View
3
Download
0
Category
Preview:
Citation preview
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
© 2016. Published by The Company of Biologists Ltd.
Title
Skb5, an SH3 adaptor protein, regulates Pmk1 MAPK signaling by controlling the intracellular
localization of Mkh1 MAPKKK
Authors
Yuki Kanda1, Ryosuke Satoh1, Saki Matsumoto1, Chisato Ikeda1, Natsumi Inutsuka1, Kanako
Hagihara1, Sumio Matzno 2, Sho Tsujimoto1, Ayako Kita1, Reiko Sugiura1
Affiliation
1. Laboratory of Molecular Pharmacogenomics, School of Pharmaceutical Sciences, Kinki
University
2. Division of Pharmaceutical Education, Faculty of Pharmacy
Corresponding author’s email address
sugiurar@phar.kindai.ac.jp
Key words
Schizosaccharomyces pombe, PKC, MAPKK kinase, Skb5, SH3 adaptor protein
JCS Advance Online Article. Posted on 22 July 2016
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Summary statement
Spatial regulation of MAPKKK remains poorly characterized in fission yeast. Skb5, an SH3
adaptor was shown to attenuate Pmk1 MAPK signaling by regulating subcellular distribution
of Mkh1 MAPKKK.
Abstract
The MAPK cascade is a highly conserved signaling module composed of
MAPK/MAPKK/MAPKKK. MAPKKK Mkh1 is an initiating kinase in Pmk1 MAPK
signaling, which regulates cell integrity in fission yeast. Our genetic screen for regulators of
Pmk1 signaling identified Skb5 (Shk1 kinase binding protein 5), an SH3 domain-containing
adaptor protein. Here, we showed that Skb5 serves as an inhibitor of Pmk1 MAPK signaling
activation by downregulating Mkh1 localization to cell tips via its interaction with the SH3
domain. Consistently, the Mkh13PA mutant protein, with impaired Skb5 binding, remained in
the cell tips, even when Skb5 was overproduced. Intriguingly, Skb5 needs Mkh1 to localize
to the growing ends as Mkh1 deletion and disruption of Mkh1 binding impairs Skb5
localization. Deletion of Pck2, an upstream activator of Mkh1, impaired the cell tip localization
of Mkh1 and Skb5 as well as Mkh1/Skb5 interaction. Interestingly, both Pck2 and Mkh1
localized to the cell tips at the G1/S phase, which coincided with Pmk1 MAPK activation.
Altogether, Mkh1 localization to cell tips is important for transmitting upstream signaling to
Pmk1 and Skb5 spatially regulates this process.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Introduction
The MAPK signaling cascade is a highly conserved signaling module, which plays a central
role in various physiological processes, including cell proliferation, gene expression,
differentiation and cell survival (Nishida and Gotoh, 1993; Marshall, 1994; Her-skowitz, 1995;
Munshi and Ramesh, 2013). It is also conserved in lower eukaryotes such as yeasts and plays
a key role in cell wall biosynthesis and stress responses (Levin, 2005; Park and Bi, 2007; Perez
and Cansado, 2010). The abnormal activation of MAPK signaling leads to deregulated
phosphorylation events that play a role in tumorigenesis (Dhillon and Kolch, 2007; Santarpia
et al., 2012). Therefore, understanding the mechanisms of negative regulation of MAPK and
its application for drug discovery which could target the Raf/MEK/ERK pathway is important
for cancer therapeutics.
The MAPK pathway transmits its signal through the sequential phosphorylation of
MAPK kinase kinase to MAPK kinase to MAPK (Zheng and Guan, 1993; Gardner et al., 1994).
Consistently, protein phosphatases such as DUSP and PP2C which dephosphorylate MAPKs
or upstream kinases play key roles in the negative regulation of these activation processes
(Jeffrey et al., 2007; Chang et al., 2015). MAPKKK lies at the apex of the MAPK pathway
kinase module and plays a critical role in transmitting upstream signaling to MAPKK and
MAPK. MAPKKK has been known to be inactivated through dephosphorylation by PP5 (von
Kriegsheim et al., 2006; Shah et al., 2015), and recent studies on RKIP (Kam et al., 2000; Park
et al., 2006) revealed a novel regulatory mechanism of MAPKKK regulation by an adaptor
protein and its influence on MAPK activation. However, relatively little is known on the
subcellular localization of MAPKKK and its relevance to MAPK activation.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
We have been studying the Pmk1 MAPK signaling module, composed of Mkh1
MAPKKK, Pek1 MAPKK and Pmk1 MAPK, a key regulator of cell wall integrity in fission
yeast (Toda et al., 1996; Sugiura et al., 1999; Sengar et al., 2007). Our genetic screen for
negative regulators of Pmk1 MAPK signaling identified phosphatases (Sugiura et al., 1998)
that inactivate MAPK signaling, including the Pmp1 dual-specificity phosphatase, and the
PP2C serine/threonine protein phosphatase (Takada et al., 2007) in addition to the Rnc1 RNA-
binding protein, (Sugiura et al., 2003) and the cell surface protein Ecm33 (Takada et al., 2010).
Our genetic screen also identified components and activating regulators of Pmk1 MAPK,
including small GTPases Rho1, Rho2, Rho4 and Rho5, and Pck2 protein kinase C, by isolating
mutants of the farnesyl transferase Cpp1 and geranylgeranyl transferase Cwg2 (Ma et al., 2006;
Doi et al., 2015). Here, we have established a novel genetic screen for negative regulators of
Pck2-mediated MAPK signaling activation by utilizing the cell growth defect induced by Pck2
overproduction and its recovery by Pmk1 signaling inhibition (Takada et al., 2007). We
identified Skb5 (Shk1 kinase binding protein 5), an SH3 adaptor protein, which has been
isolated as a binding partner for the p21-activated kinase (PAK) homolog Shk1 in fission yeast.
Further, Skb5 has been shown to directly activate Shk1 kinase activity (Yang et al., 1999). We
showed that Skb5 inhibits Pck2-mediated MAPK signaling hyperactivation by interacting with
Mkh1. Notably, Mkh1 was localized to the cell tips at the G1/S phase in addition to the
previously described localization of the medial region (Madrid et al., 2006), and importantly,
the cell tip localization of MAPKKK was regulated by Skb5/Mkh1 interaction. Pck2 deletion
impaired Mkh1/Skb5 localization at cell tips as well as the Mkh1/Skb5 interaction. Possible
roles of Skb5 as a spatial regulator of MAPKKK and the physiological significance of
MAPKKK localization to cell tips in terms of MAPK signaling activation will be discussed.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Results
Skb5 overproduction negatively regulates Pck2/Pmk1 MAPK signaling
To identify novel regulators of PKC/MAPK signaling in fission yeast, we established a genetic
screen. This screen was based on previous findings from our lab (Takada et al., 2007) and
others (Carnero et al., 2000) that the overexpression of Pck2 in Wild-Type (WT) cells resulted
in severe growth defects, whereas the inhibition or deletion of the components of the Pmk1
MAPK pathway can reverse the growth defects. Consistently, the overproduction of the pmp1+
gene that we previously identified as a dual-specificity phosphatase, which dephosphorylates
and inactivates Pmk1 MAPK (Sugiura et al., 1998) clearly suppressed the growth defect
induced by Pck2 overproduction (Fig. 1A), indicating that this screen can reveal novel genes
involved in the negative regulation of PKC/MAPK signaling. We therefore screened for genes
that when overexpressed can suppress the growth defect induced by Pck2 overproduction.
Consequently, two classes of genes have been identified, and sequence analysis revealed that
skb5+ encoding an SH3-domain containing adaptor protein, and pmp1+ were included. As
shown in Fig. 1A, the overexpression of skb5+ and pmp1+ suppressed the growth defect
induced by Pck2 overproduction in the absence of thiamine (Promoter ON), whereas cells
harboring the control vector alone (+pck2+ +vector) failed to grow in the absence of thiamine.
Because Rho2 acts upstream of Pck2/Pmk1 MAPK signaling, and the overexpression
of Rho2 is toxic to WT cells, but not to deletion cells of the components of the Pmk1 MAPK
pathway (Ma et al., 2006), the effects of Skb5 and Pmp1 overexpression on the growth of Rho2
overproducing cells were also examined. As shown in Fig. 1B, overexpression of Rho2 was
toxic to the WT cells (Promoter ON; +rho2+ +vector), but the overexpression of the skb5+ and
pmp1+ significantly reduced the toxicity of Rho2 overproduction, indicating that Skb5, similar
to Pmp1, is involved in the negative regulation of Rho2/Pck2-mediated MAPK signaling
downstream of Pck2.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
To further delineate the step at which Skb5 functions in Pmk1 MAPK signaling, we
examined the effect of skb5+ on the growth defect induced by Pek1DD, which encodes a
constitutively active MAPKK (Sugiura et al., 1999). As shown in Fig. 1C, the toxicity induced
by Pek1DD overproduction was suppressed by the expression of Pmp1, consistent with the
notion that Pmp1 dephosphorylates and inhibits Pmk1 MAPK (+pek1DD +pmp1+). In clear
contrast, the overexpression of the skb5+ gene failed to suppress the toxicity induced by Pek1DD,
indicating that Skb5, unlike Pmp1, could not reverse the hyperactivation induced by Pek1DD
overproduction. Thus, Skb5 is likely to inhibit MAPK signaling downstream of Pck2 and
upstream of Pek1.
If Skb5 serves as an inhibitor of Pmk1 MAPK signaling, then Skb5 deletion cells are
expected to exhibit phenotypes similar to those associated with Pmp1 deletion. As shown in
Figure 1D, Skb5 deletion induced hypersensitivity to 0.6 M MgCl2 as did Pmp1 deletion.
However, Skb5 deletion cells did not exhibit sensitivity to FK506, wherein the growth of Pmp1
deletion cells was significantly inhibited (Fig. 1D). We then examined the combined effect
of FK506 and MgCl2 on Skb5 and Pmp1 deletion cells. Our previous findings established
that the vic (viable in the presence of chloride ion) phenotype has been demonstrated as a strong
indicator of MAPK signaling inhibition (Ma et al., 2006; Doi et al., 2015). The results
showed that Skb5 and Pmp1 deletion cells failed to grow in the media containing 0.06 M MgCl2
and FK506, wherein the WT cells grew, indicating that Skb5 deletion induced a vic negative
phenotype (Fig. 1D). This finding is consistent with the notion that Skb5 inhibits Pmk1
MAPK signaling.
In order to confirm that the suppression of Pck2 overproduction by Skb5 was due to
its effect on Pmk1 MAPK activation, the effect of Skb5 overexpression on the phosphorylation
levels of Pmk1 MAPK was examined. For this, anti-phospho Pmk1 antibodies, which
recognize dually phosphorylated Pmk1, were utilized (Sugiura et al., 1998). As shown in Fig.
1E, Pck2 overproduction driven under the nmt1 promoter stimulated Pmk1 phosphorylation
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
without any environmental stimuli, whereas the co-expression of skb5+ significantly reduced
the phosphorylation levels of Pmk1 as compared with the cells harboring the control vector
alone, thus indicating that Skb5 is involved in the negative regulation of Pck2-mediated Pmk1
signaling. A negative control experiment with a pek1 null mutant cells showed that Pmk1
was not phosphorylated at all even when Pck2 was overexpressed (Supplementary Figure S1).
Skb5 down-regulates Pmk1 MAPK signaling independent of Ptc1
To obtain clues for the mechanisms underlying Pmk1 MAPK signaling suppression by Skb5,
we focused on the ability of Skb5 to bind to several components of the MAPK signaling
pathway. It has been reported that Skb5 binds to Mkh1 MAPKKK and Ptc1 MAPK phosphatase
(Stanger et al., 2012), and that both are involved in the regulation of Pmk1 MAPK signaling
(Sugiura et al, 1999, Takada et al., 2007). To investigate if this interaction is specific, the
interaction between Skb5 and several components of the Pmk1 MAPK pathway, including
Pmk1, Pek1 and Mkh1 was examined. Results clearly showed that Skb5 specifically interacted
with Mkh1 (Fig. 2A, GST-Skb5). Co-precipitation experiments with the unfused GST protein
did not detect Pmk1, Pek1 or Mkh1 in the pull-downs (Fig. 2A, GST).
As Ptc1 has also been shown to be involved in negative regulation of Pmk1 MAPK
(Takada et al., 2007), the Skb5 interaction with the dual-specificity MAPK phosphatase Pmp1
was also investigated. In this case, results showed that Skb5 interacted with Ptc1, but not with
Pmp1 (Fig. 2B, GST-Skb5). Co-precipitation experiments with the unfused GST protein did
not detect Pmp1 or Ptc1 (Fig. 2B, GST).
To know if the interactions between Skb5 and Mkh1 or Ptc1 are required for the
suppression of MAPK signaling, the vic phenotype was utilized. The WT cells failed to grow
in the presence of the calcineurin inhibitor FK506 and 0.12 M MgCl2, whereas cells deleted
for the components of the Pmk1 MAPK pathway were viable in the same media (Ma et al.,
2006). Consistently, cells overexpressing pmp1+ and skb5+ grew in the presence of FK506 and
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
0.12 M MgCl2, whereas the cells harboring the control vector alone failed to grow (Fig. 2C,
upper panel). Next, the effect of the overexpression of pmp1+ and skb5+ was examined in cells
deleted for Ptc1. Notably, the overproduction of Skb5 and Pmp1, fully suppressed the vic
phenotype of the Ptc1 deletion cells, indicating that Skb5 exerted its ability to suppress MAPK
signaling even in the absence of Ptc1 (Fig. 2C, lower panel). Furthermore, Skb5 overproduction
inhibited the hyper-phosphorylation of Pmk1 induced by the cell-wall-damaging agent
micafungin, both in the WT and in the Ptc1 deletion cells (Fig. 2D), thus indicating that the
Skb5-Ptc1 interaction is not required for MAPK signaling suppression by Skb5.
Skb5 inhibits Pmk1 MAPK signaling via its binding to Mkh1
We next focused on the Skb5/Mkh1 interaction and its effect on Pmk1 MAPK, because the
above results strongly suggested the possibility that Skb5 exerted its suppression via its
interaction with Mkh1. Skb5 contains an SH3-domain and it has been reported that mutations
in the SH3 domain impair its interaction with binding partners (Stanger et al., 2012). This
prompted us to make a Skb5YF2A mutant wherein both the tyrosine (Y) 89 and phenylalanine
(F) 135 in the SH3 domain of the Skb5 protein, were mutagenized to alanine (A) (Fig. 3A). As
shown in Fig. 3B, the GST-Skb5YF2A mutant protein barely bound to GFP-Mkh1, whereas the
WT GST-Skb5 interacted with Mkh1 (Fig. 3B, left panel). Importantly, Skb5YF2A maintained
the ability to interact with Ptc1-GFP (Fig. 3B, right panel), indicating that the YF2A mutation
in Skb5 specifically abolished the Mkh1/Skb5 interaction. It should be noted that none of the
GST, GST-fused Skb5 or GST- Skb5YF2A protein bound to the GFP control vector (Fig. 3B).
Next, the effect of the Skb5YF2A mutant protein on the suppression of Pmk1 MAPK
signaling was examined. The overexpression of the mutant skb5YF2A cannot rescue the lethality
of over-expressing Pck2 (Fig. 3C). Similarly, the overexpression of skb5YF2A resulted in the
failure to induce the vic phenotype as did the WT skb5+ (Fig. 3D). As expected, the
overexpression of skb5YF2A did not reduce the Pmk1 phosphorylation levels induced by
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
micafungin as did the WT skb5+ (Fig. 3E). Thus, the ability of Skb5 to interact with Mkh1 is
required for Skb5 to inhibit Pmk1 signaling.
Skb5 affects Mkh1 localization at cell tips
To explore how Skb5 overproduction inhibits Pmk1 signaling by interacting with Mkh1, the
endogenous Mkh1 protein tagged with GFP was visualized and the effect of Skb5
overproduction was examined. It has been reported that Mkh1 localizes at the cytoplasm and
at the septum during cell division (Madrid et al., 2006). Here, the endogenous Mkh1 protein
fused to GFP was localized to the cell tips in addition to the previously described localization
(Fig. 4A, +vector, arrows), (Materials and Methods). Notably, the overproduction of the skb5+
markedly reduced the Mkh1 fluorescence at the cell tips (Fig. 4A, +skb5+, arrows, promoter
ON). The quantification of the cells expressing the endogenous Mkh1-GFP localization at the
cell tips showed that less than 10% of the Skb5 overproducing cells exhibited Mkh1
localization to the cell tips as compared with the cells harboring a control vector alone (Fig.
4A, lower panel, promoter ON). Next, the effect of the overproduction of the skb5YF2A mutant
protein on the Mkh1 localization was investigated, and the skb5YF2A overproduction barely
reduced the Mkh1 localization to the cell tips (Fig. 4A, +skb5 YF2A, arrows, promoter ON), thus
indicating that the Mkh1 localization change was induced largely upon Skb5 binding to Mkh1
through the SH3 domain.
Furthermore, the impact of the Skb5/Mkh1 interaction on Mkh1 localization was
examined by investigating the effect of the Mkh1 mutation which would disrupt Skb5 binding.
It has been reported that the PXXP sequence is a preferred binding signature for the SH3
domains (Stanger et al., 2012), and that the mutation in the proline (P) residues in the budding
yeast Bck1 MAPKKK, markedly impaired its binding with the Nbp2 SH3 domain protein
(Stanger et al., 2012). We then searched for the PXXP motif in Mkh1, and three proline residues
544, 546 and 547 were mutagenized into alanines (A) to make the Mkh13PA protein (Fig. 4B).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
The resultant Mkh13PA protein markedly reduced its affinity for Skb5, whereas it
maintained the ability to interact with Pek1 and Pck2 (Fig. 4C), indicating that the Mkh13PA
mutation specifically impaired the binding between Mkh1 and Skb5. It should be noted that
none of the GST, GST-Skb5 GST-Pek1 or GST-Pck2 protein bound to the GFP control vector
and the unfused GST protein did not pulldown GFP-Mkh1 or GFP- Mkh13PA (Fig. 4C).
In order to evaluate the physiological significance of the Skb5-Mkh1 interaction, the
Mkh13PA mutation was introduced into the chromosomal mkh1 locus. The resultant Mkh13PA-
GFP protein also localized to the cytosol with intense fluorescence at the cell tips (Fig. 4D
+vector). Notably, however, the skb5+ overexpression failed to reduce the Mkh13PA localization
to the cell tips (Fig. 4D, +skb5+), which was clearly distinct from the observations with the
endogenous Mkh1-GFP protein shown in Fig. 4A. The quantification of the cells also
confirmed the above results (Fig. 4D, lower panel). Thus, the interaction between Skb5 and
Mkh1 appears to play a key role in Mkh1 localization to cell tips.
Skb5 localization was also affected by Mkh1 interaction
Next, the subcellular distribution of endogenous Skb5 tagged with GFP was analyzed. The
fluorescence of the Skb5-GFP protein expressed from its endogenous loci was vague, but
diffusedly observed throughout the cytoplasm, and less than 20% of the cells exhibited cell-
end localization (Fig. 5A, endogenous Skb5WT-GFP, arrows). The fluorescence of exogenously
expressed GFP-Skb5 visualized the Skb5 localization around the cell periphery, and
approximately half of the cells exhibited Skb5 cell-end localization (Fig. 5A, GFP-Skb5WT
overproduction, arrows). The physiological significance of the Skb5-Mkh1 interaction was
examined by introducing the YF2A mutation to the chromosomal skb5 gene. The endogenous
Skb5YF2A-GFP protein also localized to the cell periphery (Fig. 5A, endogenous Skb5YF2A-
GFP), although the frequency of cell tip localization was significantly reduced (33.3%) as
compared with the WT endogenous Skb5 (Skb5WT). Quantification revealed that more than
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
40% of the cells exhibited Skb5 cell-end localization when Skb5 was exogenously expressed
as compared with less than 20% with the endogenous Skb5 (Fig. 5A, lower panel). Notably,
however, when the GFP-Skb5YF2A mutant protein was exogenously expressed, it barely
visualized the peripheral and cell-end localization, and the frequency of the cells exhibiting
cell-end localization decreased markedly (Fig. 5A, Skb5YF2A overproduction).
In order to apprehend if Mkh1 plays a role in Skb5 localization, the effect of Mkh1
deletion on the endogenous Skb5 localization was examined. Notably, Mkh1 deletion
significantly reduced the Skb5 localization to the growing ends, and approximately only 20%
of the cells exhibited cell-end localization (Fig. 5B). Thus, Skb5 can localize to cell ends at
least partly via its interaction with Mkh1.
Skb5 deletion increased Mkh1 cell-tip localization and Pmk1 phosphorylation
To investigate if Mkh1/Skb5 interaction is important for downstream Pmk1 MAPK signaling
activation, Skb5 deletion cells, Skb5YF2A mutant strains and Mkh13PA mutant strains were
studied to see if these strains exhibit altered Pmk1 phosphorylation levels. For this purpose,
Skb5YF2A mutant and Mkh13PA mutant strains were first examined for their phenotypes in terms
of the vic phenotypes. As shown in Figure 1D and in Figure 6A, the Skb5 deletion cells failed
to grow in the presence of 0.06 M MgCl2 and FK506, wherein the WT cells grew well,
indicating that the skb5 null cells displayed vic negative phenotypes. Both the Skb5YF2A
mutant and the Mkh13PA mutant cells exhibited the vic negative phenotypes similar to that
observed in the Skb5 deletion cells (Fig. 6A), consistent with the hypothesis that Skb5/Mkh1
interaction is important for Pmk1 MAPK signaling.
Next, Skb5 deletion cells, Skb5YF2A mutant and Mkh13PA mutant cells were
investigated for Pmk1 MAPK phosphorylation before and after the micafungin treatment. In
the Skb5 deletion cells, Pmk1 MAPK phosphorylation levels were significantly higher as
compared with the WT cells after the micafungin treatment (Fig. 6B). It should be noted that
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
the basal Pmk1 activation between the Skb5 deletion and WT type cells was indiscernible (Fig.
6B). In contrast, the Skb5YF2A mutant and Mkh13PA mutant cells exhibited similar Pmk1
phosphorylation levels both before and after micafungin treatment as compared with the WT
cells (Fig. 6C).
In order to see if the difference of Pmk1 phosphorylation levels in the mutant strains
resulted from the difference in the frequencies of the Mkh1 cell tip localization, the endogenous
Mkh1 protein was visualized in the WT and Skb5 deletion cells. The endogenous Mkh13PA
mutant protein was also visualized and the fluorescence of the cell tip-localized Mkh1 in these
cells was quantified. Results showed that Skb5 deletion significantly increased Mkh1 cell-
tip localization as compared with the WT cells (Fig. 6D). This is consistent with its role as a
negative regulator of MAPK signaling via its interaction with Mkh1. In contrast, the Mkh13PA
mutation did not significantly affect Mkh1 cell-tip localization (Fig. 6D). Thus, although the
biochemical studies showed that Mkh13PA mutation impairs Mkh1/Skb5 binding (Fig. 4C), the
Mkh13PA mutant protein may still maintain its biological ability to bind to Skb5, wherein Skb5
deletion totally abolished the Skb5/Mkh1 interaction.
Pck2 influences Mkh1/Skb5 localization to the cell tips and their interaction
What are the upstream factors which would affect the Mkh1/Skb5 localization at the cell tips?
As candidates, we investigated the effect of the deletion of the small G protein Rho2 and Pck2,
both of which act upstream of Mkh1. The effects of the deletion of the Ras1 small G protein,
which acts upstream of the Byr2-Byr1-Spk1 MAPK pathway, was also investigated. Notably,
the localization of the endogenous Mkh1 protein at the cell ends was markedly abrogated in
Pck2 deletion, but not in Ras1 or Rho2 deletion cells (Fig. 7A). Similar effects were obtained
with endogenous Skb5 localization, as deletion of Pck2 specifically abrogated Skb5 cell-end
localization (Fig. 7B). Quantification revealed that only half of the Pck2 deletion cells exhibited
cell-end localization of Mkh1 and only 20% of the cells exhibited cell-end localization of Skb5
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
as compared with that in the WT cells (Fig. 7A, 7B).
This prompted us to further study the effect of Pck2 deletion on the Mkh1/Skb5
interaction. GST pull-down experiments showed that Pck2 deletion significantly impaired the
Mkh1/Skb5 interaction, as the GFP-Mkh1 protein was barely detectable in the GST pull-down
extracted from Pck2 null cells harboring GST-Skb5 (Fig. 7C). Quantification showed that the
interaction between Mkh1 and Skb5 was about 50% in Pck2 deletion cells as compared with
that in the WT cells (Fig. 7C).
Finally, the effect of Skb5 overproduction on the endogenous Pck2 localization was
examined, and the results showed that Pck2 was localized to the cell ends irrespective of Skb5
overproduction (Fig. 7D). These data are consistent with the above findings that Skb5 does not
interact with Pck2 and that Skb5 specifically impaired Mkh1 localization at the cell ends.
Pck2 and Mkh1 localized to the cell tips in the G1/S phase of the cell cycle
In order to reveal the role of Mkh1 at cell tips and the significance of Pck2-Mkh1-Skb5
localization at cell tips, cell cycle synchronization experiments were performed by using the
cell cycle mutant cdc25-22 expressing the endogenous Mkh1-GFP protein from the native
promoter. Cells from this mutant were grown to the log phase at 25°C, shifted to 37°C for 4
hr to synchronize the cells in the G2 phase, and then shifted back to 25°C. As shown in Figure
8A, the frequency of the Mkh1 cell tip localization oscillates as a function of the cell cycle,
reaching a maximum during the G1/S phase.
We also visualized the endogenous Pck2-GFP protein in the cdc25-22 mutant, and the
Pck2 protein expressed from its native promoter was similarly observed to be localized at the
cell tips during the G1/S phase of the cell cycle (Fig. 8B). It should be noted that in addition
to our findings, other researchers have shown changes in Pmk1 phosphorylation during the cell
cycle, reaching a maximum during the G1/S phase (Madrid et al., 2006; Satoh et al., 2009).
Collectively, Pck2/Mkh1 localization at the cell tips closely coincided with Pmk1 activation at
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
the G1/S phase, suggesting that the cell tip localization of the upstream kinases (Pck2/Mkh1)
could stimulate Pmk1 MAPK, which leads to the oscillation of MAPK activation during the
cell cycle.
Discussion
In this study, we utilized a forward genetic screen in fission yeast to identify molecules involved
in Pmk1 MAPK signaling inhibition. Mkh1 MAPKKK acts upstream of Pmk1 and plays a
pivotal role in MAPK activation. However, to date factors that influence Mkh1 localization
remain poorly characterized. Here, we identified Skb5 as a modulator of Pmk1 signaling and
showed that Skb5 affects Mkh1 localization at the cell tips via its interaction through the SH3
domain, thereby attenuating Pmk1 MAPK signaling.
Our genetic and biochemical experiments demonstrated that Skb5 inhibits Pmk1 MAPK
signaling at the level of Mkh1. Importantly, this data clearly showed that Ptc1, a previously
reported binding partner of Skb5 was not required for the Skb5-mediated inhibition of Pmk1
signaling. Moreover, the phosphorylation analysis of Pmk1 with the Skb5YF2A mutant protein,
with impaired binding ability with Mkh1, indicated that Skb5 inhibits Pmk1 MAPK signaling
by specifically interacting with Mkh1.
How can Skb5 overproduction affect intracellular localization of Mkh1 at the cell tips
and inhibit MAPK signaling?
Two lines of evidence suggested that Skb5 affects Mkh1 localization at the cell tips by
interacting with Mkh1 via its SH3 domain, which leads to Pmk1 signaling inhibition. First, the
overproduction of Skb5, but not that of Skb5YF2A specifically reduced Mkh1 localization at the
cell tips. In addition, the overproduction of Skb5, but not that of Skb5YF2A rescued Pck2-
induced cytotoxicity and inhibited Pmk1 MAPK activation. Second, the Mkh13PA mutant
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
protein, which specifically reduced its affinity for Skb5, was insensitive to Skb5
overproduction, and remained at the cell tips. This was further confirmed by the endogenous
Skb5WT and Skb5YF2A mutant alleles, which were integrated into the chromosomal skb5 locus.
More importantly, Skb5 deletion induced Mkh1 cell-tip localization and Pmk1 MAPK
phosphorylation levels. It should be noted that although the Skb5YF2A mutant alleles and the
Mkh13PA mutant alleles exhibited a vic negative phenotype, these mutant alleles did not exhibit
increased Pmk1 activation. Thus, although biochemical studies suggested that Mkh13PA and
Skb5YF2A mutations significantly impaired Skb5/Mkh1 binding, these proteins may still
maintain the ability to interact with the binding partners. Alternatively, there might exist as-
yet-unidentified factors, which would determine Mkh1 cell-tip localization.
What is the physiological significance of Mkh1 localization to the cell tips?
Previous studies in mammals reported that the Raf kinase (MAPKKK upstream of ERK) was
translocated from the cytoplasm to the plasma membrane through the binding with the
upstream GTP-bound Ras. This recruitment of Raf to the plasma membrane induces
conformational change of Raf, allowing its phosphorylation in the plasma membrane by several
kinases such as Src, PKC and AKT, resulting in the activation of the Raf kinase and
downstream MAPK signaling (Marais et al., 1995; Barnard et al., 1998; Hibino et al., 2011).
In our study, Pck2, a target of Rho small GTPases and an upstream activator of Mkh1,
which binds and activates Mkh1, also localizes to the cell tips. Moreover, Pck2 and Mkh1
localized to the cell tips at the G1/S phase of the cell cycle, coincident with Pmk1 MAPK
activation. Interestingly, Pck2 deletion impairs Mkh1 localization to the cell tips as well as
Mkh1/Skb5 interaction. These findings support the hypothesis that Mkh1 localization to the
cell tips is important for Mkh1 to efficiently receive and transmit the Pck2-mediated signaling
to the downstream signaling of Pek1 MAPKK and Pmk1 MAPK. In this regard, Pck2 may
stimulate Mkh1 localization to the cell tips thereby facilitating the signal transduction from the
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
upstream Rho small GTPases to Pmk1 MAPK through Mkh1. It is noteworthy that Pck2
deletion also abrogated Skb5 localization to the cell tips. Thus, it would be intriguing to
speculate if Pck2-mediated Mkh1 phosphorylation would enhance Mkh1 localization to the
cell tips as well as the Skb5/Mkh1 interaction. In line with this, the Skb5/Mkh1 interaction
also seems to be important for Skb5 cell-tip localization, based on the findings that Skb5, but
not Skb5YF2A, localized to the growing ends upon overproduction. Consistently, Mkh1 deletion
reduced Skb5 localization to the growing ends, suggesting that Skb5 needs Mkh1 to localize to
the growing ends and thereby affects Mkh1 localization at the cell tips. Thus, it is hypothesized
that Skb5 may recognize the cell-end-localized and presumably active form of Mkh1 via its
SH3 domain, and this interaction may recruit Skb5 to the cell tips.
Given that Skb5 plays a role as a negative regulator of MAPK signaling, Skb5 may
have a higher affinity to the cell-tip-localized and/or active form of Mkh1, thus raising the
possibility that activation of MAPKKK recruits its adaptor molecule thus making a negative
feedback loop system. Our observations that the Skb5YF2A mutation with impaired Mkh1
binding as well as Mkh1 deletion, markedly reduced Skb5 localization to the growing ends,
further support this hypothesis.
The additional question that arises is “What is the in vivo role of Skb5 in inhibiting
Mkh1 after its activation by Pck2?” Alternatively, does Skb5 serve to keep Mkh1 inactive
prior to recruitment to the tips? The evidence in favor of the latter possibility is the
observation that Skb5 deletion induced Mkh1 cell-tip localization. Thus, although Pmk1
phosphorylation levels may not have detected the effect of Skb5 deletion at the basal level, this
data suggests an in vivo role of Skb5 as a spatial regulator of Mkh1. However, as
hypothesized above, the Pck2-mediated MAPK activation signal induced Mkh1 cell-tip
localization and Mkh1/Skb5 interaction at the cell-tips, thus indicating that Skb5 may also play
a role in inhibiting Mkh1 after its activation by Pck2. In line with this view, Skb5 deletion
significantly stimulated Pmk1 phosphorylation after micafungin treatment. Thus, Skb5 may
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
be dually required for spatial regulation before and after the upstream Pck2 activation. Future
studies will be necessary to clarify the molecular mechanisms of Skb5-mediated inhibition of
the Pck2/Mkh1/Pmk1 MAPK signaling.
Based on a previous paper that Skb5 has been identified as an activator of the p21-
activated kinase (PAK) homolog Shk1, which belongs to the Cdc42 cascade and a paper
reporting a possible crosstalk between the Cdc42 pathway and the Pmk1 MAPK pathway, it
would be intriguing to investigate if Skb5 is also involved in the suppression of the Cdc42-
mediated signaling pathways (Merla and Johnson, 2001). This prompted us to examine the
effect of the skb5+ over-expression, and the results showed that Skb5 over-expression modestly
suppressed Cdc42-induced lethality (Supplementary Figure S2). However, based on a
previous report by Madrid et al, the overexpression of Cdc42G12V did not significantly
stimulated Pmk1 MAPK activation, they concluded that Cdc42 GTPase and PAK kinases Pak1
and Pak2 do not regulate the basal and stress-induced activations of Pmk1. Therefore, the
suppression of Cdc42-mediated lethality by Skb5 overexpression may simply reflect the Skb5
function as an activator and a binding partner for Shk1/Pak1, an important kinase downstream
of Cdc42. Future studies will be required to fully reveal Skb5 function as a critical regulator
of several kinases involved in polarity and morphogenesis.
Intriguingly, SLAP (Src-like Adaptor Protein)/SLAP2, Skb5 orthologues in higher
eukaryotes (http://www.pombase.org/spombe/result/SPCC24B10.13) have been reported to act
as negative regulators of T cell receptor (TCR) signaling. SLAP interacts with a set of proteins
relevant to TCR signal transduction, such as ZAP-70 and Vav via its SH2 domain (Tang et al.,
1999; Holland et al., 2001). In addition, accumulating evidence has revealed an emerging role
of SLAP as a key regulator in receptor tyrosine kinase (RTK) signaling. SLAP has been shown
to interact with a subset of RTKs including Eph receptors and PDGFRs. (Wybenga-Groot and
McGlade, 2015) Interestingly, SLAP function in the regulation of TCR/RTK signaling is
closely coupled with its binding to the ubiquitin ligase Cbl through its C-terminal region,
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
allowing for ubiquitination of substrates such as EphA2 and its subsequent degradation
(Wybenga-Groot and McGlade, 2015). This prompted us to investigate the protein amount of
Mkh1 in the absence and presence of Skb5 overproduction, with a presumption that Skb5 may
couple Mkh1 to the ubiquitin-mediated degradation. However, no Mkh1 protein degradation
was observed upon Skb5 overproduction (data not shown), thus indicating that the effect of
Skb5 on cell-tip Mkh1 localization was not ascribable to Mkh1 degradation, but reflects the
dispersal of Mkh1 localization from the cell tips to the cytoplasm. Further investigations
regarding the regulatory mechanism of Mkh1 localization to cell tips and factors involved in
the process are necessary. However, given that Skb5 shows similarity with SLAP/SLAP2 in
the SH3 domain, Skb5 may downregulate factors involved in Pmk1 MAPK signaling
cooperatively with unidentified ubiquitin ligases.
Materials and Methods
Strains, Media, and Genetic and Molecular Biology Methods
Schizosaccharomyces pombe strains used in this study are listed in Table 1. The complete
medium (yeast extract-peptone-dextrose [YPD]), (yeast extract with supplements [YES]) and
the minimal medium (Edinburgh minimal medium [EMM]) have been described previously
(Sabatinos et al., 2010; Toda et al., 1996). Standard genetic and recombinant DNA methods
(Sabatinos et al., 2010) were used except where otherwise noted. PCR-based genomic epitope
tagging was performed using standard methods (Bahler et al., 1998). Proteins were N-
terminally or C-terminally tagged with GFP or GST expressed from the respective endogenous
loci. The GFP- or GST-tagging did not alter the protein’s function of these molecules as
evidenced by the observations that the phenotypes in terms of the lethality in the presence of
the Cl- and FK506 as well as the sensitivity/tolerance to micafungin are indiscernible from
those of the untagged WT cells (data not shown).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Isolation of the skb5+
The chromosome-borne nmt1-GFP-pck2+ cells [Pck2 overproducing (Pck2 OP)] were
constructed as described in Bahler et al. (Bahler et al., 1998). The thiamine-repressible nmt1-
GFP-pck2+ integrated (Pck2 OP) cells were transformed using an S. pombe genomic DNA
library constructed in the vector pDB248 (Beach et al., 1982). Leu+ transformants were replica-
plated onto EMM plates at 27°C without the addition of thiamine, and plasmid DNA was
recovered from transformants that showed plasmid-dependent growth in the absence of
thiamine. The recovered plasmids suppressed the lethality induced by Pck2 OP. DNA
sequencing showed that the suppressing plasmids contained SPCC24B10.13 (skb5+) and
pmp1+.
Protein Expression, Site-directed mutagenesis
For protein expression in yeast, thiamine-repressible nmt1 promoter was used (K Maundrell et
al., 1990). Expression was repressed by the addition of 4.0 mg/ml thiamine to EMM and was
induced by washing and incubating the cells in EMM lacking thiamine. The GST- or the GFP-
fused gene was sub-cloned into the pREP1 vectors. Skb5YF2A and Mkh13PA were generated
using the Quick Change mutagenesis kit (Stratagene, La Jolla, CA, USA). The primers used
are summarized in Table 2.
Protein Detection
Anti-GFP (Ma et al., 2006), anti-GST (Ma et al., 2006), and anti-Phospho-Pmk1 (Sugiura et
al., 1999) were used as the primary antibodies (1:20,000 dilutions). anti-rabbit (Cell signaling)
was used as the secondary antibody (1:4,000 dilution). Membranes were developed with
Chemi-Lumi One Super (Nscalai tesque). Protein levels were quantified using ImageJ software
(http://rsb.info.nih.gov/ij/).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Growth Conditions and Stress Treatment
Unless otherwise stated, cells were cultivated at 27°C in EMM (Sabatinos et al, 2010). Prior to
stress treatment, the cells were grown to mid-log phase (OD660 nm= 0.5). To the culture
medium, 200 mg/mL Micafungin stock solution was added at the indicated concentrations.
After stress treatment, the culture medium was chilled in ice water for one minute. The cells
were harvested by brief centrifugation at 4°C.
Microscopy and Miscellaneous Methods
Light microscopy methods (e.g. fluorescence microscopy) were carried out as described
previously (Kita et al., 2004; Satoh et al., 2012). Photographs were taken using AxioImager
M1 (Carl Zeiss, Germany) equipped with an LSM700 (Carl Zeiss, Germany) and ZEN 2012
software (Carl Zeiss, Germany). Images were processed with ZEN 2012 software (Carl Zeiss,
Germany). Cell extract preparation and immunoblot analysis were performed as previously
described (Sio et al., 2005).
Image Quantification
The quantification of cell tip localization was done for at least 2 individual datasets, which
summed up to 100 counted cells.
Statistical Analysis
All results are expressed as means and s.d. of several independent experiments. Data were
analyzed using a one-way ANOVA, followed by a post hoc test using Dunnett's multiple
comparison (Fig. 4A; upper row of graphs, Fig. 6D; upper row of graphs), a one-way ANOVA,
followed by a post hoc test using Tukey-Kramer’s multiple comparison (Fig. 5A; upper row of
graphs), or by Student's t-test (Fig. 5B; upper row of graphs). P values less than 5% were
regarded as significant. Asterisks indicate significant differences, and n.s. indicates not
significant.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Acknowledgments
We thank Dr. T. Toda, K. Nakano and the Yeast Resource Center (YGRC/NBRP;
http://yeast.lab.nig.ac.jp/nig) for providing strains and plasmids; Professor William Figoni for
critical reading of the manuscript. We are grateful to the members of the Laboratory of
Molecular Pharmacogenomics for their support.
Competing interests
No competing interests declared.
Author contributions
R.S. designed this project. Y.K., R.S., S.M., C.I., N.I., S.T. and A.K. carried out experiments.
Y.K., S.M., S.T., A.K., K.H., and R.S. analyzed the data. Y.K. and R.S. wrote the manuscript.
All authors reviewed the manuscript.
Funding
This work was supported by research grants from the Ministry of Education, Culture, Sports,
Science and Technology of Japan (to R.S.). This work was also supported by the MEXT-
Supported Program for the Strategic Research Foundation at Private Universities 2014-2018
(S1411037).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
References
Ba¨hler, J., Wu, J., Longtine, M. S., Shah, N. G., McKenzie, III, A., Steever, A. B., Wach,
A., Philippsen, P. and Pringle, J. R. (1998). Heterologous modules for efficient and versatile
PCR-based gene targeting in Schizosaccharomyces pombe. Yeast. 14, 943–951.
Barnard, D., Diaz, B., Clawson, D. and Marshall, M. (1998). Oncogenes, growth factors and
phorbol esters regulate Raf-1 through common mechanisms. Oncogene. 17, 1539-1547.
Beach, D., Piper, M. and Nurse, P. (1982). Construction of a Schizosaccharomyces pombe
gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.
Mol. Gen. Genet. 187, 326–329.
Carnero, E., Ribas, J. C., García, B., Durán, A. and Sánchez, Y. (2000).
Schizosaccharomyces pombe ehs1p is involved in maintaining cell wall integrity and in calcium
uptake. Molecular and General Genetics. 264, 173-183.
Chang, P., Jun-yi, T., Yun-fei, X., Peng, X., Hong-da, L., Hao-an, W., Wen-bo, W., Fan-
guo, M., Xiao, Y. and Jin-peng, S. (2015). The catalytic role of the M2 metal ion in PP2Cα.
Sci. Rep. 5, 8560.
Dhillon, A. S., Hagan, S., Rath, O. and Kolch, W. (2007). MAP kinase signalling pathways
in cancer. Oncogene. 26, 3279–3290.
Doi, A., Kita, A., Kanda, Y., Uno, T., Asami, K., Satoh, R., Nakano, K. and Sugiura, R.
(2015). Geranylgeranyltransferase Cwg2-Rho4/Rho5 module is implicated in the Pmk1 MAPK
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Kinase-mediated cell wall integrity pathway in fission yeast. Genes Cells. 20, 310-23
Gardner, A. M., Vaillancourt, R. R., Lange-Carter, C. A. and Johnson, G. L. (1994). MEK-
1 phosphorylation by MEK kinase, Raf, and mitogen-activated protein kinase: analysis of
phosphopeptides and regulation of activity. Mol. Biol. Cell. 5, 193-201.
Herskowitz, I. (1995). MAP kinase pathways in yeast: for mating and more. Cell. 80, 187–
197.
Hibino, K., Shibata, T., Yanagida, T. and Sako, Y. (2011). Activation kinetics of RAF protein
in the ternary complex of RAF, RAS-GTP, and kinase on the plasma membrane of living cells:
single-molecule imaging analysis. J. Biol. Chem. 286, 36460-8.
Holland, S. J., Liao, X. C., Mendenhall, M. K., Zhou, X., Pardo, J., Chu, P., Spencer, C.,
Fu, A., Sheng, N. and Yu, P., et al. (2001). Functional cloning of Src-like adapter protein-2
(SLAP-2), a novel inhibitor of antigen receptor signaling. J. Exp. Med. 194, 1263–76.
Jeffrey, K. L., Camps, M., Rommel, C. and Mackay, C. R. (2007). Targeting dual-specificity
phosphatases: manipulating MAP kinase signalling and immune responses. Nat. Rev. Drug
Discov. 6, 391–403.
Kam, Y., Petra, J., Brian, M., David, W. R., Harald, M., John, M. S. and Walter K. (2000).
Mechanism of Suppression of the Raf/MEK/Extracellular Signal-Regulated Kinase Pathway
by the Raf Kinase Inhibitor Protein. Mol. Cell Biol. 20, 3079–3085.
Kita, A., Sugiura, R., Shoji, H., He, Y., Deng, L., Lu, Y., Sio, S.O., Takegawa, K., Sakaue,
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
M., Shuntoh, H. and Kuno, T. (2004) Loss of Apm1, the μ1 subunit of the clathrin-associated
adaptor-protein-1 complex, causes distinct phenotypes and synthetic lethality with calcineurin
deletion in fission yeast. Mol. Biol. Cell. 15, 2920–2931.
Levin, D. E. (2005). Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol. Mol.
Biol. Rev. 69, 262–291.
Ma, Y., Kuno, T., Kita, A., Asayama, Y. and Sugiura, R. (2006). Rho2 is a target of the
farnesyltransferase Cpp1 and acts upstream of Pmk1 mitogen-activated protein kinase
signaling in fission yeast. Mol. Biol. Cell. 17, 5028–5037.
Ma, Y., Kuno, T., Kita, A., Nabata, T., Uno, S. and Sugiura, R. (2006). Genetic evidence
for phospholipid-mediated regulation of the Rab GDP-dissociation inhibitor in fission yeast.
Genetics. 106, 064-709.
Madrid, M., Soto, T., Khong, H. K., Franco, A., Vicente, J., Pérez, P., Gacto, M. and
Cansado, J. (2006). Stress-induced Response, Localization, and Regulation of the Pmk1 Cell
Integrity Pathway in Schizosaccharomyces pombe. J. Biol. Chem. 281, 2033–2043.
Marais, R., Light, Y., Paterson, H. F. and Marshall, C. J. (1995). Ras recruits Raf-1 to the
plasma membrane for activation by tyrosine phosphorylation. EMBO J. 14, 3136–3145.
Marshall, C. J. (1994). MAP kinase kinase kinase, MAP kinase kinase and MAP kinase. Curr.
Opin. Genet. Dev. 4, 82–89.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Maundrell, K. (1990). nmt1 of fission yeast. A highly transcribed gene completely repressed
by thiamine. J. Biol. Chem. 265, 10857–10864.
Merla, A. and Johnson, D. I. (2001). The Schizosaccharomyces pombe Cdc42p GTPase
signals through Pak2p and the Mkh1p-Pek1p-Spm1p MAP kinase pathway. Curr. Genet. 39,
205-209.
Munshi, A. and Ramesh, R. (2013). Mitogen-activated protein kinases and their role in
radiation response. Genes Cancer. 4, 401–408.
Nishida, E. and Gotoh, Y. (1993). The MAP kinase cascade is essential for diverse signal
transduction pathways. Trends Bio-chem. Sci. 18, 128–131.
Park, H. O. and Bi, E. (2007). Central roles of small GTPases in the development of cell
polarity in yeast and beyond. Microbiol. Mol. Biol. Rev. 71, 48–96.
Park, S., Rath, O., Beach, S., Xiang, X., Kelly, S. M., Luo, Z., Kolch, W. and Yeung, K. C.
(2006). Regulation of RKIP binding to the N-region of the Raf-1 kinase. FEBS Letters. 580,
6405–6412.
Perez, P. and J. Cansado. (2010). Cell integrity signaling and response to stress in fission
yeast. Curr. Protein Pept. Sci. 11, 680–692.
Sabatinos, S. A. and Forsburg, S. L. (2010). Molecular genetics of Schizosaccharomyces
pombe. Methods Enzymol. 470, 759–795.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Santarpia, L., Lippman, S. L. and El-Naggar, A. K. (2012). Targeting the MAPK- RAS-
RAF signaling pathway in cancer therapy. Expert Opin Ther Targets. 16, 103–119.
Satoh, R., Tanaka, A., Kita, A., Morita, T., Matsumura, Y., Umeda, N., Takada, M.,
Hayashi, S., Tani, T., Shinmyozu, K. and Sugiura, R. (2012). Role of the RNA-binding
protein Nrd1 in stress granule formation and its implication in the stress response in fission
yeast. PLoS One. 7, e29683.
Sengar, A. S., Markley, N. A., Marini, N. J. and Young, D. (1997). Mkh1, a MEK kinase
required for cell wall integrity and proper response to osmotic and temperature stress in
Schizosaccharomyces pombe. Mol. Cell Biol. 17, 3508–3519.
Shah, B. H. and Catt, K. J. (2006). Protein phosphatase 5 as a negative key regulator of Raf-
1 activation. Trends Endocrinol Metab. 17, 382–384.
Sio, S. O., Suehiro, T., Sugiura, R., Takeuchi, M., Mukai, H. and Kuno, T. (2005). The role
of the regulatory subunit of fission yeast calcineurin for in vivo activity and its relevance to
FK506 sensitivity. J. Biol. Chem. 280, 12231–12238.
Stanger, K., Gorelik, M. and Davidson, A. R. (2012). Yeast Adaptor Protein, Nbp2p, Is
Conserved Regulator of Fungal Ptc1p Phosphatases and Is Involved in Multiple Signaling
Pathways. J. Biol. Chem. 287, 22133–22141.
Sugiura, R., Toda, T., Shuntoh, H., Yanagida, M. and Kuno, T. (1998). pmp1+ ,a suppressor
of calcineurin deficiency, encodes a novel MAP kinase phosphatase in fission yeast. EMBO J.
17, 140–148.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Sugiura, R., Toda, T., Dhut, S., Shuntoh, H. and Kuno, T. (1999). The MAPK kinase Pek1
acts as a phosphorylation-dependent molecular switch. Nature. 399, 479–483.
Sugiura, R., Kita, A., Shimizu,Y., Shuntoh, H., Sio, S. O. and Kuno, T. (2003). Feedback
regulation of MAPK signalling by an RNA-binding protein. Nature. 424, 961-965.
Takada, H., et al. (2007). Atf1 is a target of the mitogen-activated protein kinase Pmk1 and
regulates cell integrity in fission yeast. Mol. Biol. Cell. 18, 4794–4802.
Takada, H., Nishida, A., Domae, M., Kita, A., Yamano, Y., Uchida, A., Ishiwata, S., Fang,
Y., Zhou, X. and Masuko, T., et al. (2010). The Cell surface protein gene ecm33+ is a target
of the two transcription factors Atf1 and Mbx1 and negatively regulates Pmk1 MAPK cell
integrity signaling in fission yeast. Mol. Biol. Cell. 21, 674-85.
Tang, J. S. Sawasdikosol, J. H. Chang and S. J. Burakoff. (1999). SLAP, a dimeric adapter
protein, plays a functional role in T cell receptor signaling. Proc. Natl. Acad. Sci. USA. 96,
9775–9780.
Toda, T., Dhut, S., Superti, F. G., Gotoh, Y., Nishida, E., Sugiura, R. and Kuno, T. (1996).
The fission yeast pmk1+ gene encodes a novel mitogen-activated protein kinase homolog which
regulates cell integrity and functions coordinately with the protein kinase C pathway. Mol. Cell
Biol. 16, 6752–6764.
von Kriegsheim, A., Pitt, A., Grindlay, G. J., Kolch, W. and Dhillon, A. S. (2006).
Regulation of the Raf-MEK-ERK pathway by protein phosphatase 5. Nat. Cell Biol. 8, 1011–
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
1016.
Wybenga-Groot L. E. and McGlade, C. J. (2015). RTK SLAP DOWN: The emerging role
of Src-like adaptor protein as a key player in receptor tyrosine kinase signaling. Cellular
Signalling. 27, 267–274.
Yang, P., Pimental, R., Lai, H. and Marcus, S. (1999). Direct activation of the fission yeast
PAK Shk1 by the novel SH3 domain protein, Skb5. J. Biol. Chem. 274, 36052–36057.
Zheng, C. F. and Guan, K. L. (1993). Properties of MEKs, the kinases that phosphorylate and
activate the extracellular signal-regulated kinases. J. Biol. Chem. 268, 23933–23939.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figures
Fig. 1. Skb5 overproduction negatively regulates the Pck2/Pmk1 MAPK signaling
pathway. (A) Skb5 was identified as a regulator of the cytotoxicity induced by Pck2
overproduction. Wild-type (WT) cells transformed with the control vectors alone, pREP2-GST-
Pck2 and the control vector, pREP2-GST-Pck2 and the skb5+gene, or pREP2-GST-Pck2 and
pmp1+ gene, were grown in EMM in the presence (Promoter OFF) or absence (Promoter ON)
of thiamine at 27°C for 5 days. (B) Skb5 suppressed the cytotoxicity induced by Rho2
overproduction. WT cells transformed with the control vectors alone and Rho2 overproduction
cells harboring either the control vector, the skb5+gene, or the pmp1
+ gene, were grown in
EMM in the presence (Promoter OFF) or absence (Promoter ON) of thiamine at 27°C for 3
days. (C) Skb5 failed to suppress the cytotoxicity induced by Pek1DD
overproduction. WT cells
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
transformed with the control vectors alone, pREP2-GST-Pek1DD and the control vector,
pREP2-GST-Pek1DD and the skb5+gene, or pREP2-GST-Pek1DD and pmp1
+ gene, were grown
in EMM in the presence (Promoter OFF) or absence (Promoter ON) of thiamine at 27°C for 6
days. (D) Skb5 deletion induced a vic negative phenotype. WT, Skb5 deletion, and Pmp1
deletion cells were grown in YPD or YPD in the presence of 0.06 M MgCl2+FK506, FK506,
0.06 M MgCl2, or 0.6 M MgCl2 at 27°C for 4 days. (E) Skb5 overproduction can suppress
Pmk1 MAPK phosphorylation induced by Pck2 overproduction. The chromosome-borne nmt1-
GFP-Pck2 cells expressing endogenous Pmk1-GST transformed with either the control vector
or the skb5+, were grown in EMM in the presence (promoter ON -) or absence (promoter ON
+) of thiamine at 27°C. Cell lysates and proteins bound to glutathione beads were analyzed by
immunoblotting using either anti-GFP antibodies (GFP-Pck2), anti-GST antibodies (Pmk1-
GST), and anti-phospho-Pmk1 antibodies (phosphorylated Pmk1). Upper panel: The data
shown are representative of three independent experiments. Lower panel: Quantification of
Pmk1 phosphorylation calculated by measuring intensities of the phosphorylated Pmk1 (as
detected by anti-phospho-Pmk1 antibodies) versus total Pmk1 as loading control (as detected
by anti-GST antibodies) using Image J software.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Fig. 2. Skb5 suppressed Pmk1 MAPK signaling independent of the interaction with Ptc1.
(A) Skb5 binds to Mkh1. GST pull-downs carried out with GST or GST-Skb5; Cells
transformed with plasmids harboring GFP alone (vector), GFP-Pmk1, Pek1-GFP, or GFP-
Mkh1, were collected and the lysates were incubated with purified GST or GST-Skb5.
Proteins bound to glutathione beads were analyzed by SDS-PAGE and immunoblotted using
anti-GFP or anti-GST antibodies. (B) Skb5 binds to Ptc1. Cells transformed with plasmids
harboring GFP alone (vector), GFP-Pmp1, or Ptc1-GFP, were collected and the lysates were
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
incubated with purified GST or GST-Skb5. Proteins bound to glutathione beads were analyzed
by SDS-PAGE and immunoblotted using anti-GFP or anti-GST antibodies. (C) Skb5
overproduction exhibits vic (viable in the presence of immunosuppressant and chloride ion)
phenotype in the absence of Ptc1. Upper panel: Skb5 overexpression exhibits vic phenotype in
the WT cells. WT cells transformed with the control vector, the skb5+ gene or the pmp1+ gene
were grown in EMM and EMM containing 0.12 M MgCl2 plus FK506 at 27°C for 4 days.
Lower panel: Skb5 overexpression exhibits vic phenotype in ptc1 deletion cells. Cells as
indicated were grown EMM and EMM containing 0.12 M MgCl2 plus FK506 at 27°C for 4
days. (D) Skb5 overproduction inhibits Pmk1 MAPK phosphorylation both in the WT and ptc1
KO cells (Δptc1). Left panel: WT cells expressing endogenous Pmk1-GST transformed with
the control vector or the skb5+ gene, were grown in EMM at 27°C and incubated with 2 µg/ml
micafungin for 1 hr, and the phosphorylation of Pmk1 was analyzed as described in Fig. 1D.
Right panel: Ptc1 deletion cells expressing endogenous Pmk1-GST transformed with the
control vector or the skb5+ gene, were grown in EMM at 27°C and the phosphorylation of
Pmk1 was analyzed as described in Fig. 1E.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Fig. 3. Skb5/Mkh1 interaction is important for the Skb5-mediated inhibition of Pmk1
MAPK signaling. (A) Amino acid sequence of Skb5 and its mutant version of Skb5YF2A. The
underlined tyrosine (Y) 89 and phenylalanine (F) 135 of Skb5wt were mutated to alanine (A) to
make Skb5YF2A. (B) Skb5YF2A specifically lost its binding affinity to Mkh1. Cells transformed
with plasmids harboring GFP, GFP-Mkh1, or Ptc1-GFP were collected and the lysates were
incubated with purified GST alone, GST-Skb5 or GST-Skb5YF2A. Cell lysates (Lysate) and
proteins bound to glutathione beads (Pull-down) were analyzed by SDS-PAGE and
immunoblotted using anti-GFP or anti-GST antibodies. (C) Skb5YF2A overexpression did not
suppress the cytotoxicity induced by Pck2 overproduction. WT cells transformed with
pREP2-GST-Pck2 and the control vector, pREP2-GST-Pck2 and the skb5+gene, or pREP2-
GST-Pck2 and skb5YF2A gene, were grown in EMM in the presence (Promoter OFF) or absence
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(Promoter ON) of thiamine at 27°C for 5 days. (D) Skb5YF2A overexpression did not exhibits
vic phenotype. Cells overexpressing the skb5YF2A failed to grow in the presence of EMM plus
0.12 M MgCl2 and FK506 at 27°C. WT cells transformed with the control vector, skb5+ gene
and skb5YF2A gene were grown in EMM +0.12 M MgCl2 +FK506 at 27°C for 4 days. (E)
Skb5YF2A overproduction failed to inhibit Pmk1 MAPK signaling. The phosphorylation levels
of Pmk1 were not inhibited upon Skb5YF2A overproduction. WT cells expressing endogenous
GST-tagged Pmk1, transformed with the control vector, skb5+ gene or the skb5YF2A gene, were
grown in EMM at 27°C and incubated with 2 µg/ml micafungin for 1 hr. Proteins bound to
glutathione sepharose (Pull-down) were analyzed as described in Fig. 1D. Lower panel: Graph
shows phosphorylation levels of Pmk1 analyzed as described in Fig. 1D.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Fig. 4. Skb5 overproduction affects Mkh1 localization to the growing ends. (A) Mkh1
localization to the growing ends is reduced by Skb5 overproduction, but not by Skb5YF2A.
Upper panel: WT cell expressing endogenous Mkh1-GFP transformed with the control vector
(+vector), the skb5+gene or the skb5
YF2A gene, were grown in EMM plus thiamine for 16 hr.
The fluorescence of Mkh1-GFP was observed as described. Scale bar, 10 μm. n=3. Middle
panel: The number in each lane indicates the number of the cells with Mkh1 localization to the
cell ends/100 cells. The asterisks indicate significant differences (Dunnett's test, **P<0.01;
n=3, (mean±s.d.). (see Materials and Methods) n=3.
Lower panel: The number indicates the ratio of the number of the cells with Mkh1 localization
to the growing ends versus that of the cells harboring the control vector. (B) Amino acid
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
sequence of Mkh1 and its mutant version of Mkh13PA. The underlined three prolines 544, 546
and 547 of Mkh1wt were mutated to alanine (A) to make Mkh13PA. (C) Mkh13PA
specifically
lost its binding affinity to Skb5. Cells were transformed with plasmids harboring GFP alone,
GFP-Mkh1, GFP-Mkh13PA
were collected and the lysates were incubated with purified GST,
GST-Skb5, GST-Pek1 or GST-Pck2. Cell lysates (Lysate) and proteins bound to glutathione
beads (Pull-down) were analyzed by immunoblotting using anti-GFP and anti-GST antibodies.
(D) Mkh13PA localization to growing ends does not change upon Skb5 overproduction. Upper
panel: WT cells expressing endogenous Mkh13PA transformed with the control vector, or the
skb5+gene, were grown in EMM +thiamine for 16 hr. Scale bar, 10 μm. n=3 (see Materials and
Methods), (mean±s.d.). Middle panel and Lower panel: The ratio and the percentages of the
cells were analyzed as described in Fig. 4A.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Fig. 5. Skb5 localization to the growing ends needs Skb5/Mkh1 interaction. (A) Skb5, but
not Skb5YF2A
, accumulated in the growing ends upon its overproduction. Upper panel: WT cell
expressing endogenous Skb5-GFP, or Skb5YF2A
-GFP transformed with the control vector, and
the WT cells transformed with the GFP-Skb5 or GFP-Skb5YF2A
, were grown in EMM
+thiamine for 16 hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle
panel: The number in the picture indicates the Skb5/Skb5YF2A
cell-tip localization/100 cells in
each sample. The asterisks indicate significant differences (Tukey’s test, **P<0.01, *P<0.05;
n=3, (mean±s.d.). (see Materials and Methods). Lower panel: The graph shows the ratio of the
cells with Skb5/Skb5YF2A
cell-tip-localization versus that of the cells expressing the
endogenous Skb5. (B) Skb5 localization to growing ends is decreased in mkh1 KO cell. Upper
panel: WT cells or mkh1 KO cells expressing endogenous Skb5 transformed with the control
vector, were grown in EMM for 16 hr. Scale bar, 10 μm. n=3 (see Materials and Methods),
(mean±s.d.). Middle panel and Lower panel: The ratio and the percentages of the cells were
analyzed as described in Fig. 4A. The asterisks indicate significant differences (Student's t-test,
**P<0.01; n=3, (mean±s.d.). (see Materials and Methods).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Fig. 6. Skb5 deletion increased Mkh1 cell-tip localization and Pmk1 phosphorylation.
(A) Skb5 deletion, Skb5YF2A mutation and Mkh13PA mutation induced a vic negative phenotype.
Upper panel: WT, skb5YF2A mutant, and Skb5 deletion cells were grown in YPD or YPD in the
presence of 0.06 M MgCl2+FK506 at 27°C for 4 days. Lower panel: WT, mkh13PA mutant, and
Skb5 deletion cells were grown in YPD or YPD in the presence of 0.06 M MgCl2+FK506 at
27°C for 4 days. (B) Skb5 deletion induced Pmk1 hyperphosphorylation. The WT and Skb5
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
deletion cells expressing endogenous Pmk1-GST, were grown in EMM at 27°C and incubated
with 2 µg/ml micafungin for 0, 20, 40, 60 min, and the phosphorylation of Pmk1 was analyzed
and quantified as described in Fig. 1E. The data shown are representative of three independent
experiments. (C) The skb5YF2A mutation and the mkh13PA mutant did not increase Pmk1
hyperphosphorylation. Left panel: WT and skb5YF2A mutant cells expressing endogenous
Pmk1-GST, were grown in EMM at 27°C and incubated with 2 µg/ml micafungin for 0, 20, 40,
60 min, and the phosphorylation of Pmk1 was analyzed and quantified as described in Fig. 1E.
Right panel: The WT and mkh13PA cells expressing endogenous Pmk1-GST, were grown in
EMM at 27°C and incubated with 2 µg/ml micafungin for 0, 20, 40, 60 min, and the
phosphorylation of Pmk1 was analyzed and quantified as described in Fig. 1E. (D) Skb5
deletion increased Mkh1 cell-tip localization. Upper panel: WT and Skb5 deletion cells
expressing endogenous Mkh1 tagged with GFP or cells expressing the Mkh13PA mutant protein
tagged with GFP under the native promoter were analyzed as described in Figure 4A. Middle
panel and Lower panel: The ratio and the percentages of the cells were analyzed as described
in Fig. 4A. The asterisks indicate significant differences (Dunnett's test, **P<0.01; n=3,
(mean±s.d.). (see Materials and Methods).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Fig. 7. Pck2 is required for efficient Skb5/Mkh1 localization at the cell tips. (A) Mkh1
localization to the growing ends was decreased in the absence of Pck2. Upper panel: WT, ras1
KO, rho2 KO or pck2 KO cells expressing endogenous Mkh1 tagged with GFP, were grown in
EMM for 16 hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle panel
and Lower panel: The number in the graph indicates the cell-tip-localization of GFP-Mkh1 per
100 cells as described in Fig. 4A. The ratio and the percentages of the cells with Mkh1
localization to the cell ends, were analyzed as described in Fig. 4A. (B) Skb5 localization to
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
the growing ends was decreased in the absence of Pck2. Upper panel: WT, ras1 KO, rho2 KO
or pck2 KO cells expressing endogenous Skb5 tagged with GFP were grown in EMM for 16
hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle panel and Lower
panel: The ratio and the percentages of the cells with Skb5 localization to the cell ends, were
analyzed as described in Fig. 4A. (C) Pck2 influences the binding between Skb5 and Mkh1.
Upper panel: WT or Pck2 deletion cells expressing GFP-Mkh1 transformed with plasmids
harboring the control GST vector or GST-Skb5 were grown in EMM +thiamine at 27°C. Cells
were collected and the lysates were incubated with purified GST alone or GST-Skb5. Cell
lysates (Lysate) and proteins bound to glutathione beads (Pull-down) were analyzed by
immunoblotting using anti-GFP and anti-GST antibodies. Lower panel: Quantification of the
Mkh1/Skb5 binding in WT and Pck2 deletion cells. The intensities of the bands in the pull-
downs were analyzed using Image J software. (D) Skb5 does not affect Pck2 localization in the
growing ends. Upper panel: WT cells expressing endogenous Pck2 tagged with GFP
transformed with the control vector or the skb5+ gene, were grown in EMM +thiamine for 16
hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle panel and Lower
panel: Quantification of the cell-tip localization of Pck2-GFP was analyzed as described in Fig.
4A.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Fig. 8. Pck2 and Mkh1 localized to the cell tips in a cell-cycle dependent manner. (A) Cells
from the cdc25-22 mutants expressing endogenous Mkh1-GFP from the native promoter, were
grown to the log phase at 25°C, shifted to 37°C for 4 hr to synchronize the cells in the G2 phase,
and then shifted back to 25°C. Aliquots were obtained at different time points, and the cell-
tip Mkh1 localization (■) was analyzed as described in Figure 1(A). The septation index (□)
is also shown, which indicates good cell cycle synchrony in the culture. (B) Cells from the
cdc25-22 mutants expressing endogenous Pck2-GFP from the native promoter, were grown to
the log phase at 25°C and analyzed as described in Figure 8A. Aliquots were obtained at
different time points, and the cell-tip Pck2 localization (■) was analyzed as described in Figure
1A. The septation index (□) is also shown, which indicates good cell cycle synchrony in the
culture.
J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information
Figure S1. Pck2 overproduction did not induce Pmk1 MAPK activation in Pek1
deletion cells.
WT or Pek1 deletion cells expressing the chromosome-borne nmt1-GFP-Pck2 and Pmk1-
GST were grown in EMM in the presence (promoter OFF) or absence (promoter ON) of
thiamine at 27°C. Pmk1 phosphorylation and quantification was analyzed as described
in Figure 1E.
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information
Figure S2. Cdc42 over-expression-mediated lethality was suppressed by Pmk1
deletion and skb5 overexpression.
WT cells transformed with the control vectors alone, pREP81-cdc42G12V and the control
+vector, pREP81-cdc42G12V and the skb5 gene, or Pmk1 deletion cells harboring pREP81-
cdc42G12V, were grown in EMM in the presence (Promoter OFF) or absence (Promoter
ON) of thiamine at 27°C for 8 days.
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information
Table S1. Schizosaccharomyces pombe strain used in this study
Strain Genotype Reference
HM123 h- leu1-32 Our stock
KP452 h- leu1-32 ura4-D18 mkh1::ura4+ Our stock
KP456 h- leu1-32 ura4-D18 Our stock
KP898 h- leu1-32 ura4-D18 ptc1::ura4+ Our stock
KP2163 h- leu1-32 pck2::KanMX6 Our stock
KP2497 h- leu1-32 ura4-D18 nmt1-rho2+-GFP-ura4+ Our stock
SP630 h- leu1-32 ura4-D18 skb5::ura4+ Our stock
SP1657 h- leu1-32 ura4-D18 pck2+-GFP-ura4+ Our stock
SP2231 h- leu1-32 pmk1+-GST-KanMX6 Our stock
SP2390 h- leu1-32 ura4-D18 nmt1-pck2+-GFP-ura4+ pmk1+-GST-KanMX6 Our stock
SP2490 h- leu1-32 ura4-D18 skb5::ura4+ pmk1+-GST-KanMX6 Our stock
SP2556 h- leu1-32 mkh1+-GFP-KanMX6 This study
SP2605 h- leu1-32 skb5+-GFP-KanMX6 This study
SP2607 h- leu1-32 ura4-D18 ptc1::ura4+ pmk1+-GST-KanMX6 This study
SP2716 h? leu1-32 ura4-D18 cdc25-22 pck2+-GFP-ura4+ This study
SP2718 h- leu1-32 skb5YF2A-GFP-KanMX6 This study
SP2719 h- leu1-32 mkh13PA-GFP-KanMX6 This study
SP2724 h- leu1-32 ura4-D18 skb5::ura4+ mkh1+-GFP-KanMX6 This study
SP2725 h- leu1-32 ura4-D18 pck2::ura4+ skb5+-GFP-KanMX6 This study
SP2726 h? leu1-32 ura4-D18 cdc25-22 mkh1+-GFP- KanMX6 This study
SP2727 h- leu1-32 ura4-D18 rho2::ura4+ skb5+-GFP-KanMX6 This study
SP2729 h- leu1-32 skb5+-GFP-KanMX6 pmk1+-GST-KanMX6 This study
SP2740 h- leu1-32 skb5YF2A-GFP-KanMX6 pmk1+-GST-KanMX6 This study
SP2741 h- leu1-32 ura4-D18 ras1::ura4+ mkh1+-GFP-KanMX6 This study
SP2742 h- leu1-32 ura4-D18 ras1::ura4+ skb5+-GFP-KanMX6 This study
SP2743 h- leu1-32 ura4-D18 mkh1::ura4+ skb5+-GFP-KanMX6 This study
SP2744 h- leu1-32 ura4-D18 rho2::ura4+ mkh1+-GFP-KanMX6 This study
SP2745 h+ his2 leu1-32 mkh13PA-GFP-KanMX6 pmk1+-GST-KanMX6 This study
SP2746 h- leu1-32 ura4-D18 pck2::ura4+ mkh1+-GFP-KanMX6 This study
SP2749 h- leu1-32 mkh1+-GFP-KanMX6 pmk1+-GST-KanMX6 This study
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information
Table S2. Schizosaccharomyces pombe primers used in this study
Gene Primer
Mkh1 3PA sense 5’-CCTGCACCTGCAGCCACAGAGACATCTAGTTTACG-3’
Mkh1 3PA antisense 5’-GGCTGCAGGTGCAGGATCTCTATGTGCCACAAAAT-3’
Skb5 Y89A sense 5’-AGCTGATTTCGAGCCCCTCCATGATAATGAACTCG-3’
Skb5 Y89A antisense 5’-GCTAGCGCAACGGCGTCAGCAAGGACGTTGAAAGA-3’
Skb5 F135A sense 5’-TTGTTCCTGAGACTGCAGTTAAATTAGAGGTATAA-3’
Skb5 F135A antisense 5’-TGCAGTCTCAGGAACAAGCCCGCTTCTTCCTGAGG-3’
Mkh1 endogenous sense
5’-ATCACCCGTTTATGAAATGTGACGAAGAATTCAACTTTAAGGACACGAATCTTTACGACA
TGCTTTGTAAAAGAAAGAGCCGGATCCCCGGGTTAATTAA-3’
Mkh1 endogenous antisense
5’-
AATAAATAGCTATAAGAAGAAATTGAGAATGCATGCCCCTGCGAGGAAACGCTAAGTAA
TAAATAATAATTGCGACCAATGAATTCGAGCTCGTTTAAAC-3’
Skb5 endogenous sense
5’-
GCGATGGTTGGTTGATTGCATACGATGATGCCTCAGGAAGAAGCGGGCTTGTTCCTGAGA
CGTTTGTTAAATTAGAGGTACGGATCCCCGGGTTAATTAA-3’
Skb5 endogenous antisense
5’-TGGAACATAAAATAAGGAATAACATTTTAAAATCAATTTGACAAAAAGAAAAAGTAAAA
AGGGTTCAATTCAACGCTCTTGAATTCGAGCTCGTTTAAAC-3’
Mkh1 3PA endogenous sense 5’-ATGGCTGCCGATATCGGATC-3’
Skb5 YF2A endogenous sense 5’-ATGGCGGAAGAGACTGAAGAG-3’
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Recommended