Galectin-1 in cartilage: Expression, influence on chondrocyte growth and interaction with ECM components

Available online at www.sciencedirect.com

008) 513–525www.elsevier.com/locate/matbio

Matrix Biology 27 (2

Galectin-1 in cartilage: Expression, influence on chondrocyte growth andinteraction with ECM components

Eleonora Marsich a,⁎, Pamela Mozetic a, Fulvia Ortolani b, Magali Contin b, Maurizio Marchini b,Amedeo Vetere a, Sabrina Pacor c, Sabrina Semeraro a, Franco Vittur a, Sergio Paoletti a

a Department of Biochemistry, Biophysics and Macromolecular Chemistry, University of Trieste, Via Licio Giorgieri 1, I-34127 Trieste, Italyb Department of Medical Morphological Research, University of Udine, Piazzale Kolbe 3, I-33100 Udine, Italy

c Department of Biomedical Sciences, University of Trieste, Via Giorgieri 7, 34127 Trieste, Italy

Received 9 May 2007; received in revised form 22 April 2008; accepted 22 April 2008

Abstract

Galectin-1 is a 14 kDa beta-galactoside binding protein, capable of forming lattice-like structures with glycans of cellular glycoconjugates andinducing intracellular signaling. The expression of Galectin-1 in porcine cartilage is described in this work for the first time. Immunocytochemicalmethods revealed distinct distribution patterns for both articular and growth plate cartilage. In articular cartilage, the highest reactivity forGalectin-1 was found in all chondrocytes at the superficial zone and in most of those at the lower layer of the middle zone. In the growth plate,marked reactivity was seen in chondrocytes at the proliferative zone and reached a maximum level for the column-forming cells at thehypertrophic zone. In addition, different Galectin-1 distribution patterns were observed at the subcellular level. With regards to the metaboliceffects of Galectin-1, the results in vitro seem to indicate an inhibitory effect of Galectin-1 on articular chondrocyte anabolism (i.e. inhibition ofcell proliferation and anabolic gene expression) and a stimulation of catabolic processes (i.e. induction of matrix degradation and hypertrophymarker expression). These data represent a starting point for the understanding the molecular mechanisms underlining ECM–Galectin-1interaction and the subsequent signaling–cell transduction processes involving cartilage formation and maturation.© 2008 Elsevier B.V. All rights reserved.

Keywords: Galectin-1; Cartilage; ECM; Chondrocyte growth

1. Introduction

Galectin-1 (Gal1) is a member of a family of animal β-galactoside-binding proteins, which are highly conservedthrough animal evolution (Barondes et al., 1994). It is a non-covalent homodimeric protein with a 14 kDa monomer and aCarbohydrate Recognition Domain (CRD) which preferentiallybinds Galβ(1→4)GlcNAc sequences present in all N-linked andin many O-linked glycans (Kopitz et al., 1998). Galectin-1 iswidely expressed in several tissues and organs (placenta, lung,brain, heart, spleen, lymph nodes, and prostate) and in differentcell types (Camby et al., 2006; Poirier, 2002). It has been

⁎ Corresponding author. Tel.: +39 040 5583692; fax: +39 040 5583691.E-mail address: [email protected] (E. Marsich).

0945-053X/$ - see front matter © 2008 Elsevier B.V. All rights reserved.doi:10.1016/j.matbio.2008.04.003

proposed to play key roles in a variety of biological eventsinvolving carbohydrate recognition, such as cell adhesion(Chammas et al., 1993; Gu et al., 1994; Van den Brule et al.,2003), cell growth regulation, cell cycle progression (Hernandetzand Baum, 2002; Maeda et al., 2003; Moiseeva et al., 2000),apoptosis (He, 2004; Pace et al., 2000), T-cell receptor counterstimulation (Chung et al., 2000; Vespa et al., 1999), immunomo-dulation (Rabinovich et al., 2002a,b), RNA splicing andpromotion of H-Ras membrane anchorage (Liu et al., 2002).

Galectin-1 is present both inside and outside cells. As anextracellular effector, it can bind to cell-surface glycoconjugatesthat contain suitable galactose-containing oligosaccharides,acting as a homobifunctional cross-linker. It also binds tosome of the glycoproteins in the extracellular matrix (ECM),such as laminin, fibronectin and elastin (Sato and Hughes, 1992;Ozeky et al., 1995). As an intracellular effector, Galectin-1

mailto:[email protected]

http://dx.doi.org/10.1016/j.matbio.2008.04.003

514 E. Marsich et al. / Matrix Biology 27 (2008) 513–525

shuttles between the nucleus and the cytoplasm; it is engaged inprocesses that are essential for basic cellular functions, like pre-mRNA splicing, cell growth, apoptosis and cell cycle regula-tion. Nevertheless, the exact mechanisms by which Galectin-1regulate these processes are not yet known.

Normal articular cartilage is composed – along with the cellcomponent and the chondrocytes – by an ECM consistingprimarily of type-II collagen, aggrecan and hyaluronic acid.Type-VI, -IX and -XI collagens, thrombospondin, fibromodu-lin, decorin, biglycan, fibronectin and laminin are present to alesser extent (Lin et al., 2006). The unique expression andorganization of these macromolecules within the articularcartilage confer compressive strength, resilience and mechan-ical durability to this tissue (Mow and Guo, 2002; Grodzinskyet al., 2000).

The cross-talk of chondrocytes with the matrix components isnecessary to maintain tissue homeostasis, composition andmechanical properties as well as to regulate tissue reorganiza-

Fig. 1. Cryosections of articular cartilage samples from pig humeral head after icounterstaining with HE (B, C). A: differential zone-dependent immunostaining is aplayer of the middle zone; CZ: calcification zone; SB: subchondral bone; T: tidemark. Bin the superficial zone (SZ) and lower layer of the middle zone (LMZ); the drawn whi“tidemark” (T) demarcates LMZ from CZ in C. D: control section undergone immusubsequent staining with DAB. A, D: 110×; B: 630×; C: 1200×.

tion. The interaction of chondrocytes with ECM proteinsinduces multiple cellular responses mediated by specificmembrane and intracellular glycosylated receptors. Recently,Galectin-1 was suggested to play an important role in the biologyof chondrocytes and cartilage regeneration (Marcon et al., 2005).Galectin-1 mediates the interaction between chondrocytes and asemi-synthetic glycopolymer that promotes aggregation ofchondrocytes and production of type-II collagen and glycosa-minoglycans (Marcon et al., 2005). Apart from these importantobservations, the mechanism involving Galectin-1 in thebiology of chondrocytes still remains unclear.

Galectin-1 shows multivalent binding to glycoconjugates(Hirabayashi et al., 2002) and cross-linking properties. More-over, it can interact with the ECM causing changes in manycellular processes. Prompted by that evidence, in this study weevaluated the expression of Galectin-1 in porcine cartilage, ofboth the articular and the growing type, and we preliminarilyinvestigated its effects on articular chondrocytes in vitro.

mmunoreaction with anti-Galectin-1-Ab and staining with DAB (A–C), plusparent; SZ: superficial zone; UMZ: upper layer of the middle zone; LMZ: lower, C: intracellular immunolocalization of Galectin-1 at nucleus, cytoplasm or bothte dashed line demarcates SZ from UMZ in B, whereas the basophylic line callednoreaction with Galectin-1-Ab after preincubation with Galectin-1 excess and

515E. Marsich et al. / Matrix Biology 27 (2008) 513–525

2. Results

2.1. Galectin-1 immunolocalization

Galectin-1 immunolocalization was carried out in botharticular cartilage and growth plate to verify its distribution inthese tissues and to assess whether distinct distribution patternsmay characterize different cartilage types.

In articular cartilage, differential zone-dependent reactivitywas apparent for both chondrocytes and ECM. Analyzingarticular cartilage from top to bottom, Galectin-1 reactivity was

Fig. 2. Cryosections of growth cartilage samples from pig scapula after immunoreactwith HE (E). A: increasing ratio of reactive to unreactive cells, from the restingHZ: hypertrophic zone; CZ: chondro-osseous zone. B: Higher magnification shointralacunar matrix or adjacent territorial matrix (arrows) in hypertrophic zone. C–Ecells (arrows in C, resting zone), cytoplasm solely (arrow in D, resting zone), and boC: 400×; D: 240×; E: 870×.

found to be strongly positive in: (i) all flattened chondrocytesaligned along the superficial zone surface and for the majority ofthe roundish chondrocytes residing at lower levels (Fig. 1A,B);(ii) for a minority of the roundish chondrocytes scatteredthroughout the upper layer of the middle zone (Fig. 1A) and(iii) for the majority of the chondrocytes radially distributed inthe lower layer of the middle zone (Fig. 1A,C). ECM showed aweak, diffuse reactivity at the superficial zone and strongerreactivity at the level of the subchondral zone, whereas both theupper and lower layers of the middle zone were completelydevoid of reactions (Fig. 1A).

ion with anti-Galectin-1-Ab and staining with DAB (A–E), plus counterstainingzone toward the hypertrophic zone; RZ: resting zone; PZ: proliferative zone;wing the presence of reactive matrix-vesicle-like punctate bodies within the: intracellular immunolocalization of Galectin-1 at nucleus and edges of severalth nucleus and cytoplasm (arrows in E, hypertrophic zone). A: 130×; B: 680×;


A different pattern of Galectin distribution was noted in thegrowth plate. Reactivity was seen in increasing numbers of thecells grouped within columnar arrangements at the proliferativezone and reached a maximum in the column-forming cells at thehypertrophic zone. However, Galectin-1 reactivity was mark-edly heterogeneous in these areas because of the coexistence ofi) columns of unreactive cells, ii) columns formed by bothunreactive and highly reactive cells, iii) columns formedexclusively by very strongly reactive cells (Fig. 2A,B). At thehypertrophic zone, rounded antibody-positive bodies were alsoscattered in the intralacunar ECM as well as in the inter-columnlongitudinal matrix septa; these structures were readilyidentifiable as matrix vesicles because of their size, shape anddistribution (Fig. 2B).

Minor cell reactivity was also exhibited by the restingcartilage, where few chondrocytes were immunostained in theinner cartilage region. In addition, heterogeneity in Galectindistribution was also observed at the subcellular level becausereactivity appeared either at i) cell nucleus and cytoplasm, ii) cellnucleus and cell edge, iii) cell nucleus only, or iv) cytoplasmonly (Figs. 1B,C and 2C–E).

The above immuno-positivity patterns resulted after usingthe antibody prepared in our laboratory. Superimposablereactivity types were observed either using a commercialantibody or performing epitope demasking enzymatic proce-dure. No immuno-positivity was encountered for both cartilagetypes using either pre-immune serum (not shown) or anti-Galectin-1 antibody together with recombinant Galectin-1, as acompetitor (Fig. 1D).

Moreover, immunofluorescence staining of non-permeabi-lized cells indicated the localized presence of the lectin on theexternal cell surface, as shown by the homogenous fluorescentpattern on the cell membrane (see Fig. 3A).

The expression of Galectin-1 was assessed also by RT-PCRand Western blot analysis, performed on fresh chondrocytesimmediately after isolation from articular cartilage and growthplate cartilage. In both samples, RT-PCR showed transcriptionof Galectin-1 mRNA, as demonstrated by the presence of an

Fig. 3. Expression of galectin-1 in articular and growth cartilage chondrocytes. A) Ichondrocytes. Polyclonal anti-rabbit TRITC-IgG was used as the secondary antibodyand growth cartilage chondrocytes (GP). Twenty micrograms of total proteins extrac15% SDS-PAGE and analyzed by immunoblotting with anti-Galectin-1 antibody. C) mand growth cartilage chondrocytes (GP). GAPDH housekeeping gene expression w

amplification band of 420 bp (Fig. 3B and C). The analysis ofthe protein expression level also showed the presence of asingle 14 kDa band by Western blot using an anti-Gal1antibody.

2.2. Effect of Galectin-1 on chondrocyte adhesion

We investigated whether Galectin-1 could affect chondro-cyte adhesion to two specific ECM proteins: type-II collagen –the main matrix component of cartilage – and fibronectin – anECM component with high binding affinity for Galectin-1. In afirst set of experiments, freshly isolated chondrocytes weresuspended in DMEM containing different concentrations ofGalectin-1 (namely, 0.7 nM, 70 nM, 0.7 μM and 1.4 μM) andplated both in the presence and in the absence of type-IIcollagen or fibronectin. Adhesion tests were performed 6 and24 h after cell seeding, when 20% and 100% of chondrocytes innon-coated plates adhered to the substrate respectively. Asreported in Fig. 4A, the treatment with Galectin-1 at the highestconcentrations (0.7 and 1.4 μM) significantly reduced theadhesion of chondrocytes on plates coated with type-II collagenand non-coated wells. Interestingly, cellular adhesion onfibronectin-coated plates is promoted in a dose-dependentmanner even at one of the lowest concentrations used (70 nM).Furthermore, the contribution of the CRD to the specificity ofthe effects observed on adhesion was evaluated by incubatingthe chondrocytes in the presence of 50 mM lactose, a competitorof sugar binding by Galectin. The presence of lactose induced asignificant, albeit not complete, reduction of the inhibitoryeffects of Galectin-1 (Fig. 4A).

In another set of comparative experiments, Galectin-1 at thesame three concentrations used above was added to the cellculture medium after chondrocyte adhesion i) on non-coatedplates, and ii) on plates coated with type-II collagen orfibronectin. As shown in Fig. 4B, after 12 h, Galectin-1significantly induced detachment of cells from non-coatedplates and plates coated with type II-collagen. Conversely,adhesion to fibronectin did not seem to be affected (Fig. 4B).

mmunostaining with anti-Gal1 primary antibody of non-permeabilized articular. B) Western blot analysis of total proteins extracted from porcine articular (AC)t and 50 ng of recombinant Gal1 (r-Gal1) as internal control were separated by aRNA expression of Galectin-1 as detected by RT-PCR in porcine articular (AC)

as used as internal experimental control.

Fig. 4. A) Effect of Gal1 on chondrocyte adhesion. Cell adhesion was determined by a colorimetric microassay method. Cells were plated in a 96-well Nunc-immunomicrotiter plates uncoated, collagen II-coated and cellular fibronectin coated and treated with different concentrations (0.7 nM, 70 nM, 0.7 μM and 1.4 μM) of Gal1 inthe absence (−) and in the presence of lactose (+). After 6 and 24 h, non-adherent cells were removed by twice rinsing the wells with PBS and adherent cells werestained with a 0.5% solution of crystal violet. The cells stained were dissolved with 10% acetic acid and absorbance was measured at 600 nm with a microplate reader.B) Effect of Galectin-1 on chondrocyte detachment. Galectin-1 at different concentrations (70 nM, 0.7 μM and 1.4 μM) was added to cell culture medium afterchondrocyte plating and adhesion on 96-well Nunc-immuno microtiter non-coated plates or plates pre-coated with collagen II and cellular fibronectin. Chondrocytedetachment from culture wells was evaluated by crystal violet assay performed 24 h after lectin adding as described in the “Experimental procedures” section. Resultsare expressed as absorbance at 600 nm±SD of six determinations (n=6) from a representative out of at least three independent experiments. (⁎pb0.05; ⁎⁎pb0.01).Vertical axis: Absorbance at 600 nm +/− SD. Horizontal axis: Gal1 concentration. C) Fluorescence micrograph of chondrocytes detached from collagen-coated wellsafter incubation with 1.4 μM of Galectin-1. Dead cells appear red, live cells appear green.


A live/dead cytotoxicity assay was performed on detachedcells following Gal1 treatment at the different concentrations(70 nM, 0.7 μM and 1.4 μM) on both non-coated and collagen-coated wells, so as to exclude the possibility that the results ofthe adhesion experiments were biased by a reduced viability ofthe chondrocytes. The basis for the viability test is a differentialpermeability of live and dead cells to a pair of fluorescent stains(SYTO® 10 and DEAD Red™: see section on Experimentalprocedures). A cell population exposed simultaneously to bothdyes becomes differentially stained, live cells appearing asfluorescent green and dead cells as fluorescent red. After

Galectin-1 treatment at the three different concentrations, ineach sample more than 95% of cells after detachment fromwells were fully viable. Representative result of a viability assayconducted on cells detached after treatment with 1.4 μM ofGalectin-1 is shown in Fig. 4C.

2.3. Effect of Galectin-1 on chondrocyte proliferation

To test whether Galectin-1 affects chondrocyte prolifera-tion, freshly isolated cells – embedded in alginate beads toprevent cell dedifferentiation – were starved in serum-free

Fig. 6. Cell cycle analysis. Panel A: Flow cytometry analysis of PI stainedchondrocytes. Histograms represent mean values±S.E.M. (n=6) of percentageof cells (on Y axes) in the cell cycle phase reported on X axes. Values reportedwere subjected toMultiCycle analysis. ⁎⁎⁎pb0.002: values statistically differentfrom controls. Contour plot displaying bi-parametric histograms of doublestained chondrocytes (on X axes: PI — DNA content; on Y axes: FITC — totalprotein content) of untreated samples (control: panel B) and Galectin-1 treatedsamples (panel C).


medium for 36 h and then cultured for 12 h in the presence ofGalectin-1 at various concentrations (0.7 nM, 70 nM, 0.7 and1.4 μM, respectively) in complete DMEM, followed by a 6 hpulse with [3H]-labeled thymidine. As shown in Fig. 5,Galectin-1 inhibits DNA synthesis in a dose-dependentmanner: the proliferation rate of chondrocytes treated with1.4 μM of Galectin-1 was decreased up to 5-fold as comparedto non-treated cells. Interestingly, the growth-inhibitory actionon chondrocytes induced by Galectin-1 was not impaired bylactose.

Along with the inhibitory effect elicited by Galectin-1, weaimed to identify the phase of arrest of the cell cycle.Chondrocytes were treated with Galectin-1 at a concentrationof 1.4 μM, recovered after 24 h and then fixed with ethanol andstained for cell cycle analysis as described above. Threeindependent experiments were performed and a representativeresult is shown in Fig. 6. Panel A of Fig. 6 shows the percentageof cells arrested at each phase of the cell cycle. As expected, themajority of cells (83.7±0.4%) were in the G0/G1 phase of thecell cycle and only about 16% were dividing, being in the S andG2M phase (black columns). Galectin-1 treatment results in aperturbation of the cell cycle as depicted by the white columns.In fact, a higher percentage of cells are accumulated in the Sphase (more than 3×controls) and in the G2M phase(1.4×above control). The decrease of cell growth causes thereduction in the percentage of cells in the G0/G1 phase(reduction of about 20% vs. controls).

Double staining with FITC (indicating total protein content)and PI (indicating DNA content) of control and Galectin treatedcells are shown as contour plots in Fig. 6B and C respectively.Galectin-1 treated cells showed a propensity to exit from the cellcycle towards G0 as suggested by the lower protein content ofapproximately 10% of the treated cells (lower FL1 signal ofcells gated in the oval of panel C, pb0.02 vs. control) (Galectin-

Fig. 5. Effect of Gal1 on proliferation in chondrocyte cell culture in the absenceand in the presence of 70 mM lactose. Three different doses (70 nM, 0.7 μM,1.4 μM) of Gal1 were used as indicated. Cell proliferation was determined bythymidine incorporation assay. The data were evaluated as mean±SD (n=4)normalized to relative total protein and presented as cpm on μg of proteins.(⁎pb0.05;⁎⁎pb0.01).

1: 11.8±0.5% vs. control: 7.5±0.8%, p=0.002). Sub-G1 cellswere not observed following annexin V-FITC/PI staininganalysis.

Fig. 7. Real-time PCR analysis for mRNA expression of type-II, type-X andtype-I collagen, aggrecan and MMP13 in isolated articular chondrocytes aftertreatment with Galectin-1. Values are reported as Log10 of ratio between treatedvs. non-treated cells. Real-time PCR analyses were performed normalizinggenes expression values to endogenous GAPDH transcription.


In a previous study (Wells et al., 1999) it was reported thatapoptosis follows cell cycle arrest in S-G2M phase in humanmammary carcinoma cells treated with Galectin-1, albeit onlyafter a delay of 2–4 days. To test the presence of a similar effectin chondrocytes, 1.4 μM of Galectin-1 was added tochondrocytes in alginate beads and left in culture for 4 days.Cells that had been exposed to Galectin-1 showed a negligibledegree of apoptosis (6.1%), comparable to that of untreated cells(5.2%) (data not shown).

2.4. Effect of Galectin-1 on the expression of matrix protein

The expression level of type-II and type-X collagens,aggrecan and metalloproteinase 13 (MMP13) was studied byreal-time PCR using RNA extracted from primary articularchondrocytes cultured with or without exogenous Galectin-1.The relative expression of genes in each sample was calcu-lated from a calibration curve (Ct vs. concentration) obtainedby measuring GAPDH fragment amplification after serialdilution of the same mRNA sample. The melting dissociationprofiles performed on Gal1 and GAPDH cDNAs allowedconfirmation of the specificity of the amplifications. Theresults of the relative quantification, normalized againstGAPDH amplification, show that collagen-II mRNA levelsin cells treated with Galectin-1 decreased approximately 90-fold when compared with the basal level expression of thosecultured in medium without Galectin-1. In contrast, Gal1strongly induced the gene up-regulation of MMP 13 (morethan 100-fold), a moderate over-expression of aggrecan gene(1.5-fold) and the activation of type X-collagen gene tran-scription (Fig. 7).

3. Discussion

All galectins contain a highly conserved domain specific forβ-galactosides (Cooper, 2002). Since such sequences arepresent on cell-surface glycoconjugates and on matrix glyco-proteins, most galectins are involved in proliferation anddifferentiation processes, cellular adhesion and cell–cell andcell–matrix interactions (Hughes, 2001).

Previous studies (Orazizadeh and Salter, 2005; Colnot et al.,1999) have reported the presence of Galectin-3 in mature andearly hypertrophic chondrocytes of cartilage of the epiphysealplate of developing long bones and in articular cartilage. Knock-out mouse models implicated Galectin-3 in cell death andangiogenesis during the terminal maturation of chondrocytes inthe calcified zone (Colnot et al., 2001). Moreover, Galectin-3over-expression is observed in osteoarthritic cartilage (Orazizadehand Salter, 2005).

To the best of our knowledge, the first experimental evidenceof the presence of Galectin-1 in chondrocytes was found in ourlaboratory (Marcon et al., 2005). Galectin-1 was identified inthe cytoplasm and in the medium of porcine chondrocytescultured in adhesion and in the presence of a glycopolymerbearing side-chains with terminal galactose. We thereforeproceeded to analyze the role of Galectin-1 in chondrocytebiology in depth.

Western blot and immunohystochemistry analysis wereperformed using anti-Galectin-1 antibody produced from sera ofrabbits pre-immunized with highly pure (N98%) recombinantGalectin-1. Anti-Galectin-1 antibody was purified by affinitychromatography employing immobilized Galectin-1 matrix.In WB analysis conducted on chondrocytes total protein extract,Galectin-1 antibody revealed only one strong antigen-dependent signal at the position of Galectin-1 corresponding to14 kDa,while no specific reactivity bandswere observed at higheror lower MW. No cross reactivity against other galectins withdifferent MW, especially Galectin-3, was observed. Only twogalectins have the samemolecular weight as Galectin-1. They areGalectin-7 and Galectin-5, but literature data allow us excludingtheir expression in (porcine) cartilage. In fact, althoughGalectin-7belongs to the same Prototype group as Galectin-1, it is confinedand specifically expressed only in pluristratified epithelia such usepidermis and mucosa, where it plays a role in pro-apoptoticfunction (Magnaldo et al., 1998; Sato et al., 2002; Saussez andKiss, 2006). On the other side, Galectin-5 is considered as a rat-specific protein; both the unique sequence and the expressionprofile of rat Galectin-5 and -9 allow to identify Galectin-5 as aresult of species-specific Galectin-9 gene divergence (Wada andKanwar, 1997; Lensch et al., 2006).

The immunohistochemical examination of the distribution ofGalectin-1 showed that this protein can be detected incartilaginous tissues with distinct patterns, hence proving aclear morpho-functional relationship.

However, given the pleiotropic functions that Gal1 plays inall tissues and its different roles that depend on its cellular andsubcellular localization, a precise assessment of its role inchondrocyte and cartilage metabolism in vivo remains elusive.In fact, the complex functional mechanism of all galectins issuch that different biological effects may be correlated todifferent tissue and cellular districts. Basic studies in vitro arehypothesis-generating and require further confirmation andexperimental validation.

With regards to the scapular growth plate, Galectin-1 ispossibly involved in the onset of chondrocyte maturation anddifferentiation and in the progression of tissue calcification.This statement is supported by: i) the almost undetectable Gal1expression in the resting zone, ii) the positive gradient observedon passing from the proliferative zone to the strongly reactivehypertrophic zone and iii) the observation that matrix vesiclespositive for Gal1 were deposited in the surrounding extra-cellular matrix at the hypertrophic zone. Moreover, thehypothesis of a role for Galectin-1 in cartilage maturation isconsistent with the experimental observation that Gal1modulates the expression of various genes. It up-regulates thatof MMP13 – an enzyme involved in the alterations of the ECMand in chondrocyte apoptosis in growth plate cartilage(D'Angelo et al., 2001; Pedrozo et al., 1999; Oursler, 1994;Knauper et al., 1996; Orth, 1999) – and that of Type-X collagen– a marker for chondrocyte differentiation (Ballock andO'Keefe, 2003; Malemud, 2006). Concomitantly, it down-regulates the genes of Type-II collagen and of aggrecan.

In relation to transcription and regulation of collagen genes,an intriguing hypothesis can be proposed for the role of


Galectin-1 in articular cartilage. In particular, the strongexpression of Galectin-1 in chondrocytes aligned both alongthe superficial zone and in lower levels should imply its possibleinvolvement in collagen network organization. Type-X collagenrole in this tissue has not yet been experimentally elucidated. Infact, although Type-X collagen is a protein generally associatedwith hypertrophic chondrocytes of the growth plate duringendochondral ossification, some studies report its presence inapparently normal articular cartilage (Eerola et al., 1998;Rucklidge et al., 1996; Van der Kraan et al., 2001; Lammiet al., 2002). At present, experiments are ongoing in ourlaboratory to map the co-localization of Galectin-1 with Type-Xcollagen expression, aiming at demonstrating the possiblecorrelation between the presence of Galectin 1 and the synthesisof Type-X collagen. A pathological expression of Type-Xcollagen has been reported in articular osteoarthritic cartilage;this is true also for other differentiation markers, includingMMP13, annexin VI, alkaline phosphatase, osteopontin, andosteocalcin (Von der Mark et al., 1992; Boos et al., 1999;Pulling et al., 2000a,b; Neuhold et al., 2001). MMP13 is up-regulated and Type II-collagen is down-regulated in humanarticular chondrocytes that have been stimulated with pro-inflammatory cytokines such as Tumor Necrosis Factor α(TNFα), Interleukin-beta1 (IL-1), and Interleukin-6 (IL-6)(Patwari et al., 2003). Our observation that articular chondro-cytes begin to express Type-X collagen gene after Galectin-1stimulation, taken together with the up-regulation of MMP13and the down-regulation of Type-II collagen, interestinglypoints to a possible role of Galectin-1 also in the osteoarthriticprocess.

In our study, the cellular distribution of Gal1 in tissue or inisolated articular chondrocytes showed both an intracellular anda cell-surface protein expression. As for Galectin-3, extra-cellular localization of Gal1 seems to correlate with a functionin the modulation of adhesion, acting as an interface betweenthe ECM and the cells. This striking similarity prompted us toevaluate the effect of Galectin-1 on influencing the interactionof articular chondrocytes with the ECM components, inparticular with Type-II collagen and fibronectin. The resultsindicated that Galectin-1 inhibits adhesion to Type-II collagenwhereas it stimulates interaction and adhesion onto fibronectin.Type-II collagen represents the main protein component of thematrix both quantitatively and qualitatively. Although it is notconsidered a preferential binding protein for Galectin-1, it bindsto some integrins responsible for anchoring cells to collagenousmatrices (Loeser et al., 2000; Loeser, 2002). Interestingly,integrins are described as one of the main membrane receptorsfor Galectin-1 (Elola et al., 2005). As a consequence, from thewhole of the previous evidence and the present results, onemight tentatively suggest that a competition for integrin-receptors exists between Gal1 and Type-II collagen. Supportingevidence derives from the observation that integrins αV and α3

were identified after GST-pull down experiments with recom-binant GST-fused Galectin-1 and human chondrocyte extracts(data to be published).

Fibronectin is a glycoprotein serving as a general celladhesion molecule by anchoring cells to collagen or proteogly-

can substrates through membrane-bound receptors. Fibronectin(along with laminin) is one of the ECM proteins suggested toplay the role of receptor for Galectin-1 (Elola et al., 2005).Galectin-1 binds to poly-N-acetyl-lactosamine chains offibronectin, modulating cell adhesion, either positively ornegatively (Elola et al., 2005). Galectin-1 was shown to haveeither a pro-adhesive effect or an anti-adhesive effect accordingto cell type, cell activation status and, more importantly, therelative cell-surface expression of particular receptors (Van denBrule et al., 2003; Horiguchi et al., 2003; Rabinovich et al.,2002a,b). Our experimental data are in agreement with theseobservations ascribing to Galectin-1 an adhesion-modulatingrole for chondrocytes.

Many studies have suggested that cell–ECM interactions areinvolved in regulation and modulation of cell proliferation (e.g.Scott and Weinberg, 2004). Receptor-mediated adhesion toECM proteins (Type II-collagen, fibronectin, laminin) canactivate several intracellular signaling proteins to play a key rolein the regulation of cell proliferation (Loeser et al., 2000).Galectins have been suggested to exert their biological effectsthrough carbohydrate-specific interaction with cell-surfacereceptors (i.e. integrins) by inducing intracellular signalingmostly converging to control cell cycle progression (Hsu andLiu, 2004). Although the published data on the effect ofGalectin-1 on cell proliferation still need further clarification, itis well-established that it modulates proliferation of both normaland malignant cells depending on cell type (Adams et al., 1996;van den Brule et al., 2003; Stillman et al., 2006). The presentstudy demonstrated that Galectin-1 has an inhibitory effect onchondrocyte cell proliferation by blocking the cell cycle even atvery low concentrations without any pro-apoptotic effect.

Moreover, our results on the lactose-independent mechanismsuggest that the CRD is not involved in the above phenomenonand confirm the existence of a cytostatic galactose-binding-independent mechanism mediated by Galectin-1, as alreadyreported by Scott and Weinberg (2004), who suggested theseparate existence of a galactose-binding site and a growth-inhibitory site.

The present findings on the expression of Gal1 in theproliferative zone should be correlated with replicationprocesses that take place in this region. The processes ofchondrocyte proliferation and differentiation (up to hypertro-phy) must be strictly regulated in order to generate bone ofnormal length (Hunziker, 1994). The most recent literature datasuggest that the proliferation of chondrocytes in the growthplate is a very complex process that involves control-feedbackof growth factors (Ballock and O'Keefe, 2003). The basic cellcycle events underlying chondrocyte replication are likely to beregulated by signaling events mediated by hormonal and growthfactors/receptors interactions through balance between levels ofcyclins and CDK inhibitors. Galectin-1 cell cycle regulationresults from the inhibition of the Ras-MEK-ERK pathway andthe consecutive transcriptional induction of p27 (Fischer et al.,2005).

Finally, in the immunohistochemical analysis we observedGalectin-1 localization at different cell compartments. In fact, inaddition to the external surface of the cellular membrane,


positive reactivity is present in the nucleus and in the cytoplasmof some cells, in agreement with its recognized role as afunctionally polyvalent protein and with the results of manystudies. The functional relevance of the nuclear and cytoplasmlocalization of Galectin-1 remains unclear, depending also oncell differentiation (Cooper and Barondes, 1990; Harrison andWilson, 1992; Cho and Cummings, 1995; Savin et al., 2003;Shimonishi et al., 2001; Akimoto et al., 1995; Choi et al., 1998;Kaltner et al., 2002; Wollina et al., 1999; Vyakarnam et al.,1998). It should be noted, however, that most of the studies havedealt with a host of activities mediated by the protein in theextracellular compartment, including cell adhesion, cell pro-liferation, signal transduction and induction of apoptosis in T-lymphocytes.

The relationship between the intracellular and extracellularactivities of Galectin-1 remains therefore to be determined. Inboth articular and growth plate cartilage, we observedheterogeneity in Galectin-1 subcellular localization: reactivityappeared at the cell nucleus and cytoplasm, cell nucleus and celledge, cell nucleus alone, or cytoplasm alone. This distributionmight be correlated with the different metabolic states of thecells, in a manner analogous to what has already described forGalectin-3. The nuclear versusvs. cytoplasmic distributions ofthe latter have been described as being altered by a number ofconditions in various tissues, i.e. proliferation (Bohnsack et al.,2002), differentiation and transformation (Askew et al., 1993;Sanjuan et al., 1997) and topographical distribution (Lotz et al.,1993). For Galectin-3, it has been proposed that a continuousshuttle between the nucleus and cytoplasm creates a dynamicsituation that can change the subcellular distribution of theprotein according to the cell's metabolic state (Davidson et al.,2002).

3.1. Conclusions

Taking altogether, our results indicate an inhibitory effect ofGalectin-1 on chondrocyte anabolism (i.e. cell proliferation andanabolic gene expression) and a stimulation of catabolicprocesses (i.e. matrix degradation and hypertrophy markerexpression). These data represent an important starting point forthe understanding of the molecular mechanisms and processesunderlining ECM–Galectin-1 interaction and induced signalingcell transduction. In fact, though articular cartilage is avascular,alymphatic and aneural, the chondrocytes are nonethelesscapable of responding to environment cues. This ability ariseslargely from the interactions between the cartilage extracellularmatrix and the chondrocytes. The ECM proteins recognize avariety of receptors on chondrocytes to modulate cellsmetabolism, phenotype and response to mechanical load, butmost of the mechanisms and molecules involved are not wellcharacterized yet.

By providing a link between the ECM and cellularmembrane, Galectin-1 may be an important transducer ofmolecular and mechanical stimuli both in physiological andpathological conditions. Moreover, understanding how chon-drocytes process – and respond to – specific individualGalectin-1 signals could provide insight into the pathogenesis

of osteoarthritis, where they have been shown to feature in theirregular processing of extracellular matrix signaling (Aigneret al., 2006; Raggatt et al., 2006).

4. Experimental procedures

4.1. Isolation, expansion and culture of articular and growthplate chondrocytes

Thin slices of cartilage were aseptically excised from (i) thearticular cartilage of humeral proximal heads and (ii) cartilaginousupper edge of scapulae explanted from mature pigs within 2 h oftheir sacrifice. Cells were then isolated by enzymatic digestion ofthe tissue as already described (Grandolfo et al., 1993) and, whenrequired, maintained in DMEM supplemented with 2% gluta-mine, 500 U/ml penicillin, 500 mg/ml streptomycin and 10%FCS.

For encapsulation in alginate beads, isolated chondrocyteswere suspended in 1.5% alginate in 0.15 MNaCl, 10 mMHepes(4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) pH 7.4,to obtain a final density of 1×106 cells/ml. The cell suspensionwas gently mixed and then dropped through a 23-gauge needleinto the gelling solution (50 mM CaCl2, 0.15 M mannitol, and10 mM Hepes, pH 7.4). Beads were left to form under gentleagitation for 10 min, followed by a wash in Dulbecco'sModified Eagle Medium (DMEM) supplemented with 2%glutamine, 500 U/ml penicillin, 500 μg/ml streptomycin and10% FCS. Encapsulated cells were kept in complete medium at37 °C in an atmosphere of 5% CO2. To recover cells fromalginate, beads were dissolved in 50 mM citrate, 100 mM NaCl,and 10 mM glucose pH 7.4.

4.2. Immunocytochemistry analysis of isolated chondrocytes

For immunofluorescence analysis, freshly isolated cells werewashed twice with Earle's Balanced Salt Solution (EBSS)without detergent, fixed with of 2% formaldehyde in PBS for20 min and washed twice with EBSS. The cells were thenincubated overnight at 4 °C with polyclonal rabbit anti-Galectin-1 (1:10), washed in EBSS and incubated for 2 h atroom temperature with a polyclonal anti-rabbit TRITC-IgG(1:100). After washing with EBSS, cells were re-suspended in20 μl of EBSS, dropped on glass slides and air-dried.

4.3. Immunohystochemistry of cartilage sections

For immunohistochemical analysis, articular cartilage sam-ples were dissected from articular cartilages of the humeralproximal head and growing cartilages located at scapula upperregions of adult animals (150–200 kg). After suitable reductionand cryoprotection with OCT, the samples were frozen byimmersion in liquid nitrogen cooled isopentane. Cryostatsections were fixed with 3% paraformaldehyde in PBS, for10 min, washed, and permeabilized with 0.1% Triton X 100 inPBS for 10 min. After rinsing, the slides were incubated in 3%H2O2 in PBS for 5 min to quench endogenous peroxidaseactivity. After washing, the slides were subjected to the


following serial incubations at room temperature: (i) dilutednormal blocking serum for 30 min; (ii) primary antiserum(Polyclonal rabbit anti-Galectin-1 1:100 dilution or commercialanti-Galectin-1 antibody-Peprotech — 1:700 dilution) 90 min;(iii) biotinylated secondary antiserum, for 30min; (iv) VectastainABC reagent for 30 min (for i, iii, and iv, Vectastain, VectorLaboratories, CA). Diaminobenzidine (DAB) was used as thechromogen; sections were also counterstained with hematoxylinand eosin (HE).

Negative controls consisted in reactions using (i) pre-immuneserum (final dilution 1:100), (ii) recombinant Galectin-1 pre-incubated with an excess of anti-Galectin-1 antibody for 90 minand (iii) secondary antibody in the absence of primary one.

Demasking with 1 mg/ml hyaluronidase and 0.2 mg/mlpronase in PBS 0.1 M for 1 h at 37 °C was performed to verifyputative epitope masking by the fixative and/or ECMcomponents.

4.4. Reverse transcription PCR

Total RNA was extracted from chondrocytes with TRIZOLreagent (Invitrogen) and treated with DNAse I to removecontaminating genomic DNA (Amplification Grade DNAse Ikit, Sigma), according to manufacturer's instructions. ForcDNA synthesis, 1 μg total RNA was denatured at 70 °C for10 min and quickly chilled on ice, added to the reversetranscriptase (RT) mixture containing 1×-MLV-RT buffer, 40 URNase out, 10 mM DTT, 25 pmol random hexanucleotides,0.2 mM dNTPs, and 200 U of M-MLV-RT to a total volume of50 μl, and incubated for 1 h at 37 °C. The reaction was thenstopped by heating the mixture at 95 °C for 5 min. Polymerasechain reaction (PCR) was carried out in 50 μl reaction volumeusing 5 μl of the cDNA reaction product (corresponding to100 ng of RNA equivalent) as template mixed with PCR mix(1× Taq buffer, 25 pmol of each primer, 0.1 mM dNTPs, 0.5 UTaq polymerase) using the following cycling conditions: 94 °C,30 s; 55 °C, 1 min; 74 °C, 1 min for 30 cycles in a Progene DNAThermal Cycler. Primers are reported in Table 1.

Table 1Primers used for RT-PCR and real-time PCR

Gene Acc. no Primer sequence (5′3′)

RT-PCRGAPDH AF017079 fw: 5′-ATGGCTTGTGGTCTGGTC-3′

rev: 5′-TCAAAGGCCACACACTTGA-3′GAL1 AY604429 fw: 5′ATGGTGAAGGTCGGAGTGAAC3′

rev: 5′-TTACTCCTTGGAGGCCATGTG-3′

Real-time PCRGAPDH AF017079 fw: TCACGACCATGGAGAAGGCT

rev: CAGGAGGCATTGCTGATGATCCOL2a1 AF201724 fw: ACTCCTGGCACGGATGGTC

rev: CTTTCTCACCAACATCGCCCCOL10a1 NM_001005153 fw: TGAACTTGGTTCATGGAGTGTTTTA

rev: TGCCTTGGTGTTGGATGGTMMP13 AF069643 fw: GGACAAGTAGTTCCAAAGGCTA CAAC

rev: ATAGGAAACATGAGGGCTCCTGAggrecan AF201722 fv: CCCAACCAGCCTGACAACTT

rev: CCTTCTCGTGCCAGATCATCA

4.5. Real-time PCR

Total RNAwas extracted as described above. After quantifica-tion of total RNA by spectrophotometry, RNA dilutions of 100,10, 1 ng, 100 and 10 pg were prepared to create a quantitativereference standard. Two-step quantitativeRT-PCRwas performedusing SYBR Green PCR Master Mix (Applied Biosystems).

To obtain the maximum specificity in amplification, theprimers were designed using the software Primer Express 1.5(Applied Biosystems). Primers sequences are reported inTable 1. Real-time PCR was performed on cDNA generatedby RT reaction using the sequence detector 7700 ABI PRISMand SYBR Green I chemistry (Applied Biosystems). Thirty-fivecycles were performed at the following temperatures: 95 °C for10 min, then 95 °C for 30 s and 55 °C for 1 min. PCR was runon ABI PRISM 7700. The fluorescent light emission wasdirectly recorded in real time by the Gene Amp 7700 SDSSoftware. Based on the construction of a standard curve(GAPDH), quantitative assessment was obtained.

4.6. Western blot analysis

For western blot analysis, chondrocytes were lysed in a bufferconsisting of 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.5%IGEPAL® CA 210 (Polyoxyethylene(2) isooctylphenyl ether),50 mM NaF and proteases inhibitor cocktail (Sigma). Proteinconcentration was determined by the BCA method (Pierce).Protein samples were heat-denatured in Laemmli buffer andanalyzed by 15% SDS-polyacrylamide gel electrophoresis.Proteins were transferred for 25 min at 4 mA/cm2 onto aPVDF membrane (Millipore) using a transblot electrophoresisapparatus (Bio-Rad laboratories). After blocking, the mem-branes were incubated for 1 h at room temperature with primarypolyclonal rabbit anti-Galectin-1. Following washing, they wereincubated with anti-rabbit IgG alkaline phosphatase-conjugatedsecondary antibody. Immunoreactive bands were visualized onKodak XAR films using CSPD detection system (Tropix).

4.7. Production of recombinant Galectin-1

Recombinant pig Galectin-1 was produced as previouslydescribed (Marcon et al., 2005). In brief, E. coli BL21 strainharboring the pGEX-GALECTIN-1 plasmid, were incubated inLB medium containing glucose (10 mM), ampicillin (100 μg/ml)at 37 °C up to an O.D.600 of 0.8. 0.1 mM of isopropyl-β-thio-galactopyranoside (IPTG) was then added to induce theexpression of recombinant protein and incubation continued for4 h at 37 °C. Cells were then harvested by centrifugation at 5000 gfor 15 min and pelleted bacteria were re-suspended and incubatedin 10 ml/g of TE buffer (Tris–HCl 10 mM pH 8.0 and EDTA1 mM), lysozyme (100 μg/ml), 1 mM PMSF and 5 mM DTT for1 h at 37 °C. Following incubation, solution was mixed with 1%Triton X-100, sonicated at 220 W for 2 min on ice and theinsoluble fraction was separated by centrifugation (10,000 g,30 min at 4 °C).

Recombinant protein was purified by affinity chromatogra-phy using Glutathione-Sepharose 4B resin (Pharmacia-Biotech)


according to manufacturer's instructions. The GST tail wasremoved from fusion protein bound to the resin matrix byincubation in PBS with 0.5 U of thrombin (Pharmacia-Biotech)for each μg of fusion protein for 4 h at room temperature. Toensure maximal lectin activity, a reducing agent (2 mM DTT)was added to the buffers. Recombinant GSTwas expressed andpurified from empty pGEX vector, using the same experimentalcondition described for Galectin-1 and it was used as internalcontrol in the experiment set-up.

4.8. Production of anti-Galectin-1 antibody

Rabbit antiserum against r-Galectin-1 was prepared by theusual method. Rabbits were injected with 100–200 mg of r-Galectin-1 mixed with Freund's complete adjuvant. The rabbitswere boosted three times with the same antigen every 2 weeks.In order to check antibody activity and specificity, we first testedpre-immune serum to verify the presence of reactivity againstGalectin-1 and we regularly monitored the antibody titer byELISA during the immunization schedule. After a constant level(plateau) in immunization serum was reached, IgG antibodieswere purified by affinity chromatography using and rGal1functionalized resin (Sepharose4B cyanogen bromide activatedresin-Amersham) according to manufacturer's instructions. Pre-immune rabbit antiserum was purified using protein-A Sepharose4B resin (Amersham) according to manufacturer's instructions.

4.9. Cell proliferation assays

Chondrocyte proliferation was measured by the incorporationof labeled thymidine into nucleic acids. For this purpose, 105 cellsin alginate beads were starved in serum-free medium for 36 h andthen treatedwith 70, 700 and 1400 nMofGalectin-1, respectively,for 12 h in complete DMEM either in the absence or in thepresence of 50 mM lactose. The cells in the beads were thenpulsed for 6 h with 1 μCi of [3H]-thymidine (specific activity25 Ci/mmol). The media were then removed and the beads weredissolved with citrate. The released cells were washed twice withice-cold PBS, once with 5% trichloroacetic acid and disruptedby adding 0.4 ml 0.5 N NaOH/0.5% SDS. The suspensionswere transferred into tubes containing 4ml of scintillation cocktailand the radioactivity incorporated in DNA was measured in ascintillation counter (Betamatic V, Kontron Instruments).

4.10. Cell cycle analysis

After serum-free starvation for 36 h, 106 cells in alginatebeads were treated with 1.4 μMGalectin-1 in complete mediumfor 24 h. The medium was then removed and the beads weredissolved with citrate. The collected cells were washed withPBS and fixed in 70% ethanol for at least 4 h, or maintainedat 4°C in ethanol up to the staining protocol. For staining, fixedcells were washed twice with PBS and allowed to balance inPBS for 2 h. Pellets were then stained overnight with a dyingmixture (0.5 ml/tube) of PBS solution containing 10 mg/mlpropidium iodide (PI), 0.05 mg/ml FITC, and 40 mg/ml RNase(all from Sigma Chemicals Co.).

4.11. Analysis of apoptosis

Apoptosis was measured by annexin V/PI staining. In brief,106 chondrocytes after Galectin-1 treatment and bead dissolu-tion as described above, were suspended in 200 μl of 10 mMHepes buffer containing 140 mM NaCl, 2.5 mM CaCl2 andstained with annexin V-FITC and PI (50 μg/ml) for 15 min atroom temperature.

All flow cytometry analyses were performed with aCytomics FC500 instrument (Beckman-Coulter Inc, Fullerton,CA, USA) equipped with an Argon laser (488 nm, 5 mV) andstandard system configuration for red-filtered (610 nm, FL3)and green-filtered (525 nm, FL1) fluorescent detection. At least10,000 events were acquired for each sample, and stored as list-mode files for analysis thereafter. In particular, FL3 savedhistograms were submitted for the analysis of the cell cycle,performed by MultiCycle® software; FL1/FL3 histograms wereanalyzed with the WinMDI software (Dr. J. Trotter, ScrippsResearch Institute, La Jolla, CA, USA). Data are expressed asmeans±S.E.M. or as bi-parametric contour plot of repeatedexperiments.

4.12. Cell viability assays

Cell viability was evaluated using the Live/dead® ReducedBiohazard viability/cytotoxicity kit from Molecular Probes(Leiden, NL). SYTO® 10 is a green fluorescent nucleic acidstain which is highly membrane-permeable and labels all cells,including those with intact plasma membranes. DEAD Red™ isa cell-impermeable red fluorescent nucleic acid stain whichlabels only cells with compromised membranes. Chondrocyteswere washed twice with PBS and stained with a mixture of thetwo fluorescent probes according manufacturer's protocol.

4.13. Cell adhesion assays

To study Galectin-1 effects on chondrocyte attachment, 104

cells were plated on 96-well non-treated or type II-collagen(500 ng/well) and fibronectin (350 ng/well) pre-coated platesrespectively. Residual protein absorption sites in wells wereblockedwith 1% serum albumin in PBS for 1 h at 37 °C. Galectin-1 at 0.7, 70, 700 and 1400 nM was added to the culture mediumbefore or after cell adhesion. Cell adhesion was evaluated usingcrystal violet assay. Non-adherent cells were removed by rinsingwells twice with PBS and adherent cells were fixed for 20 minin the dark with a 2% solution of paraformaldehyde in PBS. Cellswere then stained for 10min with a 0.5% solution of crystal violetin 20% of ethanol and washed extensively with PBS. The plateswere allowed to air-dry and the stained cells were dissolvedwith 10% acetic acid. Absorbance was measured at 600 nm withan ELISA microplate reader.

4.14. Statistical analysis

The significance was determined using the two-tailedStudent's test. A p-value of b0.05 was considered statisticallysignificant.


Acknowledgements

The partial financial contributions of the University ofTrieste, the Italian Ministry of University and Research MIUR(FIRB funding to F.V., contract no RBAU01LETE), the Friuli-Venezia Giulia Regional Government (Project: “Characteriza-tion of stem cells and their use in human therapy” — art. 11 LR11/2003), and Bracco Imaging S.p.A. are gratefully acknowl-edged. We thank Salumificio Uanetto s.n.c., Castions di Strada(Udine, Italy) for kindly providing us with the pig scapulas. Ourthanks to Dr. Angela Koh for her help in the critical reviewing ofthe paper.

References

Adams, L., Scott, G.K., Weinberg, C.S., 1996. Biphasic modulation of cellgrowth by recombinant human galectin-1. Biochim. Biophys. Acta 1312,137–144.

Aigner, T., Soeder, S., Haag, J., 2006. IL-1beta and BMPs interactive players ofcartilage matrix degradation and regeneration. Eur. Cell Mater. 12, 49–56.

Akimoto, Y., Hirabayashi, J., Kasai, K., Hirano, H., 1995. Expression of theendogenous 14-kDa beta-galactoside-binding lectin galectin in normalhuman skin. Cell Tissue Res. 280, 1–10.

Askew, D., Burger, C.J., Elgert, K.D., 1993. Tumor growth and adherencechange the expression of macrophage Mac-2. Cancer Lett. 69, 67–74.

Ballock, R.T., O'Keefe, R.J., 2003. Physiology and pathophysiology of thegrowth plate. Birth Defects Res C Embryo Today 69 (2), 123–143 May.

Barondes, S.H., Cooper, D.N.V., Gitt, M.A., Leffler, H., 1994. Galectins:structure and function of a large family of animal lectins. J. Biol. Chem. 269,20807–20810.

Bohnsack, M.T., Regener, K., Schwappach, B., Saffrich, R., Paraskeva, E.,Hartmann, E., Gorlich, D., 2002. Exp5 exports eEF1Avia tRNA from nucleiand synergizes with other transport pathways to confine translation to thecytoplasm. EMBO J. 21, 6205–6215.

Boos, N., Nerlich, A.G., Wiest, I., von der Mark, K., Ganz, R., Aebi, M., 1999.Immunohistochemical analysis of type-X collagen expression in osteoar-thritis of the hip joint. J. Orthop. Res. 17, 495–502.

Camby, I., Le Mercier, M., Lefranc, F., Kiss, R., 2006. Galectin-1: a smallprotein with major functions. Glycobiology 11, 137R–157R.

Chammas, R., Veiga, S.S., Travassos, L.R., Brentani, R.R., 1993. Functionallydistinct roles for glycosylation of alpha and beta integrin chain in cell matrixinteractions. Proc. Natl. Sci. U. S. A. 90, 1795–1799.

Cho, M., Cummings, R.D., 1995. Galectin-1, a beta-galactoside-binding lectinin Chinese hamster ovary cells: II. Localization and biosynthesis. J. Biol.Chem. 270, 5207–5212.

Choi, J.Y., van Wijnen, A.J., Aslam, F., Leszyk, J.D., Stein, J.L., Stein, G.S.,Lian, J.B., Penman, S., 1998. Developmental association of the beta-galactoside-binding protein galectin-1 with the nuclear matrix of rat calvarialosteoblasts. J. Cell. Sci. 111, 3035–3043.

Chung, C.D., Patel, V.D., Moran, M., Lewis, L.A., Miceli, M.C., 2000.Galectin-1 induces partial TCR z-chain phosphorylation and antagonizesprocessive TCR signal transduction. J. Immunol. 165, 3722–3729.

Colnot, C., Sidhu, S.S., Balmain, N., Poirier, F., 2001. Uncoupling ofchondrocyte death and vascular invasion in mouse Galectin 3 null mutantbones. Dev. Biol. 229, 203–214.

Colnot, C., Sidhu, S.S., Poirier, F., an Balmain, N., 1999. Cellular andsubcellular distribution of galectin-3 in the epiphyseal cartilage and bone offetal and neonatal mice. Cell. Mol. Biol. 45, 1191–1202 (Noisy-le-grand).

Cooper, D.N.W., Barondes, S.H., 1990. Evidence for export of a muscle lectinfrom cytosol to extracellular matrix and for a novel secretory mechanism.J. Cell Biol. 110, 1681–1691.

Cooper, D.N.W., 2002. Galectinomics: findings themes in complexity. Biochim.Biophys. Acta 1572, 209–231.

D'Angelo, M., Billings, P.C., Pacifici, M., Leboy, P.S., Kirsch, T., 2001.Authentic matrix vesicles contain active metalloproteases (MMP). A role for

matrix vesicle associated MMP-13 in activation of transforming growthfactor-beta. J Biol. Chem. 27, 11347–11353.

Davidson, P.J., Davis, M.J., Patterson, R.J., Ripoche, M.A., Poirier, F., Wang, J.L.,2002. Shuttling of Galectin-3 between the nucleus and cytoplasm. Glycobiol-ogy 12, 329–337.

Eerola, I., Salminen, H., Lammi, P., Lammi, M., von der Mark, K., Vuorio, E.,Säämänen, A.M., 1998. Type X collagen, a natural component of mousearticular cartilage: association with growth, aging, and osteoarthritis.Arthritis Rheum. 7, 1287–1295.

Elola,M.T., Chiesa,M.E., Alberti, A.F., Mordoh, J., Fink, N.E., 2005. Galectin-1receptors in different cell types. J. Biomed. Sci. 12, 1–17.

Fischer, C., Sanchez-Ruderisch, H., Welzel, M., Wiedenmann, B., Sakai, T.,Andre, S., Gabius, H.J., Khachigian, L., Detjen, K.M., Rosewicz, S., 2005.Galectin-1 interacts with the {alpha}5{beta}1 fibronectin receptor to restrictcarcinoma cell growth via induction of p21 and p27. J. Biol. Chem. 280,37266–37277.

Grandolfo, M., D'Andrea, P., Paoletti, S., Martina, M., Silvestrini, G., Bonucci,E., Vittur, F., 1993. Culture and differentiation of chondrocytes entrapped inalginate gels. Calcif. Tissue Int. 52, 42–48.

Grodzinsky, A.J., Levenston, M.E., Jin, M., Frank, E.H., 2000. Cartilage tissueremodeling in response to mechanical forces. Annu. Rev. Biomed. Eng. 2,691–713.

Gu, M., Wang, W., Coopoer, D.N.W., Kaufman, S.J., 1994. Selectivemodulation of the interaction of a7b1 integrin with fibronectin and lamininby L-14 lectin during skeletal muscle differentiation. J. Cell. Sci. 107,175–181.

Harrison, F.L., Wilson, T.J., 1992. The 14 kDa beta-galactoside binding lectinin myoblast and myotube cultures: localization by confocal microscopy.J. Cell. Sci. 101, 635–646.

He, J., 2004. Cell–cell and cell matrix contact in galectin-1 cell death.Presentation of Galectin-1 by extracellular matrix triggers T cell death.J. Biol. Chem. 279, 4705–4712.

Hernandetz, J.D., Baum, L.G., 2002. Ah, sweet mystery of death! Galectin andcontrol of cell fate. Glycobiology 12, 127–136.

Hirabayashi, J., Hashidate, T., Arata, Y., Nishi, N., Nakamura, T., Hirashima,M., Urashima, T., Oka, T., Futai, M., Muller, W.E., Yagi, F., Kasai, K., 2002.Oligosaccharide specificity of galectins: a search by frontal affinitychromatography. Biochim. Biophys. Acta 1572, 232–254.

Horiguchi, N., Arimoto, K., Mizutani, A., Endo-Ichikawa, Y., Nakada, H.,Taketani, S., 2003. Galectin-1 induces cell adhesion to the extracellularmatrix and apoptosis of non adherent human colon cancer Colo201cells.J. Biochem. (Tokyo) 134 (6), 869–874 Dec.

Hsu, D.K., Liu, F.T., 2004. Regulation of cellular homeostasis by galectins.Glycoconj.J. 19 (7–9), 507–515.

Hughes, R.C., 2001. Galectins as modulators of cell adhesion. Biochimie 83,667–676.

Hunziker, E.B., 1994. Mechanism of longitudinal bone growth and its regulationby growth plate chondrocytes. Microsc. Res. Tech. 28, 505–519.

Kaltner, H., Seyrek, K., Heck, A., Sinowatz, F., Gabius, H.J., 2002. Galectin-1and galectin-3 in fetal development of bovine respiratory and digestivetracts. Comparison of cell type-specific expression profiles and subcellularlocalization. Cell Tissue Res. 307, 35–46.

Knauper, V., Lopez-Otin, C., Smith, B., knight, G., Murphy, G., 1996.Biochemical characterization of human collagenase 3. J. Biol. Chem. 271,1544–1550.

Kopitz, J., von Reitzeinstein, C., Burchert, M., Cantz, M., Gabius, H.J., 1998.Galectin-1 is a major receptor for ganglioside GM1, a product of the growth-controlling activity of a cell surface ganglioside sialidase, on humanneuroblastoma cells in culture. J. Biol. Chem. 273, 11205–11211.

Lammi, P.E., Lammi, M.J., Hyttinen, M.M., Panula, H., Kiviranta, I., Helminen,H.J., 2002. Site-specific immunostaining for type X collagen in non-calcified articular cartilage of canine stifle knee joint. Bone 6, 690–696.

Lensch, M., Lohr, M., Russwurm, R., Vidal, M., Kaltner, H., André, S., Gabius,H.J., 2006. Unique sequence and expression profiles of rat Galectins-5and -9 as a result of species-specific gene divergence. Int. J. Biochem. CellBiol. 38 (10), 1741–1758.

Lin, Z., Willers, C., Xu, J., Zheng, M.H., 2006. The chondrocyte: biology andclinical application. Tissue Eng. 7, 1971–1984.


Liu, F.T., Patterson, R.J., Wang, J.L., 2002. Intracellular functions of galectins.Biochim. Biophys. Acta 157, 263–273.

Loeser, R.F., 2002. Integrins and cell signalling in chondrocytes. Biorheology39 (1–2), 119–124.

Loeser, R.F., Sadiev, S., Tan, L., Goldring, M.B., 2000. Integrin expression byprimary and immortalized human chondrocytes: evidence of a differentialrole for alpha1beta1 and alpha2beta1 integrins in mediating chondrocyteadhesion of types II and VI collagen. Osteoarthr. Cartil. 8, 96–105.

Lotz, M.M., Andrews Jr., C.W., Korzelius, C.A., Lee, G.D., Steele Jr., E.C.,Clarke, A., Mercurio, A.M., 1993. Decreased expression of Mac-2(carbohydrate binding protein 35) and loss of its nuclear localization areassociated with the neoplastic progression of colon carcinoma. Proc. Natl.Acad. Sci. U. S. A. 90, 3466–3470.

Maeda, N., Kawada, N., Seki, S., Arakawa, T., Ikeda, K., Iwao, H., Okuyama,H., Hirabayashi, J., Kasa, K.I., Yoshizato, K., 2003. Stimulation ofproliferation of rat stellate cells by galectin-1 and galectin-3 throughintracellular signaling pathway. J. Biol. Chem. 278, 18938–18944.

Malemud, C.J., 2006. Matrix metalloproteinases: role in skeletal developmentand growth plate disorders. Front Biosci. 11, 1702–1715.

Magnaldo, T., Fowlis, D., Darmon, M., 1998. Galectin-7, a marker of all types ofstratified epithelia. Differentiation 63 (3), 159–168.

Marcon, P., Marsich, E., Vetere, A., Mozetic, P., Campa, C., Donati, I., Vittur, F.,Gamini, A., Paoletti, S., 2005. The role of galectin-1 in the interactionbetween chondrocytes and a lactose-modified chitosan. Biomaterials 26,4975–4984.

Moiseeva, E.P., Javed, Q., Spring, E.L., de Bono, D.P., 2000. Galectin 1 isinvolved in vascular smooth muscle cell proliferation. Cardiovasc. Res. 45,493–502.

Mow, V.C., Guo, X.E., 2002. Mechano-electrochemical properties of articularcartilage: their inhomogeneities and anisotropies. Annu Rev Biomed Eng. 4,175–209.

Neuhold, L.A., Killar, L., Zhao, W., Sung, M.L., Warner, L., Kulik, J., et al.,2001. Postnatal expression in hyaline cartilage of constitutively activehuman collagenase-3 (MMP-13) induces osteoarthritis in mice. J. Clin.Invest. 107, 35–44.

Orazizadeh, M. and Salter, D.M., 2005. Differential immunohistochemicalexpression pattern of galectin-3 in normal and osteoarthritic human articularcartilage. 2, 78–86.

Orth, M.W., 1999. The regulation of growth plate cartilage turnover. J Anim.Sci. 77 (Suppl 2), 183–189.

Oursler, M.J., 1994. Osteoclast synthesis and secretion and activation of latenttransforming growth factor beta. J. Bone Miner. Res. 9, 443–452.

Ozeky, Y., Matsui, T., Yamamoto, Y., Funahashi, M., Hamako, J., Titani, K.,1995. Tissue fibronectin is an endogenous ligand for Galectin-1. Glycobiol-ogy 5, 255–261.

Pace, K.E., Hahn, H.P., Pang, M., Nguyen, J.T., Baum, L.G., 2000. Cuttingedge: CD7 delivers apro-apoptotic signal during galectin-1 induced T celldeath. J. Immunol. 165, 2331–2334.

Patwari, P., Cook, M.N., DiMicco, M.A., Blake, S.M., James, I.E., Kumar, S.,Cole, A.A., Lark, M.W., Grodzinsky, A.J., 2003. Proteoglycan degradationafter injurious compression of bovine and human articular cartilage in vitro:interaction with exogenous cytokines. Arthritis Rheum. 5, 1292–1301.

Pedrozo, H.A., Schwartz, Z., Robinson, M., Gomes, R., Dean, D.D., Bonewald,L.F., Boyan, B.D., 1999. Potential mechanisms for the plasmin-mediatedrelease and activation of latent transforming growth factor-beta1 from theextracellular matrix of growth plate chondrocytes. Endocrinol. 140,5806–5816.

Poirier, F., 2002. Roles of galectins in vivo. Biochem. Soc. Symp. 69, 95–103.Pulling, O., Weseloh, G., Gauer, S., Swoboda, B., 2000a. Osteopontin is

expressed by adult human osteoarthritic chondrocytes: protein and mRNAanalysis of normal and osteoarthtritic cartilage. Matrix Biol. 19, 245–255.

Pulling, O., Weseloh, G., Ronneberger, D., Kakonen, S., Swoboda, B., 2000b.Chondrocyte differentiation in human osteoarthritis: expression of osteo-calcin in normal and osteoarthritic cartilage and bone. Calcif. Tissue Int. 67,230–240.

Rabinovich, G.A., Baum, L.G., Tinari, N., Baganelli, R., Natoli, C., liu, F.T.,Iacobelli, S., 2002a. Galectins their ligands: amplifiers, silencers or turnersof the inflammatory response? Trends Immunol. 23, 313–320.

Rabinovich, G.A., Rubinstein, N., Toscano, M.A., 2002b. Role of galectins ininflammatory and immunomodulatory processes. Biochim. Biophys. Acta1572, 274–284.

Raggatt, L.J., Jefcoat Jr, S.C., Choudhury, I., Williams, S., Tiku, M., Partridge,N.C., 2006. Matrix metalloproteinase-13 influences ERK signalling inarticular rabbit chondrocytes. Osteoarthr. Cartil. 14 (7), 680–689.

Rucklidge, G.J., Milne, G., Robins, S.P., 1996. Collagen type X: a component ofthe surface of normal human, pig, and rat articular cartilage. Biochem.Biophys. Res. Commun. 16 224 (2), 297–302.

Sanjuan, X., Fernandez, P.L., Castells, A., Castronovo, V., van den Brule, F.A.,Liu, F.T., Cardesa, A., Campo, E., 1997. Differential expression of Galectin3 and Galectin 1 in colorectal cancer progression. Gastroenterology 113,1906–1915.

Sato, S., Hughes, R.C., 1992. Binding specificity of a baby hamster kidneylectin for H type I and II chains, polylactosamine glycans and appropriatelyglycosylated forms of laminin and fibronectin. J. Biol. Chem. 267,6983–6990.

Sato, M., Nishi, N., Shoji, H., Kumagai, M., Imaizumi, T., Hata, Y., Hirashima,M., Suzuki, S., Nakamura, T., 2002. Quantification of Galectin-7 and itslocalization in adult mouse tissues. J. Biochem. 131 (2), 255–260.

Saussez, S., Kiss, R., 2006. Galectin-7. Cell. Mol. Life Sci. 63 (6), 686–697.Savin, S.B., Cvejic, D.S., Jankovic, M.M., 2003. Expression of galectin-1 and

galectin-3 in human fetal thyroid gland. J. Histochem.Cytochem. 51, 479–483.Scott, K., Weinberg, C., 2004. Galectin-1: a bifunctional regulator of cellular

proliferation. Glycoconj. J. 19, 467–477.Shimonishi, T., Miyazaki, K., Kono, N., Sabit, H., Tuneyama, K., Harada, K.,

Hirabayashi, J., Kasai, K., Nakanuma, Y., 2001. Expression of endogenousgalectin-1 and galectin-3 in intrahepatic cholangiocarcinoma. HumanPathol. 32, 302–310.

Stillman, B.N., Hsu, D.K., Pang, M., Brewer, C.F., Johnson, P., Liu, F.T., Baum,L.G., 2006. Galectin-3 and galectin-1 bind distinct cell surface glycoproteinreceptors to induce T cell death. J. Immunol. 2, 778–789.

Van den Brule, F., Califice, S., Garnier, F., Fernandez, P.L., Berchuck, A.,Castronovo, V., 2003. Galectin-1 accumulation in the ovary carcinomaperitumoral stroma is induced by ovary carcinoma cells and affects bothcancer cell proliferation and adhesion to laminin-1 and fibronectin. Lab.Invest. 83, 377–386.

Van der Kraan, P.M., Stoop, R., Meijers, T.H., Poole, A.R., van den Berg, W.B.,2001. Expression of type X collagen in young and old C57Bl/6 and Balb/cmice. Relation with articular cartilage degeneration. Osteoarthr. Cartil. 2,92–100.

Vespa, G.N.R., Lewis, L.A., Kozak, K.R., Moran,M., Nguyen, J.T., Baum, L.G.,1999. Galectin-1 specifically modulates TCR signal to enhance TCRapoptosis but inhibit IL-2 production and proliferation. J. Immunol. 162,799–806.

Von der Mark, K., Kirsh, R.T., Nerlich, A., Kuss, A., Weseloh, G., Gluckert, K.,1992. Type X collagen synthesis in human osteoarthritic cartilage: indicationof chondrocytes hypertrophy. Arthritis Rheum. 35, 806–811.

Vyakarnam, A., Lenneman, A.J., Lakkides, K.M., Patterson, R.J., Wang, J.L.,1998. A comparative nuclear localization study of galectin-1 with othersplicing components. Exp. Cell Res. 242, 419–428.

Wada, J., Kanwar, Y.S., 1997. Identification and characterization of galectin-9, anovel beta-galactoside-binding mammalian lectin. J. Biol. Chem. 272 (9),6078–6086.

Wells, V., Davies, D., Mallucci, L., 1999. Cell cycle arrest and induction ofapoptosis by beta galactoside binding protein (beta GBP) in humanmammary cancer cells. A potential new approach to cancer control. Eur. J.Cancer. 35 (6), 978–983.

Wollina, U., Schreiber, G., Gornig,M., Feldrappe, S., Burchert, M., Gabius, H.J.,1999. Sertoli cell expression of galectin-1 and -3 and accessible binding sitesin normal human testis and Sertoli cell only-syndrome. Histol. Histopathol.14, 779–784.

Documents

Galectin-1 in cartilage: Expression, influence on chondrocyte growth and interaction with ECM components