View
2
Download
0
Category
Preview:
Citation preview
51)11
CHARACTERIZATION OF GENES INVOL YED IN HETEROCYST DIFFERENTIATION AND PATTERN FORMATION IN THE
CYANOBACTERIUM ANABAENA SP. STRAIN PCC 7120
A DISSERTATION SUBMITIED TO THE GRADUATE DMSION OF THE UNIVERSITY OF HAW AI'I IN PARTIAL FULFll..MENT OF THE
REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
IN
MICROBIOLOGY
MAY 2008
By
Pritty B. Borthakur
Dissertation Committee:
Sean M. Callahan, Chairperson
David T. Webb
Paul Q. Patek
Maqsudul Alam
Sandra P. Chang
We certify that we have read this dissertation and that, in our opinion, it is satisfactory in scope and quality as a dissertation for the degree of Doctor of Philosophy in Microbiology.
Dissertation Committee
-
ID,ll)j( ik~
Acknowledgments
I am grateful to Dr. Sean Callahan, my advisor, for giving me an opportunity to come back to research on Anabaena, the cyanobacterium that I worked on previously in the labomtory of Dr. Robert Haselkom at the University of Chicago. I thank Dr. Callahan for his discussion and advice throughout this research. I would like to acknowledge my committee members, Dr. David Webb, Dr. Paul Patek, Dr. Maqs Alam, and Dr. Sandre Chang for their time, comments, and suggestious.
I would also like to thank our lab members, Christine Orozco, Shirley Y oungRobbins, Hiroshi Yamaura, Ramya RajagopaIan, Doug Risser, Asha Nayar, Scott Harada, Deborah Lee, Sasa Tom, and Kelly Higa for their help in everyday laboratory situation, companionship, and friendship. I acknowledge Chirstine for her help at the beginning of my research, Shirley for her work on acetylene reduction. Hiroshi for his constant support, and Doug for his scientific discussion.
I gratefully acknowledge Mr. Peter Whiticar, Chief, SID/AIDS Prevention Branch, Department of Health, for allowing me to carry on this research.
I thank my parents for their support and encoumgements for higher education. I also thank my mother-in-law for her patience during her visit to Hawaii. She understood that it was quite a challenge to carry on my research with a full-time job. It would not have been possible without the everlasting support of my husband, Dr. DulaI Borthakur. I thank him for his endurance during my long hours of research during evenings, weekends, and holidays, for the past five years. Finally, I would like to thank our two wonderful daughters, Dr. Rajsree Borthakur and to-be-Dr. Gitasree Borthakur for their affection and inspiration, which are the sources of my strength for completing this research.
Abstract
The goal of this research was to understand regulation of heterocyst
differentiation in Anabaena sp. strain PCC 7120 (hereafter Anabaena PCC 7120) by
characterizing regulatory genes for heterocyst fonnation and their mutants. Anabaena is
a filamentous cyanobacterium that forms specialized cells for nitrogen fixation. called
heterocysts, which differentiate from vegetative cells at intervals of 10 - 12 cells. Two
genes, patS and hetN. are known to suppress the differentiation of vegetative cells into
heterocysts for establishing and maintaining a pattern of heterocysts along the filament
This study has established that PatS and HetN work independently to suppress
differentiation. Using a patS-deletion strain with conditional expression of hetN, it was
shown in this study that PatS and HetN are members of separate heterocyst suppression
pathways. Inactivation of either of these negative regulators enhances heterocyst
frequencies to >20%, compared to 9% in the wild type. However, inactivation of both
patS and hetN increases heterocyst differentiation to nearly 100%.
A mutant, UHM I 00, was created to study the function of both genes by deleting
patS and making expression of hetN conditional. In the absence of nitrogen in liquid
medium, almost all vegetative cells of UHM 1 00 differentiated to heterocysts, giving rise
to a phenotype called 'multiple contiguous heterocysts' (Mch). Interestingly, UHMlOO
has an Mch phenotype even in the presence of combined nitrogen, which usually
suppresses heterocyst differentiation. UHMIOO was used to study the time course of
heterocyst differentiation. The percentage of cells that differentiated into heterocysts
correlated with the time since induction and was independent of cell density in liquid
ii
medium lacking a fixed nitrogen source. It was expected that in the patS and hetN double
mutant UHMIOO, hetR will be overexpressed in all cells. However, when UHM100
containing hetR-gfp was grown in nitrogen-free medium, the pattern of fluorescence
observed at 48 h after induction showed that hetR was expressed in -55% cells,
suggesting that nitrogen-deprivation did not immediately induce hetR in all cells. Thus,
hetR expression in the absence of patS and hetN was asynchronous. The patS and hetN
double mutant was also used to determine if the position ofheterocysts along the filament
was random or not When the positions of heterocysts relative to other vegetative cells
was examined using statistical analyses for randomness, the distribution of heterocysts
was found to be nonrandom. Time course studies using UHM100 further showed that
heterocyst differentiation occurred in clusters of 2-5 cells at 48 h and the size of the
clusters increased with time. Heterocyst frequency reached -98% after 144 h in the
absence of fixed nitrogen. Clustering ofheterocysts in the filaments ofUHMIOO suggests
that besides PatS and HetN, there are other factors that influence pattern formation in
Anabaena PCC 7120.
A heterocyst-deficient (Her) spontaneous mutant, NSM6, was isolated from
UHMIOO. Complementation of NSM6 by a cosmid clone, pPB6-1, from an Anabaena
PCC 7120 genomic library restored the Mch phenotype of this mutant. By sequencing,
sub-cloning, and further complementation analyses, a novel gene, alr9018, was identified
in a 4.l-kb fragment of pPB6-1. The alr9018 gene is located in the Epsilon plasmid of
Anabaena, and it encodes a 148.7 -kDa protein. The Alr9018 protein contains an NTPase
domain, which is a characteristic of proteins involved in signal transduction. alr9018 is
expressed in both vegetative cells and heterocysts. Similar to alr9018, hetR can also
iii
restore the Mch phenotype in NSM6, suggesting that the NSM6 mutant can be
functionally complemented by mUltiple copies of either a/r9018 or hetR. When palr9018
was transferred to Anabaena PCC 7120, the transconjugants formed -15% heterocysts
compared to -10% heterocysts fonned by Anabaena PCC 7120. The transconjugants
also reduced at least 50% more acetylene than PCC 7120, suggesting that multiple copies
of alr9018 enhance heterocyst development. This is the first report showing that the
Epsilon plasmid of Anabaena PCC 7120 contains genes involved in heterocyst
differentiation. The identification and characterization of alr9018 in the present study
further show that the regulation of heterocyst differentiation in Anabaena is complex.
Further studies will be required to fully understand the complex interactions between
alr9018 and hetR and the role of alr9018 in cell differentiation and pattern formation in
Anabaena PCC 7120.
iv
Contents
Acknowledgements
Abstract
List of Contents
List of Figures
List of Tables
Abbreviations
TABLE OF CONTENTS
CHAPTER I. Heterocyst Differentiation in Anabaena sp. PCC 7120 .......... .
Introduction ....................................................•...•.................. Ultrastructure of a Heterocyst ......................................................... . Physiology of heterocyst. .............................................................. ... Biochemistry and genetics of heterocyst differentiation .................. . Additional genes for regulation of heterocyst development ...........•..... Models of heterocyst differentiation ....................•.............................. Similarities and differences between heterocyst differentiation and other bacterial cell differentiation .........................•...•..........••.................• Specific Objectives ........................................................................ ..
CHAPTER 2. Inactivation of patS and hetN Causes Lethal Levels of Heterocyst Differentiation In The Filamentous Cyanobacterium
Page
i
ii
v
vii
viii
ix
I I 4 5 6 10 11
13 15
Anabaena sp. PCC 7120 18 Introduction. ......... ..... ... ............ .... .... ..... .... ..•. ..•. ...... ............. 18 Result 20 PatS and HetN work independently to suppress differentiation.. ....... ..•.. ..•.. .. .. ...... .. ... .... ..... ..... .. .. .. ..................•... 20 Controlled expression of hetN in a patS-null background. .... ..... .. ... .. ... .. .. .. ... . .. .. .. ........................... ....................... 22 Limiting factors for complete differentiation .................................. . Inactivation of patS and hetN causes complete differentiation of filaments.. .... ......... ..... ..... ........... .......... ....... ..... ... ..... .......•.... 25 Limiting factors for complete differentiation.............. ......................... 30 Induction of hetR and pattern formation in the absence of patS and hetN expression........................................................... .................... 32 Discussion. . ... ...... ... .. ....... .. ... ... ... . ... .. .. ..... .•... .... .. .. ................... 37
v
I "
.·1
I I
1 ., !
I j
.1
!
Contents Page
CHAPTER 3. Identification and Characterization ofa Gene, alr9018, Which Enhances Frequencies of Heterocyst in the Filament of Anabaena sp. 43 PCC 7120 .......................................................................... .
Introduction............................. ......................................................... 43 Results..... .............. ... ...... ... ... ........................................................... 45 Isolation ofHef mutants ofUHM100........................................................ 45 Complementation ofNSM6 with an Anabaena genomic library...... ...... 45 Isolation and characterization ofa cosmid, pPB6-1, that restores an Mch phenotype to NSM6............................................................... 46 Cosmid pPB6-1 contains cloned DNA of the Epsilon plasmid of Anabaena PCC 7120........................................................................... 46 The cloned hetR restores Mch phenotype in NSM6 mutant....................... 50 NSM6 is not an alr9018 mutant......................................................... 56 NSM6 is not a hetR mutant................... ............................................... 56 NSM6 containing alr9018 makes functional heterocysts..................... 56 PCC 7120 containing alr9018 produced increased number ofheterocysts 58 PCC 7120 containing alr9018 fixed more nitrogen than PCC 7120........ 58 The expression of alr9018..................................................•..... 58 Possible functions of alr9018.................................................... 64 Discussion 65
CHAPTER 4. General Discussion...................................................... 67
CHAPTER 5. Materials And Methods................................................. 73 Culture conditions ......................................................................... ... Conjugation ............................................................................. . Selection of transconjugants Mutant selection ........................................................................ . Identifying the phenotype of the mutant ............................................ . NSM strain archival.. .................................................................. . Plasmid constructions ................................................................. . Construction of alr9018-gfp transcriptional fusion Plasmid DNA isolation and analyses ................................................ . Nucleotide sequencing ................................................................. . PCR amplification of DNA fragments ............................................ .. Colony PCR ............................................................................. . DNA sequence analyses .............................................................. . Strains Construction .................................................................... . Microscopy ............................................................................. . Heterocyst number, pattern and statistical analysis ................................ . Acetylene reduction assays ........................................................... .
73 74 75 75 76 79 79 81 81 82 82 83 85 85 87 87 88
CHAPTER 7. References................................................................ 89
vi
.. "
I !
I ·1 !
I i I
I I ,
)
I
I I
.: , :
LIST OF FIGURES i , !
I
Contents Page
Fig 1.1 A schematic representation of physiology of a heterocyst 16
Fig 2.1 PatS and HetN are members of separate heterocyst-suppression 23 pathways
Fig 2.2 In strain UHMI 00 expression of hetN determines the number of 27 cells that will differentiate into heterocysts.
Fig 2.3 Strain UHM \00 forms mature, functional heterocysts 28 I
Fig 2.4 With hetN inactivated, strain UHMIOO differentiates nearly all 29 heterocysts
I Fig 2.5 Extent of heterocyst differentiation as a function of time since 35
:; .1
induction and phase of growth
Fig 2.6 Asynchronous, non-random differentiation of heterocysts by strain 36 UHM I 00.
Fig 3.1 PpetE.hetN chromosomal fusion, strain 7120PN 43
Fig 3.2 Three Het-mutants ofUHMIOO in Cu.N.liquid medium. 47
Fig 3.3 NSM6 and its complemented derivatives NSM6-1 in CuN liquid 48 medium
Fig 3.4 Anabaena PCC 7120 (pPB6-I) showed Mch phenotype even in 52 BG-II N' solid medium.
Fig 3.5 The map of the cloned DNA in pPB6-1 53
Fig 3.6 NSM6 containing alr9018 ORF restored the Mch phenotype 54
Fig 3.7 NSM (phetRhetR) shows Mch phenotype in CuN medium 55 I
Fig 3.8 Strain NSM6 (p90 18) forms mature, functional heterocysts. 57 I .!
I
Fig 3.9 PCC 7120 (p90 18) differentiates 5% more heterocysts compared to 60 j
the wild type i ,j
vii
Contents Page ., ,
Fig 3.10 Acetylene reduction assay of PCC 7120 (p90 18) 61
Fig 3.11 alr9018-gfp expression at 15 h in different strains in N.liquid 62 medium
Fig 3.12 alr9018-gfp expression in the !!.heIR mutant grown in N+ medium 63 at 96 h
Fig 3.13 Hydropathy profile of the amino acid sequences of Alr9018. 64
.;
LIST OF TABLES
.1
viii
ABBREVIATIONS
Mch Multiple contiguous heterocysts
Nlf Nitrogen fixing genes
AhetR hetR is deleted
ApatS pats is deleted
P petE -hetN The normal promoter of hetN is replaced by the copper-inducible
promoter, petE
ix
, I I
I , 'I I I , i I
"
CHAPTER 1
Heterocyst Differentiation In Anabaena Sp. PCC 7120
Introduction
Cyanobacteria are a diverse group of organisms found in fresh or marine waters
and terrestrial habitats. Some cyanobacteria are also found in some extreme habitats
including hot springs, deserts, and polar regions (Whitton and Potts, 2000).
Cyanobacteria are O;r-evolving photosynthetic prokaryotes, and some species of
cyanobacteria are capable of fixing nitrogen under aerobic conditions. They emerged
approximately 3.5 billion years ago as the first photosynthetic prokayotes on the Earth.
Some cyanobacteria are unicellular while others are filamentous. Filamentous
cyanbacteria can have more than 100 cells connected to each other. In the filaments,
most cells can operate independently from each other and can be separated from the
filament to produce several filaments.
Anabaena sp. strain PCC 7120 (hereafter Anabaena PCC 7120) is a filamentous
cyanobacterium that is capable of both photosynthesis and dinitrogen fixation under
aerobic conditions. In the presence of combined nitrogen, such as nitrate or ammonia,
filaments of 100 or more cells grow as undifferentiated chains of vegetative cells. On the
other hand, in the absence of combined nitrogen, approximately 10% of the cells
differentiate into a specialized cell type, called a heterocyst, in a semi-regular pattern. As
the filament grows and the number of vegetative cells between two heterocysts increases,
a single vegetative cell midway between two heterocysts develops into a new heterocyst,
thus maintaining a pattern of one heterocyst in approximately ten vegetative cells.
1 ,.i
I i i
i i
i
I
Anabaena is a simple filamentous nitrogen-fixing cyanobacterium capable of
forming a one-dimensional pattern of single heterocysts separated by 10-12 vegetative
cells. It is a multicellular organism with prokaryotic cell structures that is easy to grow
and suitable for genetic manipulation. Development of heterocysts in the filaments of
Anabaena for nitrogen fixation provides a unique model system for studying cell
differentiation and the underlying genetic regulatory system.
The vegetative cells of Anabaena and other cyanobacteria have the characteristics
of a typical Gram-negative bacterial cell. They contain a cell envelope, which consists of
an inner plasma membrane, a peptidoglycan layer, and an outer membrane. In addition to
these membranes, cells of some Anabaena species are covered with a mucilaginous
sheath made of complex polysaccharides. Cells of Anabaena PCC 7120 do not contain
such a mucilaginous sheath. AF. in other Gram-negative bacteria, the cyanobacterial cell
wall acts as a mechanical and permeability barrier for larger molecules and contains
different transport systems for transfer of large molecules in and out of cells. The porins
in cyanobacterial cell walls are monomers of about 50 to 70 kOa. Between two adjacent
vegetative cells of a filament, there are microplasmodesmata pores for transport of
substrates (Fay 1992). During heterocyst differentiation, about 80% if the existing
micoplasmodesmata are destroyed as the poles of the cell become constricted into narrow
necks leaving smaller areas of contact with the adjacent vegetative cells (Thomas and
Staehlein 2004). Cyanobacteria have an internal system of thylakoid membranes where
the electron transfer reactions of photosynthesis using photosystem I and II and
respiration occur. These membranes contain chlorophyll a and several accessory
pigments. such as phycocyanin and phycoerythrin in the photosynthetic lamellae.
2
i ,I ,
I I , "
,i I
"
i
!
i
!
I !
i
1
I ,I i I 1
i I i
Phycobilisomes, which are water-soluble multiprotein complexes associated with the
thylakoid membranes, constitute about 50% of the total cellular proteins in cyanobacteria
(Grossman et al. 1993). The photosynthetic pigments in cyanobacteria can have different
colors: yellow, red, violet, green, deep blue and blue-green. Due to their blue green
pigmentation (phycocyanin and phycoerythrin) and photosynthetic activity they are often
known as 'blue-green algae'.
Vegetative cells of cyanobacteria are photosynthetic cells that divide and grow
under favorable conditions. In some filamentous cyanobacteria they can differentiate into
three different cell types: (i) Akinetes are spores that can withstand adverse
environmental conditions and remain viable in sediments for many years under harsh
conditions such as cold, darkness and desiccation (Adam and Carr 1981). When suitable
conditions for vegetative growth are restored, the akinete germinates into new vegetative
cells. Thus the akinete appears to be a "resting" stage (Meek et aI. 2002) similar in
function to a spore. (ii) Hormogonia are small motile filaments that are capable of
gliding, and are formed during symbiotic associations with bryophytes. Their production
is inducted by an uncharacterized hormogonia-inducing factor (HIP) secreted by the host
Once the motile hormonogia reach the bryophyte host cavity, they revert back to
vegetative cells and nitrogen fixing heterocysts (Herroro et al. 2004). In the host cavity,
hormogonia differentiation is repressed by a hormogonia-repressing factor (HRF)
produced by the host (Adams 2002). (iii) Heterocysts are specialized nitrogen fixing
cells of filamentous cyanobacteria.
3
, 1 1
I '1 I
I , , ,
! , .1
Heterocysts contain a thick layer of glycoplipid to prevent oxygen getting into the
cell, thus providing a microaerofilic condition for nitrogen fixation (Winkenbach et ai.,
1972). During heterocyst differentiation, PSI! and phycobiliproteins are degraded (Wood
and Haselkorn, 1979, 1980; Wolk et al. 1994) and nitrogenase enzymes are synthesized.
A TP for nitrogen fixation is derived from PSI, and carbon sources, which are required for
generation of NADPH are provided by neighboring vegetative cells (Wolk et al. 1988,
Mum-Pastor and Florencio. 1994). Almost half of the NADPH is used for respiration
and nitrogen fixation in heterocysts (Murray and Wolk, 1989). Atmospheric nitrogen
enters a heterocyst through diffusion, where it is then converted to NH3 by nitrogenase
(Fuchs, G. 1999).
Nz+ 8It" + 8e"+ 16 ATP __ N_iII'_ose_, ..... __ ... 2NH3+ Hz+ 16ADP + 16 PI
Heterocysts transport fixed nitrogen in the fonn of glutamine or arginine to the vegetative
cells (Fay 1992). A review of the literature on the biochemistry and genetics of
heterocyst differentiation is the main objective of this chapter.
Ultrastructure of a heterocyst
Heterocysts are physically distinct from vegetative cells. They have a larger size,
thicker cell wall, and a less granular cytoplasm. The heterocyst cell envelope contains
two specialized layers composed of glycoplipid and polysaccharide that provide physical
protection and prevent oxygen from diffusing in (Fig 1.1). . At the polar ends of
heterocysts, where vegetative celis are attached, the cell wall thickens to fonn two
4
, ,
J i
.I
i i I
"
I
.,
refractile bodies. In terminal heterocysts, there is only one refractile body. Refractile
bodies are made up of cell wall with accumulated nitrogen compound. A heterocyst is
connected to the neighboring cells by a septum containing a plasma bridge called
microplasmodesmata. The microplasmodesmata between a heterocyst and a vegetative
cell is much smaller in pore size than between two vegetative cells (Wolk et aI. 1994).
Recently, it has been shown that there is a functionally continuous periplasm that allows
movement of proteins along the filament inside of a common outer membrane (Vicente et
aI., 2007). During nitrogen fixation, heterocysts and vegetative cells are functionally
independent. The vegetative cells supply fixed carbon, reduced sulphur, and glutamate to
heterocysts. In the heterocyst, fixed nitrogen (NH3) is converted by glutamine synthetase
into glutamine, which is transported to vegetative cells.
Physiology of heterocysts
Heterocyst physiology is different from that of vegetative cells due to its
specialized structure and function. Heterocysts provide a microaerophilic environment to
protect oxygen-labile nitrogenase from oxygen damage by having two additional layers:
a thick glycolipid layer and a thin polysaccaharide layer. The nitrogenase enzyme
requires an oxygen-free environment to function because this enzyme is irreversibly
damaged by oxygen. The small amount of oxygen initially present in heterocysts is used
in respiration and thus the cell achieves an anaerobic condition for the nitrogenase
enzyme to function. Heterocysts lack ribulose-bisphosphate-carboxylase (no Calvin
cycle), PSll, and phycobiliproteins; they do not fix carbon dioxide. Heterocysts receive
carbon supply from adjacent vegetative cells. pssibly through microplasmadesmata
5
I
.j
I
!
i I I
I
I
i ·i " ,
, J
(Fay (992) or the contiguous periplasm (Vicente et aI., 2007). Maltose and sucrose are
believed to be transported from the vegetative cells (Wolk et al. (988). Heterocysts
oxidize sugar via the oxidative pentose phosphate pathway to reduce NADP to NADPH.
The NADPH is then used to provide reductant to nitrogenase reductases or component n
of nitrogenase. The energy for nitrogen fixation comes as A TP from photosystem I.
Atmospheric nitrogen enters heterocysts by diffusion through the cell envelop as well as
from the neighboring cells. Nitrogenase converts nitrogen into ammonia, which is then
assimilated to produce glutamine by the enzyme glutamine synthetase and transported to
vegetative cells.
Biochemistry and genetics of heterocyst differentiation
Heterocyst differentiation takes place in the absence of fixed nitrogen within 24 h.
Some of the events that take place during heterocyst differentiation are described below:
Initiation of heterocyst differentiation: Immediately after nitrogen deprivation, the level
of 2-oxogluratate (2-00) increases in all cells and gives a signal for the absence of
nitrogen in the environment. 2-00 serves as the carbon skeleton for ammonium
assimilation through the glutamine synthetase-glutamate synthase (OS-GOOA T) cycle
(Vazquez-Bermudez et aI., 2000). Within the first hour of nitrogen starvation, the
concentration of 2-00 reaches to its highest level (Zhang et al. 2006) and activates NtcA
NtcA is a transcription factor belonging to the cyclic AMP receptor protein family
that induces transcription of a series of genes involved in nitrogen and carbon metabolism
(Herrero et al. 2004). NtcA activates transcription of hetR within 3 h of nitrogen step
down, a gene necessary for heterocyst differentiation (Buikema and Haselkorn, (991).
6
"
, :
:,1
I
I 1 I I
,I i
,
I I I I I I
,1 I
i ! ,I
,I
I I I I I i I I , :
J
HetR is the master regulator of heterocyst differentiation in Anabaena PCC 7 I 20
(Buikema and Haselkorn 200 I). HetR is a DNA binding protein and its
homodimerization is required for DNA binding (Huang et al 2004). HetR binds the
promoter regions of hetR. hepA. and patS (Black et al 1993, Leganes 1994). Besides
regulating other genes for heterocyst differentiation, heIR also regulates its own
expression (Cai and Wolk 1997). When the Cys-48 residue of hetR was replaced with Ala
residue in Anabaena PCC 7 I 20, the resulting mutant could not dimerize, indicating that
HetR dimerizatin occurs through disulphide bonds (Huang et al 2004). Similarly, a
substitution of Asp- I 7 residue to Glu has been shown to alter DNA binding ability of
HetR, as a result of which the mutant has lost the abilities to promote differentiation
Disser and Callahan 2007). HetR has also been shown to contain auto degradation
protease activity, and the serine residue at position 152 has been reported to be the active
site of protease activity (Dong 2000). However, Risser and Callahan (2007) recently
showed that a Ser to Ala substitution at position 152 did not have any effect on heterocyst
differentiation or patterning in Anabaena PCC 7 I 20. Thus HetR may not have
autodegradative protease activity as previously described (Black et al 1993, Zhang et al
2007).
Heterocyst differentiation: At about 12 h after induction, some vegetative celIs commit
to heterocyst differentiation (Yoon and Golden, 200 I). The biochemical changes in
differentiating cells starts with degradation of light harvesting proteins, phycobilisomes,
(Wood and Haselkorn 1980). Degradation of phycobilisomes is thought to provide
substrates for protein synthesis. In addition, degradation of phycobilisomes minimizes
the absorption of excess excitation energy under the stress situation. This process is
7
1
i i I 'I I
I I I
i ,I
I
"
"
I
i
I
I i
i , i
known as proteolysis and is visible by a color change from blue-green to yellow-green,
which is similar to chlorosis or bleaching (Allan and Smith 1969). NbIA, a small protein
encoded by the gene nblA plays a central role in degradation of phycobilisomes in
Anabaena PCC 7120 (Baier et al. 2004, Bienert et at. 2006). Within 3 h, the expression
of hetR increases in all cells. Expression of nrrA (NrrA is a nitrogen-responsive response
regulator with a DNA-binding domain) starts in the early stage of heterocyst
differentiation (Ehira and Ohmori 2006). The level of Ca2+ ions increases after one to
two hours of HetR expression, which suggests that HetR protease activity degrades the
ea2+ -binding protein CcbP, and releases free Ca2+ (Zhao et al. 2005). HetR is believed
to be a Ca2+ dependent protease and increased levels of ea2+ may be necessary for HetR
fimction to up-regulate other het genes in differentiating cells (Zhao et al. 2005, Shi et al.
2006). During this time, early heterocyst differentiation genes, hepA and devA for
heterocyst envelope synthesis (Y oon and Golden, 200 I); hetC and hetM for glycolipid
layer formation (Khudyakov and Wolk, 1997, Wolk 1996) are also expressed. At 12 h,
vegetative cells that are in the process of differentiation become pro-heterocysts, which
have not yet developed an additional glycoplipid layer on the cell surface (Adam 2000).
The filament grows by increasing the number of vegetative cells between heterocysts,
and when the filament reaches 20 or more vegetative cells between heterocysts, a cell,
which is midway between two heterocysts differentiate to become heterocyst
Pattern formation and pattern maintenance: Heterocyst pattern formation and
maintenance is controlled by genes that have positive effects, such as hetR and patA, and
by genes that have negative effects, such as patS and hetN. Recently, one additional
positive regulatory gene. hetZ (Zhang et al. 2007) and two negative regulatory genes,
8
I
I
I I I
1
I I j I
!
asr1734 (Wu et al. 2007) and patU3 (Zhang et al. 2007) involved in heterocyst
differentiation and pattern fonnation have been reported. The patS gene is involved in
negative regulation of heterocyst differentiation. PatS regulates de novo pattern
fonnation when filaments are induced to differentiate. patS encodes a 17- or 13-amino
acid peptide that prevents binding of HetR to the hetR promoter region (Huang et al.
2004). patS is expressed in developing heterocysts, and overexpression of patS
completely blocks heterocyst development (Yoon and Golden, 2001). The PatS peptide,
which is produced in heterocysts, diffuses to the adjacent vegetative cells and prevents
them from differentiating into heterocysts (Y oon and Golden 200 I). Expression of patS
is induced soon after nitrogen deprivation, and the mUltiple contiguous heterocyst (Mch)
phenotype of a patS mutant is observed at 24 h after nitrogen step down, but thereafter,
the expression of patS returns to preinduction levels, suggesting that PatS controls de
novo pattern fonnation, but may not be the sole factor in controlling the pattern formation
and maintenance (Y oon and Golden 1998). Pattern formation in a patS-deletion strain
shifts from a Mch to a more wild type pattern after 72 hours (Y oon and Golden 200 I).
These observations suggest that there are other factor(s) independent of PatS involved in
pattern maintenance.
Another regulatory gene involved in negative regulation of heterocyst
differentiation is hetN. The hetN gene is predicted to encode a ketoacyl reductase that
serves as a negative factor for heterocyst pattern maintenance (Black and Wolk 1994,
Callahan and Buikema 200 I, and Li et al 20002). When hetN is present on a multicopy
plasmid in Anabaena PCC 7120, it partially prevents heterocyst differentiation (Black
and Wolk 1994). This is different from the multicopy expression of patS, which
9
I , I I I
"I I
I I I
I
I i I I
completely suppresses heterocyst differentiation. Prevention of hetN expression in
Anabaena pee 7120 does not appear to have any visible effects on heterocyst frequency
in 24 h, but it causes a delayed Mch phenotype at 48 h, suggesting that HetN is involved
in maintenance of spacing after the initial heterocyst pattern has been established
(Callahan and Buikema 200 I).
During heterocyst differentiation, patA is involved in the regulation of HetR
activity (Buikema and Haselkom 200 I). The PatA protein sequence indicates that it is a
response regulator of a two-component environmental sensing system. In a patA mutant
and heterocysts are formed primarily at the ends of the filaments (Liang et aI., 1992).
Besides attenuating the negative effects of PatS and HetN on differentiation, PatA
promotes differentiation in a manner that is independent of the antagonistic effects of
PatS and HetN (Orozco et al. 2006). PatA may be required for either hetR transcription
or for posttranslational modification ofHetR (Buikema and Haselkom 2001). A patA
patS double mutant, but not a patA hetN double mutant, produces intercalary heterocysts
with an Mch phenotype (Orozco et al. 2006).
Additional genes for regulation of heterocyst development
Besides hetR. patA. hetN. and patS, there are other genes involved in fine-tuning
of heterocyst differentiation. Recently, Zhang et al. (2007) identified a gene cluster that
regulates both heterocyst differentiation and pattern formation in Anabaena pee 7120.
Among 10 genes in this cluster, two genes designated alr0099. or hetZ. and alrOlOl. or
patU3, have been shown to be directly involved in heterocyst differentiation and pattern
formation. There is a small ORF, patU5, in between hetZ and patU3. The patU5 ORF
overlaps hetZ by eight base pairs. patU5 mutants have not been isolated and the function
10
of this ORF is not known. Mutants of hetZ showed delayed or no heterocyst
differentiation in nitrogen step-down experiments. In contrast, a patU3 mutation
produced a Mch phenotype. Genes hetZ. patU5, and patU3 are inducible upon nitrogen
step-down. The up-regulation of hetZ and patU3 in differentiating cells depends on hetR.
patU3 is required for strong expression of hetZ, whereas functional hetZ reduces its own
expression (Zhang et al 2007). HetZ may bind to DNA and may regulate certain
heterocyst development genes, including its own by binding directly to their regulatory
sequences. Thus, HetZ has some function similarities with HetR.
Recently, Wu et al. (2007) identified another negative regulatory gene for
heterocyst patter formation. The asr 1734 gene inhibited heterocyst development when
present in extra copies in Anabaena PCC 7120. A asr1734 mutant produced 15%
heterocysts, compared to -10% heterocyst in the wild type Anabaena PCC 7120.
Models for heterocyst differentiation
Under nitrogen step down condition, some cells of the Anabaena PCC7120
filament undergo differentiation to become heterocysts. Although every vegetative cell in
the filament has -0.1 probability to differentiate into a heterocyst, the terminal cells have
higher probabilities for differentiation. This implies that there is an interaction between
stimulating and inhibiting factors within each cell for heterocyst differentiation. While
the stimulatory factors stimulate a vegetative cell to differentiate, the inhibitory factor
prevents it from undergoing differentiation. Thus a cell needs essential supports from the
adjacent cells to balance the opposing factors for differentiation. Deprivation of nitrogen
must trigger the cascade of stimulatory effects. It is known that under nitrogen step-
11
down condition, increased levels of 2-00 up-regulates the expression of ntcA, leading to
a high level expression of hetR. The initial stimulatory effects of nitrogen deprivation,
which are characterized by expression of hetR may occur in all vegetative cells.
Therefore. the determination that certain cells will become heterocysts is influenced by
the inhibitory effects exerted by the adjacent neighboring cells. Wilcox and Smith (1973)
demonstrated that proheterocysts at early stages could be made to regress by preventing
inhibition by neighboring cells through filament fragmentation. In comparison to
intercalary cells, the terminal cells receive only half the inhibitory effects from
neighboring cells. This explains why the terminal cells differentiate at higher
frequencies.
Wolk and Quine (1975) also supported the inhibition model, described above, and
proposed a 'one-stage model' to explain the probability of a vegetative cell to become
heterocyst. According to this model, every cell has equal probability to become a
heterocyst under nitrogen depriving conditions. They also postulated the existence of a
diffusible inhibitor made by proheterocysts that pass from cell to cell and is consumed by
neighboring cells. The cells that receive or accumulate less amount of the inhibitory
factor become committed to differentiate into heterocysts.
Meeks and Elhai (2002) expanded the above idea and proposed a 'two-stage'
model to explain the probability of a cell to become heterocyst. According to this idea,
although all vegetative cells in a filament should have equal probability to differentiate
under nitrogen deprivation, only those cells that are in a critical physiological stage of the
cell cycle can express hetR at a high level under the influence of NtcA. In a filament,
cells are at different stages of division and maturity, and only the mature cells can express
12
, , I I I I I
I , 1
i
I , i I
, I , , i ., I ! I
i
j I .. ,
j .j
hetR at high levels. Thus, the mature cells provide the first stage of initiation for
differentiation in the 'two-stage' model. The second stage of the 'two-stage' model is the
same as the inhibition stage of the 'one-stage' model by Wolk and Quine (1975).
Accordingly, the inhibitory diffusible peptide PatS is produced in the cells that express
high levels of HetR. PatS diffuses to the neighboring cells and prevents them from
differentiation. Thus, a gradient of PatS is formed in the filament. Cells located further
away from a hetR- and patS-expressing cell receives the least amount the inhibitory
peptide PatS and therefore can differentiate.
Similarities and differences between heterocyst differentiation and other bacterioJ cell
differentiation
Based on our understanding of spore formation in Bacillus subtilis, development
of swarming cells in Caulobacter crescentus, and differentiation of fruiting bodies in
Myxococcus xanthus, it was long expected that Anabaena would also have a similar
regulatory system comprising an external or internal signal molecule. a histidine kinase
like sensor and response regulator, which would serve as a regulator of transcription for
genes for heterocyst differentiation (Table 2. I). As expected, a signal molecule has been
identified; 2-0G serves as the internal signal for reduced nitrogen availability in the cell.
It has been recently shown that Anabaena PCC 7120 has at least 77 sets of two-
component regulatory proteins. None of these have so far been shown to be directly
involved in heterocyst differentiation.
Surprisingly, nitrogen fIXation in heterocysts requires at least three DNA
rearrangements (Golden et al. 1985). Three DNA elements, 10.5-kb, II -kb, and 50-kb in
13
I
I I
'i I i
size, are excised from the chromosome, resulting in the transcriptional activation of the
nif and hup genes. As a result of this rearrangement, functional nitrogenase enzymes are
synthesized for nitrogen fixation (Haselkorn 1978, 1992).
In Bacillus, there is an alternative sigma factor, which combines with the core
RNA polymerase to produce a new type of RNA polymerase holoenzyme for
transcription of genes involved in sporulation (Table 2.1). It was expected that Anabaena
might also have a similar alternative sigma factor for transcription of genes involved in
heterocyst differentiation. Such an alternative sigma factor directly involved in
heterocyst differentiation has not been found. Although, Aldea et al. (2007) have shown
that the expression of three sigma factor genes sigC. sigE. and sigG are upregulated in the
proheterocyst, these genes hllve not been shown to be directly involved in heterocyst
differentiation. Instead, another gene, hetR, a master regulatory gene for heterocyst
differentiation was discovered. These results show that there is a wide diversity among
different bacteria that undergo differentiation to develop specialized cell types for
specific functions. Differentiation can be achieved in a nwnber of ways that include gene
rearrangement, use of alternate sigma factors for transcriptional activation of specific
genes, a variety of sensor proteins to sense internal or external stimuli, and a regulatory
cascade of genes involving one or more regulatory genes.
Heterocyst differentiation involves a genetic mechanism that requires both
positive and negative regulators to maintain a steady relationship between vegetative
cells and heterocysts. The directionality of the regulatory cascade is orchestrated at
several levels. First, the intemallevels of2-oo determines the expression of the positive
regulator ntcA, which triggers the expression of the early heterocyst development genes,
14
i 1
I ,I I 1
i
.1
I
i
i I
I
i " .1
I i
I
I .1 I
the master regulatory gene for heterocyst differentiation, hetR, and nif genes for nitrogen
fixation. However, the expression of the master regulator is fine-tuned by two negative
regulators, PatS and HetN. Another regulator patA modulates hetR gene expression by
attenuating negative effects of both PatS and HetN on differentiation and promotes
differentiation independent of its effects on PatS and HetN activity (Orozco et al. 2006).
Thus, Anabaena has multiple levels of regulation for heterocyst differentiation and
nitrogen fixation.
Specific objectives
Objective I: Characterization of heterocyst differentiation and pattern formation in the
absence of negative regulators, patS and hetN, in Anabaena PCC 7120.
Objective 2. Identification of additional genes involved in heterocyst differentiation
using the patS-hetN-double mutant UHMIOO.
15
I j
I 'I
I
! I I
.1
" I
I ! I , .,
I ,
C02
fAictoptumodesmata (TflInsportltton through cds)
P SI
Nitrogen fi x:ation
fAtc:,oplasmodcsmati (Tl"lnsportltion through ulls)
{jl--:.~. 1:: "", ...... -... t Vegef.ltive cell
Heterocyst
(Nitrogen Fixation celli
Hydroxy .. ted g~cop/ipid .. yet
Fig. 1.1 . A schematic representation of physiology of a heterocyst.
Transport of fixed nitrogen as ammonia from heterocyst 10 vegetative cell
and sugars to heterocyst takes place through microplasmodesmata, a bridge
between the two types of cells.
16
Table 1.1. Similarities and differences in biochemical and genetics of heterocyst in
compared to three other bacterial cell differentiation.
Characteristics
Purpose of differentiation
Bacterial type
Inducer
Cen wall
DNA
MaJor genes Involved In
differentiation
Signal for dlfferentiatiou
Ultimate fate
Heterocyst
Specialized for nitrogen fixation, ensures
microaerobic condition
Gram-negative
Absence of combined nitrogen such as NO, or
ammonium
Glycolipid and polysaccharides,
impenneable to 0,
Undergo DNA rearrangement resulting
in activation of nif genes, loss of DNA
fragments
Het genes: heIR, hetN, helM, hetC; Pattern genes: patS, patA, Other genes: ntcA
Signal for differentiation Increase
level of2-OG (2a-ketoglutarate)
Heterocyst is terminally differentiated cell, it
dies
Endospore of Badl/JIs subtOJs
Survive harsh environmental
conditions
Gram-positive
Absence of nutrients, harsh environmental
conditions
Dipicolinic acid is • major component of
the inner coat
No gene arrangement
rpoN, Seven genes: spoD closter
External conditions seased by two
component signal transduction pathway
Germinate in suitable condition and develop new vegetative cells
17
Swarming eeIIs of Cau/olnu:ter
cresuntus
Survie harsh environmental
condition
Gram-negative
Absence of nutrients such as phosphate
Flagella attached to cell wall
No gene arrangement
DivJ and PleC, CtrAmaster transcripton
regulator
Fruldog body of Myxoeoecos
xanthos
Survie harsh environmental
condition
Gram-negative
Absence of nutrients
Partial peptidoglycan
No gene arrangement
asgA, asgB,and rpoD
3'-<li-5'External conditions (tri)diphosphate
sed b tw nucleotides c:'pon~ si;ru [(P)PPG!?p) is the
tnmsd cti path global SIgnal for u on way starvation
Divide to new cells Divide to new cells
, I I , , ,
I " I I
'!
I I i
!
"
I I ..
CHAPTER 2
Inactivation of pIllS and hetN eauses lethal levels of beterocyst differentiation In the
filamentous cyanobacterium Anabaena sp. PCC 7120
IThis chapter was published as "Borthakur. P.B., Orozco, C.C., Young-Robbins, S.S., Haselkorn, R.. and Callahan, S.M. (2005) Inactivation of palS and ketN causes lethal levels of heterocyst differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol Microbiol 57: 111-123.,,]
Introduction
Heterocyst differentiation in Anabaena represents one of the simplest
developmental patterns found in a multicellular organism. This simplicity makes it an
ideal system for elucidation of the minimal developmental genetic requirements for the
formation of a sustainable pattern of differentiated cell types. The one-dimensional
pattern of terminally differentiated cells allows the organism to simultaneously carry out
the incompatible processes of non-cyclic photosynthesis and dinitrogen fixation in an
aerobic environment Driving the differentiation of vegetative cells into nitrogen-fixing
beterocysts is HeIR, which is both necessary and sufficient for differentiation (Buikema
and Haselkorn 1991, 200 I ). Expression of hetR involves positive autoregulation, which
appears to have both direct and indirect components that affect some of the four putative
transcriptional start sites in the promoter of hetR (Black et al. 1993; Mura-Pastor et al.
2002). The products of two genes, patS and hetN, are thought to down-regulate the
expression of hetR (Callahan and Buikema 2001; Huang et aI. 2004), which may increase
indefinitely ifleft unchecked.
The gene patS governs de novo pattern formation wben filaments are induced to
differentiate. A patS-null mutant exhibits a phenotype of multiple contiguous heterocysts
(Mch), an altered pattern of shortened vegetative cell intervals (Pat) on nitrogen-<ieficient
18
I I
,; i
'I I
I 1
, ,j
media and abnonnal differentiation in the presence of fixed nitrogen (Yoon and Golden
1998). The gene encodes a 17- or 13-amino acid peptide, and exogenous addition of its
C-terminal pentapeptide to a culture of Anabaena prevents heterocyst differentiation.
Recent evidence that the receptor for PatS signal is cytoplasmic (Wu et aI. 2004) and that
PatS pentapeptide prevents binding of HetR to regions of the hetR promoter (Huang et
aI., 2004) suggests a direct action of PatS in prevention of hetR auto-regulation. To
govern pattern fonnation PatS acts non-cell autonomously (Y oon and Golden 1998).
Consequently, it has been proposed that the PatS peptide diffuses away from
differentiating proheterocysts along the filament to create a gradient of inhibitory signal.
Expression of patS is induced soon after nitrogen deprivation, but after differentiation is
complete, expression of patS returns to preinduction levels, suggesting that patS controls
de novo pattern fonnation but may not be the sole factor controlling maintenance of the
pattern. The fact that a patS-deletion strain shifts from a Pat, Mch pattern of heterocysts
to a more wild-type pattern after 72 hours (y oon and Golden 200 1) suggests that another
factor(s) independent of patS is involved in pattern maintenance.
The hetN gene is predicted to encode a ketoacyl reductase (Black and Wolk,
1994). Unlike a patS mutant, filaments that do not express hetN first develop a nonnal
pattern of heterocysts at 24 hours after induction. It is not until 48 hours that
overproduction of heterocysts results in a Mch phenotype (Callahan and Buikema 2001).
The delay in the Mch phenotype when hetN is not expressed and the fact that hetN is
nonnally not expressed until 12 h after induction (Bauer et a!. 1995) suggest that HetN
does not playa role in de novo heterocyst-pattern fonnation. Instead, it appears to be
necessal)' for maintenance of the pattern as filaments lengthen by cell growth and
19
.1 I , ,
division, and new heterocysts form between existing ones. A low level of HetN protein
is present in vegetative cells under non-inducing conditions, but localization of HetN
protein exclusively to mature heterocysts (Li et aI. 2002) and expression of hetN
primarily in heterocysts after induction (Callahan and Buikema, 200 I) imply that HetN is
involved in production of an inhibitory signal that originates in heterocysts and is
communicated to neighboring vegetative cells. This putative HetN-dependent signal
blocks heterocyst formation at points both upstream and downstream of hetR
transcription. Overexpression of hetN both prevents patterned expression of hetR and the
Mch phenotype that normally results from ectopic expression of hetR from an inducible
promoter. These findings have led to the suggestion that HetN inhibits heterocyst
formation by blocking hetR positive autoregulation (Callahan and Buikema 2001). In
this chapter, the effect of simultaneous inactivation of patS and hetN on heterocyst
differentiation will be presented.
Results
PatS and HetN work independently to suppress differentiation
Both patS and hetN are expressed at low levels in vegetative cells growing with nitrate,
and their expression is induced in proheterocysts when a fixed nitrogen source is
removed from the medium (Callahan and Buikema, 2001; Li et aI. 2002; Yoon and
Golden 200 I). In addition, overexpression or extra copies of either patS or hetN prevent
heterocyst differentiation in a wild-type genetic background (Bauer et aJ. 1995; Black and
Wolk, 1994; Callahan and Buikema, 2001; Yoon and Golden, 1998). It is possible that
patS and hetN work either in parallel as members of independent suppression pathways
20
I I
I I I
"
I
"
i !
, , I ,
or in series as members of a single pathway. If they are members of the same pathway,
each gene should be dependent on the other for its ability to suppress differentiation. If
they represent separate pathways, inactivation of one should not prevent function of the
other. To discriminate between these two possibilities, the ability of patS and hetN to
suppress differentiation in the absence of the other was tested.
Strain PCC 7 I 20, the wild-type strain in this study, forms a pattern of single
heterocysts separated by approximately 10 vegetative ce\1s when grown without a source
of combined nitrogen (Fig. 2.IA). The pattern ofheterocysts in filaments of Anabaena
strain UHMI15, a hetN-nu\1 mutant, was initially wild type, but became Mch
approximately 48 hafter induction (Fig 2. I B). This phenotype is similar to that described
for other hetN mutants (Black and Wolk, 1994; Callahan and Buikema, 2001). In
contrast, strain UHM II 5 carrying extra copies of patS uoder the control of its native
promoter on plasmid pSMCI51 did not form heterocysts in medium lacking fixed
nitrogen (BG-I 10; Fig. 2.1 C). Therefore, patS does not require a functional hetN gene for
its expression or its activity post-transcription.
Unlike patS, extra copies of hetN on a plasmid only partially suppress
differentiation in a wild-type backgrouod (Black and Wolk, 1994), probably due to the
low level of expression of hetN or negative autoregulation of hetN expression. To permit
an uoambiguous assessment of whether hetN requires patS for activity, hetN was
overexpressed from the copper-inducible petE promoter (P petE) in a patS-null mutant
Anabaena strain UHMI 14 has the patS gene deleted and plasmid pSMCl15 (Ca\1ahan
and Buikema, 200 I) carries a copy of hetN with the normal promoter of hetN replaced by
P peJE. In BG-I 10. which has a copper concentration of about 0.3 J,tM and induces half-
21
1 I , :
.1
I
I
I
i
I ! ! I
I
I !
I
I I
I I .,
maximal expression from P petE (Buikema and Haselkorn, 200 I), no heterocyst
differentiation was observed in the patS mutant overexpressing hetN. Therefore, after
transcription of hetN, patS is not required for suppression of differentiation. To
determine if patterned expression of hetN requires patS, a hetN-gfp fusion on plasmid
pSMCI26 (Callahan and Buikerna, 2001) was used to assess expression of hetN in a
!¥JatS background. GFP signal consistent with expression of hetN in maturing
proheterocysts was observed in strain UHM114 carrying plasmid pSMCI26 (Fig. 2.1D)
indicating that normal expression of hetN does not require a functional patS gene.
ControUed expression ofhetN in a patS-null background
Knowing that patS and hetN represent separate pathways, we were interested in the
phenotype of a strain that has both genes inactivated. Anabaena strain UHM 100 was
created to study the effect of simultaneous inactivation of patS and hetN on heterocyst
differentiation and patterning. In this strain patS has been deleted, and the normal
promoter of hetN in the chromosome has been replaced by a copper-inducible promoter,
P petE. Transcription from P petE increases with copper concentration. We reasoned that
inactivation of one of the two suppressors of differentiation should be conditional to
avoid the complication of acquiring additional mutations that down-regulate heterocyst
formation, a problem that has been noted previously in strains that differentiate excessive
numbers ofheterocysts (Black and Wolk, 1994; Buikema and Haselkorn, 1991).
22
I I
1
.1
I
;
I
I ., ,
I ! I
I .,
I , ! ,
"
, 'i
I I I
. , ,
.1 1
Fig. 2. 1. PatS and HetN are members of separate heterocyst-suppression pathways.
(A) The wild-type pattern of heterocysts of PCC 7 120 48 h after induction. (8) The
t1helN mutant stTai n UHM li S is MCH 48 h after induction. (C) Strain UHM 11 5
with extra copies of paIS on pSMC I51 does not differentiate heterocysts. (D)
Strain UHMI15 with apalS-gfp fusion on plasmid pSMC I26 shows transcription of
paIS in heterocysts and proheterocysts.
23
The extent of heterocyst differentiation by strain UHM 1 00 is inversely proportional to the
concentration of copper in the medium, which controls the level of expression of heN
(Fig. 2.2). A concentration of 5 nM copper reduced the number of heterocysts by half,
and complete suppression of differentiation was seen at a concentration of 100 nM.
Heterocyst differentiation by strain 7120PN, which has the coding region of hetN fused to
the petE promoter in a wild-type background, was also controlled by the level of copper,
as expected. Copper concentration had no effect on heterocyst frequency in strains PCC
7120 and UHMI14, which represent the wild-type and the !.patS strains, respectively.
The heterocysts observed in strain UHM 1 00 are mature, functional heterocysts. It
has been noted previously that the products of nitrogen fixation appear to influence
patterning and, therefore, cell differentiation (Yoon and Golden, 2001). It is conceivable
that the excessive differentiation phenotype of UHMl00 at low copper concentrations
could result in the formation of immature, nonfunctional heterocysts that do not fix
nitrogen, and therefore do not prevent excessive differentiation. Mature heterocysts
possess a cell envelope containing a layer of polysaccharide that is necessary for creation
of an anaerobic environment for fixation, one of the last steps in heterocyst maturation.
This polysaccharide layer can be detected by staining with a1cian blue (Gantar et at.,
1995). The presence of a polysaccharide layer in the heterocysts formed by UHMIOO
was confirmed by differential staining with a1cian blue (Fig. 2.3). Acetylene-reduction
assays indicated that UHM I 00 fixes nitrogen at approximately half the rate of the wild
type soon after induction of differentiation and at approximately the same rate thereafter.
Other mutant strains that form more heterocysts than the wild type have been noted to fix
24
, 1
.j I
.1 , ! ! .,
j
I I I
I ,I i ,
·1
·1 1
I 1
I I
nitrogen at a rate equivalent to or below that of the wild type. This is the case with strain
UHMIOO.
Inactivation of patS and hetN causes complete differentiation offlJaments
With hetN inactivated, approximately 97% of cells in filaments of UHM 1 00 were
heterocysts 192 h after induction of differentiation in liquid medium, compared to about
9% of cells in the wild type under the same conditions (Fig. 2.4). The increase in
heterocyst percentage was most dramatic at 24 h post-induction, and 48 h after the switch
to dinitrogen as the sole source of nitrogen over half of the cells in filaments
differentiated (Fig. 2.4.A). Over the next four days, the percentage of cells that
differentiated increased to over 90% (Fig 2.4.B), and thereafter the percentage increased
to nearly 100%, although in liquid BO-1 10 some undifferentiated vegetative cells
remained indefinitely in some filaments. Heterocyst formations by PCC 7120, UHM 114,
7120PN, and UHMIOO in BGI 10 lacking CUS04 are shown in Fig. 2.4.0. UHMIOO
formed about 10% heterocysts with nitrate supplied as a nitrogen source in liquid BO-I I,
similar to the patS-null mutant strain UHMI 14.
Consistent with the results in liquid BO-IlOo plating UHMIOO on solid BO-Ilo
lacking copper to inactivate hetN prevented growth of the strain. Heterocysts are
terminally differentiated and do not divide, so complete differentiation of heterocysts is,
essentially, a lethal phenotype. Surprisingly, UHM 1 00 with hetN inactivated also
underwent complete differentiation on BO-Il agar, which contains approximately 17
mM nitrate. Initially after being plated, the strain appeared to grow normally, forming
green colonies similar to those of the wild type. But after approximately 30 days, several
days after colony size had stopped increasing, the plate culture turned white.
25
1 i I I 1
,i i I I j i ,
I I I
,I I
i A .1
I i
Microscopic analysis of the filaments from the plate revealed that essentially all the cells
had differentiated into heterocysts (Fig. 2.4C). The growth rate of UHMI 00 on both BG-
11 and BG-11 agar was similar to those of PCC 7120, strain 7120PN, and UHM114,
indicating that UHM I 00 is not impaired in its ability to use nitrate as a source of nitrogen
and, premature nitrogen starvation is unlikely to account for excessive differentiation on
nitrate. On a confluent plate, green colonies eventually grew through the layer of white
heterocysts. All of the 8 I colonies isolated and examined produced less than 1%
heterocysts under conditions that induce near complete differentiation of the parent strain,
UHMIOO. Presumably, each of the 81 colonies arose from a cell that acquired a mutation
that prevents or severely down-regulates differentiation. In contrast to nitrate, ammonia
at a concentration of 2 mM suppressed differentiation by UHMIOO.
26
·i
j
I
i i
I I , ,
'I
I I I
I i
i ';I
I I j
100
- 80 ~ 0 -III 60 -III >-u 40 0 I-Q) - 20 Q)
J:
0 1 10 100 1000
CuSo4 (nM)
Figure 2.2. In strain UHMIOO expression of ketN determines the nwnber of
cells that will differentiate into heterocysts. The percentage of heterocysts
fonned by four strains at 96 h after induction is plotted as a function of the
concentration ofCuS04 included in the otherwise standard BO-Ilo. +, PCC
7120; .A.. UHM 114; •• 7120PN; • UHM 100.
27
, 1 , , I ~
I
j I
.1
I ., ,
i 1
, I ,
,.~
Figure 2.3. Strain UHM100 forms mature, functional heterocysts.
Aiclan blue staining of heterocysts detects the presence of
heterocyst-specific polysaccharides in filaments deprived of fixed
nitrogen for 48 h.
28
.1 I ; I
:1 !
i , I
'I
I I , i
I I i I !
:1 I
i I
I
i
I ! , ; , "
D 100
!!80
t: I 20
o 24 48 72 91 120 144 168 19 TIme Ib\
Fig. 2.4. With helN inactivated, strain UHMlOO differentiates nearly all
heterocysts. Strain UHMIOO 48 h (A) and 192 h (8) after being switched to
BG-llo medium lacking CUS04. (C) Cells from BG-l1 agar, which
contains approximately 17 mM nitrate, lacking CUS04 30 days after
inoculation. (D) Plot of the percentage of cells that are heterocysts as a
function of time after being switched to BG-II 0 medium lacking CUS04. .,
PCC 7120; "', UHM114; ., 7120PN; -UHM100.
29
i ',i
.1
I
!
I ,
i .1
I , :
i I
Limiting factors for complete differentiation
With both 8G-llo liquid medium and 8G-ll agar heterocyst differentiation was
asynchronous; cells in filaments did not all differentiate simultaneously 24 hours after
induction, but instead the percentage of heterocysts in filaments of UHM 1 00 increased
over time. Such a lag in complete differentiation suggests four possible scenarios that
may account for the limited rate of heterocyst differentiation when the negative effects of
patS and hetN are removed: i. removal or inactivation of an inhibitor of differentiation
from the medium during growth may be necessary for complete differentiation; ii.
accumulation of a substance that promotes differentiation in the medium during growth
may be necessary for complete differentiation; iii. a minimal amount of time needed for
complete differentiation; iv. or a particular phase of growth may be needed for complete
differentiation.
To address the first two possibilities, the effect of "conditioned" medium on
heterocyst formation was investigated. Cells of UHM I 00 that had differentiated into
mostly heterocysts after 192 h were removed from liquid 8G-ll0 lacking copper, and this
conditioned medium was used to induce heterocyst formation of a second culture of
UHMIOO. The second culture formed heterocysts at a rate similar to that of the first,
indicating that removal or accumulation of a substance that affects differentiation is
unlikely to account for the delay in nearly complete differentiation in liquid 8G-l1 o. The
same type of test was performed using 8G-II agar containing nitrate and lacking copper.
UHMIOO was grown on a filter overlaying the medium. After 30 days filaments had
completely differentiated and the filter was removed. A second culture ofUHMlOO on
the conditioned plate also required approximately 30 days to differentiate completely,
30
1
I 1
I 'I ;
,I
I I
1
I I I
I
indicating that as with liquid 80-110, removal or accumulation of a substance that affects
differentiation is unlikely to account for the delay in differentiation on 80-110 agar.
Removal of nitrate from the plate is an obvious factor that may have limited
differentiation on the plate, but the results above suggest otherwise, because
differentiation of UHMIOO on 80-110 agar is complete after approximately 5 days, and
differentiation on the conditioned plate still required 30 days. To further show that the
conditioned plate retained a substantial concentration of nitrate, a strain of Anabaena
with the hetR gene deleted, UHM I 03, was streaked on the conditioned plate. Despite its
inability to form heterocysts or fIX nitrogen, strain UHM I 03 grew on the conditioned
plate in a manner similar to that of the same strain on a fresh plate of the same medium,
indicating that a substantial concentration of nitrate remained in the conditioned plate.
To address the question of whether time or growth phase of the cells may limit
complete differentiation, liquid cultures of UHMIOO were induced at different cell
densities, and heterocyst percentage, time since induction, and cell density were
monitored. The percentage of cells that are heterocysts correlates with the time since
induction and is independent of cell density in liquid medium lacking a fixed nitrogen
source (Fig. 2.5). A similar approach was taken with UHMIOO on solid medium
containing nitrate, except instead of varying the starting concentration of the cells, the
concentration of the plate culture was reduced after 20 days by restreaking part of the
culture onto a new plate. Filaments of the original plate culture differentiated completely
after approximately 30 days. On the other hand, cells on the restreak:ed plate required an
additional 30 days from the time of restreak:ing (about 50 days total) for complete
differentiation. Complete differentiation on solid media in the presence of nitrate appears
31
I I I 1
, 'I
I
I I I
I
I ,j
I
I '1
I I ,I
, I
to be independent of the duration of time that both patS and hetN are not expressed.
Instead, filaments appear to differentiate completely when the culture ages, vegetative
growth slows, and cells enter stationary phase.
Induction ofhetR and pattern formation in the absence of patS and hetN expression
Both patS and hetN prevent differentiation by negatively regulating the expression of
hetR (Callahan and Buikema, 200 I; Huang et aI., 2004), whose expression is both
necessary and sufficient for differentiation (Buikema and Haselkorn, 1991, 2001). The
lag in complete differentiation when both patS and hetN are inactivated suggests that
either hetR expression increases in all cells and some unknown event downstream of hetR
limits the timing of differentiation, or expression of hetR continues to limit differentiation
in the absence of patS and heIN. In the former case patS and hetN would be the only
factors limiting hetR expression. To distinguish between these two possibilities plasmid
pSMCI27 (Callahan and Buikema, 2001), which contains a hetR-gfp fusion, was
introduced into strain UHMIOO and the fluorescent GFP signal was monitored during
differentiation in BG-110 with both patS and hetN inactivated The pattern of
fluorescence observed at 48 h post-induction, when approximately 55% of cells are
heterocysts, indicates that expression of hetR is not immediate in all cells under inducing
conditions when patS and hetN are inactivated (Fig. 2.6A). Instead, expression of hetR
was apparent in most heterocysts and some vegetative cells that will presumably become
heterocysts within 24 h, as in the wild type, while in other vegetative cells expression of
hetR remained at basal levels.
32
1 I I
i
I I I I .
I I
!
I , !
j I
I I
J
To test whether the delay in complete differentiation may be attributed to the
asynchronous expression of hetR in cells of the filament, plasmid pWB2l6S2.4. a
replicating plasmid that contains heIR under its native promoter (Buikema and Haselkorn.
2001). was added to strain UHMIOO. In the wild-type strain. this plasmid causes
abnonnal differentiation on media containing fixed nitrogen (Buikema and Haselkom,
1991). presumably by increasing expression levels. Extra copies of hetR eliminated the
30-day delay in differentiation seen with UHM I 00 with hetN conditionally inactivated on
solid media containing nitrate. Growth was precluded by near complete differentiation in
3 days with extra copies of hetR. suggesting that the level of expression of hetR limits the
timing of differentiation by individual cells of UHM I 00.
The lack of a negative regulator of heterocyst differentiation that can prevent
complete differentiation when patS and hetN are inactivated raised the question whether
all cells have the same probability of differentiating or if certain positions along the
filament favor differentiation. To address this issue. the occurrence of the various
vegetative-cell intervals (number of vegetative cells between heterocysts) was tabulated
and plotted as the length of vegetative cell intervals versus the frequency of their
occurrence (Fig. 2.6B). The positions ofheterocysts relative to other vegetative cells and
heterocysts was examined using a runs test for randomness to determine if the
distribution of heterocysts along the filament appears to be random. The test indicated
that the distribution of heterocysts was likely nonrandom, with a strong bias in favor of
clusters of heterocysts accounting for the deviation from randomness at 24 h after
removal of fixed nitrogen (p < 0.0002; Experimental Procedures). Analysis of three
replicate experiments gave similar results. A similar bias towards clusters of heterocysts
33
·1 I
, ··1'
I I
I
,I I 1
I , ; I I
,I
I I
I
I
I I
I I i i
I
has been observed in most mutant strains that produce supernumerary heterocysts (Black
and Wolk, 1994; Buikema and Haselkorn, 1991; Callahan and Buikema, 2001; Yoon and
Golden, 1998).
A separate, but related, question concerns the distribution of contiguous
heterocysts along the filament, in effect, ignoring the vegetative-cell intervals that equal
zero and regarding the cluster as a single unit From the plots in figure 3.6B there
appears to be a bias toward even-numbered intervals of vegetative cells between
heterocyst clusters 24 h after induction of differentiation. This bias was also seen in a
hetRR223W mutant that is insensitive to suppression of heterocyst differentiation by
overexpression of patS or hetN and was explained by the possible synchronous division
of nondifferentiating vegetative cells once during the time of heterocyst differentiation
and maturation (Khudyakov and Golden, 2004). The approximate times necessary for
mature heterocyst formation, commitment to differentiation, and vegetative cell division,
24 h, 12 h and 12 h respectively, are consistent with this hypothesis. With the exception
of I-cell intervals, which can be accounted for by the previous argument, the frequency
of vegetative cell intervals decreases as the interval length increases at 48 h after removal
of fixed nitrogen. A similar distribution of contiguous heterocysts was seen in a
hetRR223 W mutant and interpreted as a nearly random distribution of contiguous
heterocysts in filaments (Khudyakov and Golden, 2004).
34
I I
i I i
i
;
I I
I I I
:I I
I I
i i I
I
I j i i J
r-----------,- 2
E c
1 CI ~
~----_r------~-----+O
~~-----------------,
ot------r---y-----; o 24 48 72
Time (h)
u a o
Fig. 2.5. Extent of heterocyst differentiation as a function of time since
induction and phase of growth. The time since induction of heterocyst
formation Is plotted versus the percent of cells that are heterocysts In
filaments of strain UHM100 (lower panel) and cell density as measured
by the absorbance of the culture at 750 nm (upper panel). Starting A7&J
concentrations for both panels: .t... 0.1; •• 0.2; •• 0.4
35
, i I ,
I
I !
,
I I ,
A
B IOOOr------------------,r------------------,
wr7120.Z.a b UKM ,00.2"11
1"00 ! I.
UIIM '00. 192b
.... 100
J ,0
I h bN,.I,.-.-.,-,~~~.._I""' ..... ,I~~~~~ o a 4 6 8 10 12 14 16 'Ie 20 0 Z
_ ...... a1s .. 6 8101214'81820 Veo __
Fig. 2.6. Asynchronous. non-random differentiation of heterocysts by
strain UHM100. (A) Non-uniform transcription from the hetR promoter
as seen from a hetR-gfp fusion on plasmid pSMC127 in UHM100
correlates with the asynchronous differentiation of heterocysts.
Heterocysts that do not show GFP fluorescence most likely indicate older
heterocysts that may have lower levels of hetR expression or lack of
molecular oxygen. which is necessary for proper folding of GFP. (B) Bar
graphs of the frequency of vegetative-cell intervals between heterocysts
in filaments of UHM 1 00 at various times since induction.
36
;
I
I I i I
" 'I
i
I
Discussion
Factors that suppress cellular differentiation to form a developmental pattern are
found in organisms as evolutionarily distant as bacteria and mammals. In the
cyanobacterium Anabaena sp. strain PCC 7120, patS and hetN contribute to
developmental patterning by suppressing the differentiation of vegetative cells into
nitrogen-fixing heterocysts. The activity of each gene in the absence of the other
demonstrates that they do not work in series, but instead are members of parallel
suppression pathways that are, at a minimum, distinct to the point of the respective genes.
Our results do not rule out the convergence of these separate pathways immediately after
patS and/or hetN, and, in fact, the recent discovery of a hetRR223W allele that is less
sensitive to suppression of differentiation by overexpression of either patS or hetN
(Khudyakov and Golden, 2004) suggests convergence of the two pathways before or at
the point of HetR. Because binding of the C-terminal pentapeptide of PatS has been
shown to prevent binding of HetR to presumptive hetR-reguiatory regions (Huang et al.,
2004), the point of convergence of the patS- and hetN-suppression pathways is likely to
beat HetR.
Use of a conditional mutation appears to be essential for the study of
differentiation in the absence of patS and hetN activity. In BG-ll 0 or medium containing
nitrate as a nitrogen source the complete differentiation of filaments by strain UHM 1 00 is
a conditional lethal phenotype that is controlled by the presence or absence of copper in
the medium to activate or inactivate transcription, respectively, of hetN. A true double-
null mutant would, presumably, not grow under either of these conditions because
heterocysts do not divide and are terminally differentiated cells. Although ammonia
37
i
I ,
I
I
j
downregulated heterocyst fonnation in the absence of patS and hetN expression and its
-constant use may allow the isolation of a true patS, hetN double null mutant, maintenance
of heterocyst-free cultures in media containing ammonia requires frequent subculturing
due to inhibition of growth at high ammonia concentration and rapid degradation of
ammonia at high cell concentrations. On the other hand, strain UHMI00 was created and
can be maintained on nonnal BG-ll, which contains copper at a concentration of about
300 nM and activates transcription from the petE promoter to about half its maximum
level (Buikema and Haseikom, 2001). Under these standard growth conditions,
heterocyst fonnation is prevented. and selection for mutations that modulate heterocyst
frequency is eliminated. However, the conditional inactivation of hetN may not be
complete. There is likely to be some transcription of hetN even in the absence of copper.
Although the general nature of the UHM 1 00 phenotype should approximate that of a true
double-null mutant, the extent of differentiation by UHMI00 at different times may
underestimate that of a double-null mutant and may account for the lag in near complete
differentiation of filaments.
HetN protein can be detected in vegetative cells growing in nitrate (Li et aJ.,
2002). Our results suggest that in addition to contributing to patterning of heterocysts
under diazotrophic conditions, hetN also plays a role in preventing differentiation in the
presence of nitrate. A role for patS in suppressing differentiation in nitrate could be
sunnised from the fonnation of heterocysts by a patS-null mutant (Y oon and Golden,
1998), but hetN mutants, including the one created in this study, do not fonn heterocysts
in excess of the wild type in nitrate (Black and Wolk, 1994; Callahan and Buikema,
2001). However, complete differentiation of filaments by UHMIOO is markedly greater
38
I '.!
, I , I
.i , I ! ., , I
I I
I " I
I I I
I , . , , ,
than the approximately 10% differentiation seen in a ft,patS mutant in nitrate, the only
genetic difference in the two strains being a wild-type copy of hetN in the latter to
account for the difference in phenotype.
The phenotype of strain UHMlOO with both patS and hetN inactivated is
markedly different than the recently described HetR R223W mutant AMCl289, which is
insensitive to suppression of differentiation by patS and hetN (Khudyakov and Golden,
2004). If the only affect of the R223W missense mutation was to confer resistance to
suppression by patS and hetN, mutant filaments would be expected to differentiate almost
completely like strain UHMIOO. Instead, the R223W mutant differentiates
approximately 20% heterocysts after prolonged exposure to diazotrophic conditions, does
not produce heterocysts in media with combined nitrogen, initially lags behind the wild
type in the timing of differentiation, and has a lower nitrogen-concentration threshold for
induction of differentiation (Khudyakov and Golden, 2004). However, complete
differentiation is possible when the hetRR223W allele is overexpressed ectopically in a
hetRR223W background. The differences between UHMIOO and AMCl289 can be
explained either by a reduced ability of HetR R223W to activate transcription from the
hetR promoter or by a reduced ability of HetR R223W to initiate differentiation. If HetR
initiates differentiation by activating transcription of other genes as well as its own, the
latter argument may encompass the former.
The most striking phenotypic difference between UHMIOO and AMCl289 is their
behavior with nitrate as a nitrogen source. Reduced ability of the HetR R223 W to effect
differentiation may explain the lack of differentiation of AMCl289, but it does not
account for nearly complete differentiation of UHM 100 on nitrate. The correlation
39
i I
1 I
i I I
I I
j i , I
I , I
I I I I
1
I 'i
1
,!
I i
between extensive differentiation and the age and growth rate of the culture in nitrate
suggests that either the rate of differentiation correlates inversely with the rate of
vegetative-cell division, or a fixed rate of differentiation leads to complete differentiation
once the rate of vegetative-cell division falls below the rate of differentiation. The latter
scenario would imply that patS and/or hetN play a role in regulating the rate of
differentiation in response to growth rate.
It was observed several years ago that hetR appears to act stoichiometrically
instead of catalytically (Buikema and Haselkom, 1991), and recent evidence that HetR
may be a transcriptional activator is consistent with this observation (Huang et at., 2004).
The hetR-promoter region has four putative transcriptional start sites (Buikema and
Haselkom, 2001), one of which is dependent on HetR itself (Muro-Pastor et aI. 2002),
explaining the observed positive autoregulation of hetR (Black et at., 1993), and two of
which are dependent on NtcA (Muro-Pastor et ai., 2002), a member of the CRP family of
regulators, which activates the transcription of several genes in response to the
withdrawal of ammonia (Luque et at., 1994). Our results combined with those of others
support a model for differentiation that has at its center a hetR-positive-autoregulation
pathway that is primed by NtcA-dependent transcription upon nitrogen step-down and is
downregulated by patS- and hetN-dependent pathways. In this model, the ultimate level
of transcription of hetR in each cell detennines whether or not it will differentiate and is
detennined by the combined activities of the two independent suppression pathways. In
the absence of the patS- and hetN-dependent suppression pathways, levels of hetR
transcription spiral out of control due to unchecked positive autoregulation, and all cells
differentiate, as is the case for UHM100. Patterning is determined by the non-
40
I I I
autonomous nature of the suppression pathways, which has been demonstrated only for
patS (Y oon and Golden, 1998). Complete differentiation of filaments in the absence of
ammonia indicates that the ammonium-, patS- and hetN-dependent suppression pathways
are the only substantial suppression pathways that exist to prevent differentiation.
The lack of a pattern of differentiated cells in strain UHMIOO indicates that
suppression of differentiation by patS and hetN are the major influences on patterning.
This conclusion is supported by the similar phenotype of the hetRR223W mutant, which
is insensitive to suppression of differentiation by patS and hetN (Khudyakov and Golden,
2004). Despite complete differentiation of filaments and the lack of a discermole pattern
of cells in UHM I 00 in the absence of patS and hetN expression, the distribution of
heterocysts along filaments is not random. There is a strong bias in favor of clusters of
heterocysts. This tendency towards contiguous heterocysts also exists when cells are
grown in the presence of copper or ammonia prior to induction to eliminate preexisting
heterocysts that may introduce an additional bias towards clusters (Borthakur and
Callahan, unpublished). Therefore, contiguous cells and those adjacent to existing
proheterocysts or mature heterocysts appear more likely to differentiate than those
flanked by vegetative cells. The clustering of differentiated cells that characterizes the
Mch phenotype in Anabaena is typical of mutants that differentiate supernumerary
heterocysts and has also been observed in developmental mutants of other systems. For
example, inactivation of genes involved in patterning of trichomes in Arabidopsis and of
sensory bristles in Drosophila results in clusters of these _ structures forming in place of
the single structures seen in the wild-type organisms (HQIskamp et al., 1999; Simpson,
1990). Clustering of heterocysts in filaments of UHM 100 suggests that factors that
41
.1 !
., 1
! i
I 1
I I , I
I
I .1
I
I I 1
i I 1
J
influence pattern fonnation independent of patS and hetN exist. The nature of the
phenotype suggests that cell lineage (Meeks and Elhai. 2002). diffusion of a positive
activator of differentiation, or a cell contact-based mechanism of induction may influence
heterocyst development in addition to the patS- and hetN-dependent suppression
pathways.
42
'I i I I I
I i
i , .I
I
I I
! -, 'I I I
I
C HAPTER 3
Identification and characterization of a gene, alr90J8, which enhances frequencies of
heterocysts in the filaments of Allabaella PCC 7 120
In troduction
Many genes involved in heterocyst differentiation and pattern fonnation have so
far been identified. These include IlteA, hetR, hetC, heIF, hetP, helL, hetM, helN, hallA,
hepA, hepB, hepC, hepK, palA, patB, patN, palS, palU, devBCA, devH, devR, hewA,
hglG, hglE, hglK, pbpB, and fits (for reviews, see Herrero et al. 2004, Zhang et al. 2006).
It is likely that there are additional genes involved in heterocyst differentiation that are
yet to be identified. Recent identification of additional regulatory genes for heterocyst
differentiation, hetZ, palU3 (Zhang et al. 2007) asrl734 (Wu et al. 2007), and /raG
(Nayar et al. 2007) further supports the hypothesis that additional genes for heterocyst
differentiation exist. The objective of this chapter is to identify and characterize such
genes.
UHM IOO is a derivative of PCC 7120, where patS, a negative regulator of
heterocyst differentiation is deleted, and hetN, another negative regulator is expressed
from a copper-regulated promoter (Fig 3.1). Therefore, in presence of copper this strain
reacts
h etM P p e tE he tN he tl
• AT G
Fig 3.1. P pelE'hetN chromosomal fus ion, strain 7120PN (CaBahan and Buikema 200 I).
43
as a single mutant and without copper, this strain behaves as a double mutant of two
negative regulators, HetN and PatS, that suppress hetR expression. In the hetN-patS
double mutant (UHMIOO grown in copper-free media), the expression of hetR remains
unsuppressed. resulting in a Mch phenotype with nearly all vegetative cell differentiating
to heterocysts. Heterocysts are terminally differentiated cells and do not divide, so in the
absence of copper and fixed nitrogen, complete differentiation of heterocysts is,
essentially, a lethal phenotype. From the lethal phenotype, it may be possible to isolate
mutants ofUHMIOO with either a Her phenotype or a normal heterocyst forming wild-
type like phenotypes. Such mutants may arise as a result of several possible types of
spontaneous mutations. These include the following possibilities:
(i) Mutation in the hetR gene: A mutation in the heIR gene ofUHMIOO should result
in a Het- phenotype. Such a mutant could be complemented by cloned hetR or a
similar positive regulatory gene.
(ii) Mutation in other unknown regulatory genes that may have functions similar to
hetR: It is possible that there are other heIR-like positive regulatory genes in
Anabaena PCC 7120. hetZ identified recently by Zhang et aI. (2007) is an
example of hetR-like a gene. Mutation in such a gene ofUHMIOO should also
result in a Her or normal wild type-like phenotype.
(iii) Uo-mutation in a negative regulator that normally is expressed at a low level in
Anabaena PCC 7120: It is possible that besides hetN and patS, there are
additional negative regulatory genes that are expressed at low levels in Anabaena
PCC 7120. asr1734 and patU3 are two examples of such additional negative
regulatOl)' genes (Wu et al. 2007, Zhang et al. 2007). An up-mutation in such a
44
, I
,I I
I
I , '1 ,
i I
!
,I 'j I ! i I I
J
gene will lead to inhibition of the Mch phenotype in the hetN-patS double mutant,
resulting in nonnal filament fonnation on CuW medium.
Results
Isolation ofHef mutants ofUHMlOO
UHMlOO was grown in BO-II CuW solid agar medium. After 30 days, about
99% of the cells differentiated into heterocysts (Borthakur et al. 2005). At this stage,
nearly all the cells on the agar plate appeared white. However, after careful observation,
a few green colonies were spotted among the white heterocysts. It is possible that these
colonies carry one of the three types of spontaneous mutation that mentioned above.
These green colonies were picked and streaked on BO-B N'" solid medium for
purification and characterization. In Cu"N liquid medium, these strains did not
differentiate and died within 4 days. However in CuW liquid medium, these mutants
grew nonnally like PCC 7120. In this way, three mutants, NSM4, NSM6, and NSM50,
were selected for further characterization (Fig. 3.2). Among three mutants, NSM6 was
selected to continue further work, because the complemented derivatives of this mutant
produced a Mch phenotype similar to the parent strain UHM I 00 (see below).
Complementation of NSM6 with an Anabaena genomic library
An Anabaena PCC 7120 genomic library (Buikema and Haselkom 1991) was
transferred to NSM6 by triparental conjugation. After incubating on BO-B CuWagar
containing 2% LB for 48 h, the conjugation mixture was plated on CuN' agar medium
containing 30 Jlglml neomycin to select for transconjugants. In this medium, the mutant
45
., , ,
I I I ,
I
I ,
,: , : i 1
I
I 1
I ,I j
I !
I
I I
NSM6 grows as well PCC 7120; however, the transconjugants, in which the mutation is
complemented by the wild-type copy of the gene, are expected to regain the Mch
phenotype, and consequently will tum yellow and die. As expected, within two weeks, a
few colonies appeared as yellow-brown (differentiating to heterocysts). In these
colonies, although the majority of cells were beginning to differentiate into pro-
heterocysts, there were a few green undifferentiated vegetative cells, because of which
the strain could be recovered by plating on 80-11 CuW medium. These colonies were
picked and revived by transferring to 80-11 Cu W agar containing 30 J.1g/ml neomycin.
Sixty such colonies were tested for an Mch phenotype in CuW and Cu"N" liquid media.
Eight transconjugants that had an Mch phenotype in Cu"N" liquid media were selected.
Among these, only four transconjugants, NSM6-I, NSM6-2, NSM6-13, NSM6-18,
formed Mch phenotype in both CuW and Cu"N" liquid media. Among these,
NSM6-1 was selected due to its similar Mch phenotype with UHMIOO for identifying
genes for heterocyst differentiation (Fig 3.3).
46
1
I I
.1
I I
I I i .,
i , I
'j i
I I
i
:1
I I
I I
j
Fig. 3.2 Three Hefmutants ofUHMIOO in Cu"N· liquid medium. A. TheNSM6, B. TheNSM4, c. TheNSM50
47
!
I
I
I I
I I , , I I
I
I , , I
i ! i I
Fig. 3.3. NSM6 and its complemented derivatives NSM6-l in CuN liquid medium.
A. NSM6, B. Complemented strain, NSM6-1-2.
48
I
! I j
I I
i I
.!
;
I
I 1
I I
Isolation and characterl:ation of a cosmld, pPB6-I, that restores an Mch phenotype to
NSM6
NSM6-1 is a derivative of NSM6 containing a cosmid that restored the Mch
phenotype. The cosmid was isolated from NSM6-1 and transformed into E. coli.
Restriction digests of the cosmid isolated from E. coli showed that it contained 36 kb of
insert DNA. This plasmid was named pPB6-1. When pPB6-1 was transferred to NSM6,
the transconjugants showed an Mch phenotype, confirming that the cloned DNA in
pPB6-1 indeed contains a gene that restores the Mch phenotype in NSM6. Furthermore,
when pPB6-1 was transferred to PCC 7120, the transconjugants also showed a Mch
phenotype even in BG-ll W medium (Fig 3. 4). Previously, Buikema and Haselkom
(2001) showed that overexpression of heiR in PCC 7120 increases heterocyst frequency
and induces heterocyst differentiation under fully repressing conditions. Similarly,
multiple copies ofa gene cloned in pPB6-I, when transferred to PCC 7120, resulted in a
Mch phenotype under W conditions. This suggests that pPB6-1 contains a gene that also
positively regulates other het genes.
Cosmid pPB6-1 contains cloned DNA of the Epsilon plllsmid of Anabaena PCC 7120
Partial sequencing of the insert DNA in pPB6-1 from the two ends showed that 36
kb DNA from the Anabaena PCC 7120 Epsilon plasmid was cloned in this cosmid. The
map of the cloned DNA in pPB6-1 is shown in Fig. 3.5. Sequence comparison ofpPB6-1
with Anabaena PCC 7120 Epsilon plasmid DNA indicated that pPB6-1 contained 29
open reading frames (ORF), the functions of most of which are not known. Fourteen of
these ORFs were located in a 21-kb Nhel fragment ofpPB6-1. This Nhel fragment was
49
i I
subcloned in plasmid pPBNhel and transferred to NSM6. The Mch phenotype was not
restored by pPBNhel, indicating that the gene conferring a Mch phenotype is not located
within the 21-kb Nhel fragment Therefore, it is likely that this gene is located in the
remaining IS-kb fragment ofpPB6-1. To localize this gene within this IS-kb fragment,
various ORFs were amplified by PCR and sub-cloned into the shuttle vector pAMS04.
These plasmids are summarized in Table 3.1. The resulting plasmids were transferred to
NSM6 and the transconjugants were tested for Mch phenotype on CuW and CuN liquid
BO-ll media. One of these plasmids, pALR9018, containing a 4.1-kb insert, restored
the Mch phenotype in NSM6, suggesting that a gene for heterocyst differentiation is
located within this fragment (Fig. 3.6). The 4.1-kb fragment contains a 3,909-bp ORF,
aJr9018. and 164 bp from the putative promoter region. The alr9018 ORF encodes a
148.7-kDa protein of unknown function. These results suggest that the alr9018 ORF is
involved in heterocyst differentiation.
Extra copies of hetR restores Mch phenotype in NSM6 mutant
To determine if extra copies of heiR can also restore the Mch phenotye in NSM6,
the plasmid phetRhetR, containing heiR, was transferred to NSM6 and the
transconjugants were plated on BO-II N medium. They formed heterocysts like PCC
7120 in BO-II Nliquid medium and showed Mchphenotype in CuNmedium. Thus, the
Mch phenotype of NSM6 was restored by heiR in the mutant NSM6. When the
NSM6(phetRhetR) was grown in liquid CuN medium, it produced Mch phenotype; it
produced almost 98% heterocysts in 48 h (Fig. 3.7).
so
" I
I
I
I I !
I J
Table 3.1 Plasmids containing genes in 14 kb ofpPB6-1
Plasmid Insert size (kb) Gene cloned
pPBPCR-I A total of 5 kb alr900S alr9006 alI9007 alr9008 alr9009 alr9010 alr9011 alr9012
pALR9013 90S bp alI9013
pALR9014 2.2kb alI9014
pALR90IS 2.1 kb alr901S
pALR9016/17 1.6 kb alI90 1 6117
I!ALR9018 4.1 alr9018
51
Function of the gene
unknown unknown unknown unknown unknown unknown unknown unknown Two-component response regulator unknown
unknown
unknown
hypothetica1l!rotein
1
i I !
I I :
I
I
I I , i
I
I
I I I
I
I
j
Fig. 3.4. Anabaena PCC 7120 (pPB6-1) showed Mch phenotype even in BO-ll N'" solid
medium.
A. The Anabaena PCC 7120, in solid, N'"
B. The transconjugants of Anabaena PCC 7120 (ppb6-1) in solid, 144 h
C. The transconjugants of Anabaena PCC 7120 in liquid, N"
D. The transconjugants of Anabaena PCC 7120 (ppb6-1) in liquid, in absence of combined
nitrogen, 144 h
52
I
I j
I I
'I I
, I
i I j
,. ...... .,.- ........ -.,..... .......
~.IfOid~ 4 -.--._--- ----------------.-~---
&1111019 auSI020 et1SICI2l 4l1SlOZ3 ....... ....... .......
Fig_ 35. The map of the cloned DNA in pPB6-1, the 36-kb DNA from
the Anabaena PCC 7120 Epsilon plasmid was cloned in this cosmid.
The sequence 4,674 to 8,528 is not contained in pPB6-1.
53
I I I
I I
I 'I I
I I
i
I
I 'I
I
I I I
.'
Fig. 3.6. NSM6 containing the alr9018 ORF restored Mch Phenotype in CuN,
liquid medium. A. Control: NSM6( pAMS04), B. NSM6 (pALR9018) at 48b, C.
NSM6 (pALR9018), 96h
S4
I
I
I
I
I I ;
J
B .~
Fig. 3.7. NSM (phetRhetR) shows Mch phenotype in CuNmedium.
A. NSM (PAM504), B. NSM (phetRhetR)
55
I
I °1
! i
I
I
I
I
!
NSM6 is not an aIr9018 mutllnt
To detennine if the alr90J8 sequence in NSM carries a mutation, a 4.6-kb
fragment containing the 4.I-kb alr90J8 coding region and a 0.5 upstream region was
PCR-amplified and sequenced using a set five forward and five reverse primers.
Sequence comparison did not show any sequence differences from the published
sequence of alr90J8, indicating that alr90J8 in NSM6 did not carry a mutation.
NSM6 is not a hetR mutant
The Mch phenotype in NSM6 can also be restored by heiR when present in a
multicopy plasmid. Therefore, to determine if NSM6 carries a heiR mutation, the hetR
gene including its promoter region was PCR-amplified and sequenced. Analysis of the
sequence showed that the heiR sequence from NSM6 did not carry any mutation,
suggesting that NSM6 is not a heiR mutant. Thus, NSM6 does not carry a mutation in
either alr90 J 8 or heiR.
NSM6 contalning alr9018 makes mature heterocysts
To determine if the heterocysts made by NSM6 (p90 18) are mature and similar to
those made by PCC 1120, heterocyst-induced cells of PCC 1120, and NSM6 (P9018)
were stained with alcian bue. which binds to the glycolipid layer of mature heterocysts.
The heterocysts ofNSM6 (P9018) were stained with the dye, suggesting that those were
mature heterocysts (Fig. 3.8).
56
I .1 !
i , I I
i
I I
I I
Fig 3.8. Strain NSM6(p9018) fonns mature, functional heterocysts. Alcian blue
staining of heterocysts detects the presence of heterocyst-specific polysaccharides in
liIaments deprived of fixed nitrogen for 96 h. A. NSM6(p9018), B. Alcian blue
stained NSM6(p901 8).
57
i .,
I I
.1
J
pee 7120 containing alr9018 produced increased number of heterocysts
Since NSM6 (P9018) showed Mch phenotype, it was expected that pee 7120
(P9018) might also produce a higher number of heterocysts. Therefore, pee 7120 and
pee 7120 (P9018) were grown in N" liquid medium and the number ofheterocysts was
counted every 24 hours for four days. It was observed that pee 7120 (p90 18) made at
least 5% more heterocysts than pee 7120 (Fig. 3.9).
pee 7120 containing alr9018jixed more nitrogen than pee 7120
pee 7120 (P9018) made -15% heterocysts compared to -10% in pee 7120. To
determine if the higher number of heterocysts in pee 7120 (p90 18) resulted in higher
amounts of nitrogen fixation. strains pee 7120 and pee 7120 (p90 18) were compared
for nitrogen fixation abilities by acetylene reduction assay. pee 7120 (P9018) showed
54% higher acetylene reduction activity than pee 7120 (Fig. 3.10). When the acetylene
reduction activity of NSM6 (P9018) and pee 7120 was compared, NSM6 (P9018)
showed 39% less acetylene reduction activity than pee 7120.
The expression of alr9018
The functional complementation of NSM6 by the alr9018 ORF affects in
heterocyst differentiation. The expression of some genes for heterocyst development
such as hetR increases in the heterocysts, while hetN is expressed primarily in the
heterocyst. Therefore, it was of interest to determine whether alr9018 is expressed
primarily in heterocysts, vegetative cells, or both. To determine the expression of
alr9018 in different cell types, an alr9018 transcriptional fusion was constructed by
58
, ., ,
"
I
I
i
,
I
I
i
cloning a promoterless gfp gene behind the alr9018 promoter. The 236-bp DNA segment
immediately upstream of the ATO start side of alr9018 was fused with the gfp in the
plasmid pAM1956 to obtain the alr9018 fusion plasmid pA1r9018-gfp. Plasmid
pALR9018-gfp was transferred to Anabaena PCC 7120, NSM6, and !:.hetR; and the
transconjugants were grown in BO-ll N- for 15h before observing under the microscope
for gfp expression. In PCC 7120, at 15h, alr9018-gfp expression was observed in about
half of the cells in groups of3-5 cells. Similar observations for alr9018-gfp expression
were made for NSM6 and !:.hetR mutants in 15 h (Fig. 3.11). At 24 h and 48 h also, the
alr9018-gfp expression was observed in nearly half of the cells in all three strains. At 96
h, the alr9018-gfp expression was observed in all cells of PCC 7120, although some cells
were brighter than others. The alr9018-gfp expression in the NSM6 and !:.hetR at 96 h
were also similar to that in PCC 7120. When the cells were grown in N' medium, the
alr9018-gfp expression in PCC 7120 and NSM6 at 96 h were observed in nearly half of
the cells, similar to cells grown in N' medium. Interestingly, the alr9018-gfp expression
in the !:.hetR mutant grown in N' medium at 96 h was significantly different from those in
PCC 7120 and NSM6. In !:.hetR, higher levels of alr9018-gfp expression were observed
in one or two cells every 10-20 cells (Fig. 3.12). Those cells that showed higher levels of
the alr9018-gfp expression showed dark greenish color under normal light
59
! , I I
I I I
,I
I ! , ,
I I
I
I I
i ! I
00
C Pet celltillJe of HEIer ocysts hi tIltr OIJ&l1 De1IIclent Medlton
..... PCC7120 ---PCC 7120 U)90181 20
15 t: Ii! a- 10 e ;; \'; :c 5
0
Oh 2-111 .wI1 OOh Tbne (III
Fig. 3.9. PCC 7120 (P9018) differentiates 5% more heterocysts compared to the
wild type, PCC 7120, in N", 48h. A. PCC 7120, B. PCC 7120 (P9018), and C.
Percent of heterocyst over time by the strains, A and B.
60
I !
"
1
!
I ., i I I !
Acetylene Reduction by PCC 7120 (p9018)
10.0 o pee 7120 o pee 71 20 (p9018)
E 8.0 !:
0 It> r-. 6.0 ~ N J: N 4.0 u 0 E 2.0 !:
0.0
48 h
Fig. 3.10. Acetylene reduction at 48h switched to 8G-11 0 medium. pCC7120 (p90 18) showed increased level of acety lene reduction compared to PCC 7 120.
61
A
Co ' ..
c
I'. I •
I •• I I :. •
. '.,
\
' "', """II . ""'--..
, ......... '. ''''j • . . ..•.•• ......,J
NSM6 (p9018gfp)
Fig. 3.1 1. alr9018-gfp expression in in pee 17120 (p90 1S) (A), t.hetR(p90 1S) (B), and
NSM 6(p901S-gfp) (C) at 15 h in nitrogen deficient medium . .
62
B
Fig. 3.12. a/r90JB-gfp expression in the ",heiR mutant grown in N+ medium at 96 h
was significantly different [Tom those in pee 7120 and NSM6. A. "'heiR (a/r90/B-gfP),
B. pee 7120 (a/r90JB-gfp), C. NSM6 (a/r90JB-g(p)
63
Possible /unctions of alr9018
Based on the deduced amino acid sequence, the alr9018 gene encodes a protein
with 1,302 residues and a molecular mass of 148.70 kOa. It has 41% identity and 59%
similarity with a hypothetical protein, 5110178, of Synechocystis sp. PCC 6803, the
function of which is not known. Hydrophobicity analysis shows that the A1r9018 may be
a cytoplasmic-associated protein with several clusters of7-17 hydrophobic residues (Fig.
3.13). The AIr9018 protein has a conserved domain for NTPase of the NACHT family.
Based on computer analysis, it has a predicted A TP/GTP binding site motif-A (P-loop) at
position 57-64. It has also a cAMP-cGMP dependent protein kinase phosphorylation site
at position 929-932. Based on these domains, A1r9018 may be involved in signal
transduction. Anabaena PCC 7120 has another gene, a1l9020. of the NACHT family.
The NTPase domain is found in the apoptosis proteins of animals as well as in some
fungal and bacterial proteins.
~3r-------------------------------..,~~~'V 4.0 Window: 21 L
3.0 CF
2.0 AM
1.0
o .0 t7WL.\-fllT.ffll\Jft/l -1.0
-2.0
-3.0 -4.0 ~NEZ ~O~~~ __ ~ __ ~~ __ ~~ ________ ~ __ ~~ __ ~R
1 0 1 00 QUERY
Fig. 3.13. Hydropathy profile of the amino acid sequences of AIr9018. This plot was
derived using the internet-based computer program, "HYDROPUS" based on the
principles of outlined by Kyte and Doolittle (1982).
64
! !
i I I
I I I I
j
Discussion
We have identified a novel gene, alr9018, which may be a modulator of
heterocyst differentiation. alr9018 was isolated by first isolating a Her mutant ofa Mch-
phenotype-strain UHMIOO, and then by restoring the Mch phenotype through
complementation. The gene that restored the Mch phenotype of the Her mutant was
localized to the Epsilon plasmid of Anabaena PCC 7120. Sub-cloning and
complementation analyses have established the location of a gene within a 4.1-kb
fragment. Sequence analysis showed that alr9018 encodes a relatively large protein with
1,302 amino acids. heIR on a plasmid restored the Mch phenotype to a Het- NSM6. Like
heIR, alr9018 is also expressed in both vegetative cells and heterocysts. The presence of
an NfPase domain and cAMP-cGMP dependent protein kinase phosphorylation site
indicates that AIr9018 may be involved in signal transduction. It is likely that it
perceives different signals, or the same signal at low and high concentrations in the two
cell types of the Anabaena filament. Such signals may be the presence or absence of
oxygen, glutamine concentration, or the availability of2-OG. It is also possible that such
a regulatory protein may serve as a kinase to add phosphate in one cell type and act as
phosphatase to remove phosphate in the other cell type. This suggests that AIr9018 may
be an enzyme of an alternative pathway for modulation of genes involved in heterocyst
differentiation.
To determine the exact role of alr9018 in heterocyst differentiation, an alr9018
knock-out mutant of PCC 7120 will be required. In order to develop a single-
recombination mutant involving alr9018 in PCC 7120, an internal fragment of size 0.6 kb
was cloned in plasmid pSMC127 to obtain palr9018KO. Plasmid palr9018KO has a Str-
65
; I I
I
I
I I
i
Spc resistance selectable marker and can be mobilized to PCC 7120. It does not contain
an origin of replication for Anabaena and therefore it cannot replicate in PCC 7120. It
was expected that the cloned O.6-kb internal fragment of alr9018 in pa/r9018KO would
undergo a single recombination with the homologous alr9018 sequences in PCC
7120(palr90l8KO) and thereby would produce an alr9018 knock-out mutant Several
attempts to develop such a knock-out mutant so far have been unsuccessful. Although
many Str-Spc resistant derivatives ofPCe 7120 were obtained, further analyses of these
presumed mutants by PCR amplification using different primers showed that these were
not alr9018 knock-out mutants. A different approach to develop such a mutant is
underway.
Recently, Zhang et al. (2007) identified and characterized a novel gene hetZ.
which appears to modulate heterocyst differentiation, but its expression requires HetR.
HetZ has positive effects on heterocyst differentiation, since a hetZ mutant had delayed or
no heterocysts. Another gene, n"A, which encoded a nitrogen-responsive response
regulator, was shown to facilitate heterocyst development (Ehira and Ohmori 2006). An
n"A mutant showed delayed heterocyst development Thus, in pce 7120 there are
additional genes like hetZ and n"A that enhance heterocyst development The alr9018
gene identified in this study also enhances heterocyst formation in PCC 7120. Therefore,
it is concluded that alr9018 is a gene that may be involved in modulation of heterocyst
development.
66
,i I
i I
i I I
I ,I I I i
CHAPTER 4
General Discussion
Anabaena sp. PCC 7120 is an ideal organism for the study of cell differentiation
and pattern fonnation. It is a Gram-negative filamentous bacterium having
photosynthetic ability due to the presence of photosystems I and II. It grows relatively
fast with a generation time of about 12 h. It has a genome size of 7.2 MB, which has
been already sequenced (Kaneko et a!. 2001). The methods for genetic manipulation of
Anabaena including DNA isolation, conjugation, and transposon mutagenesis, have been
well developed. The differentiation of the specialized nitrogen-fixing cell type,
heterocyst, takes place under nitrogen deprivation conditions within 24 h. The
heterocysts are morphologically distinct from the vegetstive cells and observable under
the microscope. Therefore, the induction of differentiation is simple and easy to monitor.
Most importantly, it is a prokaryotic organism with multicellular filaments, thus
combining the features of both prokaryotic and eukaroytic organisms.
There are more than 60 genes known to be involved in heterocyst differentiation
and nitrogen fixation (Kaneko et a!. 200 I), some of which have been characterized.
These include ntcA. hetR. hetC. hetF. hetP. hefT, hetL. hetM. hetN. hanA. hepA. hepB.
hepC. hepK, patA. patH. patN. patS. patu, devBCA. devH. devR. hcwA. hglC. hglE.
hglK, pbpB. jitsZ, and n"A. More recently, additional genes for heterocyst development
and pattern fonnation. including hetZ,patU3, and asr1734. have been identified. Among
these, hetR is the master regulator gene for heterocyst differentiation. HetR encodes a
DNA binding protein that may activate transcription of other genes for heterocyst
67
,I
I I
" I ,
I J
"
differentiation. It also has serine type protease activity that may degrade the negative
regulatory peptide PatS, which interferes with the DNA binding activity of hetR. The
protease activity of HetR may also release additional Ca2+ ions, which is necessary for
up-regulating other het genes in heterocyst differentiating cells (Zhao et al. 2005, Shi et
al. 2006). The expression of hetR is balanced by two negative regulators, HetN and PatS.
In the absence of these two negative regulators, hetR is over-expressed, as a result of
which multiple heterocyst formation takes place. Thus regulation of heterocyst
differentiation is not a unidirectional cascade of gene actions, but a bi-directional
modulation of activation and de-activation of genes. Such complex regulatory switches
are characteristics of eukaroytic systems.
In this study, the negative regulatory roles of the patS and hetN genes were further
elucidated. It was shown that patS and hetN are independent of each other. Inactivation
of either patS or hetN alone in PCC 7120 increases the heterocyst frequency to -20%,
while a patS and hetN double mutant ofPCC 7120 formed up to 98% heterocysts. Thus,
the activity of patS and hetN, in the absence of each other demonstrates that they do not
work in series, but they are members of two distinct pathways. Both of these genes are
involved in balancing hetR expression independently. PatS encodes a 17 or 13 amino
acid peptide that interferes with binding of HetR to DNA, whereas HetN encodes an
oxidoreductase that inhibits the autoregulation of hetR after an initial pattern of
heterocysts has been formed (Yoon and Golden 2001, Callahan and Buikema 2001).
Therefore, in the absence of both patS and hetN, hetR is expressed at higher levels,
leading to formation of an Mch phenotype.
68
·1 I ,
I
I I
i I j I
i I I
I :J
It has also been shown in this study that heterocyst differentiation in the patS-
hetN double mutant, UHM I 00, is a function of time when a source of fixed nitrogen is
absent from the medium. UHMIOO forms approximately 25% heterocysts at 24 h after
induction. At 48 h, the frequency of heterocysts rises to about 50%. At this state,
clusters of 5-10 contiguous heterocysts are seen in the filaments. Growth of this culture
beyond 48 h results in further increases of heterocyst frequency to 98%, which causes
fragmentation of the filaments in liquid medium. The percentage of cells that were
heterocysts correlated with hours after nitrogen step-down, and was independent of cell
density in the liquid medium. The percentage of cells that differentiated into heterocyts
in the patS-hetN double mutant, UHMIOO, is also a function of growth phase, when
nitrate was supplied. Complete heterocyst differentiation of UHM I 00 on solid medium
containing nitrate depended on the age of the culture and not on duration after hetN
suppression. In CuW medium also, UHMIOO develops a Mch phenotype after 4 days.
These results show that in the absence of PatS and HetN, hetR is expressed highly even in
the presence of combined nitrogen. Nitrogen deprivation and simultaneous hetN
suppression induce UHM I 00 to form nearly 100% heterocysts and eventually cause all
cells to die.
Besides hetR, hetN. and patS, there are other regulatory genes in Anabaena that
may also be involved in heterocyst differentiation. For example, a/rOI17, a two-
component histidine kinase is involved in heterocyst development (Ning and Xu (2004).
Similarly, nrrA encodes a response regulator that is required for heterocyst development
(Ehira and Ohmori 2006). The Anabaena genome has at least 77 two-component
regulatory systems (Ashby and Houmard 2006). at least a few of which may be involved
69
I , i I , I I I I I I
in the regulation of heterocyst differentiation and nitrogen fixation. Three other genes
involved in modulation of heterocyst differentiation have recently been identified.
Among these, hetZ is a positive regulator of heterocyst development, while patU and
asr 1734 are negative regulators that reduce heterocyst differentiation. In the present
study, it has been demonstrated that alr9018 is another gene that may play an important
role in heterocyst differentiation.
In the Anabaena filaments, the vegetative cells and heterocysts are dependent on
each other for the supply of fIXed nitrogen and carbon. A strain that differentiates all
cells to heterocyst does not contain vegetative cells next to heterocysts to supply carbon
supply. UHMI00 is such a Mch phenotype strain, which is lethal under both CuN and
CuW conditions, although it lives longer under the latter condition. This strain was
considered ideal to isolate Hef mutants, because such mutants will survive by
overcoming the lethal effects of the Mch phenotype. Such mutations may be located in
hetR, other het genes, or in other un-characterized genes involved in heterocyst
differentiation. Four such Hef mutants ofUHMlOO were selected and purified.
One Het· mutant ofUHMIOO, NSM6, was used to isolate a gene that can restore
the Mch phenotype to the mutant A cosmid, pPB6-1, was isolated which restored the
Mch phenotype of NSM6 and contained cloned DNA from the Epsilon plasmid of
Anabaena PCC 7120. It was not known previously that the Epsilon plasmid contained
any genes for heterocyst differentiation. Transfer of pPB6-1 to NSM6 confirmed that the
cloned DNA in this plasmid contained a gene(s) that restored the Mch phenotype.
Sequence analysis, sub-cloning, and further complementation analyses established that
the alr9018 gene in the Epsilon plasmid restored the Mch phenotype of NSM6. alr9018
70
, , , ,
I I
! ,
I
j
is different from any previously-characterized het genes and it did not show homology
with any genes with known function. alr9018 encodes a relatively large protein of size
148.7 kDa with many short hydrophobic domains, indicating that it may be cytoplasmic-
associated. Domain analysis further showed that it has a conserved domain for NTPase
found in the NACHT family. The NTPase domain is found in the apoptosis proteins of
animals as well as in some fungal and bacterial proteins and may be involved in signal
transduction. Interestingly, hetR on a multicopy plasmid could also restore the Mch
phenotype to NSM6. However. sequence analyses ofPCR-ampIified DNA fragments of
NSM6 containing alr90J8 and hetR showed that these genes did not contain any
mutations. The observations that two different genes in multiple copy can restore the
Mch phenotype ofNSM6, and that the Her phenotype ofNSM6 was not due a mutation
in either alr90 J 8 or hetR, suggest that overexpression of either of these two genes can
bypass the effect of the mutation that causes NSM6 become Hef. The suppressor
mutation in NSM6 could be an up-mutation in a negative regulatory gene such as patU3,
asr1734 "or other yet uncharacterized genes, or it could be a down-mutation in a positive
regulatory gene such as patA. hetZ or yet uncharacterized gene.
alr90 J 8 appears to be a positive regulator of heterocyst development. PCC 7 I 20
containing multiple copies of alr9018 formed -15% heterocysts compared to -10%
heterocysts formed by PCC 7120. Moreover, PCC 7120 carrying plasmid palr90J8
reduced at least 50% more acetylene than PCC 7120. Alcian blue staining confirmed that
the heterocysts formed by NSM6 (paIr9018) and PCC 7120 (paIr9018) were mature and
functional. AIr9018 did not show any structural or domain characteristics ofHetR, which
is known to be a DNA binding homo-dimmer and also a serine protease. However, like
71
"1 ,
i I
hetR, alr9018 is expressed in both vegetative cells and pro-heterocysts. Unlike HetR,
AlrJOJ 8 does not have DNA-binding domain or protease activity, but it may be involved
in signal transduction.
A null mutant of alr9018 has not been isolated in this study. Such a mutant will
establish if this gene is essential for heterocyst differentiation, or it has a supplemen!aIy
role for modulation of het gene regulation. Domain analyses of A1r90 18 reveal that it has
domains such as NTPase, kinase phosphorylation, and A TP/GTP binding site, indicating
that it is a regulatory protein. Site-directed mutagenesis involving substitution of
residues within these domains will establish the existence and possible functions of these
domains. It will be of interest to identify the genes that might be regulated by A1r9018.
A microarry comparison of Anabaena PCC 7120 and an air90J8 null mutant may reveal
the genes regulated by alr9018. The identification and characterization of air90J8 in the
present study further show that the regulation of heterocyst differentiation in Anabaena is
complex, involving both activation and de-activation of genes by different regulatory
genes, some of which may have compensatory roles in modulation of gene function.
Such modulation of gene action may be essential for maintaining a pattern of heterocyst
fonnation in every 10-12 vegetative cells.
72
'I I
"
I
i 1
I
i I
I I !
! I
I I
J
CHAPTERS
Material and Methods
Culture conditions for Anabaena
The wild type Anabaena sp. PCC 7120 and its mutants were grown in BO-II W.
BO-II N". BO-II eu"W. and BO-II eu"N" media, which are described below.
BG-ll N+ contains (gIL): NaN03 (7.5). CaCh.2H20 (0.036). Fe~ Citrate
(0.012). Na2EDTA (0.001). K2HP04 (0.04). MgS04°7H20 (0.075). Na2C03 (0.02). and I
ml of micronutrients. which contains the following components (gIL): H~DJ (0.143).
MnCh04H20 (0.091). Zns04 (0.011). Na2Mo04.2H20 (0002). CuS04.5H20 (0.004).
CO(N03) 2.6H20 (0.002). The media was prepared with these micronutrients and
autoclaved. After it cooled to room temperature, media was buffered by adding HEPES,
pH 7.5, NaCOH3 to a fina\ concentrations of 10mM and 5mM, respectively. For BG-II
Wagar medium, 12 gIL of purified agar was added before autoclaving.
BG-ll N" contains the same components as BO-II W, except that NaN03 is not
added.
BG-ll Cu"W is the same as BO-II W, except that CUS04 was omitted from the
medium, and all solutions were filter sterilized. Plastic ware was washed with lOOmM
HCL, sterilized with 95% ETO", and washed with filter-sterilized water before use.
BG-ll CuN is the same as BO-II Cu-N+ except that NaN03 was omitted. All
Anabaena cultures were incubated at 30°C with 2% COz and continually shaken at 200
rpm.
To induce heterocyst formation, exponentially growing cells at a chlorophyll a
concentration of approximately 15 uglml were washed two times and suspended in BG-
73
I I
I j 'i
I
I I I
I I
I
I
II without combined nitrogen, supplemented with 10 mM HEPES, pH 7.5, 5 mM
NaCOH3 and antibiotics if applicable. For heterocyst induction under copper free
conitions, strains growing in BO-II Cu' W for four days, cells were washed two times
and suspended in BO-II Cu'N medium, supplemented with 10 mM HEPES, pH 7.5, 5
mM NaCOH3 and antibiotics (Neomycine 30 ug/ml).
Culture conditions for Escherichia coli
Escherichia coli strains were grown in Luria-Bertaini (LB) broth for liquid culture
and LB agar for plated cultures. For selective growth, media were supplemented with 50
J.1g1ml ampicillin, 50 J.1g1ml kanamycin and 10 J.1g1ml chloramphenicol cultures were
incubated at 37° C cuntinually shaken at 200 rpm.
Bacterial strains and plasmids
Anabaena and E. coli strains used in this study are shown in Table 5.1. The
recombinant plasmids are shown in Table 5.2.
Conjugation
Twenty ml cultures of the appropriate Anabaena strain were grown in BO-II N+
liquid media with 10 mM HEPES and 5 mM NaCH03. For six days cultures were
incubated with light, at 30° C and continuously shaken at 200 rpm.
A 2 ml overnight culture of UC585 containing the appropriate pRL278 derivative
. was diluted to an optical density of 0.05 at an optical density (OD) of 600 nM (OD600)
(usually 1:100) in LB broth containing the appropriate antibiotics. Diluted cultures were
incubated at 37"C and continuously shaken at 250 rpm for 2 h or until OD600 equaled 0.5.
74
i , ,
I I i ,
j ., I
I ,
Once the OD600 reached 0.5 the E. coli pellet was washed two times with BG-II N+ to
eliminate the LB media and antibiotics. The cell pellet was suspended in 2.4 mls ofBG-
11 N+ and Anabaena cultures were diluted to a chlorophyll a concentration of 10 ug/ml.
A mixture of 1: 1 Anabaena; E. coli. equaling 300 ul was evenly spread onto filters
overlaying BG-II N+ plates with 5% LB.
Selection of trans con jug ants
The Anabaena genomic cosmid clone library in E. coli media was grown
overnight in LB supplemented with 50 J.lg/ml kanamycin. To select for transconjugants,
conjugation mixtures were first plated on filters overlaying Cu' BG-11 W with 2% LB
broth. After two days of incubation, filters were transferred onto Cu' BG-11 N+,
supplemented with 30 J.lg/ml of neomycin. Plates were incubated until colonies
appeared, then transferred to copper-free nitrogen-free BG-II containing 30 J.lg/ml of
neomycin.
Mutant selection
UHMIOO was grown in copper-free BG-11 containing nitrogen supplemented
with ImM ~(S04 )2 and incubated for four days. After the liquid culture reached a
chlorophyll a concentration of 10 ug/ml, 300 ul ofUHMlOO was plated onto copper free
BG-II media containing nitrogen. Cultures were incubated at the same conditions as
previously stated for 30 days. After 30 days all filaments differentiated into 95-99%
heterocysts turning the culture white. Mutant colonies recognized by their green color
75
I
I !
.1 I
I I
i I I
'I , i , I
!
were picked and restreaked for isolation. Each mutant's phenotype was identified, and
the mutant was subsequently stored as a UHMlOO mutant (NSM) at -SO·C.
Identifying the phenotype o/the mutant
To confmn that there was no heterocyst formation in the NSM's, they were
viewed with a Nikon Diaphot 300 microscope at 400x magnification in Cu-BO-II N+.
The same procedure to induce heterocyst formation in wild type was used for NSM (see
above). Exponentially growing cells at a concentration of 15 uglml were washed two
times and suspended in Cu-BO-II N-, supplemented with 10mM HEPES, pH 7.5,5 mM
NaCOH3 and/or antibiotics. All strains were viewed at 24 h and 4S h post nitrogen step
down.
76
J
"
I ! ! I
I !
I I
I i I
j
I I
' I
i
i .,
Table 5"1 Anabaena and E. coli strains use in this study
Strain Relevant cbaracterlstics
Anabaena
strains
PCC 7120 Wild type
UHMI00 P petE"hetN, llpatS
UHMI03 !;.hetR
UHM114 llpatS
UHM115 !;.hetN::n sp'/sm'
7120PN PpelE"hetN
NSM4 A mutant strain ofUHMI00
NSM6 A mutant strain ofUHMI00
NSM50 A mutant strain ofUHMI00
E. cou
strain
DH5a Bacterial strain for transformation,
MCR conjugation and plasmid amplification
77
Source
Pasteur Culture Collection
This study
This study
This study
This study
(Callahan and Buikema, 2001)
This study
This study
This study
Bethesda Research Laboratory
.1
I
I ,
.1 1
.1
., i i I I 1
I
Table 5.2 Recombinant plasmids use in this study
Plasmid Relevant CbaracterIstlcs Source
PIasmids
pSMCl04 Suicide plasmid used to delete heiR This study
pSMCI15 Shuttle vector carrying P petJrheIN fusion (Callahan and Buikema, i 2001) I
pSMCI26 Shuttle vector carrying P~ fusion (Callahan and Buikema, I I 2001) I
pSMCI47 Suicide plasmid used to delete patS This study i 1
pSMCI5I Shuttle vector carrying patS This study " ,
pSMCI69 Suicide plasmid used to reintroduce heIN promoter This study
pSMCl82 Suicide plasmid used to replace hetN with sp'/sm' n This study
interposon
pRL278 Mobilizable suicide vector (Cal and Wolk, 1990)
pPB6-1 Shuttle vector carrying complementing het genes This study
pPBNhel Shuttle vector carrying partial complementing hel genes This study . ~
pPBPCRI Shuttle vector carrying 5-kb Epsilon region This study
pPBPCR2 Shuttle vector carryin8 5-kb Epsilon region This study I I
pBPCR3 Shuttle vector carrying 5-kb Epsilon region This study I pBPCR4 Shuttle vector carrying 5-kb Epsilon region This study I pALR9013 Shuttle vector carryin8 Epsilon gene aIr90 13 This study i
pALR9014 Shuttle vector carrying Epsilon gene alr9014 This study
I pALR90l5 Shuttle vector carrying Epsilon gene aIr9Ol5 This study
pALR9016n Shuttle vector carrying Epsilon gene alr9016I17 This study
pALR9018 Shuttle vector carrying Epsilon gene aIr90 18 This study ,
PAM 1956 PAM505 with gfp, mobilizable shuttle vector This study I I pDUCA7- Shuttle vector with Anabaena genomic clone This study
I Lib
pAM504 Mobilizable shuttle vector (Wei et aI., 1994) I
I pGEMT Cloning vector Promego
pBluescript Cloning vector Stratagene
SK+
1
j 78
I !
:1 ,
NSM strain archival 100 ml UHM 1 00 mutants were grown in BO-ll N+ and resuspended in one ml
of BO-ll N+ media and 80 III of filter sterilized dimethyl sulfoxide (DMSO). The
DMSO was added to preserve the strain. The strains were then archived at -80aC for
future recovery and study.
Plasmid constructions
Plasmid pSMCI04 was used to delete the hetR gene from strain PCC 7120 to
create UHM103. It is a mobilizable plasmid that cannot replicate in Anabaena. A 857-
bp region of DNA located 837 bp upstream of the hetR-coding region and a 967-bp
region of DNA located 51 bp downstream were amplified from the chromosome (using
primers HetR5'for, HetRS'rev, HetR3'for, and HetR3'rev) and fused in a 4-primer PCR
reaction using a previously described procedure (Callahan and Buikema, 2001). The
resulting fragment was cloned into the TA site of plasmid pOEM-T Easy (Prom ega) and
subsequently moved to pRL278 (Cai and Wolk, 1990) as a Bgill-Sacl fragment using
restriction sites engineered in the PCR primers to create pSMCI04.
Plasmid pSMC147 was used to delete the patS gene from straius PCC 7120 and
7120PN (Callahan and Buikema, 2001) to create strains UHMI14 and UHMIOO,
respectively. It is a mobilizable plasmid that cannot replicate in Anabaena. Two DNA
fragments corresponding to 797 bp located 152 bp upstream of patS and 789 bp located
173 bp downstream of patS were amplified from the chromosome (using primers
5'PatSSacF, 5'PatSR, 3'PatSF, and 3'PatSBglIlR) and joined as before. The resulting
fragment was cloned into the TA site ofpOEM-T and subsequently moved to pRL278 as
79
i I i i I
I
I
I
J
a Bgill-SacI fragment using restriction sites engineered in the PCR primers to create
pSMCI47.
Plasmid pSMCl5l is a mobilizable shuttle vector that contains the patS gene
under the control of its native promoter. A region of the Anabaena chromosome from
948 bp upstream to 961 bp downstream of the patS-coding region was amplified by PCR
(using primers 5'PatSSacF and 3'PatSBglIIR), cloned into the TA site ofpGEM-T and
subsequently moved into the BamHI-KpnI sites ofpAM504 (Wei et al., 1994) as a Bgill-
KpnI fragment using sites engineered in the PCR primers to create pSMC151.
Plasmid pSMC 169 was used to reintroduce the normal promoter of hetN to strain
UHMI00 to create strain UHM1l4, which is a single mutant that has the patS gene
deleted. It is a mobilizable plasmid that cannot replicate in Anabaena. The region of
DNA from nucleotide 834 of the hetM gene extending to the translational stop codon of
hetN was amplified from the chromosome of strain PCC 7120 (using primers HetM I 142F
and HetNR) and cloned into the TA site ofpGEM-T. This 2103-bp region containing the
promoter region of hetN roughly at its center was moved to pRL278 as a SacI-Bgill
fragment using restriction sites engineered into the PCR primers to create pSMCI69.
Plasmid pSMC182 was used to replace most of the coding region of hetNin strain
PCC 7120 with an interposon that confers resistance to spectinomycin and streptomycin
to create strain UHM115. It is a mobilizable plasmid that cannot replicate in Anabaena.
PCR was used to amplifY one region of DNA that begins at nucleotide 1330 of hetM, the
gene immediately upstream of helN, and extends to nucleotide 93 of hetN (using primers
HetMF-BamHI and HetMR-KpnI) and a second region that begins at nucleotide 593 of
hetN and extends to nucleotide 255 of hetl (using primers HetIF-KpnI and HetIR-SacI),
80
I I i i
I
.i I , I j , ,
the gene immediately downstream and oriented convergently to hetN. These two
fragments were joined at a KpnI site engineered into the PCR primers and cloned into
plasmid pGEM-T. An n interposon carrying the aadA gene (Fellay et aI., 1987) was
inserted as a SmaI fragment into the blunt-ended [(pnl site. The resulting construct was
moved to pBluescript SK+ (Stratagene) as a SaeI-Kspl fragment and subsequently moved
to pRL278 as a SacI-Xhoi fragment to create pSMCI82. All PCR fragments used in the
construction of plasmids were sequenced to verify their integrity.
Construction of alr901 8-gfp transcriptional fusion
An alr9018-gfp transcriptional fusion was constructed by cloning a promoterless
gfp gene behind the putative alr9018 promoter. The 236-bp DNA segment immediately
upstream of the ATG start side of alr9018 was fused with the gfp ORF in the shuttle
vector plasmid pAM1956 to obtain the alr9018-gfp fusion plasmid pALR9018-gfp.
Plasmid DNA isolation and analyses
The library plasmid was isolated using alkaline lyses and a phenol/chloroform
extraction. The plasmids were then transformed into E. coli DH5a MCR. It is important
to use DH5a MCR, to prevent the E. coli endonucleases from recognizing the Anabaena
DNA as foreign and damaging it. Once transformed, the plasmid was isolated from E.
coli by alkaline mini prep for restriction and sequence analyses. The plasmids isolated
were cut with various restriction endonucleases, such as EeoRl, Hindlll, NheI, [(pnI, and
SacI. For each cut sample, 5111 of DNA was run on a 1 % agarose gel.
81
., I
.i
I I
:, ,
I
I !
I i .,
i ,
peR ampUjiclltion of DNA fragments
Polymerase chain reaction (PCR) was used to amplify target regions of DNA
from the Anabaena PCC 7120 genome using complementaIy forward and reverse
primers. Taq DNA polymerase, from Thermus aquiaticus (Promega, Madison, WI) was
used for most routine amplification of DNA, while Pfx polymerase from Pyrococcus
furiosus (Invitrogen, Carlsbad, CA) was used for amplification of the alr9018 ORF.
Stock solutions for PCR included: dNTP mix containing 10 mM each of ATP, CTP, TIP
and GTP, lOx PCR buffer comprising 500 mM KCI, 100 mM Tris-HCI, Ph 8.3, 15 mM
MgCh. Primers were chemically synthesized by Integrated DNA Technologies
(Coralville, JA) and shipped lyophilized (standard desalted 25 nMol) via the Greenwood
Molecular Biology Core Facility, UH (Table 5.3). Upon arrival, primers were
resuspended in 10 mM Tris-HCL, pH 8.0, 0.1 mM EDTA to a final concentration of 100
pmol, and stored at _20°C as stock solutions. Working solutions were made by making a
1:4 dilution ~f the primers into sterile H20 and storing at _20° C. PCR reactions were
carried out for 30 cycles with initial denaturation at 94° C for 5 min and a final extension
at 72°C for 5 min. A typical PCR cycle comprised of the following steps: denaturation at
94° C for I min, annealing with primers at 50-60°C for 30 s, and extension for 30 s. PCR
reactions were carried out in 50 jll reactions containing 1 ng template, 1 jlM forward and
reverse primers, 1 unit of Taq polymerase, 200 jlM dNTPs, and 1 x PCR buffer.
Following PCR reaction, 10 jll reaction mix was loaded on an agarose gel for
electrophoresis and visualization under UV following staining with ethidium bromide.
PCR fragments were cloned into TOPO cloning vector for sequencing.
82
I I ,
I
i
i
·1
I I
.1
I 1
,! .'
i
I I
ColonyPCR
The following primers were used for PCR: HetRS'for and HetR3'rev, 5'patS-sacf and
3'patS-r, and PatAProF and PatA3'Rev (Table 5.3). Anabaena was suspended in 100 ul
of autoclaved M-Q autoclaved water. For samples larger than 2.5 kb, the 100 ul cell
suspension was boiled for five minutes prior to the PCR reaction. Also, for the larger
PCR products 1 ul extra 2 mM\dNTP's were used per sample. Traditional PCR
conditions were used with a 55° C melting temperature and a one minutelkb extension
time.
Following the PCR reaction, a 1% agarose gel was prepared and run with 10 ul of sample
per lane.
83
1 I
I
i I ! i I
Table 5.3 Oligonucleotides use in this study
Oligonucleotide
HetRS'F HetRS'R HetRJ'F HetRJ'R 5CPatSSacF 5'PatSR 3'PatSF 3 'PatSBglIIR HetM1I42F HetNR HetMF-Bamlll HetMR-KpnI HetIF-KpnI HetIR-SacI 5'pPBPCRlBamHIF 3 'pPBPCRI SacIR 5'pPBPCR2BamHIF 3 'pPBPCR2SacIR 5'pPBPCR3BamHIF 3 'pPBPCR3SacIR 5'pPBPCR4BamHIF 3'pPBPCR4SacIR 5'pPB9013BamHIF 3'pPBa1r9013SacIR 5'pPB9014BamHIF 3 'pPBalr90 14SacIR 5'pPB90 15BamHIF 3'pPBalr9015SacIR 5'pPB90 16/7BamHIF 3'pPBa1r9016/17SacIR 5'pPB901SBamHIF 3 'pPBalr90 lSSacIR 5 'palr90 lSKOF 3'palr901SKOR 5'paIr901S::gfpSacIF 3'paIr901S::gfpKpnR
Sequences
TTTAGATCTGCTGTCGTTCTCAGCCACAGAGATTTGTCC TCATCACTAGCATCATTAAGCCATTATGCTACTGAGCCAG TAATGGCTTAATGATGCTAGTGATCACAAATGACTCGGCG TTTCTGCAGATGTCTTGGCTCAGTCGCGGATGATGG GAGCTCCGCATCTTTTATTCAAGCTAACTAGC CTGCTTAGTACTGATATCTAGGAAGTTGGAAGATG TTCCTAGATATCAGTACTAAGCAGCGII I IIACC AGATCTGGGAGTAAATTGTAAATCATAGAAC TTTAGATCTGCTGGTAAGGTAGTCAAGGAAAGTG TTTCATATGCATGAGCGATGAGACTCAACAGCTA GGATCCTAGAACGCTGGTCTGATGAACAA GGTACCAGAACGAGAAACACAAACTACCG GGTACCATTAGCAGGTATTTCTACGCCCA GAGCTCTGGAACCAGGGCAAGTTAAATTT TCATCGGATCCAAATCGCACAAAAACCTGTTTG GGGTGGAGCTCGGTCTAGTGTCTGCTGGTG TGGATGGATCCGGGTGTTATCAAGCTTAATC CGAGAGCTCTGGCGATCGCCCTGTGTGAG TCGCGGGATCCGAGTTCAAACGGGATTAAGC TTGGAGCTCGGGATGTTGAAGGATTCCGA TGGATCCTTTGGATGTCGCAGATTTAC GGAGCTCGGGATGTTGAAGGATTCCGA AATTTGGATCCGATTGGTGTCTAGTGTCTAGC CATTCGAGCTCCCTCACCAATACATCATTCATTCAC GTGAAGGATCCATGTATTGGTGAGGAGAGTGG GTTTGGGAGCTCCTATTGAGGTTAATATTTACTTGG GTAAAGGATCCCCTCAATAGAAAACACCAAACGAG GTGAGGAGCTCGTATCTGCTTAATCCCCGTTTGAACTCC TCGCGGGATCCGAGTTCAAACGGGATTAAGC ATTTGAGCTCCCAGTTATTCAAGAGGACAATCA GATAAGGATCCAGGCATATTCTCTACTCTGTCGC GGAGCTCGGGATGTTGAAGGATTCCGA CAGAAGATGTTGTGATTCGGGAGC AACTCTGCTGCTGTTATATGATTCG AGAGAGCTCTTAATGTCGAGCCATCTATCATTG CTGGGTACCCCAAATAAGTTAATAGCTGGACAT
All oligonucleotides read in the 5' to 3' direction.
84
I
I I 1
, ,
i I
:1
I
I
I
!
I , i
·.1 1
DNA sequence analyses
DNA sequences were analyzed by using online programs from the National
Center for Biotechnology Information (NCBl). DNA homology searches were made
using BLAST tools (Altschul et aI., 1997) at NCBL The highly conserved domains
containing the signature patterns of proteins were identified by PROSITE SCAN
(Bairoch et al., 1997) analysis using the ExPASy Molecular Biology Server. The
ClustalW program used from online bioinformatics and molecular biology links
Ortto://www.molbiol.net)
Primers Npt2-629 forward and pUC 19-245-2 reverse, were used to sequence from
the pDUCA 7 vector into the Anabaena chromosomal fragment. Sequence alignments
were done using Cyanobase Blast to determine identity with the Anabaena genome
sequence.
Strain constructions
Defmed mutations were made in Anabaena sp. strain PCC 7120 and its
derivatives by gene replacement as previously described (Callahan and Buikema, 2001)
using the indicated suicide vectors. To confirm the mutant constructions, primers
flanking the mutation and located outside the region of Anabaena DNA used to make the
mutation were used to amplifY the region of the mutation. The sizes of the various PCR
products were used to confirm that the mutant construct had replaced the wild-type
region of DNA. In each case, a minimum of two mutants derived from separate single-
recombinants were used to evaluate the mutant phenotype.
85
, i I i ; , ,
i , I
I
i ,
I I
I
I
! ,
: J
Strain UHMI00 is a double mutant that has the nonnal promoter of hetN replaced
by the copper-inducible petE promoter and the patS gene deleted. Plasmid pSMC147
was used to introduce the deletion to strain 7120PN, the parent strain, which has only the
hetN locus altered. Strain UHM114 is a single mutant that has the patS gene deleted and
is isogenic with PCC 7120 otherwise. It was constructed by reintroduction of the nonnal
promoter of hetN into strain UHMlOO using plasmid pSMCI69. In both cases, a 375-bp
EcoRV-Scal fragment containing patS has been deleted from the chromosome. This
deletion is similar to the deletion made by Y oon and Golden to make the patS-deletion
strain AMC451 (Y oon and Golden, 1998). Differences in the two types of deletions
include the presence of 6 extra bp in the strains described here (the EcoRV and Seal sites
abut each other instead of being ligated to one another as in AMC451), and the deletions
in UHMlOO and UHMI14 are not marked, whereas an Q Sp'/Sm' cassette replaces the
deleted fragment in AMC451.
Strain UHMI03 is a derivative of PCC 7120 that has the heIR-promoter and -
coding regions deleted. The l783-bp unmarked deletion was created by gene
replacement using plasmid pSMCl04. Strain UHM115 is a derivative ofPCC 7120 that
has a SOO-bp internal region of the hetN gene replaced by an Q interposon that confers
resistance to spectinomycin and streptomycin. It was created by gene replacement using
plasmid pSMC 182.
Clean deletions were made for all of the double mutants except UHMlll which
contains a streptomycin, spectinomycin resistance cassette. This was done by
conjugating E. coli UC585 containing derivatives of the mobilzable plasmid pRL278 into
86
I I
I I I
I I
i i
.~
, "
! 'j
I I I
I I
I
the appropriate Anabaena strain. The suicide plasmid pRL278 contains an Anabaena
origin of replication pDUl, a neomycin resistance gene, and the sacB gene. The pRL278
derivatives, pSMCl04, pSMC I 04, pSMCl64, pSMC136, and pSMC136 and were
conjugated into UHMlOI. 7l20PN. UHMl03. UHMIOO and 7120PN respectively (Table
6.1 and Table 6.2).
Microscopy
Cells were viewed through a Nikon Diaphot 300 inverted microscope using either
a 60x oil or a 40x objective. and images were captured with an Olympus DP70 digital
camera. For fluorescent images a Chroma Technologies 41001 filter set having an
excitation of 480 ± 20 om and emission of 535 ± 25 om was used to monitor fluorescence
specific to the green fluorescent protein (GFP). Images were processed in Adobe
Photoshop version 7.0.
Heterocyst number, pattern and statistical analysis
The criteria used to distinguish heterocysts and to determine heterocyst numbers
were as previously described (Yoon and Golden, 2001). To stain heterocysts with alcian
blue dye 10 "I of a 0.5% alcian blue solution in 50% ethanol was combined with I ml of
Anabaena culture and incubated for 30 min prior to observation.
For the runs test for randomness (Daniel, 1990), 500 cells were considered for
each sample. Because none of the filaments examined were 500 cells in length, changing
from one filament to another could be considered the beginning of a new run or the
87
I .,
I
I i
.1 i
, .1
"
,; I ,
I
i I
I i i
',J
continuation of the previous run. Both choices give the same overall result, but because
counting the change as a new run would bias the results against our eventual conclusion
ofnonrandomness. the change to a new filament was regarded as a new run. At 24 h, nl
= 231. the number of heterocysts; n2 = 269. the number of vegetative cells; and r = 169.
the number of runs. The calculated z value was -6.67 indicating nonrandom distribution
of the two cell types with a bias towards clustering at a very high confidence level (p <
0.0002).
Acetylene reduction assays
Filaments that had been induced for heterocyst formation for various times were
transferred in 1 ml volumes to 3 ml serum bottles and sealed with butyl stoppers. 0.34 ml
of headspace was replaced with acetylene and the bottle was incubated under standard
lighting and shaking conditions. After 2 h, 10 J.l1 gas samples were removed and
analyzed at 55°C for ethylene production on a Hewlett Packard 5890 gas chromatograph
using an 8-ft packed column containing 80% Porapak N and 20% Porapak Q. Assays
were done in triplicate. and each measured value differed by less than 10% of the
average.
88
i
I
I ,i , " I I
I I
!
i I
I
REFERENCES
Adams, D. G. 2000. Cyanobacterial phylogeny and development: questions and
challenges, p. 51-81. In Y. V. Brun and L. J. Shimkets (ed.), Prokaryotic
Development. American Society for Microbiology, Washington, DC.
Adams, D. G. 2002. The liverwort~yanobacterial symbiosis. BioI. and Environ.
Proceedings of the Royal Irish Academy, 102B, 1: 27-29.
Adams, D. G., and N. G. Carr. 1981. The developmental biology of heterocyst and
akinete formation in cyanbacteria. 45-100.
Aldea, R. M., R. A. Mella-Herrea, and J.W. Golden. 2007. Sigma factor genes sigC,
sigE, and sigG are upregulated in heterocys of the cyanobacterium Anabaena sp.
strain PCC 7120. J. Bacterio. 10: 0821-39.
Allan, M. M., and A. J. Smith. 1969. Nitrogen chlorosis in blue-green algae.
Microbiology. 69: 114-120.
Ashby, M. K. and J. Houmar. 2006. Cyanobacterial Two-Component Proteins: Structure,
Diversity, Distribution, and Evolution, Microbiol and Mol. BioI. 70: 472-509.
Baier, B.A., H. Lehmann, D. P. Stephan, and W. Lockau. 2004. NbIA is essential for
phycobilisome degradation in Anabaena sp. PCC 7120 but not for development of
funcitonai heterocysts. Microbiol.. 150: 2739-2749.
Bienert, R., K. Baier, R. Volkmer. W. Lockau, and U. Heinemann. 2006. Crystal
Structure of NbIA from Anabaena sp. PCC 7120, a small protein playing a key
role in phycobilisome degradation. J. BioI. Chem .. 281: 5216-5223.
89
I
I I I
I , I
"l
I
J
Black, T., A. and C. P. Wolk. 1994. Analysis of a Her mutation in Anabaena sp. strain
PCC 7120 implicates a secondary metabolite in the regulation of heterocyst
spacing. J. Bacteriol. 176: 2282-2292.
Black, T. A., Y. Cai, and C. P. Wolk. 1993. Spatial expression and autoregulation of
hetR, a gene involved in the control of heterocyst development in Anabaena. Mol.
Microbiol. 9: 77-84.
Borthakur, P. B., C. C. Orozco, S. S. Young-Robbins, R. Haselkorn, and S. M. Callahan.
2005. Inactivation of patS and hetN causes lethal levels of heterocyst
differentiation in the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol
Microbiol. 57: 111-123.
Buikema, W. J., and R. Haselkom. 1991. Characterization of a gene controlling
heterocyst development in the cyanobacterium Anabaena 7120. Genes Dev. 5:
321-330.
Buikema, W. J., and R. Haselkom. 1991. Isolation and complementation of nitrogen I
fixation mutants of the cyanobacterium Anabaena sp. strain PCC 7120. J. 'I
I Bacteriol. 173: 1879-1885.
Buikema, W. J., and R. Haselkom. 2001. Expression of the Anabaena hetR gene from a
copper-regulated promoter leads to heterocyst differentiation under repressing
conditions. Proc. Natl. Acad. Sci., U.S.A. 98: 2729-2734.
Cai, Y., and C. P. Wolk. 1990. Use ofa conditionally lethal gene in Anabaena sp. strain
PCC 7120 to select for double recombinants and to entrap insertion sequences. J.
Bacteriol. 172: 3138-3145.
90
I i
I I
Cai, Y., and C. P. Wolk. 1997. Anabaena sp. strain PCC 7120 responds to nitrogen
deprivation with cascade-like sequence of transcriptional activations. J.
Bacteriol.. 179: 267-271.
Callahan, S. M. and W. J. Buikema. 2001. The role of HetN in maintenance of the
heterocyst pattern inAnabaenasp. PCC 7120. Mol. Microbiol. 40: 941-950.
Cordell, H. 2002. Epistasis: what it means, what it doesn't mean, and statistical methods
to detect it in humans. Human Molecular Genetics 11: 2463-2468.
Dong, Y., X., X.-Y. Huang, Wu, and J. Zhao. 2000. Identification of the active site of
HetR protease and its requirement for heterocyst differentiation in the
cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol.182: 1575-1579.
Ehira, S. and M. Ohmori. 2006. NrrA, a nitrogen-responsive response regulator facilitates
heterocyst development in the cyanobacterium Anabaena sp. strain PCC 7120.
Mol Microbiol 59: 1692 -1703.
Ernst, A., T. Black, Y. Cai, J.-M. Panoff, D. N. Tiwari, and C. P. Walk. 1992. Synthesis
of nitrogenase in mutants of the cyanobacterium Anabaena sp. strain PCC 7120
affected in heterocyst development or metabolism. J. Bacterial. 174: 6025-6032.
I
I
Fay, P. 1992. Oxygen relations of nitrogen fixation in cyanobacteria. Microbiol. Rev. 56:
340-373.
Frias, J. E., E. Flores, and A. Herrero. 1994. Requirement of the regulatory protein NtcA
for the expression of nitrogen assimilation and heterocyst development genes in
the cyanobacterium Anabaena sp. PCC 7120. Mol. Microbiol. 14: 823-832.
Fuchs, G. 1999. Assimilation of Macroelements and Microelements. Blackwell science,
Stuttgart, Germany.
91
Golden, J. W., S. J. Robinson, and R. Haselkorn. 1985. Rearrangement of nitrogen
fixation genes during heterocyst differentiation in the cyanobacterium Anabaena.
Nature 314: 419-423.
Grossman, A. R.. M. R. Schaefer. G.G. Chiang, and J. L. Collier. 1993. The
phycobilisome, a light-harvesting complex responsive to environmental
conditions. Microbiol. Rev. 57: 725-749.
Huang, X., Y. Dong. and J. D. Zhao. 2004. HetR homodirner is a DNA-binding protein
required for heterocyst differentiation, and the DNA-binding activity is inhibited
by PatS. Proc. Natl. Acad. Sci. USA. 101: 4848-4853.
Haseikorn, R. 1978. Heterocysts. Ann. Rev. Plant Physiol. 29: 319-344.
Haselkorn, R. 1992. Developmentally regulated gene rearrangements in prokaryotes.
Ann. Rev. Genet. 26: 111-128.
Herrero. A., A. M. Muro-Pastor. A. Valladares, and E. Flores. 2004. Cellular
differentiation and the NtcA transcription factor in filamentous cyanobacteria.
FEMS Microbiology Reviews. 28: 469-474.
Kaneko, T.; Y. Nakamura, C. P. Wolk, T. Kuritz, S. Sasamoto, A. Watanabe. M. Iriguchi,
A. Ishikawa, K. Kawashima, T. Kimura, Y. Kishida, M. Kohara, M. Matsumoto,
M. Matsuno. A. MuraId, N. Nakazaki, S. Shimpo, M. Sugimoto. M. Takazawa,
M. Yamada, M. Yasuda, and S. Tabata. 2001. Complete genome sequence of the
filamentous nitrogen-fIXing cyanobacterium Anabaena sp. strain PCC 7120. DNA
Res. 8: 205-213; 227-253.
92
1
"
j
I I
I
I I I I
I
I
j I I I I I
, I I j
Khudyakov, I. and C.P. Wolk. 1997. hetC, a gene coding for a protein similar to
bacterial ABC protein exporters, is involved in early regulation of heterocyst
differentiation in Anabaena sp. strain PCC 7120. J. Bacteriol. 179: 6971-6978.
Kyte. J. and R. F. Doolittle. 1982. A simple method for displaying the hydrophatic
character of a protein. J. Mol. BioI. 157: 105-132.
Leganes, F. 1994. Genetic evidence that hepA gene is involved in the normal deposition
of the envelope of both heterocysts and akinetes in Anabaena variabilis A TCC
29413. Ferns Microbiol. Lett. 123: 63-67.
Li, 8., X. Huang, and J. Zhao. 2002. Expression of hetN during heterocyst differentiation
and its inhibition of heIR up-regulation in the cyanobacterium Anabaena sp. PCC
7120. PEBS Lett. 517: 87-91.
Liang, J., L. Scappino, and R. Haselkorn. 1992. The parA gene product, which contains a
region similar to Che Y of Escherichia coli, controls heterocyst pattern formation
in the cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci, USA 89: 5655-
5659.
Mariscal, V., A. Herrero, and E. Flores, 2007. Continuous periplasm in a filamentous,
heterocyst-forming Cyanobacterium. Mol. Micro. 65(4): 1139-1145.
Meek, J. C., E. L. Campbell, M. L. Summers, and F. C. Wong. 2002. Cellular
differentiation in the cyanobacterium Nostoc punctiforme. Arch Microbiol. 178 :
395-403
Meeks, J. C. and J. Elhai 2002. Regulation of cellular differentiation in filamentous
cyanobacteria in free-living and plant associated symbiotic growth states.
Microbiol. and Mol. BioI. Reviews. 94-121.
93
I I I I
.1
i I ,
.,
Muny, M. A. and C. P. Wolk. 1989. Evidence that the barrier to the penetration of
oxygen into heterocysts depends upon two layers of the cell envelope. Arch.
Microbiol. 151: 469-74.
Muro-Pastor, A. M., A. Valladares, E. Flores, and A. Herrero. 2002. Mutual dependence
of the expression of the cell differentiation regulatory protein HetR and the global
nitrogen regulator NtcA during heterocyst development. Mol. Microbiol. 44:
1377-1385.
Nayar, A. S., H. Yamaura, R. Rajagopalan, D. D. Risser, and S.M. Callahan. 2007.
FmG is necessary for filament integrity and heterocyst maturation in the
cyanobacterium Anabaena sp. strain PCC 7120. Mol Microbiol 57: 111-123.
Ning, D. and X. Xu. 2004. alrOIl7, a two-component histidine kinase gene, is involved
in heterocyst development in Anabaena sp. strain PCC 7120. Microbiol. 150:
447-453.
Orozco, C. C., D. D. Risser, and S. M. Callahan. 2006. Epistasis analysis of four genes
from Anabaena sp. strain PCC 7120 suggests a connection between PatA and
PatS in heterocyst pattern formation. J. Bacteriol. 188:1808-1816.
Shi, Y., W. Zhao, W. Zhang, Z. Ye, and J. Zhao. 2006. Regulation of intercellular free
calcium concentmtion during heterocyst differentiation by HetR and NtcA in
Anabaena sp. PCC 7120. Proceed. of the National Academy of Sciences. 103.
11334-11339.
Shimkets, L. J., and Y. V. Brun. 2000. Prokaryotic development: strategies to enhance
survival, p. 1-7. In Y. V. Brun and L. J. Shimkets (ed.), Prokaryotic Development.
,. American Society for Microbiology, Wachington, DC.
94
1
I I
i I
I I
I ,
I I
Vaccari, D. A., P. F. Strom, and J. E. Alleman. 2005. Environmental Biology for
Engineers and Scientist, p246. Wiley-Interscience publisher (A John Wiley and
Son's publication).
Walsby, A. E. 1985. The permeability of heterocysts to the gases nitrogen and oxygen.
Proc. R. Soc. Lond. Ser. B 226: 345-366.
White, D. 2000. The Physiology and Biochemistry of Prokaryotes, 2nd ed. Oxford
University Press, New York. Oxford.
Whitton, B. A. and M. Potts. 2000. The Ecology of Cyanobacteia Their Diversity in
Time and Space, eds. Whitton, B. A. and M. Potts. Kluwer Academic Publishers,
Dordrecht, Netherlands, Page I - 11.
Winkenbach, F., C. P Wolk. and M. Jost, 1972. Lipids of membrane and of the cell
envelope in heterocysts ofa blue-green agIa. Planta 107: 69-80.
Wolk. C. P. 1968. Movement of Carbon from Vegetative Cells to Heterocysts in
Anabaena cylindrica. J. Bacteriol. 96: 2138-2143.
Wolk. C. P. 1996. Heterocyst formation. Annual Rev. of Gen. 30: 59-78.
Wolk. C. P. 2000. Heterocyst formation in Anabaena, p. 83-104. In Y. V. Brun and L. J.
Shimkets (ed.), Prokaryotic Development. American Society for Microbiology
Press, Washington, DC.
Wolk. C. P., A. Ernst, and J. Elhai. 1994. Heterocyst metabolism and development. In
the Molecular Biology of Cyanobacteria, ed. DA BI}'IIIlt, pp. 769-823. Dordrecht:
Kluwer.
95
i i
i I ,
I i
I
I I
I I
. . J
Wolk, C. P., S. M. Austin, 1. Bortins, and A. Galonsky. 1974. Autoradiograph
localizatoin of 13N after fixation of I3N-lableled nitrogen gas by a heterocyst-
forming blue-green alga. J. Bacteriol. 61: 440-453.
Wolk, C. P., Y. Cai, L. Cardemil, E. Flores, B. Hohn, M. Murry, O. Scbmetterer, B.
Schrautemeier, and R Wilson. 1988. Isolation and complementation of mutants of
Anabaena sp. strain PCC 7120 unable to grow aerobically on dinitrogen. J.
Bacteriol. 170: 1239-1244.
Wolk, C. P., A. Ernst, and J. Elhai. 1995. Heterocyst metabolism and development, p.
769-823. In D. A. Bryant (ed.), The Molecular Biology of Cyanobacteria, vol. I.
K1uwer Academic Publishers, Dordrecht, The Netherlands.
Wolk, C. P., and M. P. Quine. 1975. Formation of one-dimensional pattern by stochastic
possesses and by filamentous blue-green algae. Dev. BioI. 46: 370-382.
Wood, N.B., R Haselkorn. 1979. Proteinase activity during heterocyst differentiation
in nitrogen-fixing cyanobacteria. In Limited Proteolysis in Microorganisms,
ed. OH Cohen, H Hoizer, pp. 15'Hi6. Bethesda, MD: US DHEW Publ. No.
(NIH) 79-1591.
Wood, N. B. and R. Haselkorn. 1980. Control of phycobiliprotein proteolysis and
heterocyst
differentiation in Anabaena. J. Bacteriol. 141:1375-85.
Wu, X., D. W. Lee, R. A. Mella, and J. W. Golden. 2007. The Anabaena sp. strain PCC
7120 asrI734 gene encodes a negative regulator of heterocyst development.
Molecular Microbiol. 64: 782-794.
96
I
,
I I I . , I
! I
Yoon, H.-S., and J. W. Golden. 1998. Heterocyst pattero formation controlled by a
diffusible peptide. Science 282: 935-938.
Yoon, H.-S., and J. W. Golden. 2001. PatS and products of nitrogen fixation control
heterocyst pattern. J. Bacteriol. 183: 2605-2613.
Zhang, C. C., S. Huguenin, and A. Friry. 1995. Analysis of genes encoding the cell
division protein FtsZ and a glutathione synthetase homologue in the I
cyanobacterium Anabaena sp. PCC 7120. Res. Microbiol.146: 445-455.
Zhang, W.,1. Y. Du, I. V. Khudyakov, Q. Fan, H. Gao,l. D. Ning, C. P. Wolk and X. Xu.
2007. A gene cluster that regulates both heterocyst differentiaiton and pattern
formatoin in Anabaena sp. strain PCC 7120. Mol. Microbiol. 66: 1429-1443.
Zhao, Y., Y. Shi, W. Zhao, X. Huang, D. Wang, N. Brown, J. Brand and J. Zhao. 2005.
CcbP, a calcium-binding protein from Anabaena sp. Strain PCC 7120, provides
evidence that calcium ions regulate heterocyst differentiation. Proceed. of the
National Academy of Sciences, 102(16): 5744-5748.
Zhou, R., Z. Cao, and J. Zhao. 1998. Characterization of HeIR protein turnover in
Anabaena sp. PCC 7120. Arch. Microbiol. 169: 417-423.
Zhou, R., X. Wei, N. Jiang, H. Li, Y. Dong, K.-L. Hsi, and J. Zhao. 1998. Evidence that
HetR is an unusual serine-type protease. Proc. Natl. Acad. Sci., U.S.A. 95: 4959-
4963.
97
Recommended