008; Smith et al. 2009, 2010). This would imply a different
rate of ameloblastic activity, a process that may be influenced by miR-1304. This
hypothesis is in agreement with recent studies performed in rodents that denote that
miRNAs have a prominent role in teeth development being required for normal
ameloblast differentiation and enamel matrix formation (Cao et al. 2010; Michon et al.
2010). Since the ancestral allele of miR-1304 still segregates in some modern
humans, this miR-1304 variant could be involved in dental development and be
associated, for example, with the degree of enamel thickness. Although little is
known about variations of dental morphology among human populations, it has been
reported that average enamel thickness is similar among Asian, European and
African dentitions (Feeney et al. 2010). Nevertheless, given the fact that only about
0.5% of Asian individuals would be homozygous for the ancestral miR-1304 we do
not expect this allele to be involved in phenotypic traits that differ among populations
but rather in less common traits somehow related with disease. In this regard,
defects in enamel formation create the condition known as Amelogenesis Imperfecta
(AI), a disease in which the enamel does not fully form or forms in insufficient
amounts and teeth affected may be discolored, sensitive or prone to disintegration.
AI is commonly inherited as an autosomic trait and ENAM mutations appear to be
responsible for a big part of the autosomally inherited cases. However, genetic
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
21/38
21
studies provide evidence for the existence of at least one further autosomal AI locus
(Krrman et al. 1997; Dong et al. 2000). The ancestral miR-1304, as repressor of
ENAMandAMTN, is a strong candidate to be involved in the susceptibility to AI and
other forms of enamel hypoplasia. It would be of interest to test this hypothesis in
familial cases of the disorder for which the underlying genetic defect has not been
identified yet and furthermore study if Asian populations show higher AI incidence
than other populations (the exact incidence of AI is uncertain and estimates vary from
1:700 people to 1:14,000 according to the populations studied; Seow 1993). The
finding of correlation between the presence of the ancestral allele of miR-1304 and
the minor allele of rs117342040 in ENAM, a variant that would interfere with the
binding of the ancestral miR-1304 to the mRNA and would avoid its repression
rescuing a hypothetical phenotype, is very appealing. It strengthens the idea that the
presence of the ancestral miR-1304 in modern humans could have some adverse
effect and thus, removal of down-regulation ofENAMcould have been beneficial to
modern humans. Unfortunately, we could not find evidences for a selective sweep
happening in the miR-1304 gene, which would have reinforced this hypothesis.
Finally, we should not forget about other predicted target genes for the ancestral
miR-1304 that are also related to disease such as the above stated CD24 and TCF4
genes that are involved in neurological disorders in humans.
Future analysis on the differential gene repression by the two alleles of miR-1304
and deeper studies on the functional significance of this regulation would be of great
interest not only to gain insights into primate evolution but also in the possible
implication of this miRNA in phenotypic differences among present-day human
populations and its relationship with complex human disorders.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
22/38
22
SUPPLEMENTARY MATERIAL
Supplementary material includes 2 figures and 3 tables
ACKNOWLEDGMENTS
We would like to thank M. Valls, B. Kagerbauer and F. Snchez-Quinto for their
technical support and advice and to the anonymous referees whose comments and
suggestions greatly improved this manuscript. Support was provided by the Spanish
National Institute for Bioinformatics (www.inab.org). This work was supported by the
Ministerio de Ciencia e Innovacin, Espaa (BFU2010-18477, BFU2009-06974 and
CGL2009-09013) and the European Union Seventh Framework Programme (PIOF-
GA-2009-236836). This publication has been co-financed by FEDER - European
Regional Development Fund A wayto build Europe. Fieldwork at El Sidrn site has
been funded by the Consejera de Cultura, Principado de Asturias. M.L.V. is funded
by an FI fellowship from the Generalitat de Catalunya.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
23/38
23
REFERENCES
Aiello LC, Dean MC. 1990. The Microanatomy and Development of Teeth. In: An
Introduction to Human Evolutionary Anatomy. Academic Press Limited, London. p.
106-132.
Amiel J, Rio M, de Pontual L, et al. (11 co-authors). 2007. Mutations in TCF4,
encoding a class I basic helix-loop-helix transcription factor, are responsible for Pitt-
Hopkins syndrome, a severe epileptic encephalopathy associated with autonomic
dysfunction. Am J Hum Genet. 80:988-993.
Bartel DP. 2004. MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell.
116:281-297.
Bentwich I, Avniel A, Karov Y, et al. (13 co-authors). 2005. Identification of hundreds
of conserved and nonconserved human microRNAs. Nat Genet. 37:766-770.
Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk R, Cuppen E. 2005.Phylogenetic shadowing and computational identification of human microRNA genes.
Cell. 120:21-24.
Borel C, Antonarakis SE. 2008. Functional genetic variation of human miRNAs and
phenotypic consequences. Mamm Genome. 19: 503509.
Brameier M. 2010. Genome-wide comparative analysis of microRNAs in three non-human primates. BMC Res Notes. 3:64.
Brennecke J, Stark A, Russell RB, Cohen SM. 2005. Principles of microRNA-target
recognition. PLoS Biol. 3:e85.
Briggs AW, Good JM, Green RE, et al. (18 co-authors). 2009. Targeted retrieval and
analysis of five Neandertal mtDNA genomes. Science. 325:318-321.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
24/38
24
Briggs AW, Stenzel U, Johnson PL, et al. (11 co-authors). 2007. Patterns of damage
in genomic DNA sequences from a Neandertal. Proc Natl Acad Sci USA. 104:14616-
14621.
Burbano HA, Hodges E, Green RE, et al. (20 co-authors). 2010. Targeted
Investigation of the Neandertal Genome by Array-Based Sequence Capture.
Science. 328:723-725.
Cao H, Wang J, Li X, et al. (11 co-authors). 2010. MicroRNAs play a critical role in
tooth development. J Dent Res. 89:779-784.
Carroll SB. 2008. Evo-devo and an expanding evolutionary synthesis: a genetic
theory of morphological evolution. Cell. 11;134(1):25-36.
Chen K, Rajewsky N. 2006. Deep conservation of microRNA-target relationships and
3UTR motifs in vertebrates, flies, and nematodes. Cold Spring Harb Symp Quant
Biol. 71:149-156.
Dong J, Gu TT, Simmons D, MacDougall M. 2000. Enamelin maps to human
chromosome 4q21 within the autosomal dominant amelogenesis imperfecta locus.
Eur J Oral Sci. 108:353-358.
Endicott P, Ho SY, Stringer C. 2010. Using genetic evidence to evaluate four
palaeoanthropological hypotheses for the timing of Neanderthal and modern human
origins. J Hum Evol. 59:87-95.
Feeney RN. Zermeno JP, Reid DJ, Nakashima S, Sano H, Bahar A, Hublin JJ, Smith
TM. 2010. Enamel thickness in Asian human canines and premolars. Anthropological
Science. 118 (3):191-198
Filipowicz W, Bhattacharyya SN, Sonenberg N. 2008. Mechanisms of post-
transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
25/38
25
9:102-114.
Finlayson C, Pacheco FG, Rodrguez-Vidal J, et al. (26 co-authors). 2006. Late
survival of Neanderthals at the southernmost extreme of Europe. Nature. 443:850-
853.
Friedman RC, Farh KK, Burge CB, Bartel DP. 2009. Most mammalian mRNAs are
conserved targets of microRNAs. Genome Res. 19:92-105.
Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J. 2003.
Computational and Experimental Identification of C. elegans microRNAs. Mol Cell.
11:1253-1263.
Green RE, Krause J, Briggs AW, et al. (56 co-authors). 2010. A draft sequence of the
Neandertal genome. Science. 328:710-722.
Guidi M, Muios-Gimeno M, Kagerbauer B, Mart E, Estivill X, Espinosa-Parrilla Y.
2010. Overexpression of miR-128 specifically inhibits the truncated isoform of NTRK3 and upregulates BCL 2 in SH-SY 5 Y neuroblastoma cells. BMC Mol Biol. 11:95.
Hindorff LA, Sethupathy P, Junkins HA, Ramos EM, Mehta JP, Collins FS, Manolio
TA. 2009. Potential etiologic and functional implications of genome-wide association
loci for human diseases and traits. Proc Natl Acad Sci USA. 106:9362-9367.
Hofreiter M, Jaenicke V, Serre D, Haeseler Av A, Pbo S. 2001. DNA sequencesfrom multiple amplifications reveal artifacts induced by cytosine deamination in
ancient DNA. Nucleic Acids Res. 29:4793-4799.
Hublin JJ. 2009. The origin of Neandertals. Proc Natl Acad Sci USA 106:16022-
16027.
Iwasaki K, Bajenova E, Somogyi-Ganss E, Miller M, Nguyen V, Nourkeyhani H, Gao
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
26/38
26
Y, Wendel M, Ganss B. 2005. Amelotin--a Novel Secreted, Ameloblast-specific
Protein. J Dent Res. 84:1127-1132.
Jazdzewski K, Murray EL, Franssila K, Jarzab B, Schoenberg DR, de la Chapelle A.
2008. Common SNP in pre-miR-146a decreases mature miR expression and
predisposes to papillary thyroid carcinoma. Proc Natl Acad Sci USA. 105 (20): 7269
7274.
Krrman C, Bckman B, Dixon M, Holmgren G, Forsman K. 1997. Mapping of the
locus for autosomal dominant amelogenesis imperfecta (AIH2) to a 4-Mb YAC contig
on chromosome 4q11-q21. Genomics. 39: 164170.
Krause J, Lalueza-Fox C, Orlando L, et al. (13 co-authors). 2007. The derived
FOXP2 variant of modern humans was shared with Neandertals. Curr Biol. 17:1908-
1912.
Krol J, Loedige I, Filipowicz W. 2010. The widespread regulation of microRNA
biogenesis, function and decay. Nat Rev Genet. 11:597-610.
Lalueza-Fox C, Rmpler H, Caramelli D, et al. (17 co-authors). 2007. A melanocortin
1 receptor allele suggests varying pigmentation among Neanderthals. Science.
318:1453-1455.
Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A, Bertranpetit J, Krause J.
2008. Genetic characterization of the ABO blood group in Neandertals. BMC Evol
Biol. 8:342.
Lalueza-Fox C, Rosas A, Estalrrich A, et al. (16 co-authors). 2011. Genetic evidence
for patrilocal mating behavior among Neandertal groups. Proc Natl Acad Sci USA.
108:250-253.
Lennertz L, Rujescu D, Wagner M, et al. (14 co-authors) 2011. Novel Schizophrenia
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
27/38
27
Risk Gene TCF4 Influences Verbal Learning and Memory Functioning in
Schizophrenia Patients. Neuropsychobiology. 63:131-136.
Lewis BP, Burge CB, Bartel DP. 2005. Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA targets. Cell.
120:15-20.
Lin S, Cheung WK, Chen S, Lu G, Wang Z, Xie D, Li K. Lin MC, Kung HF. 2010.
Computational identification and characterization of primate-specific microRNAs in
human genome. Comput Biol Chem. 34:232-241.
Liu N, Okamura K, Tyler DM, Phillips MD, Chung WJ, Lai EC. 2008. The evolution
and functional diversification of animal microRNA genes. Cell Res. 18:985996.
Macchiarelli R, Bondioli L, Debnath A, Mazurier A, Tournepiche JF, Birch W, Dean
MC. 2006. How Neanderthal molar teeth grew. Nature. 444:748-751.
Mart E, Pantano L, Baez-Coronel M, Llorens F, Miones-Moyano E, Porta S,Sumoy L, Ferrer I, Estivill X. 2010. A myriad of miRNA variants in control and
Huntingtons disease brain regions detected by massively parallel sequencing.
Nucleic Acids Res. 38:7219-7235.
McLean CY, Reno PL, Pollen AA, et al. (13 co-authors). 2011. Human-specific loss
of regulatory DNA and the evolution of human-specific traits. Nature. 471:216-219.
Mellars P. 2004. Neanderthals and the modern human colonization of Europe.
Nature. 432:461465.
Michon F, Tummers M, Kyyrnen M, Frilander MJ, Thesleff I. 2010. Tooth
morphogenesis and ameloblast differentiation are regulated by micro-RNAs. Dev
Biol. 340:355-368.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
28/38
28
Morin R, OConnor M, Griffith M, et al. (12 co-authors). 2008. Application of
massively parallel sequencing to microRNA profiling and discovery in human
embryonic stem cells. Genome Res. 18:610-621.
Muios-Gimeno M, Guidi M, Kagerbauer B, Martn-Santos R, Navins R, Alonso P,
Menchn JM, Gratacs M, Estivill X, Espinosa-Parrilla Y. 2009. Allele variants in
functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as
susceptibility factors for anxiety disorders. Hum Mut. 30:1062-1071.
Muios-Gimeno M, Espinosa-Parrilla Y, Guidi M, et al. (14 co-authors). 2011. Human
microRNAs miR-22, miR-138-2, miR-148a, and miR-488 Are Associated with Panic
Disorder and Regulate Several Anxiety Candidate Genes and Related Pathways.
Biol Psychiatry. 69:526-533.
Nielsen CB, Shomron N, Sandberg R, Hornstein E, Kitzman J, Burge CB. 2007.
Determinants of targeting by endogenous and exogenous microRNAs and siRNAs.
RNA. 13:1894-1910.
Olejniczak AJ, Smith TM, Feeney RN, et al. (14 co-authors). 2008. Dental tissue
proportions and enamel thickness in Neandertal and modern human molars. J Hum
Evol. 55:12-23.
Pickrell JK, Coop G, Novembre J et al. (8 co-authors). 2009. Signals of recent
positive selection in a worldwide sample of human populations. Genome Research
19(5):826-837
Quach H, Barreiro LB, Laval G, et al. (11 co-authors). 2009. Signatures of purifying
and local positive selection in human miRNAs. Am J Hum Genet. 84:316-327.
Ramirez Rozzi FV, Bermudez De Castro JM. 2004. Surprisingly rapid growth in
Neanderthals. Nature. 428:936-939.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
29/38
29
Rosas A, Martnez-Maza C, Bastir M, et al. (18 co-authors). 2006. Paleobiology and
comparative morphology of a late Neandertal sample from El Sidron, Asturias, Spain.
Proc Natl Acad Sci USA. 103:19266-19271.
Skoglund P, Jakobsson M. 2011. Archaic human ancestry in East Asia. Proc Natl
Acad Sci U S A 108:18301-18306
Seow WK. 1993. Clinical diagnosis and management strategies of amelogenesis
imperfecta variants. Pediatr Dent 15: 384-393, 1993
Smith TM, Harvati K, Olejniczak AJ, Reid DJ, Hublin JJ, Panagopoulou E. 2009. Brief
communication: dental development and enamel thickness in the Lakonis
Neanderthal molar. Am J Phys Anthropol. 138:112-118.
Smith TM, Tafforeau P, Reid DJ, et al. (14 co-authors). 2010. Dental evidence for
ontogenetic differences between modern humans and Neanderthals. Proc Natl Acad
Sci USA. 107:20923-20928.
Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG,
Schmidt C, Sturm RA, Hayward NK. 2010. Characterization of the Melanoma
miRNAome by Deep Sequencing. PloS one. 5:e9685.
Stefansson H, Ophoff RA, Steinberg S, et al. (87 co-authors). 2009. Common
variants conferring risk of schizophrenia. Nature. 460:744-747.
Stringer CB, Hublin JJ. 1999. New age estimates for the Swanscombe hominid, and
their significance for human. J Hum Evol. 37:873877.
Sun G, Yan J, Noltner K, Feng J, Li H, Sarkis DA, Sommer SS, Rossi JJ. 2009.
SNPs in human miRNA genes affect biogenesis and function. RNA.
15:1640-1651.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
30/38
30
Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A.
2010. Analysis of microRNA transcriptome by deep sequencing of small RNA
libraries of peripheral blood. BMC Genomics. 11:288.
Vinci S, Gelmini S, Pratesi N, Conti S, Malentacchi F, Simi L, Pazzagli M, Orlando C.
2011. Genetic variants in miR-146a, miR-149, miR-196a2, miR-499 and their
influence on relative expression in lung cancers. Clin Chem Lab Med. DOI:
10.1515/CCLM.2011.708 Published Online ahead of
printing.
Zhou Q, Rammohan K, Lin S, et al. (14 co-authors). 2003. CD24 is a genetic modifier
for risk and progression of multiple sclerosis. Proc Natl Acad Sci USA. 100:15041-
15046.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
31/38
31
Table 1. Target gene prediction for the ancestral version of miR-1304 by TargetRank
Conserved SeedMatches
Non-conserved SeedMatches
Gene Target Gene Score Total 8merM8
7merA1
7mer 6mer 8merM8
7merA1
7mer 6merConservedin Primates
PTGFRN prostaglandin F2 receptor negative regulator 0.337 1 0 0 0 0 1 0 0 0 H, N, C
DEK DEK oncogene 0.309 1 0 0 0 0 1 0 0 0 H, N, C
AMTNamelotin 0.302 1 0 0 0 0 1 0 0 0 H, N, C
CD24 CD24 antigen precursor 0.281 1 0 0 0 0 1 0 0 0 H, N
PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 0.281 1 0 0 0 0 1 0 0 0 H, N, C
C1orf85 kidney predominant protein NCU-G1 0.263 2 0 0 0 0 1 1 0 0 H, N, C
CAMKK2 calcium/calmodulin-dependent protein kinase b 0.261 2 0 0 0 0 1 1 0 0 H, N, C
KATNAL
katanin p60 subunit A-like 1 0.259 1 0 0 0 0 1 0 0 0 H, N, C
MGC130
hypothetical protein LOC91368 0.259 1 0 0 0 0 1 0 0 0 H, N, C
FOXH1 forkhead box H1 0.257 1 0 0 0 0 1 0 0 0 H, N, C
DLST dihydrolipoamide S-succinyltransferase 0.253 1 0 0 0 0 1 0 0 0 nr
ENAM enamelin 0.253 1 0 0 0 0 1 0 0 0 H, N, C
RIC8A resistance to inhibitors of cholinesterase 8 0.253 1 0 0 0 0 1 0 0 0 H, N, C
C1orf21 chromosome 1 open reading frame 21 0.251 2 0 0 0 0 0 1 1 0 H, N, C
TNNI1 troponin I 0.240 3 0 0 0 0 1 0 0 2 H, N, C
RBPMS2 RNA binding protein with multiple splicing 2 0.237 2 0 0 0 0 0 0 1 1 nr
IGFBP3 insulin-like growth factor binding protein 3 0.237 1 0 0 0 0 0 1 0 0 H, N, C
TCF4a
transcription factor 4 0.237 1 0 0 0 0 0 1 0 0 H, N, CFIZ1 FLT3-interacting zinc finger 1 0.236 2 0 0 0 0 0 1 1 0 H, N, C
CABP7 calcium binding protein 7 0.210 1 0 0 0 0 1 0 0 0 H, N, C
CLCF1 cardiotrophin-like cytokine factor 1 0.210 1 0 0 0 0 1 0 0 0 H, N, C
GRAP GRB2-related adaptor protein 0.210 1 0 0 0 0 1 0 0 0 H, N, C
KLF15 Kruppel-like factor 15 0.210 1 0 0 0 0 1 0 0 0 H, N, C
LRRN2 leucine rich repeat neuronal 2 0.210 1 0 0 0 0 1 0 0 0 H, N, C
http://mbe.oxfordjournals.org/http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
32/38
32
PI4K2A phosphatidylinositol 4-kinase type 2 alpha 0.210 1 0 0 0 0 1 0 0 0 H, N, C
SLAMF8 SLAM family member 8 0.210 1 0 0 0 0 1 0 0 0 H, N, C
TNIP2 A20-binding inhibitor of NF-kappaB activation 0.210 1 0 0 0 0 1 0 0 0 H, N, C
ATP1B3 Na+/K+ -ATPase beta 3 subunit 0.209 1 0 0 0 0 0 1 0 0 H, N, C
L3MBTL3 Lethal (3) malignant brain tumor-like 0.209 1 0 0 0 0 0 1 0 0 H, N, C
SOX17 SRY-box 17 0.209 2 0 0 0 0 0 0 1 1 nr
TMED4 transmembrane emp24 protein transport 0.209 1 0 0 0 0 0 1 0 0 H, N
DAPL1 death associated protein-like 1 0.203 1 0 0 0 0 1 0 0 0 H, N, C
EDF1a endothelial differentiation-related factor 1 0.203 1 1 0 0 0 0 0 0 0 H, N, C
FAM90A
hypothetical protein LOC55138 0.203 1 0 0 0 0 1 0 0 0 H, N, CTADA3L transcriptional adaptor 3-like 0.203 1 0 0 0 0 1 0 0 0 H, N
a, target gene prediction common to TargetScan and TargetRank; A1 indicates presence of an adenosine opposite miRNA base 1;M8 indicates a Watson-Crick match to miRNA base 8. Conserved in Primates, indicates conservation of the binding target siteamong different primate species: H, human; N, Neanderthal; C, chimpanzee; nr, no Neaderthal reads available.
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
33/38
33
Table 2. Top associations of the predicted target genes for the derived version ofmiR-1304 with biological processes
Top Networks Score
Cell Morphology, Cellular Function and Maintenance, Cellular
Movement 51Neurological Disease, Behavior, Genetic Disorder 51Lipid Metabolism, Molecular Transport, Small Molecule Biochemistry 30Cell Cycle, Cellular Development, Cellular Growth and Proliferation 5 Auditory Disease, Genetic Disorder, Neurological Disease 5
Diseases and Disorders p-value Molecules
Genetic Disorder 5,93E-05 - 4,04E-02 24Neurological Disease 5,93E-05 - 4,04E-02 14Cancer 1,27E-03 - 3,10E-02 5
Infection Mechanism 2,12E-03 - 1,81E-02 6Cardiovascular Disease 4,49E-03 - 4,40E-02 4
Molecular and Cellular Functions p-value Molecules
Cellular Assembly and Organization 3,21E-04 - 4,40E-02 16Cell Compromise 3,89E-04 - 3,10E-02 6Cellular Growth and Proliferation 1,13E-03 - 4,83E-02 11Cellular Development 2,00E-03 - 4,68E-02 9Gene Expression 2,12E-03 - 4,83E-02 19
Physiological System Development and
Function p-value Molecules
Nervous System Development andFunction 5,45E-04 - 4,40E-02 13Tissue Morphology 5,45E-04 - 4,83E-02 8Tumor Morphology 1,13E-03 - 3,97E-02 5Connective Tissue Development andFunction 3,48E-03 - 4,83E-02 8Behaviour 4,49E-03 - 4,49E-03 1
The five most significant associations with molecular networks and with differentcategories of biological functions are shown (Ingenuity Pathway Analysis software).
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
34/38
34
FIGURE CAPTIONS
Fig 1. Genomic sequence conservation of miR-1304 among primates. First row
of the figure shows the RNA sequence of mature reference human miR-1304. The
seed region and the nucleotide change it are highlighted in grey on the genomic DNA
alignment. hsa, Homo sapiens; nea, Homo neanderthalensis; ptr, Pan troglodytes;
ggo, Gorilla gorilla; ppy, Papio pygmaeus; mmu, Macaca mulatta.
Fig 2. Genomic sequence conservation of ENAM and AMTN 3'UTRs among
primates. A; 3UTR of the ENAMandAMTNgenes, the target sequence that binds
the seed region of miR-1304 is highlighted in grey. hsa, Homo sapiens; nea, Homo
neanderthalensis; ptr, Pan troglodytes; ggo, Gorilla gorilla; ppy, Papio pygmaeus;
mmu, Macaca mulatta. B; Sequence alignments for the ancestral miR-1304 (Anc.
miR-1304) showing the predicted binding with the 3UTRs of the Neanderthal ENAM
andAMTNmRNAs.
Fig 3. The ancestral version of miR-1304 targets ENAM and AMTN 3'UTRs.
Results of the luciferase-reporter assay used to test the interaction between
ancestral (Anc.) and derived (Der.) miR-1304 with the ENAMand AMTNgenes. A;
HeLa cells were co-transfected with the miRNA mimic of interest, the Renilla reporter
plasmid pGL4.75 and either the empty pGL4.13 plasmid or pGL14.3 carrying the
3'UTR ofGAD1, ENAMorAMTNfollowed by the firefly luciferase reporter gene. The
previously proven regulation ofGAD1 by miR-7 was used as a positive control. The
ratios of Firefly to Renilla luciferase luminescence are presented after normalization
to the empty pGL4.13 and to the mean of 2 different mimic controls. B; The binding
site for the ancestral miR-1304 was removed from the 3'UTRs in the constructs by
http://mbe.oxfordjournals.org/8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
35/38
35
mutagenesis and the luciferase assay was repeated. Each experiment was done in
triplicate and at least 3 independent experiments were performed. Data reported here
are the means SD of independent experiments. Significant associations after
Bonferroni correction (p
8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
36/38
a-miR-1304 GUGUAGAGUGACAUCGGAGUUU
a TGAATCACTTGAGCCCAGGGGTTCGAGGCTACAGTGAGATGTGGCAGGATCACATCTCACTGTAGCCTCAAACCGCTGGGCTCAAGTGTTTa ---------------------------------------------------------------------G---------------------
r ---------------------------------------------------------------------G---T-----------------
o ---------------------------------------------------------------------G---T-----------------
y ------G-----------------------------G----C---------------------------G---T--------T--------
u ------G----------A-----T-----------------------------------T---------G----A-----------G-A--
8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
37/38
A
ENAM
hsa CAGACCTTAAAAAAGCAAGAAGGCCATGACCATCCCTGCCTCGAAACTTGCAAGTCACTTGTCTGAGTTAGTTTCCTTTTGCTTGATnea --------------------------------------------------G--A---------------------------------ptr --------------------------------------------------G------------------------------------ggo --------------------------------------------------G------------------------------------ppy --------------------------------------------------G------------------------------------
mmu -----------------------T-----------------T--------G----T--------------------------C----
AMTN
hsa CCAGGAATTCAGTAAGCTGTTTCAAATTTTTTCAACTAAGCTGCCTCGAATTTGGTGATACATGTGAATCTTTATCATTGATTATATnea ---------------------------------------------------------------------------------------ptr ---------------------------------------------------------------------------------------ggo ---------------------------------------------------------------------------------------ppy --------------------------------G----------------------------G-------------------------mmu ----------------------------------------------T-----------C----------------------------
B
Anc.miR-1304
3- GUGUAGAGUGACAUCGGAGCUU - 5 3- GUGUAGAGUGACAUCGGAGCUU - 5
||||||| |||||||
5... CAAGGCCAUGACCAUCCCUGCCUCGAAACUUG...3 5... AAAUUUUUUCAACUAAGCUGCCUCGAAUUUGG...3
mRNA Neanderthal ENAM mRNA Neanderthal AMTN
8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex
38/38
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
0,9
1
1,1
1,2
0,2
0,3
0,4
0,5
0,6
0,7
0,8
0,9
1
1,1
1,2
GAD1 ENAM AMTN
Lu
ciferase
activity
hsa-miR-7
Der.miR-1304
Anc.miR-1304
ENAMwt
ENAMdel
AMTNwt
Luciferase
activity
*
*
*
*
*
A
B
Recommended