Immunology and Cell Biology (1996) 74, 45-51

Bacterial metabolism, cytokine mRNA transcription andviability of bovine alveolar macrophages infected withMycobacterium bovis BCG or virulent M bovis

FE ALDWELL, DN WEDLOCK and BM BUDDLE

AgResearch. Wallaceville Animal Research Centre. Upper Hutt, New Zealand

Summary Mycobacterium bovis causes tuberculosis in cattle and many other animals including humanswhile BCG, an attenuated form of M bovis, has been used widely as a safe vaccine. Both strains infect hostmacrophages and their fate is determined by their ability to survive within these phagocytic cells. Wecompared interactions of these two strains with bovine alveolar macrophages in order to gain an understand-ing of virulence mechanisms involved in the early pathogenesis of M. bovis infection. Macrophages wereinfected with bacilli at varying multiplicities of infection and cultured for i-4 days. Bacterial metabolismwithin macrophages was assessed by I-'HJ-uracil uptake and bacterial growth was assessed by culture andacid-fast staining. Induction of TNF-a, IL-lp and IL-6 cytokine mRNA transcription in macrophages wasdetermined by reverse transcriptase-polymerase chain reaction. Infection of macrophages by virulent M. bovisresulted in enhanced bacterial metabolism, enhanced induction of macrophage cytokines and reduced viabil-ity of macrophages when compared to A/, bovis BCG-infected macrophages. These differences may reflectvirulence mechanisms contributing to the early pathogenesis of bovine tuberculosis.

Key words: BCG, bovine macrophages, cytokines, Mycobacterium bovis. tuberculosis, virulence.

Introduction

Bovine tuberculosis in farmed animals remains a majoreconomic problem in many countries and there is concernabout the contribution of the disease to the prevalence oftuberculosis in humans, particularly in developingcountries.' Mycobacteriutn bovis. the organism responsi-ble for the disease, is very closely related to the humanpathogen Mycobacterium tuberculosis and both organismscause disease of similar pathology that is clinically indis-tinguishable in humans.--^ BCG. an attenuated form ofM. bovis which was originally derived from an isolatefrom a cow with tuberculous mastitis, has been widelyused as a vaccine against human tuberculosis since the1920s with few complications."* Despite the widespreaduse of M. bovis BCG and its demonstrated lack of viru-lence in humans and other animals, little is known aboutwhy it is avirulent. Furthermore, there have been noclearly defined molecular or structural diflerences thatexplain the difference in virulence between A/, bovis BCGand virulent M. bovis. Recent developments in molecularbiology have been used to characterize genetic factorswhich may contribute to virulence of pathogenic myco-bacteria;'"^ however, there is increasing evidence thattuberculosis results from a combination of mycobacterialand immunological factors.""'"

Mycobacterium bovis is a facultative intracellular patho-gen which multiplies within cells of the host's immune

Correspondence: FE Aldwell, AgResearch Wallaceville, POBox 40-063, Ward St, Upper Hutt, New Zealand.

Received 10 August 1995; accepted 5 October 1995.

system, primarily macrophages.'" Immunity to infectionis generally believed to be mediated by macrophageswhich have been activated by T cell cytokines.** Failure tocontrol the growth of M. bovis by macrophages leads tocell destruction and disease in many hosts." The capacityto replicate inside host macrophages denotes the distinc-tive feature of A/, bovis and other pathogenic mycobacte-ria and has often been correlated with virulence.*"^

The rational design and administration of a more effec-tive vaccine against tuberculosis requires a better under-standing of the pathogenesis of infection, particularly dur-ing the initial stages, about which little is known. Aerosoltransmission is the predominant route of infection, and ithas been shown that droplet nuclei (particle size < 5 |im)containing one to three bacilli gain access to alveoli. Herethe bacteria are engulfed by alveolar macrophages. whichpresumably are equipped with multiple microbicidalmechanisms, including phagoiysosome fusion and a respi-ratory burst, to rid the host of the infecting bacilli. Toestablish infection successfully the organism must surviveits encounter with the alveolar macrophages and ulti-mately gain access to the lymphatics or the blood-stream.'*'°

In an attempt to define the factors which contribute tothe observed differences in pathogenesis of virulent M.bovis and A/, bovis BCG in the lungs of their natural hostwe decided to examine the interaction of these two strainswith bovine mononuclear phagocytes. This report com-pares the ability of virulent M. bovi.s and A/, bovis BCGto metabolize in, induce cytokines from and affect theviability of in vitro cultures of bovine alveolar macro-phages.

46 FE Aldwell et al

Materials and methods

Bacteria

The two strains of mycobacteria used were M. bovis BCG Pasteur1173P2 and virulent M hovis strain 83/6235 which was origi-nally isolated from a tuberculous lesion in a brushtail possum andhas been used in previous cattle inoculation studies.'- '•' Thestrains were grown to mid-log phase in Dubos broth (DifcoLaboratories. Detroit. MI, USA) supplemented with Tween 80.0.006% (v/v) alkalinized oleic acid, 0.5% (w/v) albumin fractionV and 0.25% (w/v) glucose. Cultures were centrifuged, washedtwice in PBS. aliquotted and stored frozen at - 70°C. Prior to usein infection experiments both strains were thawed and sonicatedfor 75 s in a sonicating water bath (Branson. Shelton, CT. USA).

Preparation of macrophages

Bovine alveolar macrophages (BAM) were obtained by bronchiallavagc of freshly excised lungs from tuberculosis-free adult cattle.Two litres of sterile PBS warmed to 37°C was introduced into thetrachea and the lung lobes were gently massaged for 5-10 min.Lavage fluid was collected in sterile teflon-coated erienmeyerflasks, and passed through a 50 nm sieve to remove clots. The cellsuspension was washed three times in PBS and resuspended at2 X lO*" cells/mL in RPMI-1640 containing 4 mmol L-glutamine,I mmol non-essential amino acids (Sigma. St Louis. MO, USA).1 mmol sodium pyruvate, 2.9 mmol 7.5% sodium bicarbonate,50U/mL of penicillin G (supplemented RPMI-1640) and 5%normal bovine serum. Two hundred microlitres of cell suspen-sion was dispensed into flat-bottom 96-wc!l microtitre plates(Nunclon. Nunc, Denmark) which were incubated for 2 h at37°C in a 5% CO2-95% air atmosphere. Cultures were thenwashed three times with warm, supplemented RPMI-1640 toremove non-adherent cells. The remaining cells were incubatedin 200 iL of supplemented RPMI-1640 containing 15% normalbovine serum. Cultures were maintained for 6-10 days, withmedium changes every 3-4 days before being used in infectionexperiments. The number of adherent cells was determined bytrypsinizing and counting using a Ncubaucr haemacytometer(American Optical Corp.. Buffalo. NY. USA). Estcrasc activity ofadherent cells was ascertained by staining with alpha-naphthylacetate. Staining was performed according to the suppliers in-structions (Sigma). Morphological examinations were performedwith the use of Wright-Giemsa stained preparations. Macro-phagc viability was assessed by Trypan Blue dye exclusion,adherence to polystyrene and phagocytosis of BCG.

Infection of macrophages

Quadruplicate wells containing approximately 1 x lO"* macro-phages per well were infected with 5x10'' CFU of A/, bovis orvirulent M. bovis per well at a multiplicity of infection (MOI) of5:1 or I X 10"* CFU of M bovis or virulent M. bovis per well at aMOI of 1:1 and incubated for 2-3 h at 37°C in 5% CO.. Mac-rophages were then rinsed extensively with warm PBS to removeextracellular bacteria and reincubated in serum-supplementedRPMI-1640. Uptake of bacilli into macrophages was confirmedby acid-fast staining. Cultures which had been formalin-fixed onglass cover slips were stained with haematoxylin and eo.sin, andZiehl-Ncclsen solutions. At least 100 cells for each MOI wereexamined by light microscopy and scored for the percentage ofmacrophages containing acid-fast organisms (AFO). Viability of

M bovis BCG and virulent M /)(jv/. -infected macrophages wasassessed by counting the number of adherent cells excludingTrypan Blue in a representative area of each microtitre well.

For determination of cytokine mRNA expression in macro-phages, BAM were cultured in 24-we!l plates (Nunclon) for 6days in macrophage serum-free medium (Gibco BRL, Gaithers-burg, NY, USA). Macrophages (5 x lO"* per well) were infectedwith 2.5 X 105 (MOI 5: Dor 5 X lOMMOI 10:1) CFU per well ofM. bovis BCG or virulent M bovis per well. To determine theeffect of killed A/, bovis in macrophage cultures. M- bovis BCG orvirulent M. bovis was heated to 80°C for 30 min or streptomycinsulfate (100|ig/mL) was added to cultures prior to infection.Uninfected control wells contained macrophages grown inserum-free media.

Assessment of myeobacterial growth

Growth of A/, bovis BCG and virulent M. bovis was determinedprimarily by metabolic labelling with [^H]-uracil and confirmedby acid-fast staining and by measuring CFU after culture. [^H]-uracil uptake by bacilli was assessed according to a modificationof the method of Rook et al.'"* as described by Chan et a/.'^Cultures were pulsed with I.O|iCi of [-'H]-uracil (Amersham.Australia) per well at 6, 24. 48 and 72 h post-infection. After afurther 24 h incubation, cultures were heated to 80°C for 30 min,allowed to cool and harvested onto glass fibre filters (WhatmanInc.. Clifton. NJ, USA) using an automated cell harvester (Cam-bridge Technology Inc., USA). The amount of [- H]-uracil incor-porated was determined using a liquid p-scintillation counter(Beckman LS6000 IC. Bcckman Instruments. USA). RNA syn-thesis by intracellular bacteria was determined as [- H]-uraciIincorporation by cultures infected with bacilli minus that byuninfected macrophage cultures.

Samples for culture were eollcctcd by pooling the eontents offour microtitre wells and sonicating for 75 s. Numbers of viableorganisms were determined by inoculating 1/10 dilutions onmodified Mycobacteria 7H11 agar containing 10% sheep serum,0.5% lysed SRBC and supplemented with glycerol (BCG) orpyruvate and glycerol {M. bovis). Culture slopes were incubatedat 37X and the number of colonies was counted after 4 weeks ofculture.

Isolation of macrophage RNA and synthesis ofcDNA

RNA was prepared from 2 x 10 macrophages by a modificationof the method of Chomczynski and Saachi"" as described by Nget a/." Cells were homogenized in 600 \ih of denaturing solution(4 mol guanidinium isothiocyanate. 26 mmol sodium citrate. pH7.0 and 0.5% lauryl sarcosine) and then mixed with 60|iL of2 mol sodium acetate, pH 4.0. Following extraction with 600 pLof phenol and 120 pL of 49:1 chloroform:A'-amyl-alcohoL RNAwas precipitated with isopropanol from the aqueous phase. Firststrand cDNA was .synthesized by reverse transcription of totalRNA (2.0 |ig) with 200 units of reverse transcriptase (Ng et al.Vand 500ngof oligo-dT primer.

Detection ofeytokine mRNA by PCR

Cytokine mRNA transcription in M. bovis BCG or virulent A/.bovis infected and non-infected macrophages was determined bysemi-quantitative polymerase chain reaction (PCR) amplifiea-tion. Bovine specific primers were designed from the published

M. bovis-infected bovine alveolar macrophages 47

sequences of cytokines IL-lp. lL-6, IL-IO and TNF-a and thecontrol y-actin. The sequences of these primer pairs were asfollows: Y-actin. ACCAACTGGGACGACATGGA. GAGCTTC-TCCTTG ATGTC AC;'« IL-1 p, GCTAGCCCATGTGTGCT-GAA. CGGGCCTTTCTTCGATTTGA:'^ lL-6. TCAGGC-GATTTGCTTGATCA. TGACCAGAGGAGGGAATGCC-"IL-10. GATGCGAGCACCCTGTCTGAC, GCAGGGCAG-AAAGCGATG ACA;-' TNF-a. CCCCAGGGCTCCAGA A-GTTG, GGTAGGAGACTGCAATGCGG."

PCR reactions were set up as described by Ng et al.''' andperformed with 30 cycles of 94°C for 15 s, 56°C for 30 s and72°C for 30 s. PCR products were analysed by electrophorcsis on2% agarose gels and visualized by staining with ethidium bro-mide. PCR was also performed with primers for the constitu-tively expressed y-actin gene to check that the total amount ofRNA in each reaction subjected to re\erse transcription-PCRwas equivalent.

Results

Purification of macrophages

Isolation of BAM from bovine lungs yielded 5-10 x lO**mononuclear cells with lymphocytes accounting for lessthan 1% and neutrophils less than 4% of lavagc cells.Adherent cells were greater than 97% macrophages asdetermined by esterase staining and morphology follow-ing Giemsa staining. Maerophages vvere defined as es-terase positive, adherent mononuelear cells that had beenin eulture for 6 days or longer.

Phagocytosis of bacilli

Light mieroscopie examination of acid-fast stained cul-tures at 6 h following infection showed that at an MOI of5:1 and 1:1. 80-90 and 70-80% of BAM, respectively,were infected with one or more AFO per cell. Followingwashing and staining, all AFO were intracellular and noextracellular or pcriceltular bacilli were observed.

pHJ-uracil uptake

Comparison of input CFU and uptake of ['H]-uracil byBCG and A/, hovis cultured in serum-supplemented me-dium without BAM showed that both strains incor-porated uracil in a manner consistent with input CFU.[- H]- uracil incorporation by both strains was reduced by45-75%. with each doubling dilution for cultures pulsedbetween 6 and 72 h. ['H]-uracil uptake by uninfectedBAM or BAM to which killed BCG or Af. hovis had beenadded was always low and did not exceed 500 cpm.

['H]-uraciI uptake by 5xlO-* CFU of M hovis BCG orvirulent M. hovi.s cultured in supplemented media or insupplemented media containing RAM is shown in Fig. 1.In supplemented media alone (Fig. la) both strainsshowed high levels of [^H]-uracil uptake between 24 and48 h followed by a more gradual increase from 48 to 96 h.A/, hovis BCG showed a higher rate of [- HJ-uraeil uptakethan virulent M. bovis between 48 atid 96 h. The results

indicated that in the absence of BAM A/, hovis BCG wasable to metabolize more efficiently than virulent \f. hovisover a 96 h period. When cultured in the presence ofBAM (Fig. Ib), both strains showed low levels of [^H]-uracil uptake compared to similar cultures without BAM.However at 48 h. uptake of [^H]-uracil by virulent Mhovis was significantly greater than that by \f bovis BCG.By 96 h post-infection, ['H]-uracil uptake by .\f. hovisBCG showed a slight increase. By comparison [^H]-uraciluptake by virulent \f. hovis was markedly increased. Al-though BAM were capable of inhibiting metabolism o\'M.hovis BCG and virulent A/, hovis. they were less effectiveat controlling metabolism by virulent A/, hovis comparedto M. hovis BCG.

However, [^H]-uracil uptake by A/, hovis BCG-infectedBAM remained low (< 500 cpm) between 24 and 96 h. Incontrast. [^H]-uracil uptake by virulent M. hovis increasedmarkedly between 24 and 96 h post-infection (300-4800 cpm). At an MOI of 1:1. BAM were capable ofcausing metabolic stasis of M. hovis BCG for up to 96 hpost-infection, whereas virulent M. hovis was able to ac-tively metabolize in BAM.

Figure 2 compares the effect of .\f. hovis BCG and vir-ulent .\I. hovis on viability of BAM. At an MOI of 1:1, theviability of vinjlent M. />ov/i-infected BAM decreased asassessed by Tr\pan Blue exclusion, from > 90% at 24 h to65-75% at 96 h post-infection, while .\I. bovis BCG-infected BAM remained > 90% viable between 24 and96 h post-infection. Similarly at an MOI of 5:1. virulentA/. /j<n7.i-infected BAM decreased in viability, from> 90% at 24 h post-in feet ion to < 30% at 96 h. WhereasM. hovis BCG-infected BAM decrease in viability from> 90% at 24 h post-infection to 85-90% at 96 h.

Light microscopy

Morphological changes in virulent A/. /rcn'Lv-infected BAMwere first observed at 48 h post-infection (MOI 5:1) and at96 h post-infection (MOI 1:1). Macrophages appearedrounded with increased ruffling of cell membranes. Somemacrophages appeared dense and acid-fast staining re-vealed that these cells contained numerous bacilli. Nomorphological changes were observed in BCG-infectedBAM during this time period. Twenty four hours after theinitial morphological changes, some virulent A/, hovis-infected BAM appeared to be disrupted and some bacilliwere extracellular. After a further 24 h incubation fewintact BAM remained and many bacilli were extracellular.In contrast, BCG-infected BAM (MOI 1:1) could bemaintained in culture for up to !0 days without anychanges in macrophage morphology or viability (data notshown).

Disruption and loss of" viability of macrophages andsubsequent release of A/, hovis into the culture mediumwas first observed at 72 h (MOI 5:1) and 96 h (MOI 1:1)post-infection, resulting in extracellular growth of organ-isms. At the higher MOI therefore, uracil uptake beyond48 h is likely to reflect both intra- and extracellular growthof A/, hovis. Similarly, at an MOI of 1:1. uracil uptakebeyond 96 h may reflect both intra- and extracellular

48 FE Aldwell et al

MOI 5:1

72 96 24

After jnfectjon (h)

72 96

Figure 1 pHl-uracil uptake by (D) M. bovis BCG and (•) virulent M. bovis (MOI 5:1 and MOI 1:1) in serum supplemented RPMI (a) orBAM (b). Results are expressed as means from quadruplicate determinates ± standard deviations. Data presented in (b) are representa-tive of macrophages isolated from three different animals.

growth. Since no extracellular bacilli were observed whenmacrophage viability exceeded 90%, comparison of uraciluptake by BCG and M. bovis in these cultures is likely toreflect metabolism of intracellular bacilli.

mRNA transcription

Figure 3 demonstrates the different abilities of virulent M.bovis and A/, bovis BCG to induce TNF-a, IL-ip and IL-6mRNA transcription in BAM. The lack of mRNA tran-scription of all three cytokines by uninfected BAM isshown in lane 1. Virulent M. bovis induced strong mRNAtranscription of TNF-a, IL-p and IL-6 at both multi-plicities of infection (lanes 2 and 3). In contrast, M. bovisBCG showed weak induction of TNF-a, IL-p and IL-6mRNA at both multiplicities of infection (lanes 4 and 5).Killed M. bovis also induced weak induction of mRNA

for the three cytokines (lane 6) and there was no differencebetween heated-killed and streptomycin-treated cultures.

Discussion

This report demonstrated marked differences in the inter-action of a virulent and an avirulent strain of M. boviswith BAM. Virulent \f. bovis showed higher levels ofmetabolism, induce enhanced levels of cytokine mRNA,and caused reduced viability of macrophages when com-pared to similar cultures infected with A/, bovis BCG.Virulent A/, bovis showed enhanced levels of uracil uptakein macrophages which had been infected at a high (5:1)and a low (1:1) multiplicity of infection for up to 96 h. Incontrast, at a high MOI, M. bovis BCG showed only aslight increase in uracil uptake, and at a low MOI there

M. boviS'infected bovine alveolar macrophages 49

Figure 2 The effect of (D) M. bovisBCG and (•) virulent M- bovis at anMOI of (a) 1:1 or (b) 5:1 on viabilityof BAM, Results arc expressed asmeans from quadruplicate determi-nates ± standard deviations. Datapresented are representative of mac-rophages isolated from three differentanimals.

100

48 72 96 24 18 72 96

Alier infection (h)

O

o•Q O

CO

o-Q

y-actin

TNF-a

IL-1P

IL-6

Figure 3 The effect of A/, bovis BCG (D) and virulent M. bovis(•) infection on expression of TNF-a. IL-l[i and IL-6 mRNA byBAM. mRNA was extracted from macrophages 24 h post-infection and analysed for cytokine mRNA transcription by RT-PCR using bovine specific primers.

was no increase in uracil uptake observed at any time.These results indicate that BAM are capable of causingmetabolic stasis of M hovis BCG but not of virulent M.hovis. The data presented here show for the hrst time thatthere are important differences in the interaction of twostrains of A/, hovis with BAM. These differences mayreflect virulence mechanisms resulting in pathogenesis ofbovine tuberculosis.

The widely used measurement of uracil incorporationby metabolically active bacteria has been shown to pro-vide a reliable indication of the metabolic status of grow-ing organisms.'''--^-'* We found that uracil uptake corre-lated closely with the number of bacilli introduced tocultures. Several other in vitro methods including PCR,--^acid-fast staining and bacterial enumeration have beendeveloped to detect the presence of intracellular mycobac-teria and to quantitate their growth within macrophages.It is generally accepted that the ability of bacilli to formcolonies on nutrient media is the most reliable estimate ofviable numbers of organisms. However, clumping ofbacilli, particularly when cultured in macrophages. andthe possibility of bacilli in dormant states make accurateassessment by this method difficult.-^ Others have shownthat while measurement of intracellular bacteria by CFUprovides a reliable means of determining killing or non-viability, uracil uptake more accurately reflects the meta-bolic state of actively dividing bacteria over a short timecourse.'-''-'*

Commonly encountered technical problems were takeninto careful consideration in this study. The use ofantibiotics in the culture media was restricted to penicillinwhich was used at a dose which had previously beenshown not to affect growth of the two A/, hovis strains.Extracellular organisms were minimized by carefullywashing cultures from 4 to 6 h following infection. Aftercultures were infected and washed they were not manipu-lated until harvest except to pulse with uracil.

Virulent A/, hovis induced enhanced mRNA transcrip-tion of the macrophage-associated cytokine genes forTNF-a, IL-lp and IL-6 in comparison to similar culturesinfected with A/, bovis BCG. Enhanced induction of cyto-

50 FE Aldwell ex al.

kine mRNA by virulent M. bovis may reflect a response bymacrophages to the viable bacilli because killed M. bovisdid not induce etihanced levels of these cytokines. Thelack of cytokine mRNA induced by viable A/, bovis BCGsuggested that enhanced cytokine induction is specific forvirulent M. bovis. This is further supported by the obser-vation that both strains showed very low levels of uraciluptake during the initial 24 h of infection when mRNAexpression was measured, indicating that growth of bacilliwas not essential for enhanced induction of cytokinemRNA transcription.

The viability of virulent M. bovis-'mfected macrophagesdecreased dramatically between 48 and 96 h followinginfection. This effect was dose dependent since a morerapid reduction in macrophage viability was observed athigher multiplicities of infection. In contrast, the viabilityof M. bovis BCG-infected macrophages remained highand at lower multiplicities of infection, these macro-phages remained > 90% viable for up to 10 days.

Loss of macrophage viability caused by virulent M.bovis may simply reflect the ability of this strain tometabolize and replicate intracellularly. resulting in de-struction of the host cell. Virulence has often beencorrelated with the ability of mycobacteria to replicatewithin macrophages. More recently, it has been suggestedthat M. tuberculosis strains are able to escape from fusedvesicles whereas M. bovis BCG does not. suggesting thatvirulent A/, tuberculosis may elude the microbicidalmechanisms of macrophages by escaping from fusedphagolysosomes into the cytoplasm. Alternatively, theenhanced induction of macrophage cytokines such asTNF-a may result in autocrine effects on the host cell.This concept is supported by recent data demonstratingthat infection of macrophages with virulent M. tubercu-losis but not M. bovis BCG renders them exquisitelysensitive to the efl'ect of TNF-a.^^ TNF-a is known toplay a dual role in tuberculosis. Granuloma formationand inhibition of mycobacteria! growth in vitro byTNF-a may reflect a protective response in the host,whereas tissue necrosis at lesion sites may be representa-tive of the disease process. In addition, TNF-a mediatesexpression of genes for other cytokines which mayexplain the concurrent stimulation of ILl-P and IL-6mRNA observed in this study. All three cytokines areknown to induce inflamatory proteins and modulate avariety of other immune parameters which may beinvolved in the pathogenesis of tuberculosis. Enhancedinduction of these cytokines by virulent M. bovis maytherefore result in some of the disease-related immuneresponse to bovine tuberculosis observed in vivo. A thirdpossibility is that virulent strains of mycobacteria containsubstances which interfere with macrophage viability.Mycobacterial products including lipoarabinomannanhave been shown to have profound effects on the biologyof macrophages.-^--^' Recently, King et al.^- have shownthat virulent M. tuberculosis but not M. bovis BCGcontains a cytolysin which causes contact-dependentbaemolytic activity.

Our results indicate that destruction of BAM by viru-lent M. bovis occurs once bacilli have begun to activelymetabolize, suggesting that disruption of macrophage

function is caused by replicating bacteria. However,bacterial induction of macrophage cytokines occurs earlyfollowing infection with viable but not necessarily repli-cating bacteria. These early changes may determine thesubsequent fate of the host cell.

Ourpresent knowledge about anti-mycobacterial macro-phage function is largely derived from studies using un-related macrophage populations or macrophage-Iike celllines which are more conveniently available. Yet themononuclear phagocyte system comprises macrophagesat varying stages of differentiation and activation. In con-trast to macrophages from many other tissue locations,alveolar macrophages are in continuous contact withexogenous stimuli which influence their activation status.Furthermore, there is considerable variation in the sus-ceptibility of different host species to pathogenic myco-bacteria. In this study, we have analysed the interaction ofA/. 0175 strains with alveolar macrophages in an attemptto gain an understanding of the early events in the lungfollowing infection. In addition, we have used macro-phages from cattle, the species which is the natural host ofM. bovis.

The reported numbers of lymphocytes in the alveolarair spaces of a normal lung are often very low (< 1% forbovines). There is also a considerable lag time betweeninitial infection and the development of a T cell responseto mycobacteria. Therefore the initial encounter in thelungs between A/, /lov/^iand the BAM, of an unimmunizedhost is likely to be independent of specific T cell immu-nity. In the absence of an adequate T cell response in thelungs, virulent A/, bovis may multiply in BAM. thus pro-viding a basis for dissemination to other tissues. Replica-tion of A/, bovis and subsequent loss of viability of BAMmay also interfere with their antigen presenting functions,resulting in inadequate or inappropriate activation of Tcells.- - The ability of virulent strains of A/, bovis to pref-erentially metabolize in and eventually incapacitate alve-olar macrophages may be a key factor in establishinginfection in the lung thus forming the basis for the subse-quent pathogenetic events in bovine tuberculosis.

Recently, there have been major advances in identify-hig virulence genes associated with pathogenic M. tuber-culosis and M. bovis. The results presented here demon-strate a means of defining the biological role of these genesin the early pathogenesis of tuberculosis.

Acknowledgements

The authors would like to thank Gary Yates for his valu-able assistance with the bacteriology and Dr Des Collinsand Dr Geoff de Lisle for their helpful suggestions andassistance in preparing this manuscript.

References

1 Daborn CJ. Grange JM. HIV/AIDS and its implications forthe control of animal tuberculosis. Br. \'ci. J. 1993; 149:405-17.

2 Thoen CO. Tiibereulosis in wild and domestic animals. In:Bloom BR {ed.) Tuberculosis—Pathogenesis. Proicciion andControl. Washington DC ASM Press, 1994; 157-62.

M. bovis-infected bovine alveolar maerophages 51

3 Smith DW. Wicgeshaus EH. What animal models can teachus about pathogcnesis of tuberculosis in humans. Rev. Inject.Dis. 1989; U (Suppl. 2): S385-93.

4 Fine PEM. The BCG story: Lessons from the past and impli-cations for the future. Rev. Infect. Dix. 1989; II (Suppl. 2):353-9.

5 Wilson TM. de Lisle GW. Collins DM. Effect of inhA andkatG on isoniazid resistance and virulence of Mycobacte-rium bovis. Mot. Mtcrobiol. 1995; 15: 1009-15.

6 Jacobs WR, Bloom BR. Molecular genetic strategies for iden-tifying virulence determinants of Mycohactenum tuber-culosis. In: Bloom BR (cd.) Tuberculosis—Pathogenesis. Pro-tection and Control. Washington DC: ASM press. 1994; 253-68.

7 Plum G. Clarke-Curtiss JE. Induction of Mvcobacteriumavium gene expression following phagocytosis by humanmaerophages. Infect. Immun. 1994; 62: 476-83.

8 Kaufmann SHE. Immunity to intracellular microbial patho-gens. Immunol. Today. 1995; 16: 338-42.

9 Danncnberg AM. Rook GAW. Pathogenesis of pulmonarytuberculosis; An interplay of tissue-damaging andmacrophage-activating immune responses—dual mecha-nisms that control bacillary multiplication. In: Bloom BR(ed.) Tuberculosis—Pathoj^enesis, Protection and Control.Washington DC: ASM Press. 1994; 459-83.

10 Kaufmann SHE. Immunity to intracellular bacteria. Annu.Rev. Immtinol 1993; II: 129-63.

11 Zurbrick, BG. Follet DM, C>,uprynsky CH. Cytokine regula-tion of the intracellular growth o( Mycobacterium paratuber-cutosis in bovine monocytes. Infect. Immun. 1988; 56:1692-7.

12 Buddie BM. Keen D, Thomson A et al. Protection of cattlefrom bovine tuberculosis by vaccination with BCG by therespiratory or subcutaneous route, but not by vaccinationwith killed Mycobacterium vaccae. Res. let. Sci. 1995; 59:10-16.

13 Buddie BM. Aldwell FE, Pfeffer A. de Lisle GW, Corner LA.Experimental Mycobacterium bovis infection of cattle: Effectof dose of A/, bovis and. pregnancy on immune responses anddistribution of lesions. New Zealand Vet. J. 1994; 42: 167-72.

14 Rook GAW, Stccle J, Ainsworth M. Champion BR. Activa-tion of maerophages to inhibit proliferation of Mycobacte-rium tuberculosis: Comparison of the effects of rccombinantgamma-interferon on human monocytes and murine perito-neal maerophages. Immunol. 1986; S9; 333-8.

15 Chan J, Xing Y, Magliozzo RS. Bloom BR. Killing of viru-lent Mycobacterium tuberculosis by reactive nitrogen inter-mediates produced by activated murine maerophages. /E.\p. Med. 1992; 175; 1111-22.

16 Chomczynski P. Saachi N, Single step method of RNA isola-tion by acid guanidinium thiocyanate-phenol-chloroformextraction. .4™/. Biochem. 1987; 162: 156-9.

17 Ng KH, Watson JD. Prestidge R. Buddie BM. CytokinemRNA expressed in tuberculin skin test biopsies from BCG-vaccinated and Mycobacterium /inv/v-inoculated cattle. Im-munol. Cell Biol. 1995 (in press).

18 Degen JL, Ncubauer MG, Friezner Degen SJ, Seyfried CE,

Morris DR. Regulation of protein synthesis in mitogen-activated bovine lymphocytes; Analysis of actin-specific andtotal mRNA accumulation and utilization. / Biol. Chem.1983; 258: 12 153-62.

19 Leong SR, Flaggs GM, Lawman M, Gray PW. The nucle-otide sequence for the cDNA of bovine interleukin-1 beta.Nucl. Acids Res. 1988; 16: 9054.

20 Droogmans L. Cludts I. Cleuter Y. Keftmann R, Bumy A.Nucleotide sequence of bovine intcrleukin-6 cDNA. / DNASequencing and Mapping 1992; 2: 411-14.

21 Hash SM. Brown WC. Rice-Ficht AC. Characterization ofacDNA encoding bovine intcrleukin 10: Kinetics of ex-pression in bovine lymphocvles. Gene 1994; 139: 257-61.

22 Cludts 1. Cluter Y. Kettmann R. Bumey A. Droogmans L.Cloning and characterization of the tandemly arranged bo-vine lymphotoxin and tumour necrosis factor-alpha genes.Cytokine 1993; 5: 336-41.

23 Barrera LF. Skamene F. Radzioch D. .Assessment of myco-bacterial infection and multiplication in maerophages bypolymerase chain reaction. / Immunol. Methods 1993; 157:91-9.

24 Flesch IEA, Kaufmann SHE. Activation of tuberculostaticmacrophage functions by gamma interferon, interleukin-4,and tumour necrosis factor. Infect, tmmun. 1990; 58:2675-7.

25 Collins FM. In vivo vs. in vitro killing of Mycobacteriumtuberculosts. Res Mtcrobiot. 1990; 141: 253-8.

26 Filley EA, Rook GAW. Effect of mycobacteria on sensitivityto the cytotoxic effects of tumour necrosis factor. Infect.Immun. 1991; 59: 2567-72.

21 Russell DG. Mycobacterium and Leishmania: Stowaways inthe endosomal network. Cell BioL 1995; 5: 125-8.

28 Newman GW, Gan HX. McCarthy PL. Renold HG. Survivalof human maerophages infected with Mycobacterium aviumintracellularle correlates with increased production oftumour necrosis factor-a and IL-6. J. Immunol. 1991; 147:3942-8.

29 Gan HX, Newman G, McCarthy PL, Renold HG. TNF-aresponse of human monocyte derived maerophages to A/rc(>-bacterium avium. serovar 4, is of brief duration and proteinkinase C dependent. / Immunol. 1993; 150: 2892-900.

30 Roach TIA, Barton HC, Chatterjee D, Biackwell JM. Mac-rophage activation: Lipoarabinomannan from avirulent andvirulent strains of Mycobacterium tuberculosis differentiallyinduces the early genes c-fos, KC, JE, and tumour necrosisfactor-a./ Immunot. 1993; 150: 1886-96.

31. Roach TIA. Chatterjee D, Biackwell JM. Induction ofcarly-rcsponse genes KC and JE by Mycobacterial lipo-arabinomannans: Regulation of KC expression in murinemaerophages by Lsh/Ity/BCG (candidate N ramp). Infect.Immun. 1994; 62: 1176-84.

32 King HC, Mundayoor S, Crawford JT. Shinnick TM. Expres-sion of contact-dependent cytolytic activity by Mycobacte-rium tuberculosis and isolation of the genomic locus thatencodes the activity. Infect. Immun. 1993; 61; 2708-12.

33 Pancholi P, Mirza A, Bhardwaj N. Steiman RM. Sequestra-tion from immune CD4- T cells of mycobactcna growing inhuman maerophages. Science 1993; 260: 984-6.