An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Explain Dental Differences With Modern Humans

8/2/2019 An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Ex

1/38

and Evolution. All rights reserved. For permissions, please e-mail: [email protected]

The Author 2012. Published by Oxford University Press on behalf of the Society for Molecular Biology

1

An ancestral miR-1304 allele present in Neanderthals regulates genes involved

in enamel formation and could explain dental differences with modern humans

Paper submitted as Research Article

Maria Lopez-Valenzuela1, Oscar Ramrez1, Antonio Rosas2, Samuel Garca-Vargas2,

Marco de la Rasilla3, Carles Lalueza-Fox1 and Yolanda Espinosa-Parrilla1

1Institut de Biologia Evolutiva (UPF-CSIC), CEXS-UPF-PRBB. C/ Dr. Aiguader, 88,

08003 Barcelona, Catalonia, Spain

2Paleoanthropology Group, Department of Paleobiology, Museo Nacional de

Ciencias Naturales, CSIC. C/ Jos Gutierrez Abascal, 2, 28006 Madrid, Spain

3rea de Prehistoria, Departamento de Historia, Universidad de Oviedo. C/ Teniente

Alfonso Martnez s/n. 33011 Oviedo, Spain

Corresponding author: Yolanda Espinosa-Parrilla. Institut de Biologia Evolutiva

(UPF-CSIC), CEXS-UPF-PRBB. C/ Dr. Aiguader, 88, 08003, Barcelona, Spain. Tel:

+34 93 316 0845. Fax: +34 93 316 0901. E-mail: [email protected]

Keywords: Neanderthal, gene regulation, miR-SNP, microRNA, miR-1304, tooth

development

Running Head: An ancestral miR-1304 allele regulates dental genes

MBE Advance Access published January 27, 2012
http://mbe.oxfordjournals.org/


2/38

2

ABSTRACT

Genetic changes in regulatory elements are likely to result in phenotypic effects that

might explain population-specific as well as species-specific traits. MicroRNAs are

post-transcriptional repressors involved in the control of almost every biological

process. These small non-coding RNAs are present in various phylogenetic groups

and a large number of them remain highly conserved at the sequence level.

MicroRNA-mediated regulation depends on perfect matching between the 7

nucleotides of its seed region and the target sequence usually located at the 3'UTR

of the regulated gene. Hence, even single changes in seed regions are predicted to

be deleterious as they may affect microRNA target specificity. In accordance to this,

purifying selection has strongly acted on these regions. Comparison between the

genomes of present-day humans from various populations, Neanderthal and other

non-human primates showed a microRNA, miR-1304, that carries a polymorphism on

its seed region. The ancestral allele is found in Neanderthal, non-human primates, at

low frequency (~5%) in modern Asian populations and rarely in Africans. Using

microRNA target site prediction algorithms we found that the derived allele increases

the number of putative target genes for the derived microRNA more than tenfold,

indicating an important functional evolution for miR-1304. Analysis of the predicted

targets for derived miR-1304 indicates an association with behavior and nervous

system development and function. Two of the predicted target genes for the

ancestral miR-1304 allele are important genes for teeth formation, enamelin and

amelotin. MicroRNA over-expression experiments using a luciferase-based assay

showed that the ancestral version of miR-1304 reduces the enamelin and amelotin

associated reporter gene expression by 50%, whereas the derived miR-1304 does

not have any effect. Deletion of the corresponding target sites for miR-1304 in these


3/38

3

dental genes avoided their repression, which further supports their regulation by the

ancestral miR-1304. Morphological studies described several differences in the

dentition of Neanderthals and present-day humans like slower dentition timing and

thicker enamel for present-day humans. The observed miR-1304 mediated-regulation

of enamelin and amelotin could at least partially underlie these differences between

the two Homo species as well as other still-unraveled phenotypic differences among

modern human populations.


4/38

4

INTRODUCTION

Investigating the genetic differences associated with phenotypic diversity among

hominins is a crucial step towards the understanding of human adaptation and

evolution. Genetic and genomic alterations in regulatory regions are a significant

source of phenotypic diversity underlying important inter-individual and inter-species

differences (Carroll 2008; Hindorff et al. 2009). This record has been recently

confirmed in primates by the discovery that the human loss of specific regulatory

DNA, in particular the loss of non-coding RNA with enhancer function, associates

with the appearance of specific human traits such as the expansion of specific brain

regions (McLean et al. 2011). Increasing evidence supports that allelic changes

involving either microRNAs (miRNAs) or their regulatory machinery are major

contributors to phenotypic diversity in human populations and may thus be important

sources of phenotypic variation and have a role in the pathophysiology of several

disorders (Borel and Antonorakis 2008).

miRNAs are small non-coding RNAs of 1925 nucleotides in length in their mature

form, processed from a longer hairpin structure, that act as post-transcriptional

regulators of gene expression by either mRNA degradation or translational

repression (Krol et al. 2010). It is estimated that miRNAs regulate more than 30% of

all protein-coding genes, building complex regulatory networks that control almost

every cellular process (Filipowicz et al. 2008). miRNAs act by means of partial

complementarity to miRNA binding sites usually located in the 3-UTR regions of their

target genes (Bartel 2004). Perfect complementarity between the target sequence of

the regulated messenger RNA and the so-called seedregion -nucleotides 2 through

7 or 8 from the 5 end of the mature miRNA- is thought to determine successful

binding and, together with the stability of the RNA hybrids, are the basis of many


5/38

5

miRNA target site prediction algorithms (Brennecke et al. 2005; Lewis et al. 2005).

Strong purifying selection acts on the mature miRNA and particularly on nucleotides

corresponding to the seed region, where no mutation is tolerated as it would most

likely produce a change in the target spectrum that could give rise to the emergence

of a novel miRNA (Chen and Rajewsky 2006; Liu et al. 2008; Quach et al. 2009).

Conservation of miRNAs through evolution is well documented and has been used

for the discovery of homologous miRNAs across different phylogenetic groups. It is

assumed that conserved miRNA may have high functional relevance and hence

many previous research efforts focused on finding and characterizing those miRNAs

(Grad et al. 2003; Berezikov et al. 2005; Chen and Rajewsky 2006). Nonetheless, the

identification of species-specific miRNAs may help to understand evolutionary

novelties among different phylogenetic groups. Several studies reach the conclusion

that miRNAs are strongly conserved among primates, but still there is a set of

miRNAs that are found only in present-day humans and thus are good candidates to

contribute to human specific phenotypes (Bentwich et al. 2005; Berezikov et al. 2005;

Liu et al. 2008; Brameier 2010; Lin et al. 2010). The first published draft of the

Neanderthal genome revealed that present-day humans differ from Neanderthals by

a nucleotide substitution in the seed region of microRNA miR-1304 (Green el al.

2010) that therefore it is likely to change the spectrum of target genes for miR-1304.

Neanderthals are the closest known evolutionary relatives of modern humans. They

inhabited parts of Europe and Western Asia during a succession of climatic cycles,

exhibiting both behavioural and morphological adaptations probably related to cold

climates, until their extinction around 30,000 years ago (Mellars 2004; Finlayson et

al. 2006). The morphological features that distinguish Neanderthals from other

humans, including specific cranio-facial and dental traits, first appear in the European


6/38

6

fossil record around 400,000 years ago (Stringer and Hublin 1999; Hublin 2009).

Estimated from genomic data, these Homo populations diverged between 440,000 to

270,000 years ago (Endicott et al. 2010; Green et al. 2010). The analysis of the

Neanderthal genome has revealed that about 80 protein-coding genes show fixed

amino acid changes between Neanderthals and modern humans (Green et al. 2010).

Phenotypes evolve by functional differences in proteins but also do largely through

mutations in regulatory regions (Carroll 2008); thus it seems clear that genetic

differences related to the distinctive Neanderthal phenotype should not be restricted

to a set of protein coding genes and that the analysis shall be broadened to

incorporate gene regulation as well.

Here we analyze the primate specific miR-1304 by studying genetic variation of the

human miR-1304 locus and the spectrum of target genes predicted for the derived

and ancestral versions of this miRNA. By means of functional studies we show

repression of a cluster of dental genes by the ancestral version of miR-1304

illustrating how a single nucleotide change in a regulatory element may underlie

particular phenotypic differences.


7/38

7

MATERIAL AND METHODS

Sequencing of chimpanzee miR-1304 and NeanderthalAMTN3UTR

miR-1304 was PCR-amplified from genomic DNA of 3 chimpanzee individuals using

primers listed in supplementary table 1. Eight clones per individual were sequenced

using standard procedures.

The target site for miR-1304 on the 3UTR of the Neanderthal AMTN was PCR-

amplified in a Neanderthal specimen (SD-1253) from El Sidrn site (Asturias, Spain),

and 55 clones were sequenced (supplementary fig 1) following a previously

described methodology (Lalueza-Fox et al. 2007) using specific primers

(supplementary table 1). This bone sample has been used to retrieve ~14,000

protein-coding positions (Krause et al. 2007; Lalueza-Fox et al. 2008, 2009; Burbano

et al. 2010), as well as 0.1% of the nuclear genome (Green et al. 2010) and the

complete mitochondrial genome (Briggs et al. 2009). The degree of contamination

has been estimated to be 0.27-0.29% for the mtDNA and 2% upper bound for

autosomal DNA capture (Krause et al. 2007; Lalueza-Fox et al. 2008); these low

figures render this specimen one of the most suitable Neanderthal samples for

targeted paleogenetic analysis.

Firefly luciferase constructs and Mutagenesis

The 3UTRs of ENAM, AMTN and GAD1 were PCR-amplified from genomic DNA

with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, California), using primers

containing an XbaI restriction site at the 5 end (supplementary table 1). PCR

fragments were later purified, XbaI-digested and cloned into pGL4.13 vector

(Promega, Madison, Wisconsin) downstream of the firefly luciferase reporter gene.

Mutant reporter plasmids were generated as previously described (Muios-Gimeno

et al. 2009) with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla,


8/38

8

California), using either the AMTN or ENAM pGL4.13 construct as a template and

primers carrying the desired deletions (supplementary table 1).

Cell culture and transfection

HeLa cells were maintained in Dulbeccos Modified Eagles Medium supplemented

with 10% fetal bovine serum, 100 units/ml penicillin and 100 g/ml Streptomycin

(GIBCO, Invitrogen). Co-transfection optimization has been previously described

(Guidi et al. 2010). Briefly, HeLa cells were seeded at 1.3 x 104 cells/well in 96-well

plates and co-transfected 24 h later with the Firefly reporter constructs described

above or the empty pGL4.13 vector (24 ng), the Renilla reporter plasmid pGL4.75 (3

ng) and 10nM miRNA mimic for derived miR-1304, ancestral miR-1304 and negative

controls #2 and #4 (miRIDIAN, Dharmacon, Lafayette, Colorado) using

Lipofectamine 2000 (Invitrogen).

Luciferase activity assay

The activity of Firefly and Renilla luciferases was determined 24 h after transfection

using the Dual-Glo Luciferase Assay System (Promega). Relative reporter activity

was obtained by normalization to the Renilla luciferase activity. In order to correct for

vector-dependent unspecific effects, each relative reporter activity was normalized to

the empty vector co-transfected with the corresponding miRNA (Guidi et al. 2010).

Results were then compared to the mean of the two negative controls. Each

experiment was done in triplicate and at least three independent experiments were

performed for each miRNA. Statistical significance was determined using Students t

test (p


9/38

9

Computational methods

Targets were predicted using the web-based prediction methods TargetScan

(www.targetscan.org, release 5.1 (Friedman et al. 2009)) and TargetRank

(www.hollywood.mit.edu/targetrank, (Nielsen et al. 2007)) on the human genome

assembly (NCBI36/hg18, March 2006). Genomic coordinates are according to the

following assemblies: Homo sapiens GRCh37/hg19, Pan troglodytes CHIMP2,

Gorilla gorilla gorGor3, Pongo pygmaeus PPYG2, Macaca mulatta MMUL_1.

Sequences, unless sequenced by ourselves, were obtained from the University of

California Santa Cruz (UCSC) Genome Browser (http://www.genome.ucsc.edu) and

Ensembl Genome Browser release 61 (www.ensembl.org). Pathway analysis was

performed with the Ingenuity Pathway Analysis Software (IPA) version 6.3

(www.ingenuity.com). Human genetic variation on miR-1304 was assessed using

genotypes for 1094 individuals in the June 2011 Data Release of the 1000 Genomes

Project (www.1000genomes.org). Exploration for natural selection signatures in the

human genome was performed by the analysis of data from HapMap, using the

UCSC browser, and from the 53 populations of the Human Genome Diversity Panel

(HGDP), using the HGDP selection browser (http://hgdp.uchicago.edu/)(Pickrell et al.

2009).


10/38

10

RESULTS

Conservation of miR-1304 among primates

As noted by Green et al (2010), the Neanderthal draft genome sequence differs from

the reference genome of present-day humans in one base in the seed region of the

primate specific miRNA miR-1304 (fig 1). The corresponding genomic sequence for

Neanderthals is GCCTCGA and GCCTCAA for the reference human sequence. We

took advantage of the recently completed genome sequencing of four primates

Macaca mulatta, Pan troglodytes,Gorilla gorilla and Pongo pygmaeus- to compare

primate sequences orthologous to human miR-1304 (fig 1). The sequence alignment

confirmed that the reference human genome bear the derived state at this nucleotide

position while Neanderthal and other non-human primates share the ancestral state.

The rest of the hairpin sequence was identical between Neanderthals and the

reference human genome and showed few changes in the other four primates. In the

case of chimpanzee, the published shotgun assembly (March 2006 Pan_troglodytes-

2.1 6x) showed a deletion of 26 nucleotides together with an insertion that set apart

the two resting parts of the miRNA. To verify the possibility that chimpanzee had lost

this miRNA we sequenced three chimpanzees DNAs and, after analysis of eight

clones per individual, identified a consensus sequence identical to the gorilla miR-

1304 sequence that differs in only one nucleotide position from the ancestral miR-

1304 (fig 1) indicating that chimpanzees likely also have a functional copy of miR-

1304.

Analysis of the genetic variation of miR-1304 in human populations

We checked for genetic variation at the miR-1304 locus among human populations

using the dbSNP database. We found one Single Nucleotide Polymorphism (SNP),

rs79759099, at this particular position in the seed region indicating that this change is


11/38

11

not fixed in human populations. Using the new release of the 1000 Genomes Project

(June 2011 data release) with 1094 individuals representing 14 populations

worldwide we found that while all the individuals in the European (GBR, FIN, IBS,

CEU and TSI), Colombian (CLM), Mexican (MXL) and Kenyan (LWK) populations

only presented the derived allele, the ancestral allele of miR-1304 was present as the

minor allele in the Asian Japanese (JPT, MAF=0.067) and Chinese (CHB,

MAF=0.072; CHS, MAF=0.05) populations and, at very low frequency, in the

Yoruban (YRI, MAF=0.028); Puerto Rican (PUR, MAF=0.009) and African American

(ASW, MAF=0.008) populations (supplementary table 2). Furthermore, since this

different allelic distribution could be the result of selective sweeps within recent

human populations we looked for signatures of selection for the derived miR-1304 by

the study and comparison of linkage disequilibrium (integrated haplotype score, iHS),

population differentiation (Fst) and the frequency of rare variants (Tajimas D) along

the genomic region using public data from HapMap and HGDP. However, neither a

significant excess of rare variants nor significant population differentiation indexes

compatibles with a selective sweep were found in the region.

Analysis of target gene predictions for miR-1304

To assess the variation in the target gene spectrum for the ancestral and derived

miR-1304, we used different prediction algorithms based on seed sequence

matching, namely TargetScan and TargetRank. For the ancestral miR-1304,

TargetRank predicted 35 target genes and TargetScan predicted only four genes

(LCORL, RIMBP2, EDF1 and TCF4, the last two being common to both prediction

programs, table 1). A limitation of these predictions is that they were performed on

the modern human genome, thus we checked if predicted target genes had identical

binding sites for the ancestral miR-1304 in the chimpanzee and Neanderthal


12/38


13/38

13

putative targets was interesting, particularly given that the best-described differences

between Neanderthals and modern humans are related to cranial and dental traits.

Thus, among the predicted target genes, we focused on the study of the ENAMand

AMTNgenes.

Analysis of the 3UTR region of the ENAMandAMTNgenes in Neanderthal

Because the human genome was used as a reference for predicting the role of the

ancestral variant of miR-1304 in the regulation of ENAMandAMTN, it is necessary

that Neanderthals match humans in the target site sequences for these genes. In the

case of the ENAMNeanderthal gene, the sequence corresponding to the target site

for this miRNA is identical to the modern human sequence and the 3UTR exhibits

only two changes in its vicinity (fig 2A). The first is a C to G substitution

corresponding to a common SNP also present in modern humans (rs7664896)

located seven bp from the seed region binding site. The second is a G to A

nucleotide change, which is among the most common forms of post-mortem DNA

damage and may be considered an artefact induced by cytosine deamination

occurring in the complementary strand (Hofreiter, et al. 2001; Briggs et al. 2007).

Neither of these changes is predicted to interfere with the correct binding of the

miRNA. In the case of the AMTN gene, the sole available read from Vindija

Neanderthal ends up at the beginning of the target sequence for miR-1304 and

displays two G to A nucleotide changes that, as stated before, could be an artifact

due to post-mortem DNA damage (fig 2A). To ascertain if the extinct Homo had a

complete binding site for the ancestral miR-1304 atAMTN3'UTR, we sequenced part

of this region in a Neanderthal specimen (SD-1253) from El Sidrn site (Asturias,

Spain) dated to about 49,000 years ago and extracted under controlled conditions

(Rosas et al. 2006; Lalueza-Fox et al. 2011). The analysis of 55 clones showed that


14/38

14

the recognition site for miR-1304 in the AMTN gene is identical in both hominin

groups (supplementary fig 1). The 3'UTRs of ENAM and AMTN are also highly

conserved among other primates studied (chimpanzee, gorilla, orangutan and rhesus

monkey) and all but the rhesus monkey carry the exact matching sequence for the

ancestral miR-1304 seed region (fig 2). Accordingly, the seed region of this version of

miR-1304 presents perfect complementarity with its predicted target site region at the

3UTR of ENAMand AMTN (fig 2B) and might be regulating both dental genes in

Neanderthal as well as in other non-human primates and humans carrying the

ancestral allele of miR-1304.

Functional screening of miR-1304 target sites in ENAMandAMTN

To investigate the interaction between ENAM and AMTN mRNA and the different

versions of miR-1304, functional validation of the predicted ancestral miR-1304 target

site was performed using a dual-luciferase assay in HeLa cells. A luciferease reporter

pGL4.13 construct carrying the 3'UTR of either the ENAMorAMTNgenes was co-

transfected with the corresponding miRNA mimic: ancestral miR-1304, derived miR-

1304 or 2 different control miRNAs. As shown in fig 3A, a statistically significant

reduction of the luciferase activity was observed for ENAM and AMTN when co-

transfected with the ancestral miR-1304 as compared with the modern miR-1304

(p


15/38

15

AMTN pGL4.13 constructs and co-transfected the plasmids with the respective

miRNAs. A statistically significant recovery of the luciferase activity was observed

when the ancestral miR-1304 was co-transfected with the deleted ENAMandAMTN

plasmids in comparison with the wild type constructs, reaching levels of recovery of

about 100% (fig 3B). The observed rescue of the quantitative phenotype further

supports the predicted repression of these two dental genes by this version of miR-

1304.

Analysis of the genetic variation ofENAMandAMTNin human populations

To further characterize the gene-miRNA interaction we analyzed genetic variation on

the ENAM and AMTN miR-1304 target site sequences in present-day populations

using the 1000 Genomes Project data. While we did not find genetic variation in the

target site of AMTN, the ENAM target site harbors the SNP rs117342040 (G/A with A

being the minor allele). Interestingly, the affected nucleotide in the target site of

ENAM is located exactly matching the described change in the miR-1304 seed

region in such a way that the minor allele of rs117342040 would interfere with the

proper binding of the ancestral allele of miR-1304. Moreover, the allele frequencies

for this SNP are differentially distributed among human populations being absent in

European populations, very rare in Africans (one carrier of African origin from Kenya)

and present in about 2.5% of Asian individuals (Supplementary table 2). As this

variant is found in populations where the ancestral version of miR-1304 is also

detected, we studied if they were correlated using and hypergeometric test and

observed that, for the total of 1094 individuals analyzed, our finding of 3 individuals

having both minor alleles was significant (p=0.0162) meaning that there are more

carriers of both minorENAMand miR-1304 alleles than expected by chance.


16/38

16

DISCUSSION

The main basis of miRNA action is its sequence complementarity with the target

regions of the genes that they regulate. Functional SNPs that create or disrupt these

miRNA target sites have been shown to have diverse phenotypic implications

contributing sometimes to human disease susceptibility (Borel and Antonarakis

2008). Since one miRNA can have multiple targets, SNPs located on the miRNA

regions important for target recognition would be expected to exhibit a broader

biological effect than SNPs on the target sequences. So far, very few functional

variants in miRNA genes have been described and only a small number of studies

have been devoted to describe their functional consequences (Jazdzewski K et al.

2008; Sun et al. 2009; Vinci et al. 2011).

Analysis of the Neanderthal genome sequence led to the detection of a miRNA, miR-

1304, that differs from the reference human miR-1304 sequence at one nucleotide

position in the seed region (Green et al. 2010). Interestingly, analysis of 1000

genomes project data revealed that this nucleotide change is not fixed in present-day

human populations and it turned out to be a SNP (rs79759099) present in Asian

populations (allele frequency of about 0.06). In European and East-African

populations, the ancestral allele was not found and populations with West-African

origin carry the ancestral allele but at very low frequencies. Since this distribution

schema could be the result of selective sweeps within recent human populations

compatible with a beneficial role for the new derived miR-1304 allele, we looked for

signatures of selection along the region using HapMap and HGDP data but no

evidences for a selective sweep, such as an excess rare allele variants or a block of

extensive linkage disequilibrium, could be found. Other explanation for the presence

of the ancestral allele in Asian populations could be that it was reintroduced through


17/38

17

admixture with Neanderthals; however, because Neanderthal admixture is restricted

to non-African populations (Green et al. 2010) and given the presence of the

ancestral miR-1304 in some Africans and its low frequency in Asia, the distribution of

the ancestral miR-1304 could not solely be explained in terms of introgression.

Furthermore, miR-1304 is not included into the 13 regions that have been identified

as candidate gene flow regions between Neanderthals and modern humans that

were described through the analysis on extended Neanderthal haplotype blocks in

modern human genomes (Green et al. 2010). In this scenario, a combination of

admixture in Asia such as the described by Skoglund (Skoglund and Jakobsson

2011) with rs79759099 being a retained ancient polymorphism in Africa could be the

most plausible explanation.

miR-1304 is a relatively novel primate specific miRNA that was recently discovered at

very low levels in human embryonic stem cells and after differentiation of these cells

into embryonic bodies (Morin et al. 2008). Since then deep RNA sequencing studies

have found miR-1304, also lowly expressed, in diverse tissues such as peripheral

blood, brain cortex and melanoma (Mart et al. 2010; Stark et al. 2010; Vaz et al.

2010) but its targets and function remain largely unknown. The in silico approach

based on target site predictions performed in this work allowed us to gain insights

into the putative functional differences between the two versions of miR-1304. One of

the main restrictions to find target genes for the ancestral miR-1304 was the dearth

of good quality Neanderthal sequence data. The use of the modern humans genome

for target gene predictions may have lead us to disregard Neanderthal target genes

that diverged from human genes in their 3UTRs; nevertheless, we did not find false

positive as all target genes for the ancestral miR-1304 that could be tested (33 out of

37, 89%) have an identical and conserved binding site in the Neanderthal and human


18/38

18

genomes.

Remarkably, we observed a significant difference in the number of predicted target

genes between both miRNAs: the derived version of miR-1304 has more than 14

times more predicted targets than the ancestral one, which is indicative of a critical

functional evolution for miR-1304. Interestingly, the analysis performed using the

Ingenuity software associated the predicted targets of derived miR-1304 with

biological processes and disorders related to central nervous system development

and function which suggests that the evolutionary change of miR-1304 may affect

aspects of human brain functioning and cognition. Previous work showed that SNP

variants in the vicinity of miR-22, miR-148a and miR-488 associate with panic

disorder and that these miRNAs effectively repress candidate genes for anxiety

(Muios-Gimeno et al. 2011). In this context, involvement of miR-1304 in brain

function regulation raises the interesting possibility of particular neurological

phenotypes being associated with one miR-1304 allele or the other. On the other

hand, comparison of the Neanderthal genome and modern humans genomes

identified a number of genomic regions that may have been affected by positive

selection in ancestral modern humans, including regions involved in cognitive abilities

like NRG3, a gene involved in schizophrenia (Green et al. 2010). Taken together

these data suggest that human cognition has been an important target of recent

human evolution that could have been shaped in part by miRNAs.

Among the few predicted target genes for the ancestral miR-1304, CD24 and the

transcription factor 4 (TCF4) are of interest for their involvement in neurological

disorders in humans. CD24 has been associated with multiple sclerosis (Zhou et al.

2003) and TCF4 (predicted by TargetRank and TargetScan) has been recently

associated with a range of neuropsychiatric phenotypes including schizophrenia,


19/38

19

impaired verbal learning and Pitt-Hopkins syndrome (Amiel et al. 2007; Stefansson et

al. 2009; Lennertz et al. 2011). Two other noteworthy target genes are ENAMand

AMTN, both involved in odontogenesis. We focused on these genes due to the

known dental differences between Neanderthals and modern humans, and

demonstrated the conservation of their 3'UTRs among primates as well as their

differential response after transfection with either the derived or the ancestral miR-

1304. These two genes are involved in teeth formation and map near each other in

an interesting cluster on chromosome 4 together with other genes also involved in

dental formation as well as salivary proteins such as ameloblastin (AMBN) or mucin 7

(MUC7).

Tooth enamel, the hardest substance in vertebrates, is formed by epithelium-derived

ameloblasts. As ameloblasts differentiate, they deposit specific proteins necessary

for enamel formation, including amelogenin, ameloblastin and enamelin, in the

organic enamel matrix. Enamelin is the largest protein in the enamel matrix of

developing teeth. It is involved in the mineralization and structural organization of

enamel. Amelotin was discovered in mouse, where it is specifically expressed in

maturation-stage ameloblasts. It has been hypothesized that it functions as a

protease helping the processing of the enamel matrix at this stage (Iwasaki et al.

2005). We can only speculate about the function of the ancestral miR-1304 in

Neanderthals but, given the involvement ofENAMandAMTNin odontogenesis, their

observed repression by the ancestral miR-1304 could implicate this miRNA, acting

together with other divergent genes, in a range of differences related to Neanderthal

and modern humans dentition (Macchiarelli et al. 2006; Olejniczak et al. 2008). For

example, the union surface between dentine and enamel was more complex in

Neanderthals than it is in Homo sapiens. Additionally, the volume of coronal dentine


20/38

20

was larger in the extinct Homo and, since enamel volume is similar in both species,

this results in significantly thinner cuspal enamel in Neanderthals (Ramirez Rozzi and

Bermudez De Castro 2004; Olejniczak et al. 2008). Moreover it is believed that

enamel cusps formed faster in Neanderthals as evidenced by a significantly lower

periodicity of their enamel growth marks (Retzius marks or perikymata) (Aiello and

Dean 1990), a fact that has often lead to overestimation of Neanderthal's age at

death (Olejniczak et al. 2008; Smith et al. 2009, 2010). This would imply a different

rate of ameloblastic activity, a process that may be influenced by miR-1304. This

hypothesis is in agreement with recent studies performed in rodents that denote that

miRNAs have a prominent role in teeth development being required for normal

ameloblast differentiation and enamel matrix formation (Cao et al. 2010; Michon et al.

2010). Since the ancestral allele of miR-1304 still segregates in some modern

humans, this miR-1304 variant could be involved in dental development and be

associated, for example, with the degree of enamel thickness. Although little is

known about variations of dental morphology among human populations, it has been

reported that average enamel thickness is similar among Asian, European and

African dentitions (Feeney et al. 2010). Nevertheless, given the fact that only about

0.5% of Asian individuals would be homozygous for the ancestral miR-1304 we do

not expect this allele to be involved in phenotypic traits that differ among populations

but rather in less common traits somehow related with disease. In this regard,

defects in enamel formation create the condition known as Amelogenesis Imperfecta

(AI), a disease in which the enamel does not fully form or forms in insufficient

amounts and teeth affected may be discolored, sensitive or prone to disintegration.

AI is commonly inherited as an autosomic trait and ENAM mutations appear to be

responsible for a big part of the autosomally inherited cases. However, genetic


21/38

21

studies provide evidence for the existence of at least one further autosomal AI locus

(Krrman et al. 1997; Dong et al. 2000). The ancestral miR-1304, as repressor of

ENAMandAMTN, is a strong candidate to be involved in the susceptibility to AI and

other forms of enamel hypoplasia. It would be of interest to test this hypothesis in

familial cases of the disorder for which the underlying genetic defect has not been

identified yet and furthermore study if Asian populations show higher AI incidence

than other populations (the exact incidence of AI is uncertain and estimates vary from

1:700 people to 1:14,000 according to the populations studied; Seow 1993). The

finding of correlation between the presence of the ancestral allele of miR-1304 and

the minor allele of rs117342040 in ENAM, a variant that would interfere with the

binding of the ancestral miR-1304 to the mRNA and would avoid its repression

rescuing a hypothetical phenotype, is very appealing. It strengthens the idea that the

presence of the ancestral miR-1304 in modern humans could have some adverse

effect and thus, removal of down-regulation ofENAMcould have been beneficial to

modern humans. Unfortunately, we could not find evidences for a selective sweep

happening in the miR-1304 gene, which would have reinforced this hypothesis.

Finally, we should not forget about other predicted target genes for the ancestral

miR-1304 that are also related to disease such as the above stated CD24 and TCF4

genes that are involved in neurological disorders in humans.

Future analysis on the differential gene repression by the two alleles of miR-1304

and deeper studies on the functional significance of this regulation would be of great

interest not only to gain insights into primate evolution but also in the possible

implication of this miRNA in phenotypic differences among present-day human

populations and its relationship with complex human disorders.


22/38

22

SUPPLEMENTARY MATERIAL

Supplementary material includes 2 figures and 3 tables

ACKNOWLEDGMENTS

We would like to thank M. Valls, B. Kagerbauer and F. Snchez-Quinto for their

technical support and advice and to the anonymous referees whose comments and

suggestions greatly improved this manuscript. Support was provided by the Spanish

National Institute for Bioinformatics (www.inab.org). This work was supported by the

Ministerio de Ciencia e Innovacin, Espaa (BFU2010-18477, BFU2009-06974 and

CGL2009-09013) and the European Union Seventh Framework Programme (PIOF-

GA-2009-236836). This publication has been co-financed by FEDER - European

Regional Development Fund A wayto build Europe. Fieldwork at El Sidrn site has

been funded by the Consejera de Cultura, Principado de Asturias. M.L.V. is funded

by an FI fellowship from the Generalitat de Catalunya.


23/38

23

REFERENCES

Aiello LC, Dean MC. 1990. The Microanatomy and Development of Teeth. In: An

Introduction to Human Evolutionary Anatomy. Academic Press Limited, London. p.

106-132.

Amiel J, Rio M, de Pontual L, et al. (11 co-authors). 2007. Mutations in TCF4,

encoding a class I basic helix-loop-helix transcription factor, are responsible for Pitt-

Hopkins syndrome, a severe epileptic encephalopathy associated with autonomic

dysfunction. Am J Hum Genet. 80:988-993.

Bartel DP. 2004. MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell.

116:281-297.

Bentwich I, Avniel A, Karov Y, et al. (13 co-authors). 2005. Identification of hundreds

of conserved and nonconserved human microRNAs. Nat Genet. 37:766-770.

Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk R, Cuppen E. 2005.Phylogenetic shadowing and computational identification of human microRNA genes.

Cell. 120:21-24.

Borel C, Antonarakis SE. 2008. Functional genetic variation of human miRNAs and

phenotypic consequences. Mamm Genome. 19: 503509.

Brameier M. 2010. Genome-wide comparative analysis of microRNAs in three non-human primates. BMC Res Notes. 3:64.

Brennecke J, Stark A, Russell RB, Cohen SM. 2005. Principles of microRNA-target

recognition. PLoS Biol. 3:e85.

Briggs AW, Good JM, Green RE, et al. (18 co-authors). 2009. Targeted retrieval and

analysis of five Neandertal mtDNA genomes. Science. 325:318-321.


24/38

24

Briggs AW, Stenzel U, Johnson PL, et al. (11 co-authors). 2007. Patterns of damage

in genomic DNA sequences from a Neandertal. Proc Natl Acad Sci USA. 104:14616-

14621.

Burbano HA, Hodges E, Green RE, et al. (20 co-authors). 2010. Targeted

Investigation of the Neandertal Genome by Array-Based Sequence Capture.

Science. 328:723-725.

Cao H, Wang J, Li X, et al. (11 co-authors). 2010. MicroRNAs play a critical role in

tooth development. J Dent Res. 89:779-784.

Carroll SB. 2008. Evo-devo and an expanding evolutionary synthesis: a genetic

theory of morphological evolution. Cell. 11;134(1):25-36.

Chen K, Rajewsky N. 2006. Deep conservation of microRNA-target relationships and

3UTR motifs in vertebrates, flies, and nematodes. Cold Spring Harb Symp Quant

Biol. 71:149-156.

Dong J, Gu TT, Simmons D, MacDougall M. 2000. Enamelin maps to human

chromosome 4q21 within the autosomal dominant amelogenesis imperfecta locus.

Eur J Oral Sci. 108:353-358.

Endicott P, Ho SY, Stringer C. 2010. Using genetic evidence to evaluate four

palaeoanthropological hypotheses for the timing of Neanderthal and modern human

origins. J Hum Evol. 59:87-95.

Feeney RN. Zermeno JP, Reid DJ, Nakashima S, Sano H, Bahar A, Hublin JJ, Smith

TM. 2010. Enamel thickness in Asian human canines and premolars. Anthropological

Science. 118 (3):191-198

Filipowicz W, Bhattacharyya SN, Sonenberg N. 2008. Mechanisms of post-

transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet.


25/38

25

9:102-114.

Finlayson C, Pacheco FG, Rodrguez-Vidal J, et al. (26 co-authors). 2006. Late

survival of Neanderthals at the southernmost extreme of Europe. Nature. 443:850-

853.

Friedman RC, Farh KK, Burge CB, Bartel DP. 2009. Most mammalian mRNAs are

conserved targets of microRNAs. Genome Res. 19:92-105.

Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J. 2003.

Computational and Experimental Identification of C. elegans microRNAs. Mol Cell.

11:1253-1263.

Green RE, Krause J, Briggs AW, et al. (56 co-authors). 2010. A draft sequence of the

Neandertal genome. Science. 328:710-722.

Guidi M, Muios-Gimeno M, Kagerbauer B, Mart E, Estivill X, Espinosa-Parrilla Y.

2010. Overexpression of miR-128 specifically inhibits the truncated isoform of NTRK3 and upregulates BCL 2 in SH-SY 5 Y neuroblastoma cells. BMC Mol Biol. 11:95.

Hindorff LA, Sethupathy P, Junkins HA, Ramos EM, Mehta JP, Collins FS, Manolio

TA. 2009. Potential etiologic and functional implications of genome-wide association

loci for human diseases and traits. Proc Natl Acad Sci USA. 106:9362-9367.

Hofreiter M, Jaenicke V, Serre D, Haeseler Av A, Pbo S. 2001. DNA sequencesfrom multiple amplifications reveal artifacts induced by cytosine deamination in

ancient DNA. Nucleic Acids Res. 29:4793-4799.

Hublin JJ. 2009. The origin of Neandertals. Proc Natl Acad Sci USA 106:16022-

16027.

Iwasaki K, Bajenova E, Somogyi-Ganss E, Miller M, Nguyen V, Nourkeyhani H, Gao


26/38

26

Y, Wendel M, Ganss B. 2005. Amelotin--a Novel Secreted, Ameloblast-specific

Protein. J Dent Res. 84:1127-1132.

Jazdzewski K, Murray EL, Franssila K, Jarzab B, Schoenberg DR, de la Chapelle A.

2008. Common SNP in pre-miR-146a decreases mature miR expression and

predisposes to papillary thyroid carcinoma. Proc Natl Acad Sci USA. 105 (20): 7269

7274.

Krrman C, Bckman B, Dixon M, Holmgren G, Forsman K. 1997. Mapping of the

locus for autosomal dominant amelogenesis imperfecta (AIH2) to a 4-Mb YAC contig

on chromosome 4q11-q21. Genomics. 39: 164170.

Krause J, Lalueza-Fox C, Orlando L, et al. (13 co-authors). 2007. The derived

FOXP2 variant of modern humans was shared with Neandertals. Curr Biol. 17:1908-

1912.

Krol J, Loedige I, Filipowicz W. 2010. The widespread regulation of microRNA

biogenesis, function and decay. Nat Rev Genet. 11:597-610.

Lalueza-Fox C, Rmpler H, Caramelli D, et al. (17 co-authors). 2007. A melanocortin

1 receptor allele suggests varying pigmentation among Neanderthals. Science.

318:1453-1455.

Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A, Bertranpetit J, Krause J.

2008. Genetic characterization of the ABO blood group in Neandertals. BMC Evol

Biol. 8:342.

Lalueza-Fox C, Rosas A, Estalrrich A, et al. (16 co-authors). 2011. Genetic evidence

for patrilocal mating behavior among Neandertal groups. Proc Natl Acad Sci USA.

108:250-253.

Lennertz L, Rujescu D, Wagner M, et al. (14 co-authors) 2011. Novel Schizophrenia


27/38

27

Risk Gene TCF4 Influences Verbal Learning and Memory Functioning in

Schizophrenia Patients. Neuropsychobiology. 63:131-136.

Lewis BP, Burge CB, Bartel DP. 2005. Conserved seed pairing, often flanked by

adenosines, indicates that thousands of human genes are microRNA targets. Cell.

120:15-20.

Lin S, Cheung WK, Chen S, Lu G, Wang Z, Xie D, Li K. Lin MC, Kung HF. 2010.

Computational identification and characterization of primate-specific microRNAs in

human genome. Comput Biol Chem. 34:232-241.

Liu N, Okamura K, Tyler DM, Phillips MD, Chung WJ, Lai EC. 2008. The evolution

and functional diversification of animal microRNA genes. Cell Res. 18:985996.

Macchiarelli R, Bondioli L, Debnath A, Mazurier A, Tournepiche JF, Birch W, Dean

MC. 2006. How Neanderthal molar teeth grew. Nature. 444:748-751.

Mart E, Pantano L, Baez-Coronel M, Llorens F, Miones-Moyano E, Porta S,Sumoy L, Ferrer I, Estivill X. 2010. A myriad of miRNA variants in control and

Huntingtons disease brain regions detected by massively parallel sequencing.

Nucleic Acids Res. 38:7219-7235.

McLean CY, Reno PL, Pollen AA, et al. (13 co-authors). 2011. Human-specific loss

of regulatory DNA and the evolution of human-specific traits. Nature. 471:216-219.

Mellars P. 2004. Neanderthals and the modern human colonization of Europe.

Nature. 432:461465.

Michon F, Tummers M, Kyyrnen M, Frilander MJ, Thesleff I. 2010. Tooth

morphogenesis and ameloblast differentiation are regulated by micro-RNAs. Dev

Biol. 340:355-368.


28/38

28

Morin R, OConnor M, Griffith M, et al. (12 co-authors). 2008. Application of

massively parallel sequencing to microRNA profiling and discovery in human

embryonic stem cells. Genome Res. 18:610-621.

Muios-Gimeno M, Guidi M, Kagerbauer B, Martn-Santos R, Navins R, Alonso P,

Menchn JM, Gratacs M, Estivill X, Espinosa-Parrilla Y. 2009. Allele variants in

functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as

susceptibility factors for anxiety disorders. Hum Mut. 30:1062-1071.

Muios-Gimeno M, Espinosa-Parrilla Y, Guidi M, et al. (14 co-authors). 2011. Human

microRNAs miR-22, miR-138-2, miR-148a, and miR-488 Are Associated with Panic

Disorder and Regulate Several Anxiety Candidate Genes and Related Pathways.

Biol Psychiatry. 69:526-533.

Nielsen CB, Shomron N, Sandberg R, Hornstein E, Kitzman J, Burge CB. 2007.

Determinants of targeting by endogenous and exogenous microRNAs and siRNAs.

RNA. 13:1894-1910.

Olejniczak AJ, Smith TM, Feeney RN, et al. (14 co-authors). 2008. Dental tissue

proportions and enamel thickness in Neandertal and modern human molars. J Hum

Evol. 55:12-23.

Pickrell JK, Coop G, Novembre J et al. (8 co-authors). 2009. Signals of recent

positive selection in a worldwide sample of human populations. Genome Research

19(5):826-837

Quach H, Barreiro LB, Laval G, et al. (11 co-authors). 2009. Signatures of purifying

and local positive selection in human miRNAs. Am J Hum Genet. 84:316-327.

Ramirez Rozzi FV, Bermudez De Castro JM. 2004. Surprisingly rapid growth in

Neanderthals. Nature. 428:936-939.


29/38

29

Rosas A, Martnez-Maza C, Bastir M, et al. (18 co-authors). 2006. Paleobiology and

comparative morphology of a late Neandertal sample from El Sidron, Asturias, Spain.

Proc Natl Acad Sci USA. 103:19266-19271.

Skoglund P, Jakobsson M. 2011. Archaic human ancestry in East Asia. Proc Natl

Acad Sci U S A 108:18301-18306

Seow WK. 1993. Clinical diagnosis and management strategies of amelogenesis

imperfecta variants. Pediatr Dent 15: 384-393, 1993

Smith TM, Harvati K, Olejniczak AJ, Reid DJ, Hublin JJ, Panagopoulou E. 2009. Brief

communication: dental development and enamel thickness in the Lakonis

Neanderthal molar. Am J Phys Anthropol. 138:112-118.

Smith TM, Tafforeau P, Reid DJ, et al. (14 co-authors). 2010. Dental evidence for

ontogenetic differences between modern humans and Neanderthals. Proc Natl Acad

Sci USA. 107:20923-20928.

Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG,

Schmidt C, Sturm RA, Hayward NK. 2010. Characterization of the Melanoma

miRNAome by Deep Sequencing. PloS one. 5:e9685.

Stefansson H, Ophoff RA, Steinberg S, et al. (87 co-authors). 2009. Common

variants conferring risk of schizophrenia. Nature. 460:744-747.

Stringer CB, Hublin JJ. 1999. New age estimates for the Swanscombe hominid, and

their significance for human. J Hum Evol. 37:873877.

Sun G, Yan J, Noltner K, Feng J, Li H, Sarkis DA, Sommer SS, Rossi JJ. 2009.

SNPs in human miRNA genes affect biogenesis and function. RNA.

15:1640-1651.


30/38

30

Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A.

2010. Analysis of microRNA transcriptome by deep sequencing of small RNA

libraries of peripheral blood. BMC Genomics. 11:288.

Vinci S, Gelmini S, Pratesi N, Conti S, Malentacchi F, Simi L, Pazzagli M, Orlando C.

2011. Genetic variants in miR-146a, miR-149, miR-196a2, miR-499 and their

influence on relative expression in lung cancers. Clin Chem Lab Med. DOI:

10.1515/CCLM.2011.708 Published Online ahead of

printing.

Zhou Q, Rammohan K, Lin S, et al. (14 co-authors). 2003. CD24 is a genetic modifier

for risk and progression of multiple sclerosis. Proc Natl Acad Sci USA. 100:15041-

15046.


31/38

31

Table 1. Target gene prediction for the ancestral version of miR-1304 by TargetRank

Conserved SeedMatches

Non-conserved SeedMatches

Gene Target Gene Score Total 8merM8

7merA1

7mer 6mer 8merM8

7merA1

7mer 6merConservedin Primates

PTGFRN prostaglandin F2 receptor negative regulator 0.337 1 0 0 0 0 1 0 0 0 H, N, C

DEK DEK oncogene 0.309 1 0 0 0 0 1 0 0 0 H, N, C

AMTNamelotin 0.302 1 0 0 0 0 1 0 0 0 H, N, C

CD24 CD24 antigen precursor 0.281 1 0 0 0 0 1 0 0 0 H, N

PIK3AP1 phosphoinositide-3-kinase adaptor protein 1 0.281 1 0 0 0 0 1 0 0 0 H, N, C

C1orf85 kidney predominant protein NCU-G1 0.263 2 0 0 0 0 1 1 0 0 H, N, C

CAMKK2 calcium/calmodulin-dependent protein kinase b 0.261 2 0 0 0 0 1 1 0 0 H, N, C

KATNAL

katanin p60 subunit A-like 1 0.259 1 0 0 0 0 1 0 0 0 H, N, C

MGC130

hypothetical protein LOC91368 0.259 1 0 0 0 0 1 0 0 0 H, N, C

FOXH1 forkhead box H1 0.257 1 0 0 0 0 1 0 0 0 H, N, C

DLST dihydrolipoamide S-succinyltransferase 0.253 1 0 0 0 0 1 0 0 0 nr

ENAM enamelin 0.253 1 0 0 0 0 1 0 0 0 H, N, C

RIC8A resistance to inhibitors of cholinesterase 8 0.253 1 0 0 0 0 1 0 0 0 H, N, C

C1orf21 chromosome 1 open reading frame 21 0.251 2 0 0 0 0 0 1 1 0 H, N, C

TNNI1 troponin I 0.240 3 0 0 0 0 1 0 0 2 H, N, C

RBPMS2 RNA binding protein with multiple splicing 2 0.237 2 0 0 0 0 0 0 1 1 nr

IGFBP3 insulin-like growth factor binding protein 3 0.237 1 0 0 0 0 0 1 0 0 H, N, C

TCF4a

transcription factor 4 0.237 1 0 0 0 0 0 1 0 0 H, N, CFIZ1 FLT3-interacting zinc finger 1 0.236 2 0 0 0 0 0 1 1 0 H, N, C

CABP7 calcium binding protein 7 0.210 1 0 0 0 0 1 0 0 0 H, N, C

CLCF1 cardiotrophin-like cytokine factor 1 0.210 1 0 0 0 0 1 0 0 0 H, N, C

GRAP GRB2-related adaptor protein 0.210 1 0 0 0 0 1 0 0 0 H, N, C

KLF15 Kruppel-like factor 15 0.210 1 0 0 0 0 1 0 0 0 H, N, C

LRRN2 leucine rich repeat neuronal 2 0.210 1 0 0 0 0 1 0 0 0 H, N, C
http://mbe.oxfordjournals.org/http://mbe.oxfordjournals.org/


32/38

32

PI4K2A phosphatidylinositol 4-kinase type 2 alpha 0.210 1 0 0 0 0 1 0 0 0 H, N, C

SLAMF8 SLAM family member 8 0.210 1 0 0 0 0 1 0 0 0 H, N, C

TNIP2 A20-binding inhibitor of NF-kappaB activation 0.210 1 0 0 0 0 1 0 0 0 H, N, C

ATP1B3 Na+/K+ -ATPase beta 3 subunit 0.209 1 0 0 0 0 0 1 0 0 H, N, C

L3MBTL3 Lethal (3) malignant brain tumor-like 0.209 1 0 0 0 0 0 1 0 0 H, N, C

SOX17 SRY-box 17 0.209 2 0 0 0 0 0 0 1 1 nr

TMED4 transmembrane emp24 protein transport 0.209 1 0 0 0 0 0 1 0 0 H, N

DAPL1 death associated protein-like 1 0.203 1 0 0 0 0 1 0 0 0 H, N, C

EDF1a endothelial differentiation-related factor 1 0.203 1 1 0 0 0 0 0 0 0 H, N, C

FAM90A

hypothetical protein LOC55138 0.203 1 0 0 0 0 1 0 0 0 H, N, CTADA3L transcriptional adaptor 3-like 0.203 1 0 0 0 0 1 0 0 0 H, N

a, target gene prediction common to TargetScan and TargetRank; A1 indicates presence of an adenosine opposite miRNA base 1;M8 indicates a Watson-Crick match to miRNA base 8. Conserved in Primates, indicates conservation of the binding target siteamong different primate species: H, human; N, Neanderthal; C, chimpanzee; nr, no Neaderthal reads available.


33/38

33

Table 2. Top associations of the predicted target genes for the derived version ofmiR-1304 with biological processes

Top Networks Score

Cell Morphology, Cellular Function and Maintenance, Cellular

Movement 51Neurological Disease, Behavior, Genetic Disorder 51Lipid Metabolism, Molecular Transport, Small Molecule Biochemistry 30Cell Cycle, Cellular Development, Cellular Growth and Proliferation 5 Auditory Disease, Genetic Disorder, Neurological Disease 5

Diseases and Disorders p-value Molecules

Genetic Disorder 5,93E-05 - 4,04E-02 24Neurological Disease 5,93E-05 - 4,04E-02 14Cancer 1,27E-03 - 3,10E-02 5

Infection Mechanism 2,12E-03 - 1,81E-02 6Cardiovascular Disease 4,49E-03 - 4,40E-02 4

Molecular and Cellular Functions p-value Molecules

Cellular Assembly and Organization 3,21E-04 - 4,40E-02 16Cell Compromise 3,89E-04 - 3,10E-02 6Cellular Growth and Proliferation 1,13E-03 - 4,83E-02 11Cellular Development 2,00E-03 - 4,68E-02 9Gene Expression 2,12E-03 - 4,83E-02 19

Physiological System Development and

Function p-value Molecules

Nervous System Development andFunction 5,45E-04 - 4,40E-02 13Tissue Morphology 5,45E-04 - 4,83E-02 8Tumor Morphology 1,13E-03 - 3,97E-02 5Connective Tissue Development andFunction 3,48E-03 - 4,83E-02 8Behaviour 4,49E-03 - 4,49E-03 1

The five most significant associations with molecular networks and with differentcategories of biological functions are shown (Ingenuity Pathway Analysis software).


34/38

34

FIGURE CAPTIONS

Fig 1. Genomic sequence conservation of miR-1304 among primates. First row

of the figure shows the RNA sequence of mature reference human miR-1304. The

seed region and the nucleotide change it are highlighted in grey on the genomic DNA

alignment. hsa, Homo sapiens; nea, Homo neanderthalensis; ptr, Pan troglodytes;

ggo, Gorilla gorilla; ppy, Papio pygmaeus; mmu, Macaca mulatta.

Fig 2. Genomic sequence conservation of ENAM and AMTN 3'UTRs among

primates. A; 3UTR of the ENAMandAMTNgenes, the target sequence that binds

the seed region of miR-1304 is highlighted in grey. hsa, Homo sapiens; nea, Homo

neanderthalensis; ptr, Pan troglodytes; ggo, Gorilla gorilla; ppy, Papio pygmaeus;

mmu, Macaca mulatta. B; Sequence alignments for the ancestral miR-1304 (Anc.

miR-1304) showing the predicted binding with the 3UTRs of the Neanderthal ENAM

andAMTNmRNAs.

Fig 3. The ancestral version of miR-1304 targets ENAM and AMTN 3'UTRs.

Results of the luciferase-reporter assay used to test the interaction between

ancestral (Anc.) and derived (Der.) miR-1304 with the ENAMand AMTNgenes. A;

HeLa cells were co-transfected with the miRNA mimic of interest, the Renilla reporter

plasmid pGL4.75 and either the empty pGL4.13 plasmid or pGL14.3 carrying the

3'UTR ofGAD1, ENAMorAMTNfollowed by the firefly luciferase reporter gene. The

previously proven regulation ofGAD1 by miR-7 was used as a positive control. The

ratios of Firefly to Renilla luciferase luminescence are presented after normalization

to the empty pGL4.13 and to the mean of 2 different mimic controls. B; The binding

site for the ancestral miR-1304 was removed from the 3'UTRs in the constructs by


35/38

35

mutagenesis and the luciferase assay was repeated. Each experiment was done in

triplicate and at least 3 independent experiments were performed. Data reported here

are the means SD of independent experiments. Significant associations after

Bonferroni correction (p


36/38

a-miR-1304 GUGUAGAGUGACAUCGGAGUUU

a TGAATCACTTGAGCCCAGGGGTTCGAGGCTACAGTGAGATGTGGCAGGATCACATCTCACTGTAGCCTCAAACCGCTGGGCTCAAGTGTTTa ---------------------------------------------------------------------G---------------------

r ---------------------------------------------------------------------G---T-----------------

o ---------------------------------------------------------------------G---T-----------------

y ------G-----------------------------G----C---------------------------G---T--------T--------

u ------G----------A-----T-----------------------------------T---------G----A-----------G-A--


37/38

A

ENAM

hsa CAGACCTTAAAAAAGCAAGAAGGCCATGACCATCCCTGCCTCGAAACTTGCAAGTCACTTGTCTGAGTTAGTTTCCTTTTGCTTGATnea --------------------------------------------------G--A---------------------------------ptr --------------------------------------------------G------------------------------------ggo --------------------------------------------------G------------------------------------ppy --------------------------------------------------G------------------------------------

mmu -----------------------T-----------------T--------G----T--------------------------C----

AMTN

hsa CCAGGAATTCAGTAAGCTGTTTCAAATTTTTTCAACTAAGCTGCCTCGAATTTGGTGATACATGTGAATCTTTATCATTGATTATATnea ---------------------------------------------------------------------------------------ptr ---------------------------------------------------------------------------------------ggo ---------------------------------------------------------------------------------------ppy --------------------------------G----------------------------G-------------------------mmu ----------------------------------------------T-----------C----------------------------

B

Anc.miR-1304

3- GUGUAGAGUGACAUCGGAGCUU - 5 3- GUGUAGAGUGACAUCGGAGCUU - 5

||||||| |||||||

5... CAAGGCCAUGACCAUCCCUGCCUCGAAACUUG...3 5... AAAUUUUUUCAACUAAGCUGCCUCGAAUUUGG...3

mRNA Neanderthal ENAM mRNA Neanderthal AMTN


38/38

0

0,1

0,2

0,3

0,4

0,5

0,6

0,7

0,8

0,9

1

1,1

1,2

0,2

0,3

0,4

0,5

0,6

0,7

0,8

0,9

1

1,1

1,2

GAD1 ENAM AMTN

Lu

ciferase

activity

hsa-miR-7

Der.miR-1304

Anc.miR-1304

ENAMwt

ENAMdel

AMTNwt

Luciferase

activity

*

*

*

*

*

A

B

Documents

An Ancestral MiR-1304 Allele Present in Neanderthals Regulates Genes Involved in Enamel Formation and Could Explain Dental Differences With Modern Humans