Embed Size (px)
Citation preview
lable at ScienceDirect
Plant Physiology and Biochemistry 84 (2014) 271e276
Contents lists avai
Plant Physiology and Biochemistry
journal homepage: www.elsevier .com/locate/plaphy
Research article
Diadenosine triphosphate is a novel factor which in combination withcyclodextrins synergistically enhances the biosynthesis of trans-resveratrol in Vitis vinifera cv. Monastrell suspension cultured cells
Małgorzata Pietrowska-Borek a, b, *, Łukasz Czekała a, b, Sarai Belchí-Navarro b,María Angeles Pedre~no b, Andrzej Guranowski c, **
a Department of Plant Physiology, Pozna�n University of Life Sciences, 35 Woły�nska Street, 60-637 Pozna�n, Polandb Departamento de Biología Vegetal, Facultad de Biología, Campus de Espinardo, Universidad de Murcia, 30100, Spainc Department of Biochemistry and Biotechnology, Pozna�n University of Life Sciences, 11 Dojazd Street, 60-632 Pozna�n, Poland
a r t i c l e i n f o
Article history:Received 1 July 2014Accepted 30 September 2014Available online 1 October 2014
Keywords:Diadenosine triphosphateCyclodextrintrans-ResveratrolPhenylpropanoid pathwayVitis vinifera cv. Monastrell
Abbreviations: 4CL, 4-coumarate CoA ligase; Ap3Ap4A, diadenosine tetraphosphate; C4H, cinnamate-4trins; PAL, phenylalanine ammonia lyase; SCC, susstilbene synthase; trans-R, trans-resveratrol.* Corresponding author. Present address: Depar
Biotechnology, Pozna�n University of Life Sciences, 11 DPoland.** Corresponding author.
E-mail addresses: [email protected], m.(M. Pietrowska-Borek), [email protected] (A. Gu
http://dx.doi.org/10.1016/j.plaphy.2014.09.0190981-9428/© 2014 Published by Elsevier Masson SAS
a b s t r a c t
Dinucleoside polyphosphates are considered as signal molecules that may evoke response of plant cellsto stress. Other compounds whose biological effects have been recognized are cyclodextrins. They arecyclic oligosaccharides that chemically resemble the alkyl-derived pectic oligosaccharides naturallyreleased from the cell walls during fungal attack, and they act as true elicitors, since, when added to plantcell culture, they induce the expression of genes involved in some secondary metabolism pathways.Previously, we demonstrated that some dinucleoside polyphosphates triggered the biosynthesis of en-zymes involved in the phenylpropanoid pathway in Arabidopsis thaliana. In Vitis vinifera suspensioncultured cells, cyclodextrins were shown to enhance the accumulation of trans-resveratrol, one of thebasic units of the stilbenes derived from the phenylpropanoid pathway. Here, we show that diadenosinetriphosphate, applied alone or in combination with cyclodextrins to the grapevine suspension-culturedcells, increased the transcript level of genes encoding key phenylpropanoid-pathway enzymes as well asthe trans-resveratrol production inside cells and its secretion into the extracellular medium. In the lattercase, these two compounds acted synergistically. However, the accumulation of trans-resveratrol and itsglucoside trans-piceid inside cells were stimulated much better by diadenosine triphosphate than bycyclodextrins.
© 2014 Published by Elsevier Masson SAS.
1. Introduction
Dinucleoside polyphosphates, NpnN0s (where N and N0 are pu-rine or pyrimidine nucleosides and n represents the number ofphosphate residues in the oligophosphate chain that esterifies Nand N0 at their 50 position) are rare dinucleotides occurring in allcell types (Garrison and Barnes, 1992). They accumulate when cellsare under stress and therefore, they had been considered to act as
A, diadenosine triphosphate;-hydroxylase; CDs, cyclodex-pension cultured-cells; STS,
tment of Biochemistry andojazd Street, 60-632 Pozna�n,
.
alarmones (Lee et al., 1983; Brevet et al., 1985; Miller andMcLennan,1986; Coste et al., 1987). These compounds are synthesized in re-actions catalyzed by some ligases (Zamecnik et al., 1966;Jakubowski, 1983; Pietrowska-Borek et al., 2003) and transferases(Wang and Shatkin, 1984; Guranowski et al., 1988, 2004). In addi-tion, NpnN0 levels can be also controlled by different catabolic en-zymes (Guranowski, 2000). It is well-known that plant cellsrespond to stress by intensifying the production of various phe-nylpropanoid compounds, such as flavonoids, lignins, anthocyaninsand stilbenes (Dixon and Paiva, 1995). Recently, we have demon-strated that the most studied NpnN0s, diadenosine triphosphate(Ap3A) and diadenosine tetraphosphate (Ap4A) may act as signalmolecules (alarmones) in plants (Pietrowska-Borek et al., 2011).Micromolar concentrations of Ap3A or Ap4A, exogenously added tothe seedlings of Arabidopsis thaliana, markedly increased theexpression of genes encoding phenylalanine ammonia lyase (PAL)and 4-coumarate CoA ligase (4CL), enzymes involved in the phe-nylpropanoid pathway. We have chosen the plant cell system of
M. Pietrowska-Borek et al. / Plant Physiology and Biochemistry 84 (2014) 271e276272
Vitis vinifera cv. Monastrell growing in a liquid medium in order totest if Ap3A or Ap4A evoke the same effects in other plant systems.These grapevine cells have proved to be highly effective in theproduction of trans-resveratrol (trans-R) (Belchí-Navarro et al.,2012), one of the basic units of stilbenes which derives from thephenylpropanoid pathway (Fig. 1). Many researchers have paidmuch attention to trans-R because of its potent benefits for humanhealth. In fact, multiple lines of evidence indicate its beneficial ef-fects on neurological (Okawara et al., 2007) and cardiovascularsystems (Bradamante et al., 2004) but the most striking biologicalactivity of trans-R investigated during the last decade has been itsantitumoral activity since this compound has been seen to preventcarcinogenesis (Pervaiz, 2003). More data provide interesting in-sights into its potential as an antioxidant agent in treating age-related human diseases (De la Lastra and Villegas, 2005), and as apreventive agent for obesity-related disorders (Kaeberlein andRabinovitch, 2006).
Our previous studies showed that the biosynthesis of trans-R ingrapevine suspension cultured-cells (SCC) of Monastrell wasstimulated by adding cyclodextrins (CDs), which are cyclic oligo-saccharides consisting of seven glucopyranose residues linked by a
(1 / 4) glucosidic bonds, and their eliciting activity is due to theirchemical similarity to the alkyl-derived oligosaccharides that arereleased from plant cell walls during fungal attack (Bru et al., 2006).In this work, we show that the addition of 5 mM Ap3A to theV. vinifera SCC enhanced trans-R biosynthesis, and the combinationof Ap3A with CDs synergistically and specifically induced theexpression of a stilbene synthase (STS) as well as those of phenyl-propanoid biosynthetic pathway: PAL, cinnamate-4-hydroxylase(C4H) and 4CL (Fig. 1).
Fig. 1. Phenylpropanoid pathway that leads to the stilbene trans-resveratrol. PAL,phenylalanine ammonia lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumarate CoAligase; CHS, chalcone synthase; STS, stilbene synthase (Chong et al., 2009). In boxes arenames of enzymes and two compounds that were objects of this study.
2. Materials and methods
2.1. Plant materials
V. vinifera L. cv. Monastrell calli were well-established asdescribed by Calderon et al. (1993). They were maintained at 25 �Cin darkness in 250 mL flasks containing 100 mL of fresh culturemedium (Gamborg B5, Duchefa, Spain) as described by Belchí-Navarro et al. (2012), and subcultured on this solid medium everymonth. Monastrell SCC were initiated by inoculating friable calluspieces in 250 mL Erlenmeyer flasks containing 100 mL of liquidGamborg B5 medium, and were routinely maintained by periodicalsubcultures every 14e16 days as described by Belchí-Navarro et al.(2012).
2.2. Elicitor treatments
Elicitation experiments were carried out in triplicate using 10day old Monastrell SCC. At that stage of cell development, 3 g offresh weight of cells washed with cold distilled water were trans-ferred into 50 mL flasks and suspended in 15 mL of fresh GamborgB5 medium supplemented either with 50mMCDs (Wacker Chemie,Spain), 5 mM Ap3A (SigmaeAldrich, USA) or with a combination ofboth during 72 h incubation at 25 �C in the dark in a rotary shaker(110 rpm). Control treatments without elicitors were always run inparallel. After incubation, cells were harvested after 6, 12, 24, 48and 72 h, separated from the culture medium by filtration under agentle vacuum, rapidly washed with cold distilled water, frozen inliquid nitrogen, and kept at �80 �C until use. The spent culturemedia were also frozen at �20 �C until use.
2.3. Analysis of trans-resveratrol and its glycosylated form trans-piceid in Monastrell suspension cultured-cells
To determine the extracellular content of trans-R, aliquots of thespent medium were diluted with methanol to its final concentra-tion of 80% (v/v). Then, 20 mL of diluted and filtered (Anopore0.2 mm) samples were analyzed by HPLC with UVeVIS and fluo-rescence detectors (lex ¼ 330 nm and lem ¼ 374 nm) as describedby Stecher et al. (2001) using a LiChrospher 100 RP-18 column(250 � 4 mm, 5 mm; Merck, column temperature 35 �C). Gradientelutions were performed with 0.05% TFA (solvent A) and 0.05% TFAinmethanol/acetonitrile (60/40 v/v; solvent B): 0 min.10% B; 5min,15% B; 40 min, 35% B; 45 min, 65% B; 50 min, 65% B and 55 min 10%B and eluted at 1 mL min�1. To determine the intracellular contentof trans-R and trans-piceid, 200 mg of freeze-dried cells wereextracted overnight with 4 mL methanol at 4 �C with continuousshaking and then 20 mL of each sample was analyzed on aLiChrospher 100 RP-18 column as described above. trans-R andtrans-piceid were identified (at 306 nm) and quantified by com-parison with commercial trans-resveratrol (SigmaeAldrich, Spain)and trans-piceid (ChromaDex) using respective calibration curves.
2.4. RNA isolation, cDNA synthesis and analysis by quantitativereal-time PCR (qRT-PCR)
Total RNA was extracted from 200 mg of Monastrell frozen cellsusing the RNeasy Plant Minikit (Qiagen) according to the supplier'srecommendations. RNA samples were treated with RNase-freeDNase (Qiagen) according to the manufacturer's protocol and theconcentration of each RNA samplewasmeasured using a NanoDrop2000 (Thermo Scientific). Only the RNA samples with a 260/280ratio between 1.9 and 2.1were used for the analysis. The integrity ofRNA samples was also assessed by agarose gel electrophoresis.Purity of RNA was confirmed by PCR using actin-specific primers
M. Pietrowska-Borek et al. / Plant Physiology and Biochemistry 84 (2014) 271e276 273
and then 3 mg of total RNA was used for cDNA synthesis. RNA andoligo (dT)20 (50 mM) primers were mixed in a total volume of 27 mLand incubated for 10 min at 65 �C followed by 1 min on ice. Su-perscript III reverse transcriptase (Invitrogen), dNTP mix, 5� firststrand buffer, DTT and RNase inhibitor (RNase-OUT Invitrogen)were mixed at 4 �C and dispensed into the tubes with RNA. Thereaction was carried out in 40 mL at 50 �C for 45 min and then, at70 �C for 15 min for reverse transcriptase inactivation. A quanti-tative real-time PCR reaction was carried out using a CFX96 Real-Time PCR Detection System (Bio-Rad) and HotStar-IT SYBR GreenqPCR Master Mix (USB), and the specific primers for Monastrellgenes (PAL1, C4H1, 4CL1, CHS1 and STS1). Comparative CT methodfor relative quantification has been used with EFa1 as endogenouscontrol. The amount of target, normalized to an endogenousreference and relative to a calibrator, is given by 2�DDCT (Schmittgenand Livak, 2008). Primer sequences and GenBank accessionnumbers are presented in Table 1.
2.5. Statistical analysis
Data concerning mRNA level and stilbenes level are the meansof 3 replicates ±SD. Values without a common superscript aresignificantly different according to the ANOVA statistical analysisand the Tukey's HSD multiple range test (P < 0.05). Graphs(mean ± SD) were drawn with SigmaPlot 11 (Systat Software Inc.,Richmond, CA, USA).
3. Results
3.1. Ap3A alone or in combination with cyclodextrins increased thebiosynthesis of trans-resveratrol in grapevine suspension cultured-cells
The effects of CDs, alone or in combination with other elicitors,on trans-R production in Monastrell SCC, have been previouslyanalyzed by Bru et al. (2006) and Belchí-Navarro et al. (2012).Independently, previous studies on A. thaliana seedlings showedthat 5 mM of Ap3A was enough to activate the phenylpropanoidpathway (Pietrowska-Borek et al., 2011). However, it was notknown how that grapevine SCC responds to the addition of Ap3A orAp4A alone or in combination with CDs. To establish this, twodifferent concentrations (5 mM and 25 mM) of Ap3A and Ap4A, aloneor in combinationwith 50mMof CDs, were used in order to check ifthese compounds were able to induce the biosynthesis of trans-R.No enhancement of trans-R was detected in the spent media orinside the cells treatedwith Ap4A alone at any tested concentration.Also, when this compound was used in combination with CDs, theproportion of extracellular trans-R was similar to that found whenthe cells where treated onlywith CDs (data not shown). By contrast,Ap3A appeared to be a good inducer of trans-R biosynthesis. Theamount of trans-R produced using Ap3A was similar at both con-centrations (data not shown), and for this reason, the remainingexperiments were carried out using 5 mM of Ap3A.
Table 1Primer sequences used for quantitative real-time polymerase chain reaction.
Gene symbol GeneBank ID Forward primer (50e30)
PAL1 XM_002281763.2 CCGAACCGAATCAAGGACTGC4H1 XM_002266202.1 TCCAAGTCACCGAGCCTGAT4CL1 XM_002272746.2 CTGATGCCGCTGTTGTTTCGSTS1 XM_002264419.2 CGCCAGGAGATAATCACTGCTCHS1 EC996578.1 GTCCCAGGGTTGATTTCCAAEFa1 XP_002284964.1 GAACTGGGTGCTTGATAGGC
Fig. 2A and B shows the time course of the effect of elicitation ontrans-R and trans-piceid accumulation, respectively, in Monastrellcells subjected to 5 mM of Ap3A alone or in combination with CDs.As can be observed, the addition of 5 mM of Ap3A caused a pro-gressive accumulation of trans-R and trans-piceid that reached thehighest levels (0.3 mg g�1 DW in both cases) at 48 and 12 h,respectively. However, in the presence of CDs alone or in combi-nation with Ap3A, the values of these stilbene compounds weresignificantly lower than those observed in the treatment with Ap3Aalone.
Another experiment was conducted to investigate extracellularproduction of trans-R over time inMonastrell elicited SCC (Fig. 3). Inthis case, a striking synergistic effect was observed 12 h after elic-itation with the combined treatment of Ap3A and CDs. Moreover,this effect increased up to 72 h, reaching high levels of trans-R(around 800 mg L�1). The levels of trans-R with CDs alone alsoincreased progressively until 72 h (700 mg L�1). However, theaddition of Ap3A alone only slightly increased the extracellulartrans-R production up to 12 h, so that the amount of this stilbenewas significantly lower than in the other two treatments. Moreover,it is worthy of note that the concentration of trans-R in the spentmedium (Fig. 3) was significantly higher than in cells (Fig. 2A), andthe glycoside (trans-piceid) was not detected outside cells.
3.2. Effect of Ap3A alone or in combination with cyclodextrins onthe expression of genes encoding key enzymes involved in thesynthesis of trans-resveratrol
Here, we define term “the gene expression” as accumulation ofcorresponding transcripts. In order to analyze the relationship be-tween trans-R accumulation in the spent medium triggered byAp3A alone or combined with CDs, and the expression of relatedbiosynthetic genes, we carried out a qRT-PCR analysis of genes thatcontrol the general phenylpropanoid pathway: PAL, C4H, 4CL, andSTS which is specifically involved in trans-R biosynthesis. Therelative transcript levels of these four genes were quantified at fivedifferent time points through the incubation of SCC with Ap3A, CDsor the combined treatment with Ap3A and CDs (Fig. 4). It is worthyof note that the expression of the STS genewas the highest of all thegenes tested. The STS gene showed the same expression profile inall the treatments. In fact, a marked expression of STS in cellstreated with Ap3A alone (12-fold) or in combination with CDs (8-fold) was noted 6 h after elicitation, which drastically decreasedat 48 h, reaching the control levels. However, the decline in STSexpression was slower in the combined treatment with Ap3A andCDs than that observed in the treatment with Ap3A alone. Inaddition, the synergistic effect observed for the production of trans-R did not have the same pattern in STS gene expression. Morenotable results were observed in cells elicited with CDs, where themaximum transcript level (20-fold) was reached at 12 h of elici-tation. Later, this expression slowly decreased until the lastanalyzed point (72 h).
To evaluate the specificity of this induction, we analyzed therelative transcript level of the phenylpropanoid pathway genes
Reverse primer (50e30) Amplicon length (bp)
GTTCCAGCCACTGAGACAATC 183GCAGGAATGTCATAGCCACC 109GCAGGATTTTACCCGATGGA 198GCACCAGGCATTTCTACACC 134TCTCTTCCTTCAGACCCAGTT 157AACCAAAATATCCGGAGTAAAAGA 164
0 6 12 24 48 72
Control5 μM Ap A50 mM CD5 μM Ap A+50 mM CD
t-Res
vera
trol
in c
ells
(mg
g-1 D
W)
Time (h)
0
0.4
0.1
0.2
0.3
A0.5
0 6 12 24 48 72
t-Pic
eid
in c
ells
(mg
g-1 D
W)
Time (h)
0
0.4
0.1
0.2
0.3
B0.5 Control
5 μM Ap A50 mM CD5 μM Ap A+50 mM CD
Fig. 2. Time course of trans-resveratrol (A) and trans-piceid (B) accumulation in Monastrell cells treated either with 5 mM Ap3A, 50 mM cyclodextrins or with their combination.Data are the mean ± SD for three individual experiments (n ¼ 3).
Fig. 3. Time course of trans-resveratrol accumulation in the spent medium of Mon-astrell suspension cultured-cells treated either with 5 mM Ap3A, 50 mM cyclodextrinsor with their combination. Data are the mean ± SD for three individual experiments(n ¼ 3).
M. Pietrowska-Borek et al. / Plant Physiology and Biochemistry 84 (2014) 271e276274
(PAL, C4H and 4CL). The expression of the first gene PAL, involved inthe phenylpropanoid pathway, (Fig. 4), was induced in all thetreatments, showing the highest levels in the combined treatmentwith Ap3A and CDs at 6 h (2.5-fold) and 24 h (2.2-fold). After then,the accumulation of transcripts decreased below control levels inall treatments.
The enzyme C4H catalyzes the conversion of cinnamic acid in p-coumaric acid. As is shown in Fig. 4, C4H expression was stronglyinduced in all treatments from 6 to 24 h especially when Ap3A wasadded, reaching expression values around 7.5-fold over the control.The accumulation of transcripts in cells treated with CDs alone or incombination with Ap3A showed a similar trend, since a significantincrease in C4H expression was first observed at 6 h (around 5.9-fold), then these levels decreased at 12 h only to increase again at24 h, and finally declined to basal levels after 72 h.
The transformation of p-coumaric acid into 4-coumaroil-CoA iscatalyzed by 4CL. As happened in the case of C4H, the expression of4CL (Fig. 4) was strongly induced after 6 h of elicitation in all thetreatments, reaching the maximum levels of transcripts with Ap3Ain combination with CDs (3-fold). However, after 6 h of treatment,the accumulation of transcripts progressively decreased in thepresence of CDs alone or in combination with Ap3A, with theexception of the Ap3A treatment. In that case the 4CL gene
expression first increased at 12 h and then decreased drasticallyuntil the end of the experiment. Finally, the expression of chalconesynthase gene (CHS) was studied in order to unravel if this otherphenylpropanoid branch was activated. However, it was not (datanot shown).
4. Discussion
Our initial experiments were focused on determining whetherthe exogenous application of Ap3A or Ap4A alone or in combinationwith CDs might induce the expression of the phenylpropanoidpathway genes and, if so, at what concentration. The resultsdescribed here show that the use of Ap4A was not effective totrigger the production of stilbenes but 5 mM of Ap3Awas enough toenhance the accumulation of trans-R and trans-piceid insidegrapevine cells (reaching in each case approximately0.3 mg g�1 DW). However, the use of CDs alone or in combinationwith Ap3A did not increase the intracellular production of thesestilbenes, and the presence of trans-R was only observed in thespent medium. These results are in agreement with those of otherauthors who showed that piceids are not released from these cells(Martínez-Esteso et al., 2011; Lijavetzky et al., 2008). Moreover, asynergistic effect was observed when a combination of Ap3A andCDs was applied and the extracellular production of trans-R wasenhanced 10-fold after 12 h of elicitation in comparison to treat-ment with CDs alone. It has been shown that CDs act as inducers ofdefense responses in different plant species (Bru et al., 2006;Zamboni et al., 2009; Almagro et al., 2011). Moreover, they areable to form inclusion complexes with non-polar compounds liketrans-R (Bru et al., 1996; Morales et al., 1998; Almagro et al., 2011).Hence, the synergistic effect is due to both the ability of Ap3A andCDs to induce the biosynthesis of trans-R and the capacity of CDs tobind and remove this metabolite from the culture medium,avoiding a possible feedback inhibitory effect of free soluble trans-RonMonastrell cells. Moreover, this implies that CDs not only enablehigher accumulation but also direct recovery of trans-R from theculture medium without biomass destruction. These results are inaccordance with those of Belchí-Navarro et al. (2012), whoobserved that the synergistic production of trans-R in V. vinifera SCCin the presence of CDs and a signal molecule, methyl jasmonate,was higher than the sum of the individual treatments. In our workthe expression analysis of these responses showed that both elici-tors stimulate the expression of PAL, C4H, 4CL and STS. Themaximum accumulation of transcripts was observed for the STSgene at 12 h of elicitation, reaching in the case of Ap3A and CDtreatments 15-fold and 20-fold higher transcript levels respectively
PAL1
Time (h)
0 6 12 24 48 72
Rel
aive
gen
e ex
pres
sion
(fol
d)
0
1
2
3
4Control5 μM Ap A 50 mM CD 5 μM Ap A+50 mM CD
C4H1
Time (h)
0 6 12 24 48 72
Rel
tive
gene
exp
ress
ion
(fold
)
0
2
4
6
8
10
12 Control5 μM Ap A 50 mM CD 5 μM Ap A+50 mM CD
Time (h)
0 6 12 24 48 72
Rel
ativ
e ge
ne e
xpre
ssio
n (f
old)
0
1
2
3Control5 μM Ap A 50 mM CD 5 μM Ap A+50 mM CD
STS1
Time (h)
0 6 12 24 48 72
Rel
ativ
e ge
ne e
xpre
ssio
n (f
old)
0
5
10
15
20
25Control5 μM Ap A 50 mM CD 5 μM Ap A+50 mM CD
4CL1
aa
bcbc
c bb
d d
e ee e eeg
h
f
ijj
a
h
a-d
b cdef
gg
h-l
g
jlk
i i i i i i
h h h h h h hi i
g
ff
dede
cc c
b
a
g g g g f g gfg
e
h
i
jj
d
d
dede
bb
c
a
b
Fig. 4. Effect of Ap3A, cyclodextrins or a combination of both on the relative transcript levels of PAL1, C4H1, 4CL1 and STS1 genes. Ten day old grapevine suspension cultured-cellswere treated either with 5 mM Ap3A, 50 mM CD or with the both compounds. Total RNA was reverse-transcribed into cDNA and used as a template for real-time quantitative PCRreaction as described in the Materials and methods. Specific primers were designed for PAL1, C4H1, 4CL1 and STS1 and for EFa1, that was an endogenous control. Relative transcriptlevels were normalized to EFa1 mRNA. The expression level of PAL1, C4H1, 4CL1 and STS1 in the control cells was set to 1. Data are the mean ± SD for three individual experiments(n ¼ 3).
M. Pietrowska-Borek et al. / Plant Physiology and Biochemistry 84 (2014) 271e276 275
than in control cells. These results corroborate Lijavetzky et al.(2008) observations of an increase in the expression of thesegenes when CDs were used alone or in combination with methyljasmonate. Those authors observed a synergistic effect both intrans-R production and in the expression of genes when they used acombination of CDs and methyl jasmonate. In our study, the syn-ergistic effect was only observed in the extracellular accumulationof trans-R but not in the gene expression when a combination ofCDs and Ap3A was used on Monastrell SCC.
It is noteworthy that the maximum transcript levels of PAL or4CL reached around 2e3-fold, that of C4H reached almost 8-fold,and the highest accumulation of transcripts was observed for STSreaching 20-fold more than in control cells. This STS gene expres-sion is directly related to trans-R biosynthesis, and therefore,related to stress responses. Similarly to our results, Lijavetzky et al.(2008) also found higher transcripts levels in STS than in the rest ofphenylpropanoid genes studied. Moreover, Zamboni et al. (2009)carried out a large-scale transcriptional characterization of theearly response of Vitis riparia � Vitis berlandieri cells to CDs, andshowed that besides other responses CDs specifically modulate theexpression of a small number of genes involved in trans-R andlignin biosynthesis. In order to check if the flavonoid branch of thephenylpropanoid pathway was activated, we studied also theexpression of the CHS gene. This other pathway leads to thebiosynthesis of important defense compounds, such as chalcones,flavonols and flavones. Moreover, it is well known that stressconditions, such as UV light, wounding, herbivory or microbialpathogens, induce the expression of CHS, resulting in the produc-tion of compounds that have e.g. antimicrobial (phytoalexins),insecticidal or antioxidant activities or quench UV light directly or
indirectly (Dao et al., 2011). The flavonoid pathway genes are highlydiverse and have been found to be present in the earliest plants onland. The flavonoids act as a sunscreen, protecting plants againstthe oxidative damage caused by UV-B radiation (Dao et al., 2011).Hence, the lack of CHS gene expression in this Monastrell SCC couldbe due to their growth in darkness.
There is also evidence that the STS gene has emerged from theCHS gene several times in evolution (Tropf et al., 1995). Perhaps thelack of expression of CHS favors the high STS expression.
5. Conclusions
The results obtained in this work support the hypothesis of thealarmone effect of Ap3A because of its ability to increase theexpression of phenylpropanoid pathway genes, and in particularthe STS gene that belongs to the stilbene branch. Ap3A enhancedalso the cellular accumulation of trans-piceid, the glucoside oftrans-R and the storage form of this compound. The alarmone effectof Ap3A in combination with the eliciting and/or sequestering ef-fects of CDs promoted the high accumulation in the culture me-dium of trans-R, but not its glucoside trans-piceid.
Contributions
MP-B, AG and MAP conceived the study, participated in itsdesign, coordinated the work and wrote the manuscript. SBN, MP-Band ŁC carried out the experiments.
M. Pietrowska-Borek et al. / Plant Physiology and Biochemistry 84 (2014) 271e276276
Acknowledgments
This work was partially supported by National Science Centre inPoland, grant 2012/05/B/NZ1/00025 to MP-B and AG, MICINN-FEDER (BIO2011-29856-C02-02) to MAP and SBN and by the stat-utory activity of Pozna�n University of Life Sciences, no. 508.645.00to MP-B and ŁC. We are also grateful to the European Cooperationin the Field of Scientific and Technical Research (Cost ActionFA1006). ŁC held a Cost STSM grant from FA1006.
References
Almagro, L., Sabater-Jara, A.B., Belchi
-Navarro, S., Ferna
ndez-Pe
rez, F., Bru, R.,Pedreneo, M.A., 2011. Effect of UV light on secondary metabolite biosynthesis inplant cell cultures elicited with cyclodextrins and methyl jasmonate. In:Vasanthaiah, H. (Ed.), Plants and Environment. InTech Europe, Rijeka, Croatia,pp. 115e136.
Belchí-Navarro, S., Almagro, L., Lijavetzky, D., Bru, R., Pedre~no, M., 2012. Enhancedextracellular production of trans-resveratrol in Vitis vinifera suspensioncultured cells by using cyclodextrins and methyljasmonate. Plant Cell Rep. 31,81e89.
Bradamante, S., Barenghi, L., Villa, A., 2004. Cardiovascular protective effects ofresveratrol. Cardiovasc. Drug Rev. 22, 169e188.
Brevet, A., Plateau, P., Best-Belpomme, M., Blanquet, S., 1985. Variation of Ap4A andother dinucleoside polyphosphates in stressed Drosophila cells. J. Biol. Chem.260, 15566e15570.
Bru, R., Lopez-Nicolas, J.M., Nu~nez-Delicado, E., Nortes-Ruiperez, D., Sanchez-Ferrer, A., Garcia-Carmona, F., 1996. Cyclodextrins as hosts for poorly water-soluble compounds in enzyme catalysis. Appl. Biochem. Biotechnol. 61,189e198.
Bru, R., Selles, S., Casado-Vela, J., Belchi-Navarro, S., Pedre~no, M.A., 2006. Modifiedcyclodextrins are chemically defined glucan inducers of defense responses ingrapevine cell cultures. J. Agric. Food Chem. 54, 65e71.
Calderon, A.A., Zapata, J.M., Munoz, R., Pedreneo, M.A., Barcelo, A.R., 1993. Resvera-trol production as a part of the hypersensitive-like response of grapevine cellsto an elicitor from Trichoderma viride. New Phytol. 124, 455e463.
Chong, J., Poutaraud, A., Hugueney, P., 2009. Metabolism and roles of stilbenes inplants. Plant Sci. 177, 143e155.
Coste, H., Brevet, A., Plateau, P., Blanquet, S., 1987. Non-adenylylated bis(50-nucle-osidyl) tetraphosphates occur in Saccharomyces cerevisiae and in Escherichia coliand accumulate upon temperature shift or exposure to cadmium. J. Biol. Chem.262, 12096e12103.
Dao, T.T.H., Linthorst, H.J.M., Verpoorte, R., 2011. Chalcone synthase and its func-tions in plant resistance. Phytochem. Rev. 10, 397e412.
De la Lastra, C.A., Villegas, I., 2005. Resveratrol as an anti-inflammatory and anti-aging agent: mechanisms and clinical implications. Mol. Nutr. Food Res. 49,405e430.
Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. PlantCell 7, 1085e1097.
Garrison, P.N., Barnes, L.D., 1992. Determination of dinucleoside polyphosphates. In:McLennan, A.G. (Ed.), Ap4A and Other Dinucleoside Polyphosphates. CRC Press,Boca Raton, FL, pp. 29e61.
Guranowski, A., 2000. Specific and nonspecific enzymes involved in the catabolismof mononucleoside and dinucleoside polyphosphates. Pharmacol. Ther. 87,117e139.
Guranowski, A., de Diego, A., Sillero, A., Günther Sillero, M.A., 2004. Uridine poly-phosphates (p4U and p5U) and uridine (50)polyphospho(50)nucleosides (UpnNs)
can be synthesized by UTP:glucose-1-phosphate uridylyltransferase fromSaccharomyces cerevisiae. FEBS Lett. 561, 83e88.
Guranowski, A., Just, G., Holler, E., Jakubowski, H., 1988. Synthesis of diadenosine 50 ,50 0 0-P1, P4-tetraphosphate (AppppA) from adenosine 50-phosphosulfate andadenosine 50-triphosphate catalyzed by yeast AppppA phosphorylase.Biochemistry 27, 2959e2964.
Jakubowski, H., 1983. Synthesis of diadenosine 50 , 50 0 0-P1, P4-tetraphosphate andrelated compounds by plant (Lupinus luteus) seryl-tRNA and phenylalanyl-tRNAsynthetases. Acta Biochim. Pol. 30, 51e69.
Kaeberlein, M., Rabinovitch, P.S., 2006. Medicine: grapes versus gluttony. Nature444, 280e281.
Lee, P.C., Barry, R., Ames, B.N., 1983. Diadenosine 50 , 50 0 0-P1,P4-tetraphosphate andrelated adenylylated nucleotides in Salmonella typhimurium. J. Biol. Chem. 258,6827e6834.
Lijavetzky, D., Almagro, L., Belchi-Navarro, S., Martinez-Zapater, J.M., Bru, R.,Pedre~no, M.A., 2008. Synergistic effect of methyljasmonate and cyclodextrin onstilbene biosynthesis pathway gene expression and resveratrol production inMonastrell grapevine cell cultures. BMC Res. Notes 1, 132e140.
Martinez-Esteso, M.J., Sell�es-Marchart, S., Vera-Urbina, J.C., Pedre~no, M.A., Bru-Martinez, R., 2011. DIGE analysis of proteome changes accompanying largeresveratrol production by grapevine (Vitis vinifera cv. Gamay) cell cultures inresponse to methyl-b-cyclodextrin and methyl jasmonate elicitors. J. Proteome74, 1421e1436.
Miller, D., McLennan, A.G., 1986. Changes in intracellular levels of Ap3A and Ap4A incysts and larvae of Artemia do not correlate with changes in protein synthesisafter heat-shock. Nucleic Acids Res. 14, 6031e6040.
Morales, M., Bru, R., García Carmona, F., Ros Barcel�o, A., Pedre~no, M.A., 1998. Effectof dimethyl-b-cyclodextrins on resveratrol metabolism in Gamay grapevine cellcultures before and after inoculation with Xylophilus ampelinus. Plant Cell Tiss.Org. 53, 179e187.
Okawara, M., Katsuki, H., Kurimoto, E., Shibata, H., Kume, T., Akaike, A., 2007.Resveratrol protects dopaminergic neurons in midbrain slice culture frommultiple insults. Biochem. Pharmacol. 73, 550e560.
Pervaiz, S., 2003. Resveratrol: from grapevines to mammalian biology. FASEB J. 17,1975e1985.
Pietrowska-Borek, M., Nuc, K., Zielezi�nska, M., Guranowski, A., 2011. Diadenosinepolyphosphates (Ap3A and Ap4A) behave as alarmones triggering the synthesisof enzymes of the phenylpropanoid pathway in Arabidopsis thaliana. FEBS OpenBio 1, 1e6.
Pietrowska-Borek, M., Stuible, H.O., Kombrink, E., Guranowski, A., 2003. 4-Coumarate:coenzyme A ligase has the catalytic capacity to synthesize andreuse various (di)adenosine polyphosphates. Plant Physiol. 131, 1401e1410.
Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by comparative CTmethod. Nat. Protoc. 3, 1101e1107.
Stecher, G., Huck, C.W., Popp, M., Bonn, G.K., 2001. Determination of flavonoids andstilbenes in red wine and related biological products by HPLC andHPLCeESIeMSeMS. Fresenius J. Anal. Chem. 371, 73e80.
Tropf, S., Karcher, B., Schroder, G., Schroder, J., 1995. Reaction mechanisms ofhomodimeric plant polyketide synthase (stilbenes and chalcone synthase). Asingle active site for the condensing reaction is sufficient for synthesis of stil-benes, chalcones, and 60-deoxychalcones. J. Biol. Chem. 270, 7922e7928.
Wang, D., Shatkin, A.J., 1984. Synthesis of Gp4N and Gp3N compounds by guany-lyltransferase purified from yeast. Nucleic Acids Res. 12, 2303e2315.
Zamboni, A., Gatto, P., Cestaro, A., Pilati, S., Viola, R., Mattivi, F., Moser, C., Velasco, R.,2009. Grapevine cell early activation of specific responses to DIMEB, a resver-atrol elicitor. BMC Genomics 10, 363e376.
Zamecnik, P.C., Stephenson, M.L., Janeway, C.M., Randerath, K., 1966. Enzymaticsynthesis of diadenosine tetraphosphate and diadenosine triphosphate with apurified lysyl-sRNA synthetase. Biochem. Biophys. Res. Commun. 24, 91e97.
