Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B

j ourna l homepage: www.e lsev ie r .com/ locate /cbpb

A kinetic characterization of the gill V(H+)-ATPase in juvenile and adultMacrobrachium amazonicum, a diadromous palaemonid shrimp

Malson N. Lucena a, Marcelo R. Pinto a, Daniela P. Garçon c, John C. McNamara b, Francisco A. Leone a,⁎a Departamento de Química, Faculdade de Filosofia, Ciências e Letras da Universidade de São Paulo, Ribeirão Preto 14040-901, SP, Brazilb Departamento de Biologia, Faculdade de Filosofia, Ciências e Letras da Universidade de São Paulo, Ribeirão Preto 14040-901, SP, Brazilc Departamento de Biologia Molecular, Centro de Ciências Exatas e da Natureza, Universidade Federal da Paraíba, PB, Brazil

⁎ Corresponding author at: Faculdade de Filosofia, CiênUniversidade de São Paulo, Departamento de Química14040-901 Ribeirão Preto, SP, Brazil. Tel.: +55 16 3315 36

E-mail address: fdaleone@ffclrp.usp.br (F.A. Leone).

http://dx.doi.org/10.1016/j.cbpb.2014.11.0021096-4959/© 2014 Published by Elsevier Inc.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 25 June 2014Received in revised form 5 September 2014Accepted 7 November 2014Available online 15 November 2014

Keywords:V(H+)-ATPase kineticsFreshwater shrimp gillCrustaceaBiochemical characterization

Novel kinetic properties of a microsomal gill V(H+)-ATPase from juvenile and adult Amazon River shrimp,Macrobrachium amazonicum, are described. While protein expression patterns are markedly different, Westernblot analysis reveals a sole immunoreactive band, suggesting a single V(H+)-ATPase subunit isoform, distributedin membrane fractions of similar density in both ontogenetic stages. Immunofluorescence labeling locates theV(H+)-ATPase in the apical regions of the lamellar pillar cells in both stages in which mRNA expression of theV(H+)-ATPase B-subunit is identical. Juvenile (36.6 ± 3.3 nmol Pi min−1 mg−1) and adult (41.6 ± 1.3 nmol Pimin−1 mg−1) V(H+)-ATPase activities are similar, the apparent affinity for ATP of the adult enzyme (K0.5 =0.21 ± 0.02 mmol L−1) being 3-fold greater than for juveniles (K0.5 = 0.61 ± 0.01 mmol L−1). The K0.5 forMg2+ interaction with the juvenile V(H+)-ATPase (1.40 ± 0.07 mmol L−1) is ≈6-fold greater than for adults(0.26 ± 0.02 mmol L−1) while the bafilomycin A1 inhibition constant (KI) is 45.0 ± 2.3 nmol L−1 and 24.2 ±1.2 nmol L−1, for juveniles and adults, respectively. Both stages exhibited residual bafilomycin-insensitive ATPaseactivity of ≈25 nmol Pi min−1 mg−1, suggesting the presence of ATPases other than the V(H+)-ATPase. Thesedifferences may reflect a long-term regulatory mechanism of V(H+)-ATPase activity, and suggest stage-specificenzyme modulation. This is the first kinetic analysis of V(H+)-ATPase activity in different ontogenetic stages ofa freshwater shrimp and allows better comprehension of the biochemical adaptations underpinning the estab-lishment of palaemonid shrimps in fresh water.

© 2014 Published by Elsevier Inc.

1. Introduction

The colonization of freshwater habitats from the ancestral marineenvironment is one of the most dramatic evolutionary transitions inthe history of life on earth (Lee et al., 2011) since existence in freshwater necessitates the ability to acquire essential ions (Glenner et al.,2006). Hyperosmoregulating species that inhabit dilute media or freshwater are challenged by osmotic water influx and passive salt loss forwhich they actively compensate; they are also less permeable to ionloss (Kirschner, 2004; Foster et al., 2010).

The gills, together with the excretory organs, are mainly respon-sible for ionic regulation in the Crustacea (Freire et al., 2008) andprovide a selective interface across which salt is activelytransported between the external environment and the internalmi-lieu. Thus, the gills constitute a multi-functional effector organ sys-tem contributing simultaneously to osmotic, excretory, acid–base

cias e Letras de Ribeirão Preto -Avenida Bandeirantes, 3900,68; fax: +55 16 3315 4838.

and respiratory homeostasis (Gilles and Péqueux, 1985; Taylorand Taylor, 1992; Péqueux, 1995; Lucu and Towle, 2003; Freireet al., 2008; Henry et al., 2012).

Many enzymes and transporters are involved in ion transport by thecrustacean gill such as the (Na+, K+)-ATPase, V(H+)-ATPase, carbonicanhydrase, and Cl−/HCO3

− and Na+/H+ exchangers (Tsai and Lin,2007; Freire et al., 2008; McNamara and Faria, 2012). Of these enzymes,the evolution of function in the V(H+)-ATPase and (Na+, K+)-ATPasehas been considered critical for the colonization of fresh water(Morris, 2001; Tsai and Lin, 2007).

The (Na+, K+)-ATPase is restricted to the basalmembrane of the gillionocytes and provides part of the driving force for the trans-epithelialmovement of monovalent ions across the gill epithelia in brachyuranCrustacea (Towle and Kays, 1986; McNamara and Torres, 1999; Lignotand Charmantier, 2001; Lucu and Towle, 2003; McNamara and Faria,2012). In freshwater shrimps, a V(H+)-ATPase located apically in thegill pillar cell flanges may complement the intralamellar septal cell(Na+, K+)-ATPase in energizing osmoregulatory NaCl uptake fromfresh water (McNamara and Lima, 1997; Faleiros et al., 2010; McNa-mara and Faria, 2012). TheV(H+)-ATPase is also considered responsiblefor acid–base balance and to participate in nitrogen excretion(Weihrauch et al., 2001).

16 M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

V(H+)-ATPases are membrane-associated ATP-dependent protonpumps that couple the energy released during the hydrolysis of ATP tothe active transport of protons from the cytoplasm to the lumenof intra-cellular compartments or to the extracellular space, when located in theplasmamembrane (Forgac, 2007). V(H+)-ATPases are structurally con-served, regardless of kingdom (Stevens and Forgac, 1997), and are orga-nized into two large multi-subunit functional domains (Saroussi andNelson, 2009; Nakanishi-Matsui et al., 2010; Toei et al., 2010). The inte-gral V0 domain consists of six different subunits in which multiple cop-ies of the proteolipid c subunit are organized as the c-ring. An essentialglutamate residue, buried within each proteolipid c copy is reversiblyprotonated during proton translocation (Jefferies et al., 2008). The pres-ence of hemi-channels in the a subunit provides proton access to theacidic glutamate residues. The peripheral V1 domain contains eight dif-ferent subunits (A–H) in which three copies of the A and B subunits arealternately disposed in a ring pattern. Catalytic sites located at the A andB subunit interfaces are involved in ATP hydrolysis. Multiple stalks in-terconnect the V0 and V1 domains. The central stalk, formed by the D,F and d subunits is attached to the c-ring and passes through the A3B3hexamer center. V(H+)-ATPases are enzymes that operate through a ro-tary mechanism resulting in unidirectional H+ transport across themembrane. ATP hydrolysis in the V1 domain drives the rotation of thecentral stalk causing rotation of the entire rotary assembly, which in-cludes the D, F and d subunits and the c-ring (Imamura et al., 2003).

In mammalian cells, most of the V(H+)-ATPase subunits areexpressed as multiple isoforms which are often tissue-specific (Toeiet al., 2010). Several complex mechanisms including the reversible dis-sociation of the V1 and V0 domains, the tightness of coupling betweenproton transport and ATP hydrolysis, and selective targeting of specificV(H+)-ATPases to different cellular membranes are involved in the reg-ulation of V(H+)-ATPase activity in vivo (Kane, 2006; Forgac, 2007; Toeiet al., 2010). Phosphorylation of the C subunit by protein kinase A caus-ing the rapid and reversible dissociation of the V1 and V0 domains is themost well-known mechanism (Toei et al., 2010). The reversible inser-tion of fully assembled V(H+)-ATPase molecules resulting from A sub-unit phosphorylation may regulate proton transport across the apicalmembrane of some polarized cells (Alzamora et al., 2010; Toei et al.,2010). Reversible disulfide bond formation at subunit A catalytic sitesaccounting for blockage of ATP hydrolysis and modification of couplingefficiency between ATP hydrolysis and H+ translocation, apparentlyresulting from thepresence of different subunit isoforms, also constitutepossible mechanisms of V(H+)-ATPase regulation (Kawasaki-Nishiet al., 2001; Forgac, 2007; Toei et al., 2010).

pH change is an importantmodulator of transepithelial solute trans-port, endocrine function, and cell growth and differentiation (Boron,1986). While the V(H+)-ATPase may be regulated by extracellular pH,studies in crustaceans are rare (Pan et al., 2007). Gill V(H+)-ATPase ac-tivity increases in response to low and/or high salinities andmay reflectincreased H+ export, maintaining hemolymph acid–base regulationconsequent to altered metabolic rate (Bianchini et al., 2007).

The palaemonid shrimp genusMacrobrachium constitutes one of themost diverse and widespread taxons that have successfully invadedfreshwater from the ancestral estuarine habitat (Murphy and Austin,2005; Augusto et al., 2009; McNamara and Faria, 2012). However, var-iousMacrobrachium species inhabit streams discharging into the Atlan-tic Ocean along the coast of São Paulo State (Brazil) and exhibit widelyvarying degrees of physiological adaptation to fresh water (Moreiraet al., 1983; Freire et al., 2003; Freire et al., 2008; McNamara andFaria, 2012). Diadromous forms, like Macrobrachium heterochirus,Macrobrachium acanthurus andMacrobrachium olfersi, exhibit extendedlarval phases that require estuarine ormarinewaters. Hololimnetic spe-cies like Macrobrachium potiuna and Macrobrachium brasiliense inhabitcontinental waters in which they spend their entire life cycles(Moreira et al., 1983).

The AmazonRiver shrimpMacrobrachiumamazonicum is endemic toSouth America (Holthius, 1952; Odinetz-Collart and Rabelo, 1996) and

its presumptive natural distribution includes the Orinoco, Amazon,and the Paraguay/Lower Paraná river basins (Magalhães et al., 2005).This diadromous shrimphas diversified into coastal populations that in-habit rivers close to estuaries and continental populations living inrivers, lakes and other inland water bodies (Charmantier and Anger,2011; Anger, 2013). These two groups apparently differ in externalmorphology and meristic characters (Pileggi and Mantelatto, 2012).Coastal populations ofM. amazonicum exhibit a lengthy larval sequencedependent on brackish water for development to the post-larva. Thejuvenile stage then migrates back to fresh water to mature into theadult form (Moreira et al., 1986). Adult M. amazonicum are stronghyperosmotic and ionic regulators, an ability underpinned by gill(Na+, K+)-ATPase activity (Augusto et al., 2007; Faleiros et al., 2010).While a gill (Na+, K+)-ATPase has been kinetically characterized in sev-eral ontogenetic stages ofM. amazonicum (Santos et al., 2007; Belli et al.,2009; Leone et al., 2012), only a single study has characterized gillV(H+)-ATPase activity (Faleiros et al., 2010), in this frequently usedpalaemonid shrimp model. Investigations of the effects of salinity onV(H+)-ATPase activity are also scarce (Pan et al., 2007; Tsai and Lin,2007), and the mechanisms modulating enzyme activity in responseto salinity change are as yet unknown.

Most studies addressing an osmoregulatory role for the gill V(H+)-ATPase in euryhaline and freshwater crustaceans have employed elec-trophysiological techniques (Onken and McNamara, 2002; Genoveseet al., 2005). V(H+)-ATPase activity rarely has been characterized, cor-relation with ontogenetic development is not well investigated, andthe biochemical mechanisms underlying long-term gill V(H+)-ATPaseactivity regulation in response to salinity change are only now being in-vestigated. Recent studies show a substantial increase or decrease inV(H+)-ATPase B subunitmRNA expression in the gill epithelia of certaincrustaceans in response to low or high salinity acclimation, respectively,suggesting alteration in transcription rates and/ormRNA stability, lead-ing to altered rates of enzyme synthesis (Weihrauch et al., 2001; Luquetet al., 2005; Tsai and Lin, 2007; Faleiros et al., 2010).

In this study, we provide an extensive kinetic characterization ofV(H+)-ATPase activity in a gill microsomal fraction from juvenile andadult M. amazonicum. V(H+)-ATPase activity distribution in a sucrosedensity gradient and V(H+)-ATPase subunit expression are also exam-ined. Our findings disclose a substantial increase in affinity of the en-zyme for ATP, Mg2+ and bafilomycin in adults compared to juveniles,suggesting that modulation of V(H+)-ATPase activity may be stage-specific.

2. Materials and methods

2.1. Materials

All solutions were prepared using Millipore MilliQ ultrapure,apyrogenic water. Tris (hydroxymethyl) amino methane (Tris), ATPdi-Tris salt, pyruvate kinase (PK), phosphoenolpyruvate (PEP), NADH,N-(2-hydroxyethyl) piperazine-N′-ethanesulfonic acid (HEPES),sodium orthovanadate, lactate dehydrogenase (LDH), phosphoglycer-ate kinase (PGK), nitroblue tetrazolium (NBT), bafilomycin A1,diethylpyrocarbonate(DEPC) and 5-bromo-4-chloro-3-indole phos-phate (BCIP) were purchased from the Sigma Chemical Company(Saint Louis, USA). Dimethyl sulfoxide (DMSO) and triethanolaminewere from Merck (Darmstadt, Germany). The protease inhibitor cock-tail (1 mmol L−1 benzamidine, 5 μmol L−1 antipain, 5 μmol L−1

leupeptin, 1 μmol L−1 pepstatin A, and 5 μmol L−1 phenyl-methane-sulfonyl-fluoride) was from Calbiochem (San Diego, USA). The V(H+)-ATPase monoclonal antibody raised against the c-subunit ofDictyostelium discoideum (#224-256-2) was purchased from the Devel-opmental Studies Hybridoma Bank (Iowa, USA); the goat polyclonalV(H+)-ATPase A1 (L-20) antibody against the 116-kDa subunit, andthe donkey anti-goat IgG alkaline phosphatase conjugate were pur-chased fromSanta Cruz Biotechnology, Inc. (Dallas, USA). Themolecular

17M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

mass markers myosin (220 kDa), bovine serum albumin (100 kDa),glyceraldehyde dehydrogenase (60 kDa), alcohol dehydrogenase(45 kDa) and carbonic anhydrase (30 kDa) were from Sigma ChemicalCompany (Saint Louis, USA). All other reagents usedwere of the highestpurity commercially available.

Crystalline suspensions of LDH and PK were centrifuged at20,000 ×g for 15 min at 4 °C in an Eppendorf 5810 refrigerated centri-fuge. The pellet was resuspended in 500 μL of 50mmol L−1 HEPES buff-er, pH 7.5, transferred to a YM-10 Microcon filter and centrifuged 5times in the above buffer until complete removal of ammonium ions(tested with the Nessler reagent). Finally, the pellet was resuspendedto the original volume.

The stock solution of ATPwas prepared by dissolving ATP di-Tris saltin water and adjusting the pH to 7.0 with triethanolamine (d =1.12 gmL−1). The exact concentration was established from the extinc-tion coefficient (ε260 nm pH 7.0 = 15,400mol L−1 cm−1) and adjusted to100 mmol L−1. Concentrated bafilomycin A1 solution (200 μmol L−1)was prepared in DMSO. Sodium orthovanadate solution was preparedaccording to Gordon (1991). When necessary, enzyme solutions wereconcentrated on YM-10 Amicon Microcon filters.

2.2. Shrimps

Amazon River prawns,M. amazonicum, were produced at the Aqua-culture Center, UNESP, Jaboticabal, São Paulo, Brazil from broodstockcollected in fresh water at Furo das Marinhas near Santa Bárbara doPará (1° 13′ 25″ S; 48° 17′ 40″ W), northeastern Pará State, Brazil, in2001 (Araújo and Valenti, 2007). Juveniles of about 5 cm length and3 g wet weight (20 individuals/preparation, ≈700 μg wet gill mass)were collected from freshwater rearing tanks and held in carboys con-taining 32 L aerated fresh water from the rearing tank. Adult maleshrimps of about 12 cm length and ≈12 g wet weight (20 individuals/preparation, ≈6 g wet gill mass) were collected from freshwaterponds and maintained in carboys containing 32 L aerated pond water.Juveniles and adults were used in stage C of the intermolt cycle, con-firmed by stereoscopic microscopy (Hayd et al., 2008). The juvenile isan early benthonic freshwater stage while adult shrimps are wellestablished in fresh water and are sexually mature.

2.3. Gill dissection

For each homogenate prepared, shrimps were anesthetized by chill-ing on crushed ice immediately before dissection and gill homogeniza-tion. After removal of the branchiostegites, the gills of juvenile andadult shrimps were rapidly dissected, diced and homogenized in a Pot-ter homogenizer set at 600 rpm in 20 mmol L−1 imidazole buffer,pH 6.8, containing 6 mmol L−1 EDTA, 250mmol L−1 sucrose and a pro-tease inhibitor cocktail (20 mL buffer/g wet tissue).

2.4. Preparation of gill microsomes

After centrifuging the crude extract at 20,000 ×g for 35 min at 4 °C,the supernatant was placed on crushed ice and the pellet was re-suspended in an equal volume of the imidazole homogenization buffer.After further centrifugation as above, the two supernatants were gentlypooled and centrifuged at 100,000 ×g for 90 min at 4 °C. The resultingpellet, containing the microsomal fraction, was homogenized in20 mmol L−1 imidazole buffer, pH 6.8, containing 6 mmol L−1 EDTAand 250 mmol L−1 sucrose (15 mL buffer/g wet tissue). Finally, 0.5-mLaliquots were rapidly frozen in liquid nitrogen and stored at −20 °C.No appreciable loss of V-ATPase activitywas seen after two-month's stor-age of the microsomal enzyme prepared from the gill tissue. When re-quired, the aliquots were thawed, placed on crushed ice and usedimmediately.

2.5. Gill ultrastructure and immunolocalization of the gill V(H+)-ATPase

For ultrastructural analysis, sixth right-side gills were used. All pro-cedures were performed according to Faleiros et al. (2010).

For immunolocalization, fourth left-side gills were dissected and in-cubated in a fixative solution containing 2.5% p-formaldehyde in a phos-phate buffered saline (PBS, 10mmol L−1 Na2HPO4, 2mmol L−1 KH2PO4,137 mmol L−1 NaCl, 2.7 mmol L−1 KCl, 290 mOsm kg−1 H2O), pH 7.4,for 1 h, and then embedded in Optimal Cutting Temperature Com-pound. Thick cryosections (12-μm) were taken transversely to the gilllamella long-axis using a Micron HM 505E model Cryostat Microtome(Walldorf, Germany) at −20 °C and collected on gelatin-coated slides(Bloom 225). V(H+)-ATPase immunolocalization was performed usinga mouse monoclonal IgG1 antibody (#224-256-2) raised againstD. discoideum V(H+)-ATPase c-subunit (Journet et al., 1999).

Cryosectioning was performed according to França et al. (2013).Drops of V(H+)-ATPase c-subunit antibody, diluted to 21 mg mL−1 inPBS (1:1.2), were placed on the cryosections, which were incubatedfor 1 h at room temperature in a humid chamber. Negative control sec-tions were incubated in blocking solution (1% bovine serum albuminplus 0.1% gelatin in PBS) without the primary antibody. The sectionswere then incubated with donkey anti-mouse IgG secondary antibodyconjugated with Alexa-fluor 488 diluted 1:450 in PBS for 45 min. Thenuclei were stained with DAPI (diluted 1:200) in PBS for 20 min. Thesections were observed and photographed using an Olympus BX-50fluorescence microscope (Olympus America Inc., Melville, USA)equipped with a SPOT RT3 25.4 2 Mb Slider camera (SPOT Imaging So-lutions Inc., Sterling Heights, USA) employing differential interferencecontrast microscopy and excitation/emission wavelengths of 495/519 nm (Alexa-fluor 488) and 358/461 nm (DAPI).

2.6. Measurement of V(H+)-ATPase activity

V(H+)-ATPase activitywas assayed at 25 °C using a PK/LDH couplingsystem (Rudolph et al., 1979) in which ATP hydrolysis was coupled toNADH oxidation according to Lucena et al. (2012). In this system, thephosphate released during ATP hydrolysis by the V(H+)-ATPase is con-verted to ATP while phosphoenolpyruvate is converted to pyruvate bypyruvate kinase. Pyruvate is converted to lactate concomitant withNADH oxidation. The rate of ATP hydrolysis by the V(H+)-ATPase canbe estimated by monitoring NADH titers. NADH oxidation was moni-tored at 340 nm (ε340 nm, pH 7.5 = 6,200 mol L−1 cm−1) in a HitachiU-3000 spectrophotometer equipped with thermostatted cell holders.Standard assay conditions for estimation of total microsomal P-ATPaseactivity were 50 mmol L−1 HEPES buffer, pH 7.5, containing ATP(5 mmol L−1 for juveniles and 2 mmol L−1 for adults), 5 mmol L−1

MgCl2, 20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1

NADH, 2.0 mmol L−1 PEP, 82 μg PK (49 U) and 110 μg LDH (94 U) in afinal volume of 1.0mL. Microsomal V(H+)-ATPase activity was estimat-ed by firstly measuring total ATPase activity with 50 μmol L−1

orthovanadate (orthovanadate-insensitive ATPase activity) and thenwith 50 μmol L−1 orthovanadate plus 4 μmol L−1 bafilomycin A1

(bafilomycin-insensitive ATPase activity). The difference in activitiesmeasured without (orthovanadate-insensitive ATPase activity) andwith bafilomycin A1 (bafilomycin-insensitive ATPase activity) repre-sents the V(H+)-ATPase activity. ATPase activity was also assayedafter 10 min pre-incubation at 25 °C with alamethicin (1 mg/mg pro-tein) as a control for leaky and/or disrupted vesicles.

The initial velocities were constant for at least 15 min provided thatless than 5% NADH was oxidized. For each microsomal preparation,assay linearity was verified using samples containing from 5 to 50 μgprotein; total microsomal protein added to the cuvette was within thelinear range of the assay. Neither NADH, PEP, LDH nor PK was rate lim-iting over the initial course of the assay and no activity was measurablein the absence of NADH. Controls without added enzyme were also in-cluded in each experiment to quantify non-enzymatic substrate

18 M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

hydrolysis. Assays of (Na+, K+)-ATPase with andwithout ouabain werealso performed to evaluate microsomal activity (Lucena et al., 2012).

Reaction rates were estimated using duplicate aliquots from thesame microsomal preparation and their mean values were used to ob-tain the respective saturation curves. Each saturation curve for eachmodulator (pH, ATP, Mg2+) of V(H+)-ATPase activity was repeatedusing three different microsomal homogenates (N = 3). One enzymeunit (U) is defined as the amount of enzyme that hydrolyzes 1.0 nmolof ATP per minute at 25 °C, and specific activity is given as nmolmin−1 mg protein−1.

2.7. Effect of pH on V-ATPase activity

The effect of pH on V-ATPase activitywas assayed discontinuously at25 °C by measuring the amount of inorganic phosphate released overthe pH range of 6.5 to 8.5 according to Heinonen and Lahti (1981).The reactionmediawere adjusted to pH 6.5, 7.0, 7.5, 8.0 or 8.5with con-centrated Tris solution. The reaction was initiated by addition of the en-zyme, stopped with 0.5 mL cold 30% TCA, and immediately centrifugedat 4000 ×g at 4 °C, followed by measurement of inorganic phosphate.

2.8. Continuous-density sucrose gradient centrifugation

A 5-mg aliquot of the ATPase-rich gill microsomal fraction was lay-ered into a 10 to 50% (w/w) continuous-density, sucrose gradient in20 mmol L−1 imidazole buffer, pH 6.8 and centrifuged at 180,000 ×gfor 3 h at 4 °C, using a PV50T2 Hitachi vertical rotor. Fractions(0.5 mL) collected from the bottom of the gradient were then assayedfor orthovanadate-insensitive ATPase activity, bafilomycin-insensitiveATPase activity, protein concentration and refractive index.

2.9. SDS-PAGE and Western blot analysis

SDS-PAGE was performed in 5–20% gels according to Laemmli(1970), using 2.5 μg and 120 μg protein/lane for protein staining andblotting analysis, respectively. After electrophoresis, the gel was split,one half being stained with silver nitrate and the other electroblottedusing a Hoefer SE200 system employing nitrocellulose membranes ac-cording to Towbin et al. (1979). The nitrocellulose membrane wasblocked for 10 h with 5% nonfat dry milk freshly prepared in50 mmol L−1 Tris–HCl buffer, pH 8.0, containing 150 mmol L−1 NaCland 0.1% Tween 20, with constant agitation. The membrane was incu-bated overnight at 25 °C in a 1:50 dilution of the goat polyclonalV(H+)-ATPase A1 (L-20) antibody. After washing 3 times in50 mmol L−1 Tris–HCl buffer (pH 8.0) containing 150 mmol L−1 NaCland 0.1% Tween 20, the membrane was incubated for 1 h at 25 °C in adonkey anti-goat IgG alkaline phosphatase conjugate (diluted 1:7,500). Specific antibody incorporation was developed in100 mmol L−1 Tris–HCl buffer (pH 9.5) containing 100 mmol L−1

NaCl, 5mmol L−1MgCl2, 0.2mmol L−1 NBT and 0.8mmol L−1 BCIP. Im-munoblots were scanned and imported as JPG files into a commercialsoftware package (Kodak 1D 3.6) where the immunoreaction densitieswere quantified and compared. Western blot analysis was repeated 3times using different gill tissue homogenates.

2.10. Measurement of protein

Protein concentration was estimated according to Read andNorthcote (1981), using bovine serum albumin as the standard.

2.11. Estimation of kinetic parameters

The kinetic parameters V (maximum rate), K0.5 (apparent dissocia-tion constant of the enzyme-modulator complex), KM (Michaelis–Menten constant) and the nH value (Hill coefficient) for ATP hydrolysiswere calculated using SigrafW software (Leone et al., 2005). The

apparent dissociation constant, KI, of the enzyme–inhibitor complexwas estimated as described byMarks and Seeds (1978). The kinetic pa-rameters V, KM and K0.5 are calculated values and are given as themean ± SD from three different microsomal preparations (N = 3) ofshrimps collected at different periods. SigrafW software can be obtainedfrom http://portal.ffclrp.usp.br/sites/fdaleone/downloads.

2.12. Quantitative RT-PCR (real-time PCR)

Five total RNA extractions were performed under RNAse-free condi-tions, using pools of gills from 4–5 juveniles or adults. Whole gills(100 mg) were placed in an Eppendorf tube containing 1 ml Trizol(Ambion RNA, Life Technologies, USA). After adding 200 μL chloroformthe tube was centrifuged at 12,000 ×g for 15 min at 4 °C; 500 μL ofthe aqueous phase was transferred to another tube, 500 μL isopropanolwas added and, after 10-min incubation at 25 °C, the homogenate wascentrifuged at 12,000 ×g for 10 min at 4 °C. The pellet was dissolvedin 950 μL 75% ethanol containing 0.1% DEPC and centrifuged at7400 ×g for 5 min at 4 °C. After drying at 25 °C, the pellet was dissolvedin 50 μL ultrapure water containing 0.1% DEPC and the total RNA storedat−80 °C.

DNA and RNA purity was assessed from the absorbance ratio at260 nm and 280 nm. Reverse transcription was performed using 2 μgtotal RNA employing a Maxima® First Strand cDNA synthesis kit(Fermentas, Synapse Biotechnology, Brazil) following themanufacturer's instructions. PCR reactions were performed in a peltierthermocycler (Biocycle Co. Ltd., Hangzhou, China).

Quantitative PCR reactions were performed employing a Bio-RadCFX96 RT thermocycler, using SsoFast™ EvaGreen® Supermix (Bio-Rad), according to the manufacturer's instructions. The thermocyclingprocedure consisted of an initial step at 95 °C for 10 min, followed by40 cycles at 95 °C for 15 s each, and a final step at 60 °C for 1 min. TheRPL10 gene that encodes for ribosomal protein L10 was used as anendogenous control against which the V(H+)-ATPase B-subunitmRNA expression values were normalized. Specific primers for quanti-fying the RPL10 and V(H+)-ATPase B subunit gene expressions inM. amazonicum gill homogenates (Table 1)were designed based on par-tial cDNA sequences originally obtained by Faleiros et al. (2010),employing specific primers for theM. amazonicum RPL10 (GenBank ac-cession number GU366065) and V(H+)-ATPase gill genes (GenBank ac-cession number GQ329699). Quantitative PCR was repeated five timesfor each microsomal preparation.

3. Results

3.1. Gill ultrastructure and immunolocalization of the V(H+)-ATPase

The gill lamellar epithelium consists of two opposing layers of pillarcells whose cell bodies abut onto an intralamellar septum (Fig. 1).Hemolymph percolates through the narrow capillary-like lacunae be-tween the apical pillar cell flanges and bodies and the septal cells. Juxta-posed to the fine cuticle, the pillar cell flanges contain numerousmitochondria, polyribosomes and vesicles; their electron-denseperikarya are characterized by abundant, frequently concentric RER cis-ternae, Golgi bodies and numerous vesicles. The electron-lucent septalcells exhibit abundant mitochondria most associated with deep,encompassing membrane invaginations.

Fig. 2 shows the distribution of the V(H+)-ATPase in the gill lamellaeof juvenile and adult M. amazonicum. Immunofluorescence labeling injuvenile gill lamellae shows theV(H+)-ATPase c-subunit to bedistribut-ed weakly and irregularly in the apical regions of the pillar cells, al-though strongly in the marginal canals (Fig. 2A and inset). In the adultgill lamellae, although the V(H+)-ATPase exhibits a patchy appearance,the distribution is associated mainly with the apical pillar cell flanges(Fig. 2B). Intense staining is seen throughout the cytoplasm of thecells lining the marginal channels (inset to Fig. 1B). The intralamellar

Table 1Specific oligonucleotide primers used for quantitative amplification of V(H+)-ATPase B-subunit and ribosomal protein L10 cDNA from juvenile and adultMacrobrachium amazonicum gills.Primers were designed based on partial cDNA sequences obtained for the V(H+)-ATPase B-subunit (GenBank accession number GQ329699) and ribosomal protein L10 (GenBank acces-sion number GU366065) from M. amazonicum gills (Faleiros et al., 2010).

Primer Nucleotide sequence (5′–3′) Amplicon (bp)

V(H+)-ATPaseSpecific sense primer V_Ma_F TTCCTTCTACTCGACCGGCACG 81Specific anti-sense primer V_Ma_R TGCCAGGTAGACGTGGTTTCCC

Ribosomal protein L10Specific sense primer PRL10_Ma_F AAATGTTGTCGTGTGCTGGTGC 91Specific anti-sense primer PRL10_Ma_R ATTCTTACACGTGCAACCGTGC

19M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

septum shows very little signal. The negative control sections did notshow non-specific fluorescence signal (data not shown).

3.2. Characterization of the gill microsomal fraction

The gill orthovanadate-insensitive ATPase activities (58.9 ± 3.0 and59.4 ± 4.0 nmol Pi min−1 mg−1, respectively) were very similar in thejuveniles and adults, as were the bafilomycin-insensitive ATPase activi-ties (25.3 ± 1.3 and 21.5 ± 1.1 nmol Pi min−1 mg−1 for juveniles andadults, respectively). No differences in ATP hydrolysis were seen withalamethicin (data not shown), confirming the presence of permeablemicrosomes. Clearly, all solutes had unrestricted access to the intracel-lular and extracellular domains of the enzyme under the assay condi-tions used.

3.3. Distribution of V(H+)-ATPase activity by continuous-density sucrosegradient

Fig. 3 shows the distribution of microsomal gill V(H+)-ATPase activ-ity in juvenile and adult M. amazonicum by the continuous-density su-crose gradient centrifugation. In the juveniles (Fig. 3A), a protein peakshowing a maximal activity V(H+)-ATPase activity of≈27 U mL−1 ap-peared between 29% and 33% sucrose. In the adults (Fig. 3B), a proteinpeak showing V(H+)-ATPase activity sedimented between 28% and34% sucrose, and contained membrane fractions with lower V(H+)-ATPase activity (≈8 U mL−1).

Fig. 1.Ultrastructure of the gill epithelium in adultM.amazonicum. Beneath thefine cuticle(c), the pillar cell flanges (pf) radiate apically from the pillar cell bodies (pb) that abut onto the intralamellar septal cells (sc). Thepillar cells contain abundant, often concentric RERcisternae, Golgi bodies, vesicles and polymorphic mitochondria. The intralamellar septalcells (sc) are characterized by abundant, spherical mitochondria and deep, encompassingmembrane invaginations. Hemolymph (h)flows through the complex capillary spaces be-tween the two cell types, bathing their cell membranes. Scale bar = 5 μm.

3.4. SDS-PAGE and western blot analyses

SDS-PAGE and Western blot analyses of gill microsomes from juve-nile and adult shrimps are shown in Fig. 4. Striking differences in bothprotein patterns and concentrations were seen for juveniles and adults(Fig. 4A). However, the Western blot analysis identified only a singleimmunoreactive band of ≈116 kDa for the V(H+)-ATPase present inmicrosomal homogenates of juvenile and adult gills (Fig. 4B). Imageanalysis revealed very similar immunoreactive bands for the V(H+)-ATPase subunit in both ontogenetic stages.

Fig. 2. Cellular distribution of the V(H+)-ATPase in gill lamellae from juvenile and adultM. amazonicum. V(H+)-ATPase c-subunit distribution in transverse cryosections of gill la-mellae from juvenile and adultM. amazonicum. A — Juvenile. Immunofluorescence label-ing (Alexa-fluor 488, 495/519 nm) reveals the V(H+)-ATPase c-subunit (green) to bepatchily distributed in the apical pillar cell regions, and particularly in the cells formingthe marginal channels (inset, arrows). B — Adult. The V(H+)-ATPase is located mainly inthe apical pillar cell flanges with a strong signal in the marginal channels (inset, arrows).Nuclei (blue) were stained with DAPI. Scale bars = 50 μm.

10 20 30 40 50

10 20 30 40 50

9

18

27

36

45

10

20

30

40Sp

ecifi

c ac

tivity

, U m

L -1

0.001

0.002

0.003

0.004

% S

ucro

se (w

/w)

Spec

ific

activ

ity, U

mL

-1

Tube number

% S

ucro

se (w

/w)

Tube number

A

[Pro

tein

] (µµ µµg

/ µµ µµL)

3

6

9

12B

[Pro

tein

] (µµ µµg

/ µµ µµL)

0.003

0.009

0.006

0.012

10

20

30

40

Fig. 3. Sucrose density gradient centrifugation of gill microsomal fractions from juvenileand adult M. amazonicum. An aliquot containing 5 mg protein was layered into a 10–50% (w/w) continuous sucrose density gradient in 20 mmol L−1 imidazole buffer,pH 6.8, and centrifuged at 180,000 ×g for 3 h at 4 °C. Fractions (0.5 mL) were collectedfrom the bottom of the gradient and analyzed for V-ATPase activity (□), protein concentra-tion (▲), sucrose concentration (○), orthovanadate-insensitive ATPase activity (■) andbafilomycin-insensitive ATPase activity (◊). A— Juvenile. B— Adult.

20 M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

3.5. Effect of pH on V-ATPase activity

The effect of pH on the gill V(H+)-ATPase activity of juvenile andadult shrimps is shown in Fig. 5. Approximately 40 nmol Pimin−1mg−1was estimated at pH7.5 for gill homogenates fromboth on-togenetic stages. As pH increased from 6.5 to 7.5, V(H+)-ATPase activityin the juvenile gills increased 4-fold (from≈10 nmol Pi min−1 mg−1 to≈40 nmol Pi min−1 mg−1), decreasing to ≈15 nmol Pi min−1 mg−1

with increasing pH up to 8.5 (Fig. 5A). Very similar results were foundfor the adult stage (Fig. 5B). The orthovanadate-insensitive ATPase activ-ity of ≈60 nmol Pi min−1 mg−1 (inset to Fig. 5A) and bafilomycin-insensitive ATPase activity of ≈22 nmol Pi min−1 mg−1 (inset toFig. 5B) estimated for both ontogenetic stages suggest that the P-ATPase content is roughly the same for both stages.

Fig. 4. SDS-PAGE andWestern blot analyses of gill microsomal fractions from juvenile andadultM. amazonicum. Electrophoresiswas performed in a 5–20% polyacrylamide gel using2.5 μg and 120 μg protein/lane for protein staining and blotting analysis, respectively. A—

Silver-stained gill microsomal protein. B — Western blot analysis of gill microsomalprotein.

3.6. Modulation by ATP of gill V(H+)-ATPase activity

The effect of ATP concentration on V(H+)-ATPase activity in gill mi-crosomal preparations from juvenile and adultM. amazonicum is shownin Fig. 6. At a saturating Mg2+ concentration (5 mmol L−1) with50 μmol L−1 orthovanadate, increasing ATP concentrations from 10−5

to 5 × 10−3 mol L−1 stimulated juvenile V(H+)-ATPase activity follow-ing a well-defined saturation curve (Fig. 6A). ATP was hydrolyzed at amaximum rate of V = 36.6 ± 3.3 nmol Pi min−1 mg−1 with K0.5 =0.61 ± 0.01 mmol L−1, exhibiting site–site interactions (Table 2). Fur-ther, a residual V(H+)-ATPase activity of ≈8 nmol Pi min−1 mg−1

was seen at ATP concentrations as low as 10−5 mol L−1. Bafilomycin-insensitive ATPase activity was also stimulated up to 25 nmol Pimin−1 mg−1, corresponding to ≈40% of orthovanadate-insensitive

ATPase activity, over the same ATP concentration range (inset toFig. 6A).

A very similar profile was seen formodulation by ATP of the adult en-zyme (Fig. 6B). However, in addition to site–site interactions, ≈15%greatermaximum rates (V=41.6± 1.3 nmol Pi min−1 mg−1) associat-ed with a 3-fold lower K0.5 (0.21 ± 0.02 mmol L−1) were estimated(Table 2). A residual V(H+)-ATPase activity corresponding to 6 nmol Pimin−1 mg−1 was seen at ATP concentrations as low as 10−5 mol L−1.The stimulation of bafilomycin-insensitive ATPase activity reachedvalues of ≈20 nmol Pi min−1 mg−1, representing ≈35% that oforthovanadate-insensitive ATPase activity (inset to Fig. 6B).

3.7. Modulation of gill V(H+)-ATPase activity by Mg2+

Themodulation byMg2+of V(H+)-ATPase activity in gill microsomesfrom juvenile and adultM. amazonicum is shown in Fig. 7. At a saturatingATP concentration (5 mmol L−1) with 50 μmol L−1 orthovanadate, in-creasingMg2+ concentration from 10−4 to 5 × 10−3 mol L−1 stimulatedthe juvenile V(H+)-ATPase activity following a clear saturation curve(Fig. 7A). Maximum rate was 40.6 ± 2.4 nmol Pi min−1 mg−1 withK0.5 = 1.4 ± 0.07 mmol L−1 resulting from site–site interactions(nH = 3.9) between Mg2+ and the enzyme (Table 2). A residual ATPaseactivity (≈5 nmol Pimin−1mg−1)was revealed atMg2+ concentrationsas low as 10−4 mol L−1. Bafilomycin-insensitive ATPase activity wasstimulated up to≈20 nmol Pi min−1 mg−1 (corresponding to≈35% oforthovanadate-insensitive ATPase activity) over the sameMg2+ concen-tration range (inset to Fig. 7A).

Mg2+ stimulation of the adult enzyme also followed a well-definedsaturation curve (Fig. 7B).While enzyme affinity forMg2+was≈5-foldgreater (K0.5=0.26±0.02mmol L−1) than for juveniles, themaximumhydrolysis rate was very similar (39.8 ± 1.1 nmol Pi min−1 mg−1,Table 2). Compared to the juvenile enzyme, residual ATPase activitywas greater for the adult enzyme (≈17 nmol Pi min−1 mg−1) atMg2+ concentrations as low as 10−5 mol L−1. The bafilomycin-insensitive ATPase activity of the adult enzyme constituted ≈35% thatof the orthovanadate-insensitive ATPase activity (inset to Fig. 7B).

10

20

30

40

- Log [ATP] (mol L-1)

nmol

Pi m

in-1 m

g-1

4 35

5 4 3

A

15

30

45

60

nmol

Pi m

in-1 m

g-1

- Log [ATP] (mol L-1)

10

20

30

40

B

- Log [ATP] (mol L-1)

nmol

Pi m

in-1 m

g-1

5 4 3

5 4 3

15

30

45

60

nmol

Pi m

in-1 m

g-1

- Log [ATP] (mol L-1)

Fig. 6. Effect of ATP on microsomal V(H+)-ATPase activity in gill tissue from juvenile andadult M. amazonicum. Activity was assayed continuously at 25 °C in 50 mmol L−1 HEPESbuffer, pH 7.5, containing 5 mmol L−1 MgCl2, 20 mmol L−1 KCl, 50 μmol L−1

orthovanadate, 0.14 mmol L−1 NADH, 2 mmol L−1 PEP, 49 U PK and 94 U LDH, using29.6 μg protein and 13.4 μg protein for juveniles (A) and adults (B), respectively. Activitywas also estimated as above with 4 μmol L−1 bafilomycin A1. Duplicate aliquots fromthree different gill homogenates were used. Data are the mean ± SD. Inset:orthovanadate-insensitive ATPase activity (●) and bafilomycin-insensitive ATPase activity(○).

10

20

30

40

Anm

ol P

i min

-1 m

g-1

pH6.5 7.0 7.5 8.0 8.5

15

30

45

60

nmol

Pi m

in-1 m

g-1

pH6.5 7.0 7.5 8.0 8.5

20

30

40

8.0 8.57.57.0

nmol

Pi m

in-1 m

g-1

pH6.5

B

15

30

45

60

nmol

Pi m

in-1 m

g-1

pH6.5 7.0 7.5 8.0 8.5

Fig. 5. Effect of pH on microsomal V(H+)-ATPase activity in gill tissue from juvenile andadult M. amazonicum. Activity was assayed continuously at 25 °C in 50 mmol L−1 HEPESbuffer, containing ATP (5 mmol L−1 for juveniles and 2 mmol L−1 for adults),5 mmol L−1 MgCl2, 20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1

NADH, 2 mmol L−1 PEP, 49 U PK and 94 U LDH, using 29.6 μg protein and 13.4 μg proteinfor juveniles (A) and adults (B), respectively. Activity was also estimated as above with4 μmol L−1 bafilomycin A1. pHwas adjusted to the final value using concentrated Tris so-lution. Duplicate aliquots from three different gill homogenates were used. Data are themean ± SD. Inset: orthovanadate-insensitive ATPase activity (●) and bafilomycin-insen-sitive ATPase activity (○).

21M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

3.8. Inhibition by bafilomycin A1 of orthovanadate-insensitive ATPaseactivity

The effect of a wide range of bafilomycin A1 concentrations on gillorthovanadate-insensitive ATPase activity in juvenile and adultM. amazonicum is shown in Fig. 8. At saturating ATP (5 mmol L−1) andMg2+ (5 mmol L−1) concentrations, bafilomycin A1 concentrations upto 8 × 10−9 mol L−1 have little effect on orthovanadate-insensitiveATPase activity in juveniles. However, increasing bafilomycin concentra-tions up to 8 × 10−7 mol L−1 considerably inhibited orthovanadate-insensitive ATPase activity from ≈60 nmol Pi min−1 mg−1 to≈20 nmol Pi min−1 mg−1. This profile, revealing a single titrationcurve, likely reflects a single bafilomycin A1 binding site (Fig. 8A). Thecalculated KI for bafilomycin inhibition was 45.0 ± 2.3 nmol L−1 (insetto Fig. 8A).

A very similar profile was observed for bafilomycin inhibition in theadult shrimp (Fig. 8B). However, the bafilomycin A1 inhibition constantwas two-fold lower (KI=24.2±1.2 nmol L−1) compared to the juvenileenzyme (inset to Fig. 8B). As seen in juveniles, a residual bafilomycin-insensitive ATPase activity of ≈20 nmol Pi min−1 mg−1 was disclosedeven at bafilomycin concentrations up to 4 × 10−7 mol L−1.

3.9. Expression of gill V(H+)-ATPase B-subunit mRNA

V(H+)-ATPase B subunit mRNA expression in the gill homogenatesof juvenile and adult M. amazonicum was identical (Fig. 9).

4. Discussion

We disclose novel kinetic properties of a microsomal gill V(H+)-ATPase from juvenile and adult Amazon River shrimp, M. amazonicum.These findings constitute the first kinetic analysis of V(H+)-ATPase ac-tivity in different ontogenetic stages of a freshwater shrimp. The differ-ences in the kinetic parameters of the enzyme between the twoontogenetic stages may reflect a long-term regulatory mechanism ofV(H+)-ATPase activity, and suggest that enzyme modulation may bestage-specific.

The apparent affinity for ATP of the adult gill V(H+)-ATPase (K0.5 =0.21 ± 0.02 mmol L−1) is 3-fold greater than that of the juvenile(K0.5 = 0.61 ± 0.01 mmol L−1) while the K0.5 value for Mg2+ interac-tion in the juvenile (1.40 ± 0.07 mmol L−1) is ≈6-fold that in theadult (0.26 ± 0.02 mmol L−1). The inhibition constants (KI) forbafilomycin in juveniles and adults were 45.0 ± 2.3 nmol L−1 and24.2 ± 1.2 nmol L−1, respectively. The expression of mRNA levels

Table 2Kinetic parameters for the stimulation by ATP and Mg2+, and KI values for inhibition by bafilomycin A1, of V(H+)-ATPase activity in gill microsomal fractions from juvenile and adultMacrobrachium amazonicum.

Effector V (U mg−1) K0.5 or KM (mmol L−1) nH

V(H+)-ATPase (Na+,K+)-ATPasea V(H+)-ATPase (Na+,K+)-ATPasea V(H+)-ATPase (Na+,K+)-ATPasea

Juvenile Adult Juvenile Adult Juvenile Adult Juvenile Adult Juv. Adult Juv. Adult

ATP 36.6 ± 3.3 41.6 ± 1.3 194.4 ± 9.6 133.3 ± 6.4 0.61 ± 0.01 0.21 ± 0.02 0.18 ± 0.01 0.21 ± 0.01 2.3 1.3 1.0 1.0Mg2+ 40.6 ± 2.4 39.8 ± 1.1 181.3 ± 7.7 139.4 ± 6.7 1.40 ± 0.07 0.26 ± 0.02 0.51 ± 0.02 1.03 ± 0.05 3.9 1.6 1.3 1.7K+ – – 196.5 ± 10.1 137.1 ± 7.0 – – 2.35 ± 0.12 2.02 ± 0.10 – – 1.0 1.0Na+ – – 186.8 ± 9.3 126.4 ± 6.3 – – 4.06 ± 0.20 3.00 ± 0.15 – – 1.3 2.2NH4

+ – – 205.9 ± 9.4 194.2 ± 8.5 – – 1.88 ± 0.08 4.76 ± 0.23 – – 1.0 1.9

Bafilomycin A1 inhibition

Juvenile Adult

KI (μmol L−1) 45.0 ± 2.3 24.2 ± 1.2

a Data from Leone et al. (2012).

22 M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

were identical in both stages as was enzyme distribution in the pillarcell flanges and marginal canals of the gill lamellae.

V(H+)-ATPase activity appears to sustain a good deal of the Na+ up-take byM. amazonicum gills when in fresh water (McNamara and Faria,2012), although apical antiporters, such as the Na+/H+ and Na+/NH4

+

10

20

30

40

- Log [MgCl2] (mol L-1)

nmol

Pi m

in-1 m

g-1

4 3

4 3

A

15

30

45

60

nmol

Pi m

in-1 m

g-1

- Log [MgCl2] (mol L-1)

20

30

40

B

- Log [MgCl2] (mol L-1)

nmol

Pi m

in-1 m

g-1

5 4 3

5 4 3

15

30

45

60

nmol

Pi m

in-1

mg-

1

- Log [MgCl2] (mol L-1)

Fig. 7. Effect ofMg2+ onmicrosomal V(H+)-ATPase activity in gill tissue from juvenile andadult M. amazonicum. Activity was assayed continuously at 25 °C in 50 mmol L−1 HEPESbuffer, pH 7.5, containing ATP (5 mmol L−1 for juveniles and 2 mmol L−1 for adults),20 mmol L−1 KCl, 50 μmol L−1 orthovanadate, 0.14 mmol L−1 NADH, 2 mmol L−1 PEP,49 U PK and 94 U LDH, using 29.6 μg protein and 13.4 μg protein for juveniles (A) andadults (B), respectively. Activity was also estimated as above with 4 μmol L−1 bafilomycinA1. Duplicate aliquots from three different gill homogenates were used. Data are themean ± SD. Inset: orthovanadate-insensitive ATPase activity (●) and bafilomycin-insen-sitive ATPase activity (○).

exchangers (Towle et al., 1997), may also contribute to Na+ uptake.V(H+)-ATPase activities have been measured in anterior and posteriorgills of freshwater crabs, including Eriocheir sinensis (Onken andPutzenlechner, 1995; Morris, 2001) and Dilocarcinus pagei (Weihrauchet al., 2004), and a gill V(H+)-ATPase already has been partially charac-terized kinetically in microsomal gill preparations of M. amazonicum(Faleiros et al., 2010) and D. pagei (Firmino et al., 2011). In contrast,V(H+)-ATPase activity is very reduced in the euryhaline blue crabs

15

30

45

60

- Log [Bafilomycin] (mol L-1)

nmol

Pi m

in-1 m

g-1

10 7

A10 20 30 40 5020

30

40

50

1/V c(U

mg-

1 )x1

03

[Bafilomycin] (nmol L-1)

15

30

45

60

9 8

789

nmol

Pi m

in-1 m

g-1

- Log [Bafilomycin] (mol L-1)10

B10 20 30

30

40

50

1/V c

(U m

g-1 )

x103

[Bafilomycin] (nmol L-1)

Fig. 8. Effect of bafilomycin A1 onmicrosomal V(H+)-ATPase activity in gill tissue from ju-venile and adult M. amazonicum. Activity was assayed continuously at 25 °C in50 mmol L−1 HEPES buffer, pH 7.5, containing ATP (5 mmol L−1 for juveniles and2mmol L−1 for adults), 5 mmol L−1MgCl2, 20mmol L−1 KCl, 50 μmol L−1 orthovanadate,0.14 mmol L−1 NADH, 2 mmol L−1 PEP, 49 U PK and 94 U LDH, using 29.6 μg protein and13.4 μg protein for juveniles (A) and adults (B), respectively. Duplicate aliquots from threedifferent gill homogenates were used. Data are the mean ± SD. Inset: Dixon plot for esti-mation of KI.

Fig. 9. V(H+)-ATPase B subunit mRNA expression from juvenile and adult forms ofM. amazonicum. The analysis was assayed by real time RT-PCR using SYBR Green (Bio-Rad). The values obtained are the ratio of the value of the expression observed betweenthe gene of interest (B subunit) in each ontogenetic stage and the value of the expressionof the endogenous control (PRL10) in the same ontogenetic stage. The calculated valuesrepresent the mean ± SD (N = 3).

23M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

Callinectes danae (Masui et al., 2002) and Callinectes ornatus (Garçonet al., 2009), and in M. amazonicum after high salinity acclimation(Faleiros et al., 2010). Lee et al. (2011) have shown that the V(H+)-ATPase exhibits an evolutionary shift to elevated activity in freshwaterpopulations of the copepod Eurytemora affinis.

Maximal gill V(H+)-ATPase in M. amazonicum was found at pH 7.5independently of ontogenetic stage and is in close agreement withdata for several crustaceans (Onken and Putzenlechner, 1995; Zareand Greenaway, 1998; Onken et al., 2000; Weihrauch et al., 2004; Panet al., 2007; Firmino et al., 2011). In contrast, V(H+)-ATPase activity ofthe mussel Cygnea anadonta decreases considerably near pH 8.0(Oliveira et al., 2004). V(H+)-ATPase activity in vacuoles isolated fromcells cultivated at pH 7.5 is greater than at pH 4, a difference attributedto higher levels of V1 assembly in the vacuoles from cells cultivated athigh pH (Paddilla-Lopez and Pearce, 2006; Diakov and Kane, 2010).The diminished V(H+)-ATPase activity at lower pH likely reflects al-tered c-subunit structure, occluding the proton binding sites andpreventing transport (Rastogi and Girvin, 1999; Müller et al., 2002).

Our findings reveal important ontogenetic differences in gill V(H+)-ATPase kinetics inM. amazonicum gill microsomes, particularly with re-gard to the adult shrimp enzyme that exhibits unusual kinetic charac-teristics. Its apparent affinity for ATP is 3-fold greater than thejuvenile, and 5.5- and 20-times greater, respectively, than the micro-somal gill enzyme from M. amazonicum (Faleiros et al., 2010) andD. pagei (Firmino et al., 2011). The K0.5 value for Mg2+ of the adult gillV(H+)-ATPase is 5-fold less than that for the juvenile, and is 2- and 4-fold less, respectively, than for M. amazonicum (Faleiros et al., 2010)and D. pagei (Firmino et al., 2011). The inhibition constant forbafilomycin A1 of the adult enzyme is 2-fold less than for the juvenile,and is 10-fold higher than previously reported for M. amazonicum(Faleiros et al., 2010), and 2.5-fold less than for D. pagei (Firmino et al.,2011). The different apparent affinities for ATP and Mg2+ of theV(H+)-ATPase from M. amazonicum gills in distinct ontogenetic stagessuggest the expression of different isoenzymes that may contribute tolong-term activity regulation. Although the ATP and Mg2+ bindingsites are located on the V1 A and B subunits (Kawasaki-Nishi et al.,2003; Nakanishi-Matsui et al., 2010; Toei et al., 2010), the expressionof different subunit isoforms may induce long-term conformationalchanges, affecting substrate and ion affinities. Ourfindings differ consid-erably from Faleiros et al. (2010) a fact thatmay be attributed to the dis-tinct shrimp populations used. We used juvenile and adultM. amazonicum cultivated from Amazonian (Pará) broodstock whileFaleiros et al. (2010) trappedwild shrimps from a small lake in northernSão Paulo state. Different populations of this species exhibit distinctmorphological, morphometric and osmoregulatory capabilities (Angerand Hayd, 2010; Charmantier and Anger, 2011).

Gill (Na+, K+)-ATPase activity in the fiddler crab Uca formosensis isunaffected on exposure to dilute seawater (5‰S), suggesting that

V(H+)-ATPase may provide the driving force for Na+ uptake by gener-ating a proton gradient that facilitates Na+ influx (Tsai and Lin, 2007).The gill V(H+)-ATPase specific activity measured here under optimalconditions is similar in juvenile and adult M. amazonicum, althoughgill (Na+, K+)-ATPase specific activity is 50% less in adults (Leoneet al., 2012, and Table 2). However, gill V(H+)-ATPase specific activityinM. amazonicum is 50% greater than in D. pagei (Firmino et al., 2011)and previously in adult M. amazonicum (Faleiros et al., 2010), whichsuggests methodological differences. Since adult M. amazonicummain-tain hemolymph Na+ and Cl− concentrations at ≈120 and≈150 mmol L−1, respectively, when in fresh water (Augusto et al.,2007), this V(H+)-ATPase activity likely drives active Na+ uptake acrossthe gills as typically seen in strong hyperosmoregulators (Freire et al.,2008; Belli et al., 2009).

Our immunofluorescence findings show the V(H+)-ATPase to be lo-cated in the apical region of the gill pillar cells in juvenile and adultM. amazonicum, as also seen in early and late juveniles (Boudour-Boucheker et al., 2014). In crustaceans, the subcellular localization ofthe V(H+)-ATPase is variable, and the apical distribution is suggestiveof adaptation to fresh water (Tsai and Lin, 2007; McNamara and Faria,2012). In marine crabs like Scylla paramamosain, Macrophtalmusabbreviatus, Macrophtalmus banzai (Tsai and Lin, 2007) and Carcinusmaenas (Weihrauch et al., 2001) the gill cells exhibit a cytosolicV(H+)-ATPase distribution, reflecting a reduced role in osmoregulation(Tsai and Lin, 2007). InM. amazonicum, the apical surface of the lamellarepithelium is highly amplified by extensive evaginations associatedwith mitochondria in the sub-apical cytoplasm, evidently coupled toion uptake (Faleiros et al., 2010). Such evaginations would increasethe apical membrane area available for insertion of transport proteinslike the V(H+)-ATPase and the HCO3

−/Cl− exchanger (Faleiros et al.,2010). In E. sinensis, Cl− transport via the HCO3

−/Cl− exchanger isHCO3

− gradient-dependent and is complemented by a V(H+)-ATPaseputatively located in the apical pillar cell evaginations (Onken, 1996).

The V(H+)-ATPasewas densely distributed in themarginal channelsof the gill lamellae in both juvenile and adult shrimps. This channel isimportant in the collection and distribution of hemolymph throughthe capillaries and lacunae across each hemi-lamella and serves as ashunt under certain conditions (McNamara and Lima, 1997). The nota-ble presence of the enzyme in themarginal channels suggests importantion transport activity at sites in the gill epithelium other than the apicalpillar cell flanges.

While the B subunit of the V(H+)-ATPase is highly conserved acrossthe animal kingdom (Weihrauch et al., 2001; Faleiros et al., 2010), var-ious different subunit isoforms are reported for mammalian and yeastenzymes (Sun-Wada and Wada, 2010; Toei et al., 2010), and isoform-specific regulation of enzyme activity by selective targeting and regula-tion of the coupling efficiency of proton transport and ATP hydrolysis isalso well established (Sun-Wada and Wada, 2010; Toei et al., 2010). Inthis regard, our findings provide the first suggestion of differentV(H+)-ATPase subunit isoforms in crustaceans.

Acknowledgments

This investigation was supported by research grants from theFundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP,2010/17534-0), Conselho de Desenvolvimento Científico e Tecnológico(CNPq, 473990/2009-1 to JCM) and Fundação de Amparo à Pesquisa doEstado do Amazonas (INCT/CNPq/FAPEAM 573976/2008-2). MNL re-ceived an undergraduate scholarship from FAPESP (2010/16115-3).DPG and MRP received post-doctoral scholarships from FAPESP (2010/06395-9) and CNPq (560501/2010-2) respectively. FAL (302776/2011-7) and JCM (300662/2009-2) received research scholarshipsfrom CNPq. We thank Nilton Rosa Alves for technical assistance. Thislaboratory (FAL) is integrated with the Amazon Shrimp Network(Rede de Camarão da Amazônia) and with INCT ADAPTA (Centro deEstudos de Adaptações da Biota Aquática da Amazônia).

24 M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

References

Alzamora, R., Thali, R.F., Gong, F., Smolak, C., Li, H., Baty, C.J., Bertrand, C.A., Auchli, Y.,Brunisholz, R.A., Neumann, D., Hallows, K.R., Pastor-Soler, N.M., 2010. PKA regulatesvacuolar H+ ATPse localization and activity via direct phosphorylation of the A sub-unit in kidney cells. J. Biol. Chem. 285, 24676–24685.

Anger, K., 2013. Neotropical Macrobrachium (Caridea: Palaemonidae): on the biology, or-igin, and radiation of freshwater-invading shrimp. J. Crustac. Biol. 33, 151–183.

Anger, K., Hayd, L., 2010. Feeding and growth in early larval shrimp Macrobrachiumamazonicum from the Pantanal, southwestern Brazil. Aquat. Biol. 9, 251–261.

Araújo, M.C., Valenti, W.C., 2007. Feeding habit of the Amazon River prawnMacrobrachium amazonicum larvae. Aquaculture 265, 187–193.

Augusto, A., Greene, L.J., Laure, H.J., McNamara, J.C., 2007. The ontogeny of isosmotic intra-cellular regulation in the diadromous, freshwater palaemonid shrimps,Macrobrachium amazonicum and M. olfersi (Crustacea, Decapoda). J. Crustac. Biol.27, 626–634.

Augusto, A., Pinheiro, A.S., Greene, L.J., Laure, H.J., McNamara, J.C., 2009. Evolutionary tran-sition to freshwater by ancestral marine palaemonids: evidence from osmoregulationof in a tide pool shrimp. Aquat. Biol. 7, 113–122.

Belli, N.M., Faleiros, R.O., Firmino, K.C.S., Masui, D.C., Leone, F.A., McNamara, J.C., Furriel, R.P.M.,2009. Na, K-ATPase activity and epithelial interfaces in gills of the freshwater shrimpMacrobrachium amazonicum (Decapoda, Palaemonidae). Comp. Biochem. Physiol.152A, 431–439.

Bianchini, A., Lauer, M.M., Pedroso, M.S., Barcarolli, I.F., Martins, S.E.G., Lima, A.F.A., Pinho,G.L.L., 2007. Osmoregulation in estuarine invertebrates: effects of metals. Comp.Biochem. Physiol. 148A, S67 Abstracts.

Boron, W.F., 1986. Intracellular pH regulation in epithelial cells. Ann. Rev. Physiol. 48,377–388.

Boudour-Boucheker, N., Boulo, V., Charmantier-Daures, M., Grousset, E., Anger, K.,Charmantier, G., Lorin-Nebel, C., 2014. Differential distribution of V-type H+-ATPaseand Na+/K--ATPase in the branchial chamber of the palaemonid shrimpMacrobrachium amazonicum. Cell Tissue Res. 353, 87–98.

Charmantier, G., Anger, K., 2011. Ontogeny of osmoregulatory patterns in the SouthAmerican shrimp Macrobrachium amazonicum: loss of hypo-regulation in a land-locked population indicates phylogenetic separation from estuarine ancestors. J.Exp. Mar. Biol. Ecol. 396, 89–98.

Diakov, T.T., Kane, P.M., 2010. Regulation of vacuolar proton-translocating ATPase activityand assembly by extracellular pH. J. Biol. Chem. 285, 23771–23778.

Faleiros, R.O., Goldman, M.H.S., Furriel, R.P.M., McNamara, J.C., 2010. Differential adjust-ment in gill Na+/K+- and V-ATPase activities and transporter mRNA expression dur-ing osmoregulatory acclimation in the cinnamon shrimp Macrobrachiumamazonicum (Decapoda, Palaemonidae). J. Exp. Biol. 213, 3894–3905.

Firmino, K.C.S., Faleiros, R.O., Masui, D.C., McNamara, J.C., Furriel, R.P.M., 2011. Short- andlong-term, salinity-induced modulation of V-ATPase activity in the posterior gills ofthe true freshwater crab, Dilocarcinus pagei (Brachyura, Trichodactylidae). Comp.Biochem. Physiol. 160B, 24–31.

Forgac, M., 2007. Vacuolar ATPases: rotary proton pumps in physiology and pathophysi-ology. Mol. Cell. Biol. 8, 917–929.

Foster, C., Amado, E.M., Souza, M.M., Freire, C., 2010. Do osmoregulators have lower ca-pacity of muscle water regulation than osmoconfomers? A study on Decapod Crusta-ceans. J. Exp. Zool. 313A, 80–94.

França, J.L., Pinto, M.R., Lucena, M.N., Garçon, D.P., Valenti, W.C., McNamara, J.C., Leone, F.A.,2013. Subcellular localization and kinetic characterization of a gill (Na+, K+)-ATPasefrom the giant freshwater prawn Macrobrachium rosenbergii. J. Membr. Biol. 246,529–543.

Freire, C.A., Cavassin, F., Rodrigues, E.N., Torres, A.H., McNamara, J.C., 2003. Adaptive pat-terns of osmotic and ionic regulation, and the invasion of freshwater by the palaemonidshrimps. Comp. Biochem. Physiol. 136A, 771–778.

Freire, C.A., Onken, H., McNamara, J.C., 2008. A structure–function analysis of ion transportin crustacean gills and excretory organs. Comp. Biochem. Physiol. 151A, 272–304.

Garçon, D.P., Masui, D.C., Mantelatto, F.L.M., Furriel, R.P.M., McNamara, J.C., Leone, F.A.,2009. Hemolymph ionic regulation and adjustments in gill (Na+, K+)-ATPase activityduring salinity acclimation in the swimming crab Callinectes ornatus (Decapoda,Brachyura). Comp. Biochem. Physiol. 154A, 44–55.

Genovese, G., Ortiz, N., Urcola, M.R., Luquet, C.M., 2005. Possible role of carbonicanhydrase, V-H+-ATPase, and Cl−/HCO3

− exchanger in electrogenic ion transportacross the gills of the euryhaline crab Neohelice granulatus. Comp. Biochem. Physiol.142A, 362–369.

Gilles, R., Péqueux, A., 1985. Ion transport in crustacean gills: physiological and ultrastruc-tural approaches. In: Gilles, R., Gilles-Baillien, M. (Eds.), Transport Processes, Iono-and Osmoregulation, Current Comparative Approaches. Springer, Berlin, pp. 136–158.

Glenner, H., Thomsen, P.F., Hebsgaard, M.B., Sørensen, M.V., Willerslev, E., 2006. The ori-gin of insects. Science 314, 1883–1884.

Gordon, J.A., 1991. Use of vanadate as protein-phosphotyrosine phosphatase inhibitor.Methods Enzymol. 201, 477–482.

Hayd, L.A., Anger, K., Valenti, W.C., 2008. The moulting cycle of larval Amazon Riverprawn Macrobrachium amazonicum reared in the laboratory. Nauplius 16, 55–63.

Heinonen, S.K., Lahti, R.J., 1981. A new and convenient colorimetric determination of in-organic orthophosphate and its application to the assay of inorganicpyrophosphatase. Anal. Biochem. 113, 313–317.

Henry, R.P., Lucu, C., Onken, H., Weihrauch, D., 2012. Multiple functions of the crustaceangill: osmotic/ionic regulation, acid–base balance, ammonia excretion, and bioaccu-mulation of toxic metals. Front. Physiol. 3, 1–33.

Holthius, L.B., 1952. A general revision of the Palaemonidae (Crustacea, Decapoda,Natantia) of the Americas, II: the subfamily Palaemoninae, Allan Hancock Foundationpublications. Occas. Pap. 12, 1–396.

Imamura, H., Nakano, M., Noji, H., Muneyuki, E., Ohkuma, S., Yoshida, M., Yokoyama, K.,2003. Proc. Natl. Acad. Sci. U. S. A. 100, 2312–2315.

Jefferies, K., Cipriano, D.J., Forgac, M., 2008. Function, structure and regulation of the vac-uolar (H+)-ATPases. Arch. Biochem. Biophys. 476, 33–42.

Journet, A., Chapel, A., Jehan, S., Adessi, C., Freeze, H., Klein, G., Garin, J., 1999. Characteri-zation of Dictyostelium discoideum cathepsin D: molecular cloning, gene disruption,endo-lysosomal localization and sugar modifications. J. Cell Sci. 112, 3833–3843.

Kane, P.M., 2006. The where, when and how of organelle acidification by the yeast vacu-olar H+-ATPase. Microbiol. Mol. Biol. Rev. 70, 177–191.

Kawasaki-Nishi, S., Bowers, K., Nishi, T., Forgac, M., Stevens, T.H., 2001. The amino-terminal domain of the vacuolar proton translocating ATPase subunit controlstargeting and in vivo dissociation, and the carboxyl-terminal domain affects couplingof proton transport and ATP hydrolysis. J. Biol. Chem. 276, 47411–47420.

Kawasaki-Nishi, S., Nishi, T., Forgac, M., 2003. Proton translocation driven by ATP hydro-lysis in V-ATPases. FEBS Lett. 545, 76–85.

Kirschner, L.B., 2004. The mechanism of sodium chloride uptake in hyperregulatingaquatic animals. J. Exp. Biol. 207, 1439–1452.

Laemmli, U.K., 1970. Cleavage of structural proteins during assembly of head ofbacteriophage-T4. Nature 227, 680–685.

Lee, C.E., Kiergaard, M., Gelembiuk, G.W., Eads, B.D., Posavi, M., 2011. Pumping ions: rapidparallel evolution of ionic regulation following habitat invasions. Evolution 65,2229–2244.

Leone, F.A., Baranauskas, J.A., Furriel, R.P.M., Borin, I.A., 2005. An easy-to-use program forfitting enzyme kinetic data. Biochem. Mol. Biol. Educ. 33, 399–403.

Leone, F.A., Masui, D.C., Bezerra, T.M.S., Garçon, D.P., Valenti, W.C., Augusto, A.S.,McNamara, J.C., 2012. Kinetic analysis of gill (Na+, K+)-ATPase activity in selectedontogenetic stages of the Amazon River shrimp, Macrobrachium amazonicum(Decapoda, Palaemonidae): interactions at ATP- and cation-binding sites. J. Membr.Biol. 245, 201–215.

Lignot, J.H., Charmantier, G., 2001. Immunolocalization of Na+, K+-ATPase in the branchi-al cavity during the early development of the European lobster Homarus gammarus(Crustacea, Decapoda). J. Histochem. Cytochem. 49, 1013–1023.

Lucena, M.N., Garçon, D.P., Mantelatto, F.F.M., Pinto, M.R., McNamara, J.C., Leone, F.A.,2012. Hemolymph ion regulation and kinetic characteristics of the gill (Na+, K+)-ATPase in the hermit crab Clibanarius vittatus (Decapoda, Anomura) acclimated tohigh salinity. Comp. Biochem. Biophys. 161B, 380–391.

Lucu, C., Towle, D.W., 2003. (Na+, K+)-ATPase in gills of aquatic crustacea. Comp.Biochem. Physiol. 135A, 195–214.

Luquet, C.M., Weihrauch, D., Senek, M., Towle, D.W., 2005. Induction of branchial iontransporter mRNA expression during acclimation to salinity change in the euryhalinecrab Chasmagnathus granulatus. J. Exp. Biol. 208, 3627–3636.

Magalhães, C., Bueno, S.L.S., Bond-Buckup, G., Valenti, W.C., Silva, H.L.M., Kiyohara, F.,Mossolin, E.C., Rocha, S.S., 2005. Exotic species of freshwater decapod crustaceansin the state of São Paulo, Brazil: records and possible causes of their introduction.Biodivers. Conserv. 14, 1929–1945.

Marks, M.J., Seeds, N.W., 1978. A heterogeneous ouabain–ATPase interaction in mousebrain. Life Sci. 23, 2735–2744.

Masui, D.C., Furriel, R.P.M., McNamara, J.C., Mantelatto, F.L.M., Leone, F.A., 2002. Modula-tion by ammonium ions of gill microsomal (Na+, K+)-ATPase in the swimmingcrab Callinectes danae: a possible mechanism for regulation of ammonia excretion.Comp. Biochem. Physiol. 132C, 471–482.

McNamara, J.C., Faria, S.C., 2012. Evolution of osmoregulatory patterns and gill ion trans-port mechanisms in the decapod Crustacea: a review. J. Comp. Physiol. 182B,997–1014.

McNamara, J.C., Lima, A.G., 1997. The route of ion watermovements across the gill epithe-lium of the freshwater shrimpMacrobrachium olfersii (Decapoda, Palaemonidae): ev-idence from ultrastructural changes induced by acclimation to saline media. Biol. Bull.192, 321–331.

McNamara, J.C., Torres, A.H., 1999. Ultracytochemical location of Na+/K+-ATPase activityand effects of high salinity acclimation in gill and renal epithelia of the freshwatershrimp Macrobrachium olfersii (Crustacea, Decapoda). J. Exp. Biol. 284, 617–628.

Moreira, G.S., McNamara, J.C., Shumway, S.E., Moreira, P.S., 1983. Osmoregulation and re-spiratory metabolism in Brazilian Macrobrachium (Decapoda, Palaemonidae). Comp.Biochem. Physiol. 74A, 57–62.

Moreira, G.S., McNamara, J.C., Moreira, P.S., 1986. The effect of salinity on the upper thermallimits of survival and metamorphosis during larval development in Macrobrachiumamazonicum (Heller) (Decapoda, Palaemonidae). Crustaceana 50, 231–238.

Morris, S., 2001. Neuroendocrine regulation of osmoregulation and the evolution of air-breathing in decapod crustaceans. J. Exp. Biol. 204, 979–989.

Müller, O., Bayer, M.J., Peters, C., Andersen, J.S., Mann, M., Mayer, A., 2002. The Vtc pro-teins in vacuole fusion: coupling NSF activity to V0 trans-complex formation. EMBOJ. 21, 259–269.

Murphy, N.P., Austin, C.M., 2005. Phylogenetic relationships of the globally distributedfreshwater prawn genus Macrobrachium (Crustacea: Decapoda: Palaemonidae): bio-geography, taxonomy and the convergent evolution of abbreviated larval develop-ment. Zool. Scr. 34, 187–197.

Nakanishi-Matsui, M., Sekiya, M., Nakamoto, R.K., Futai, M., 2010. The mechanism of ro-tating proton pumping ATPases. Biochim. Biophys. Acta 1797, 1343–1352.

Odinetz-Collart, O., Rabelo, H., 1996. Variation in egg size of the fresh-water prawnMacrobrachium amazonicum (Decapoda: Palaemonidae). J. Crustac. Biol. 16, 684–688.

Oliveira, P.F., Lopes, I.A., Barrias, C., Rebelo da Costa, A.M., 2004. H+-ATPase of crude ho-mogenate of the outer mantle ephitelium of Anodonta cygnea. Comp. Biochem. Phys-iol. 139, 425–432.

Onken, H., 1996. Active and electrogenic absorption of Na+and Cl- across posterior gills ofEriocher sinensis: influence of short-term osmotic variations. J. Exp. Biol. 199,901–910.

25M.N. Lucena et al. / Comparative Biochemistry and Physiology, Part B 181 (2015) 15–25

Onken, H., McNamara, J.C., 2002. Hyperosmoregulation in the red freshwater crabDilocarcinus pagei (Brachyura, Trichodactylidae): structural and functionalasymmetries of the posterior gills. J. Exp. Biol. 205, 167–175.

Onken, H., Putzenlechner, M., 1995. A V-ATPase drives active, electrogenic and Na+- inde-pendent Cl- absorption across the gills of Eriocheir sinensis. J. Exp. Biol. 198, 767–774.

Onken, H., Schobel, A., Kraft, J., Putzenlechner, M., 2000. Active NaCl absorption acrosssplit lamellae of posterior gills of the Chinese crab Eriocher sinensis: stimulation byeyestalk extract. J. Exp. Biol. 203, 1373–1381.

Paddilla-Lopez, S., Pearce, D.A., 2006. Saccharomyces cerevisiae lacking Btn1p modulatevacuolar ATPase activity to regulate pH imbalance in the vacuole. J. Biol. Chem. 281,10273–10280.

Pan, L.Q., Zhang, L.J., Liu, H., 2007. Effects of salinity and pH on ion-transport enzyme ac-tivities, survival and growth of Litopenaeus vannamei postlarvae. Aquaculture 273,711–720.

Péqueux, A., 1995. Osmotic regulation in crustaceans. J. Crustac. Biol. 15, 1–60.Pileggi, L.G., Mantelatto, F.L.M., 2012. Taxonomic revision of doubtful Brazilian freshwater

species of genus Macrobrachium (Decapoda, Palemonidae). Iheringia 102, 426–437.Rastogi, V.K., Girvin, M.E., 1999. Structural changes linked to proton translocation by sub-

unit c of the ATP synthase. Nature 402, 263–268.Read, S.M., Northcote, D.H., 1981. Minimization of variation in the response to different

proteins of the coomassie blue-g dye-binding assay for protein. Anal. Biochem. 116,53–64.

Rudolph, F.B., Baugher, B.W., Beissner, R.S., 1979. Techniques in coupled enzyme assays.Methods Enzymol. 63, 22–42.

Santos, L.C.F., Belli, N.M., Augusto, A., Masui, D.C., Leone, F.A., McNamara, J.C., Furriel, R.P.M.,2007. Gill (Na+, K+)-ATPase in diadromous, freshwater palaemonid shrimps: species-specific kinetic characteristics and α-subunit expression. Comp. Biochem. Physiol.148A, 178–188.

Saroussi, S., Nelson, N., 2009. The little we know on the structure and machinery of V-ATPase. J. Exp. Biol. 212, 1604–1610.

Stevens, T.H., Forgac, M., 1997. Structure, function and regulation of the vacuolar H-+ATPase. Annu. Rev. Cell Dev. Biol. 13, 779–808.

Sun-Wada, G.H., Wada, Y., 2010. Vacuolar-type proton pump ATPases: roles of subunitisoforms in physiology and pathology. Histol. Histopathol. 25, 1611–1620.

Taylor, H.H., Taylor, E.W., 1992. Gills and lungs: the exchange of gases and ions. In:Harrison, F.W., Humes, A.G. (Eds.), Microscopic Anatomy of Invertebrates, DecapodCrustacea vol. 10. Wiley-Liss, New York, pp. 203–293.

Toei, M., Saum, R., Forgac, M., 2010. Regulation and isoform function of the V-ATPases.Biochemistry 49, 4715–4723.

Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from poly-acrylamide gels to nitrocellulose sheets — procedure and some applications. Proc.Natl. Acad. Sci. U. S. A. 76, 4350–4354.

Towle, D.W., Kays, W.T., 1986. Basolateral localization of Na+, K+-ATPase in gill epitheli-um of two osmoregulating crabs, Callinectes sapidus e Carcinus maenas. J. Exp. Zool.239, 311–318.

Towle, D.W., Rushton, M.E., Heidysch, D., Magnani, J.J., Rose, M.J., Amstutz, A., Jordan, M.K.,Shearer, D.W., Wu, W.S., 1997. Sodium/proton antiporter in the euryhaline crabCarcinus maenas: molecular cloning, expression and tissue distribution. J. Exp. Biol.200, 1003–1014.

Tsai, J.R., Lin, H.C., 2007. V-type H1-ATPase and Na, K-ATPase in the gills of 13 euryhalinecrabs during salinity acclimation. J. Exp. Biol. 210, 620–627.

Weihrauch, D., Ziegler, A., Siebers, D., Towle, D.W., 2001. Molecular characterization of V-type H+-ATPase (B subunit) in gill of euryhaline crab and its physiological role in os-moregulatory ion uptake. J. Exp. Biol. 204, 25–37.

Weihrauch, D., McNamara, J.C., Towle, D., Onken, H., 2004. Ion-motive ATPases and activetransbranchial NaCl uptake in the red freshwater crab Dilocarcinus pagei (Decapoda,Trichodactylidae). J. Exp. Biol. 207, 4623–4631.

Zare, S., Greenaway, P., 1998. The effect of moulting and sodium depletion on sodiumtransport and the activities of NaK-ATPase and V-ATPase in the freshwater crayfishCherax destructor (Crustacea: Parastacidae). Comp. Biochem. Physiol. 119A, 739–745.