The EMBO Journal vol.7 no.12 pp.3957-3962, 1988

Messenger RNA recognition in Escherichia coli:a possible second site of interaction with 16S ribosomalRNA

G.B.Petersen, P.A.Stockwell and D.F.HillDepartment of Biochemistry, University of Otago, Dunedin,New Zealand

Communicated by G.Brownlee

Examination of the nucleotides following the ATG orGTG initiation codons of a file of 251 genes fromEscherichia coli has shown that 247 (98.4%) of themcontain a sequence of at least three and 168 (66.9%) ofthem a sequence of at least four consecutive nucleotidesthat is complementary to some part of the 16 nt at the5' terminus of the bacterial 16S rRNA. It is proposedthat this sequence, which falls within the first 24 nt codingfor the genetic message, might be involved in mRNArecognition through a mechanism analogous to the well-established 'Shine-Dalgarno' interaction with the 3'terminus of the 16S rRNA. Comparison of these datawith data derived from a file of 117 'false' gene startsthat have a Shine-Dalgarno-like sequence followed bya suitably spaced ATG or GTG triplet but which arebelieved not to lie at the beginnings of genetic messagesshows the association that we have found to be statisticallysignificant at the 99.9% level.Key words: Escherichia coli/mRNA/prokaryotic genes/rRNA/translational initiation

Introduction

The availability of successful techniques for the rapiddetermination of nucleotide sequences in DNA moleculeshas led to an increased need for the development of reliablemethods for the conversion of 'raw' DNA sequence data intogenetic maps. In the absence of direct evidence from proteinprimary structure, it is often possible to make predictionsabout the genetic activity of an unknown DNA sequencefrom a study of the sequence itself (Staden, 1985). Steitz(1979) has reviewed the experiments and thinking thatfollowed the observation by Shine and Dalgarno (1974,1975) that the initiation codons of known genes in theEscherichia coli/coliphage system are preceded by a shortsequence (SD sequence) of nucleotides that is directlycomplementary to some part of the -ACCUCCUUA-OHnucleotide sequence lying at the extreme 3' terminus of E. coli16S rRNA. The present view of the mechanism of initiationof mRNA translation in prokaryotic systems is that a

preliminary interaction between the 16S rRNA sequence andthe mRNA 'points' a 30S ribosomal subunit towards an AUGor GUG triplet lying 5-9 nt 'downstream' (i.e. 3') in themRNA sequence as the first codon in the genetic messageand thus allows the formation of a properly oriented30S subunit-mRNA -fmet tRNA complex. The initiationcomplex is completed by the addition of the 50S ribosomalunit to give an active, in-phase ribosome. Thus, in

©IRL Press Limited, Oxford, England

considering a new DNA sequence, it is a simple matter totranslate the sequence in all three phases and to identify openreading frames (ORFs) that might code for viable proteinsin vivo. This usually involves the selection of ORFs ofplausible length (i.e. that are capable of coding for a peptideof greater than a specified minimum size) that contain aninitiation codon that is preceded by a suitably spaced SDsequence. If the sequences of one or two genes in the systemare already known, a comparison of the codon usage of anunknown nucleotide sequence can provide strong supportingevidence for the assignment of genetic function to a newsequence and a number of computer-assisted methodsexploiting this and other approaches have been described(Staden, 1985).

In many cases, this approach gives convincing results, butthe difficulties experienced with the interpretation of thesequence of the DNA of bacteriophage X (Sanger et al.,1982) highlighted the uncertainties involved. Application ofthe methods outlined above to the X sequence allowed 46ORFs to be identified, but in -50% of these cases theinitiating codon could not be identified with certainty, whilea further 20 ORFs that do not meet the usually acceptedcriteria can be distinguished in the sequence. Steitz (1979)drew attention to the likely importance of mRNA secondarystructure and of protein -RNA interactions (possiblyinvolving nucleotides lying downstream of the initiationcodon as well as upstream sequences) in enhancing thespecificity of the interaction and in stabilizing the ribosome-mRNA-tRNA initiation complex.

In a critical and original review, Gold et al. (1981)discussed the evidence that an SD sequence, an initiationcodon and a suitable spacing between the two are sufficientto specify the translational start of a coding sequence. Theevidence is convincing that they are necessary, but equallyconvincing that they are not sufficient. Their own studiesand those of others (discussed in Gold et al., 1981) supportthe view that other upstream sequences, distinct from theSD sequence, are probably involved. More strikingly,downstream sequences (i.e. nucleotides lying within theamino acid coding sequence itself) are also implicated in theinitial recognition of translational start codons by the 30Sribosomal subunit.The evidence for the participation of downstream

sequences, summarized by Gold et al. (1981), is basedmainly upon statistical analyses of coding sequences. In anearlier study, Scherer et al. (1980) scored the occurrenceof nucleotide triplets in E.coli ribosome binding sites anddeduced a 'consensus' sequence that is optimal for thebinding of ribosomes to mRNA in this system. This sequenceincluded 25 nucleotides upstream of the initiating codon andran some 20 nucleotides downstream, into the coding regionitself. Gold and his colleagues (Gold et al., 1981; Stormoet al., 1982a) used a statistical analysis to obtain a measureof the significance of any one nucleotide occupying a positionfrom -25 to + 18, relative to the initiation codon (these

3957

G.B.Petersen, P.A.Stockwell and D.F.Hill

workers called the first nucleotide of this codon position 0).They compared a series of known 'gene starts' from E. coli,coliphages and Salmonella typhimurium with a similar seriesof 'false' starts, constructed by selecting ATG or GTGcodons known to be located within genes but fortuitouslypreceded by a suitably spaced nucleotide sequence of theSD type. Their analysis revealed several regions-three(including the SD sequence) lying upstream from theinitiation codon and two lying downstream-in which thenucleotide sequence of the known gene starts differedsignificantly from those of the control selection of falsesequences. One of the downstream sequences was centredaround nucleotides 3-6 of the coding sequence, the secondat nucleotides 10-13. These data were used to develop a'perceptron' algorithm for the identification of likely genestarts in an unknown DNA sequence (Stormo et al., 1982b).There are two ways by which a sequence of nucleotides

might be 'recognized' by a ribosome in setting up themRNA -30S subunit-fmet tRNA initiation complex: byprotein-RNA interaction or by RNA-RNA interaction.Although the first of these is likely to be an importantmechanism in the overall process, we have in this studyconcentrated on the possibility that RNA-RNA interactionmight also be involved in the recognition of some, at least,of the downstream sequences and have used this as a workinghypothesis. If this hypothesis is correct, then there are onlytwo RNA species-fmet tRNA and 16S rRNA-that can beconsidered as candidates for this interaction. Clear precedentfor the involvement of the 16S rRNA is already providedby the Shine- Dalgarno hypothesis (Shine and Dalgarno,1974, 1975) and we have therefore looked in detail at thepossibility that the 16S rRNA is involved in a secondinteraction with nucleotides of the mRNA sequence that liedownstream from the initiating codon.

Results and discussionPreliminary studies showed that an unexpectedly largenumber of nucleotide sequences lying in positions +3 to + 18of E. coli genes showed a direct complementarity to five ormore consecutive nucleotides from some part of the 16SrRNA sequence. Four regions, comprising nucleotides1-18, 49-77, 79-99 and 105-132 of the 16S RNA, stoodout as candidates for investigation. Closer examination ofshort lists composed of gene starts known to be the firsttranslated genes after a promoter (and therefore presumedto be efficiently used ribosome binding sites) focused ourattention on nucleotides 1-18 (i.e. the extreme 5' terminus)of the 16S RNA. On the basis of the examination of a fileof 251 gene starts we now propose that, in addition to theupstream SD sequence (complementary to the 3' terminusof the 16S RNA), E. coli genes usually contain a downstreamsequence, lying in the region containing nucleotides +4 to+21, that is complementary to three or more consecutivenucleotides of the first 16 nucleotides from the 5' terminusof the 16S rRNA. Stated more precisely: most E. coli genestarts contain at least three consecutive nucleotides fromthe string TCAAACTCTTCAATTT within the first 21nucleotides of the coding sequence immediately followingthe initiation codon. A list of the contents of our database,arranged to emphasize these observations, is given inAppendix 1 and some representative examples of theevidence supporting this proposal are given in Tables I and

II. Table I lists 10 examples of E. coli gene starts selectedfrom list (a) of Appendix 1 that show homology of four ormore consecutive nucleotides to this complementarysequence. The SD sequence and the new, downstream,sequence are shown in upper case. To make it easier to seethe limits to the downstream sequences, the file has beenarranged in increasing order of spacing from the initiatingcodon. Nucleotides that can extend the SD and downstreamsequences if G:U base pairing is allowed are underlined.Table II lists a further 10 gene starts from the 79 of list (b)in Appendix 1 that show complementarity to only threeconsecutive nucleotides of the 16S RNA sequence. Manyof the entries in list (b) of Appendix 1 have more than onesuch triplet and in the examples given in Table II only thefirst triplet occurring from nucleotide +4 onwards is marked.Again, many of the sequences in this file can be extendedby invoking G:U base pairing and the additional nucleotidesthat will then take part in the overall interaction have beenunderlined. The four gene starts in our database that do notsatisfy the criteria of either Table I or Table II are listedin part (c) of Appendix 1.

The boundaries of the downstream sequenceThe formation of an initiation complex requires interactionbetween mRNA, fmet tRNA and 16S RNA. In general, thenucleotides involved in the SD interaction are separated fromthe initiation codon by at least five nucleotides, a spacingthat is, perhaps, dictated by steric considerations and the needto provide 'room' for the fmet tRNA-initiation codoninteraction. Instinctively, it might be thought that adownstream interaction with the 16S RNA would involvea similar spacing from the initiation codon. The data ofTable I suggest that this is not necessarily the case. It is notpossible to be definite about this since in a number of casesin Appendix 1 where a sequence of at least four or fivecomplementary nucleotides starts immediately after theinitiation codon another sequence of at least four or fiveconsecutive nucleotides can be found further downstream.At this stage, however, there would seem to be no reasonto exclude the early nucleotides in the gene from participatingin the interaction and some of the examples in Tables I andII have been selected to display this. The question of howfar the downstream sequence extends into the codingsequence must also be addressed. For all of the sequenceslisted in Appendix l(b), the match of three nucleotides liescompletely within the range +4 to + 18. Gene hisreg (seeTable I) has a match of eight consecutive nucleotidescomprising nucleotides +11 to + 18. Similarly, gene rplJhas a match of seven consecutive nucleotides terminatingat the same position. Although in this case there are severalpossible triplets lying upstream, the interaction of these willbe energetically much less favourable for helix formationand we would argue that the 7-nt interaction will be the onethat is actually used. The sequence for gene dnaB, however,provides support for extending the likely region furtherinto the coding sequence since a much more favourableinteraction can be found with the sequence CTTCAA(AGO = -6.4 kcal/mol) lying further downstream thanwith the sequence AAAC (AG37 = -2.6 kcal/mol) that wehave highlighted in Table I. The last sequence in Table Iextends to nucleotide +21. Although triplet interactionsfurther upstream could be formed by this sequence, thepentanucleotide interaction that we have highlighted is

3958

Gene recognition in E.coli

Table I. Examples of gene starts from E. coli that obey the new rule and have four or more downstream nucleotides complementary to some part ofnucleotides 1-16 of the 16S rRNA

a a c g a g c a ta a a a t c a g ga g a t t g c t aa a g c a a c a at g a a t a a a ct g g c a a a c ac t t t a t c t ct a a ag t c c tt a c t g a a c gagc aa ac a t

a a a c AGGA t c g c c a t cc a c AGG c a g a a c a a c at t t t t t t GGAG t c a t aa t t t c t GAG a c t t g t aa t t c a c a GAG a c t t t tt c c AGGAG c a a a g c t aGGT a a c t c c a t t c a c tc g c g t a c g AAG t g c g ta gAAGG c g g g t g c g t aa a gAAGGg g t g t t t t t

atg CAAA a a g a c g c g c t g a a t a a c g t a catg a TCAAg g c g a c g g a c a g a a a a c t g gatg g a t T C T T g t c a t a a a a t t g a t t a t gatg a a c a1AACTg a c g a a c t c c g t a c t gatg acacgcgTTCAATTTaaacaccaccatg gct t taaaTCTTCAAgacaaacaagatg g c a g g a a a t A A A C c c t t c a a c a a a catg t tgatgaccgaCAAACTgcaactggatg a c c g a t a a a a t c c g t A C T C T g c a a gatg t c a t c c g a tat t a a g aTCAAAg t g c

The SD sequences and the downstream sequences are shown in upper case. Nucleotides that extend the SD and downstream sequences if G:U basepairing is allowed are underlined. The gene name used in the EMBL database is given in the right hand column.

Table H. Examples of gene starts from E. coli that obey the new rule but have only three downstream nucleotides complementary to some part ofnucleotides 1-16 of 16S rRNA

g c t a t c c tg c c t a a a at t g t t a g cga c t t gc ag a c a c a t tt t t g c g g tg a g g c g t tc a c a t a g ct t a c t ga ta c a t a t t a

t a a c c AGGg a g c tg a t a a a c GAGG a at g a g t c AGGAGa ta t a t AGGA t a a c gt t AAGGg g a t t t tc t g g t g t GAGGT ta g cc a cAGGAGGgc a g t a GAG t c a g ga t g a a a a GAG t t ta a t a g t AGGAG t g

g a t ta c a a

a a t cc g c at a c ca t c ta c t ga a c ac a t a

atg AAA a a a g c catg CTCgtac aatg t t AAAgcg tatg g c a CAA_gt catg c g t a TCA t tatg a g t g g A T T aatg t c c g g gTTTatg a a g a c g t t aatg c a g c a g t t agtg g c c c g t a ta

a c a t g c t t a a c t g a c gac a c c c a t cgc a c g c tg a a a t g a a c a t t g c c ga t t a a t ac c a a c agc cc t g c t t g g c g c t c c g gcg t c c ggc a t t a t c a at a t c a t a a g c a t t t c cTCT c c c g c t g t g a t t ac a gAAC a t t a t t g a a ag c a g g c A T T a a c a t t c

The SD sequences and the downstream sequences are shown in upper case. Nucleotides that extend the SD and downstream sequences if G:U basepairing is allowed are underlined. The gene name used in the EMBL database is given in the right hand column.

energetically much more favourable and we thereforepropose the limits +4 to +21 for the downstreaminteraction. This range includes the nucleotides found byStormo et al. (1982a) to be significant when a group of genestarts (largely differing from those in our file) was studiedusing the x2 test. Scherer et al. (1980) studied a file of 68gene starts that, in common with the file used by Stormoet al. (1982a), and unlike ours, contained a large numberof coliphage genes as well as sequences from E. coli genes.

They deduced a downstream consensus sequence that appearsto be preferred in this system. This sequence:

AUGAAAAAAAUUAAAAAACUCAACUC G

contains many elements that are complementary to the5'-terminal sequence of E. coli 16S rRNA and an examinationof the tables of gene starts on which their consensus is basedstrengthens our proposal that this preference for certainnucleotides reflects a requirement for a limited complemen-tarity with the 5'-terminal sequence of the 16S RNA.

The boundaries of the 16S rRNA sequenceThe 16-nt sequence from the 5' end of the 16S RNA thatwe propose to be involved in the recognition of thedownstream genetic sequence is longer than the 3' sequenceinvolved in the SD interaction. While the advantage of thegreater flexibility that this longer sequence introducesthrough allowing a larger number of amino acid codingpossibilities is readily appreciated, the tetramer -TCAA-

appears twice in the sequence and an obvious question toask is whether the putative binding sequence could beshortened (and the case for it perhaps strengthened) bychoosing a more limited region of the 16S RNA sequence.An examination of the contents of our database and of theconsensus sequence of Scherer et al. (1980) emphasizes thefrequency with which runs of consecutive A residues appearin E. coli gene starts and it would seem likely that, if a

mechanism of the sort we propose operates, it should beimportant that the isolated sequence -AAA- should be capableof being recognized. This could, of course, be achieved bya sequence terminating at nucleotide 14 of the 16S RNA.In 40 of the entries of Appendix 1(a), the -AAA- sequenceis extended further at least to -AAAC-, with a consequentsignificant increase in the overall negative free energy changeon formation of the helical interaction (Freier et al., 1986).For 32 other sequences, however, the additional C residueis at the 5' end of the AAA sequence. While the increasein stability of interaction will be fractionally smaller it is stillsignificant and there seems to be no reason to exclude thispossibility at this stage. The extension of the sequence toinclude the T residue that is complementary to the A at

position 16 of the 16S RNA is justified at this stage by theobservation that the stabilities of interaction of eight of the

entries of Appendix 1(a) involving the sequence CAAA are

significantly increased by the inclusion of this residue in theoverall interaction, despite the consequent duplication of theTCAA tetramer. (A comparable advantage of the duplicationof the -AGG- triplet in the SD nucleotide should be noted.)The single exception in the E. coli/coliphage system to

3959

aroFftsAhlyBaroHhisregrpUdnaBenvZrpsQmtlA

adaef-gglyAhagadkkdpCarglpabBdapDS13

G.B.Petersen, P.A.Stockwell and D.F.Hill

the requirement for an SD sequence is that of gene CI ofbacteriophage X. This gene can be transcribed from eitherof two promoters, depending upon the physiologicalconditions prevailing. When transcription is initiated fromthe proximal promoter the transcribed mRNA, which istranslated in the infected cell, has the A of the ATG initiationcodon as its 5' terminus. This mRNA thus lacks an SDsequence (Walz et al., 1976). The first seven codons of thisgene (ATGAGCACAAAAAAGAAACCA-) include both-CAAA- and -AAAC- within the sequence range that wepropose to be significant. Interestingly, although both of thesesequences are absent from the corresponding sequence(ATGAGTATTTCTTCCAGGGTA-) from the closelyrelated bacteriophage 434 (Kuziel and Tucker, 1987), thedownstream sequence from this phage gene includes twoother sequences, -ATTT- and -TCTTC-, that are com-plementary to that part of the 5' region of the 16S RNA thatwe propose to be involved in this initiation interaction.

In an early paper, van Knippenberg (1975) noted somestriking features of the ribosome binding sites of the Aprotein and coat protein genes of the RNA coliphages R17and Q,B. He pointed out that these sequences had extensiveregions both of direct homology and complementarity to the5'-terminal sequence of E. coli 16S rRNA and proposedmechanisms by which these might be involved in trans-lational initiation of the messages. The possible mechanismsthat he proposed involved interactions with nucleotides lyingon both sides of the initiation codon and include nucleotidesthat are believed to take part in the SD interaction. Suchextensive interaction would not appear to be possible withE. coli genes in general, but the downstream interactions thathe envisaged as taking part in the interaction with the5'-terminal sequence of the 16S RNA are identical to thosethat we would now propose to have more universal im-portance.

Statistical considerationsThe question whether the complementarity that we observebetween E. coli gene starts and the 5' end of 16S rRNA isthe result of chance can be addressed in several ways. Thereare 44 tetramers that can be constructed from the fournucleotides A, G, C and T. The entries of Table I, however,contain only the 12 tetramers found in the sequenceTCAAACTCTTCAATTT (remembering that the sequence-TCAA- appears twice). If, as we propose, the sequence withwhich the 16S RNA can interact involves the 21 nucleotideswithin the range +4 to +24 of the gene, then there are 18possible nucleotides in each gene start at which a tetramercan be initiated. The probability of one of the 12 'allowed'tetramers occurring in such a sequence at random is thus12/(18 X 44) = 1:384. Similarly, the probability ofthe random occurrence of five consecutive nucleotidescomplementar to this part of the 5' end of the 16S RNAis 12/(17 x 4) 1:1450. Of the 251 entries in our file,168 (66.9% of the total file) contain a sequence of at leastfour consecutive nucleotides and 47 of those 168 (18.7%of the total file) have a sequence of five or more consecutivenucleotides that is complementary to the 5'-terminal sequenceof E.coli 16S RNA. The calculations of probability ofoccurrence assume that the four nucleotides are randomlydistributed in E. coli gene starts and ignores the fact that,for example, the sequences immediately following theinitiation codon tend to be low in G residues (Stormo et al.,

1982a). Although it does not completely overcome thisproblem, another approach is to consider the distribution oftetramers in a selection of 'false' gene starts of the type usedby Stormo et al. (1982a) in their statistical studies. We haveanalysed a file of 'false' gene starts, selected from some ofthe longer sequence entries in the EMBL database on thebasis of the occurrence of a possible SD sequence followedby a suitably spaced ATG codon. Of the 117 entries in thefile, 11 (9.4% of the file) have a match of five or moreconsecutive nucleotides; 46 (39.3%) have a match of fouror more consecutive nucleotides; 35 (47.9%) have a matchof no more than three, and 14 (18.8%) have no match ofat least three nucleotides with the corresponding 16S RNAsequence.These data were used to calculate x2 values to test the

hypothesis that the occurrence downstream of sequences ofconsecutive nucleotides complementary to the 5' terminusof the 16S rRNA is significant. The x2 values testing thehypothesis that the occurrence of three such consecutivenucleotides is significant (X2 = 35.3) and the more refinedhypothesis that a sequence of four such nucleotides issignificant (X2 = 25.0) are both significant at the 99.9%level. The facts that not all of the gene starts in our file obeythe new rule and that sequences that obey both the SDhypothesis and the new rule but are not gene starts can befound make it clear that other determinants, as yet unknown,are involved in the setting up of the initiation complex. Wehave, of course, taken no account of the role of secondarystructure, nor have we any clear conception at this stage ofthe importance of our proposed interaction in determiningthe 'strength' of ribosome binding or the efficiency ofinitiation.

It can be argued that interactions of this kind shouldinvolve associations that are easily made but easily brokenand that a weak, but specific, interaction may be more likelyto lead to enhanced translational efficiency than a strongerinteraction. Munson et al. (1984) studied the effects onexpression induced by 16 separate point mutations near thebeginning of the lacZ gene of E. coli and Looman et al.(1987) have extended these observations by studying theeffect on synthesis of the protein product of altering the threenucleotides that form the first codon following the initiatingATG codon. This gene (which we did not include in ourfile because the upstream sequence was not given in theversion of the EMBL database from which we constructedour data set) has two possible ATG initiation codons,separated by one triplet. The sequence is given by Munsonet al. (1984) as: TAACAATTTCACACAGGAAACAGC-TATGACCATGATTACGGATTCACTGGTCG (the twoATG codons are underlined). Although the spacing betweenthe second ATG and the SD sequence (13 nt) is towards theupper limit that is usually observed, - 20% of the proteinmolecules synthesized in vivo are initiated at the second ofthe two ATG codons (Munson et al., 1984). This gene obeysour rule, since the tetramer TTCA is found within theproposed range of both of the two initiation codons. It isof particular interest to note that, in each case (CAA, TCA,TTC) where the new second codon introduced a four-basesequence complementary to the 5'-terminal sequence of 16SRNA immediately after the first ATG initiation codon, theexpression of the gene was drastically reduced (Looman etal., 1987). Interpretation of these results in the light of ourhypothesis is complicated by the fact that secondary

3960

Gene recognition in E.coli

structure involving both initiation codons is believed to playan important role in the regulation of the translationalinitiation of this gene (Munson et al., 1984) and that theeffect of these mutations on this secondary structure maybe more important than the introduction of a newdownstream interaction of the type that we propose. Equally,however, these results might be taken to indicate that a strongdownstream interaction with the 16S RNA that is close tothe ATG initiation codon has the effect of reducing trans-lational efficiency.The effectiveness of this type of theoretical study depends

heavily upon the accuracy with which the gene starts thatare used in constructing the database have been identifiedby the various authors in the first place. In many cases theinterpretation of the nucleotide sequences cited in our tableswas supported by direct determination of the primarystructure of at least the N terminus of the correspondingprotein product, but in a large number of cases theassignment of the initiation codon depended solely upon theapplication purely of rules based on the SD hypothesis,sometimes with additional support from measurements ofamino acid composition and/or the mol. wt of the proteinproduct. It is thus likely that some of the entries in ourdatabase are themselves 'false' but it is most unlikely thatthe number of these will be so high as to affect thesignificance of the effect that we observe. The issue is furtherclouded by the knowledge that initiation at internal ATGcodons can occur in vivo (see Steitz, 1979, for a detaileddiscussion). It is therefore likely that some of the 'false' genestarts that seem to obey our rule are, in fact, capable ofparticipating in translational initiation.The immunochemical studies of Mochalova et al. (1982)

and, more recently, the cross-linking studies of Brimacombeet al. (1988) have mapped the 5' and 3' termini of the 16SrRNA to opposite faces of the 30S ribosomal particle,separated by a distance of - 130 A. An interaction of thesort that we propose would therefore require the mRNA tobe wrapped around the ribosome and the question ariseswhether the initial encounter between the mRNA and the16S RNA is at the 3' or the 5' end of the latter. The SDhypothesis assumes that the initiation complex involvesrecognition of the mRNA in the 5' to 3' direction, but therewould seem to be no reason to exclude the possibility of thefirst interaction being with the downstream sequence, withformation of the complex being completed by recognitionof the SD sequence and relaxation of the downstreaminteraction. This proposal gains some plausibility when itis noted that a number of the gene starts in our file (Appendix1) have ATG or GTG triplets between the SD sequence andthe true initiation codon, while a significant number havesequences resembling our downstream sequence lying 5' tothe SD sequence.Our hypothesis that the 5' end of the 16S rRNA might

interact with the mRNA during the formation of the initialtranslation complex is, of course, based solely upon analysesof published sequence data. We hope, however, that ourpresentation of it at this stage as a theoretical possibility willstimulate experimental investigation since, if the hypothesisis correct, it will be important in taking us one stage closerto a complete understanding of the multiple interactions thatthis process of translational initiation involves, as well asproviding additional criteria for the interpretation of newsequence data. Our hypothesis could be tested by a systematicstudy of the effects of modifying the nucleotide sequence

in the first few codons of a suitable mRNA but theinterpretation of such experiments would be complicated bythe uncertainties introduced by possible changes to thesecondary structure of the mRNA. Perhaps more rewardingwould be to use the approach that has been used sosuccessfully to obtain supporting evidence for the SDsequence (Hui and de Boer, 1987; Jacob et al., 1987) bydetermining the effect of modifying the 5' terminus of the16S rRNA on the efficiency of translation of genes in a modelsystem.Eukaryotic mRNAs do not seem not to have an SD se-

quence associated with translational starts and Both (1979)has suggested the possibility of base pairing of eukaryoticmRNA with a conserved, internal sequence of the 18SrRNA. He did not, however, limit his proposal solelyto downstream sequences and we are not aware of anyexperimental evidence that has been adduced to support hisproposal. It would be of interest to re-examine the evidencefor this sequence, given the very large number of eukaryoticgene sequences now available.The SD sequence of the 16S rRNA of E. coli is very

strongly conserved amongst different bacterial species (Damset al., 1988). The sequence at the 5' terminus that we areproposing to be involved in the recognition of downstreamnucleotide sequences is strongly conserved for part of itslength, but there is some variation in the last six nucleotidesor so of the sequence. This variability involves mainly thegene sequences for which the downstream 'recognition'sequence includes the nucleotides -AATTT. We are not, ofcourse, able at this stage to decide whether these nucleotidesshould properly be considered part of the downstreamsequence that we propose to be important. We note that,in most cases, a triplet or a tetramer that will base pair withthe conserved nucleotides can be found elsewhere withinthese gene starts, but the possibility cannot be excluded thatthe use of these poorly conserved nucleotides might representa species-specific feature of some gene starts.

Materials and methodsWe have followed the route taken by others by compiling lists of E.coli'gene starts' from the literature and using these as a basis for study. Wehave confined our attention to those nucleotides that are believed to becovered by the ribosome during the formation of the initiation complex andshown by the statistical studies of Stormo et al. (1982a) to be significant.Nucleotides +4 to +28 (we number the first A or G of the initiation codon+ 1) of each entry were scanned for direct homology of pre-determinedlengths with the complement of the Ecoli 16S rRNA sequence (Brosiuset al., 1978), converted to a DNA sequence by the substitution of T forU. The possibility of G:U base pairing was not considered in this first stageof selection. Matches were scored against the 16S RNA sequence and thoseregions of the 16S RNA that showed high scores were then reinvestigatedin greater detail. Approximate free-energy changes for helix formation werecalculated when required using the parameters determined by Freier et al.(1986).

AcknowleduementsSome of the early work of this study was performed while G.B.P. was onstudy leave in the MRC Laboratory of Molecular Biology, Cambridge, UK.The manuscript was completed while he was on study leave in the Sir WilliamDunn School of Pathology, University of Oxford. He is grateful to hiscolleagues in those laboratories, especially to Fred Sanger, Rodger Stadenand George Brownlee, for their helpful discussion and encouragement. Thehelp of Rodger Staden with computing in the early stages of the work wasparticularly valuable. We thank Derek Holton for advice on the probabilitycalculations. This research was supported through a Programme Grant fromthe Medical Research Council of New Zealand and through grants for

3961

G.B.Petersen, P.A.Stockwell and D.F.Hill

computer equipment from the Medical Research Council of New Zealand,the New Zealand Lottery Board and the New Zealand University GrantsCommittee.

ReferencesBoth,G.W. (1979) FEBS Lett., 101, 220-224.Brimacombe,R., Atmadja,J., Stiege,W. and Schuler,D. (1988) J. Mol. Biol.,

199, 115-136.,Brosius,J., Palmer,M.L., Poindexter,J.K. and Noller,H.F. (1978) Proc.

Natl. Acad. Sci. USA, 75, 4801-4805.Dams,E., Hendriks,L., Van de Peer,Y., Neefs,J.-M., Smits,G.,

Vandenbempt,I. and De Wachter,R. (1988) Nucleic Acids Res., 16(Suppl.), r87-r173.

Freier,S.M., Kierzek,R., Jaeger,J.A., Sugimoto,N., Caruthers,M.H.,Neilson,T. and Turner,D.H. (1986) Proc. Natl. Acad. Sci. USA, 83,9373-9377.

Gold,L., Pribnow,D., Schneider,T., Shinedling,S., Singer,B.S. andStormo,G. (1981) Annu. Rev. Microbiol., 35, 365-403.

Hui,A. and de Boer,H.A. (1987) Proc. Natl. Acad. Sci. USA, 84,4762-4766.

Jacob,W.F., Santer,M. and Dahlberg,A.E. (1987) Proc. Natl. Acad. Sci.USA, 84, 4757-4761.

Kuziel,W.A. and Tucker,P.W. (1987) Nucleic Acids Res., 15, 3181.Looman,A.C., Bodlaender,J., Comstock,L.J., Eaton,D., Jhurani,P., de

Boer,H.A. and van Knippenberg,P.H. (1987) EMBO J., 6,2489-2492.Mochalova,L.V., Shatsky,I.N., Bogdanov,A.A. and Vasiliev,V.D. (1982)

J. Mol. Biol., 159, 637-650.Munson,L.M., Stormo,G., Neice,G.D. and Reznikoff,W.S. (1984) J. MoI.

Biol., 177, 663-683.Sanger,F., Coulson,A.R., Hong,G.F., Hill,D.F. and Petersen,G.B. (1982)

J. Mol. Biol., 162, 729-773.Scherer,G.E., Walkinshaw,M.D., Arnott,S. and Morre,D.J. (1980) Nucleic

Acids Res., 8, 3895-3907.Shine,J. and Dalgarno,L. (1974) Proc. Natl. Acad. Sci. USA, 71,

1342-1346.Shine,J. and Dalgarno,L. (1975) Nature, 254, 34-38.Staden,R. (1985) In Setlow,J.K. and Hollaender,A. (eds.), Genetic

Engineering: Principles and Methods. Plenum Press, New York. Vol.7, pp. 67-114.

Steitz,J.. (1979) In Goldberger,R.F. (ed.), Biological Regulation andDevelopment. Plenum Press, New York, pp. 349-399.

Stormo,G.D., Schneider,T.D. and Gold,L.M. (1982a) Nucleic Acids Res.,10, 2971-2996.

Storrno,G.D., Schneider,T.D., Gold,L. and Ehrenfeucht,A. (1982b) NucleicAcids Res., 10, 2997-3011.

van Knippenberg,P.H. (1975) Nucleic Acids Res., 2, 79-85.Walz,A., Pirrotta,V. and Ineichen,K. (1976) Nature, 262, 665-669.

Received on June 20, 1988; revised on August 15, 1988

Appendix 1

Contents of the database analysed in this study. The entries are arrangedin increasing order of spacing from the ATG or GTG initiation codon asis illustrated in Tables I and II. For each entry the name used in the EMBLdatabase is given first, followed by the EMBL database identifier (ID).

(a) Gene starts from E. coli that obey the new rule and have four or moreconsecutive downstream nucleotides complementary to some part ofnucleotides 1-16 of 16S rRNA:aroF ECTYRA; aroG ECAROG; aspA ECASPA; deoB ECDEOAB; dhfrECDHFROI; dld ECDLDH; fumA ECFUMA; glysA ECGLYS; guaBECGUAB; ilvN ECILVBN; lacd ECLACI; nusB ECNUSB1; phoAECPHOA; rpmH ECRPMH; thyA ECTHYA; trpC, trpE ECTRPX; carBECCARB; dnaN ECDNAAN; envA ECFTSQAB; ftsA ECFTSQA; polAECPOLA; pyrE ECDUTPYR; rplM ECRPSI; rplV ECRPOS1P; rpmDECSPC; rpsO ECRPSO; sdhA ECSDHACD; SI I ECRPA; tyrB ECTYRB;uncA, uncB ECUNC; uncC ECUNC; asnA ECORIASN; deoR ECDEOR;dsdA ECDSDA; hlyD ECHLY; malG DECMALG; rplD ECRPOSIO;ecoRV ECECORV; gshII ECGSHII; fimA ECFIMAO1; metG ECMETG;nusA ECNUSA; pepN ECPEPN5; rpsB ECRPSB; rpsP ECTRMD; sdhBECSDHB; uncE, uncF, uncI ECUNC; Ispa ECLSP; tnaA ECTNAA; gyrBECGYRB; hlyB ECHLY; metK ECMETK; pldA ECPLDA1; prlA ECSPC;mh ECRNHX; rplA ECROPBC; rplE ECSPC; tsr ECTSRX; uvrBECUVRB; argF ECARGF; hlyA ECHLY; lacY ECLACY; motA

ECMOTAB; narG ECNARPR; rfi ECRF1X; rpmC ECRPOSIO; rpoBECRPOJ; rpoC ECRPOBC; sulA ECSULA; gap ECGAP; aac ECAAC3IV;aroHECAROH; gidlB ECUNC; rj2 ECRF2X; rpsUECRPSU; tsfECRPSB;hlyC ECHLYC; lysC ECLYSC; motB ECMOTAB; argE ECARGOPI;trg ECG; cheZ ECCHEY; dacA ECDACA; kdpB ECKDPABC; metBECMETLB1; ompR ECOMPB; ppcp ECPPCP; proA ECPROAB; rpsNECSPC; rpsJ ECRPOS1O; uvrD ECUVRD; rpsA ECRPSA; lamBECLAMBA; melB ECMELB; npl ECNPL; glysB ECGLYS; uncGECUNC; xylA ECXYLA; rpsD ECRPA; rpsS ECRPOS1O; gltA ECGLTA;melA ECMELOP; rpIP ECRPOS 10; tyrA ECTYRA; ftsZ ECFTSQA; metFECMETF; araB ECARABM; araE ECARAE; dapB ECDAPB; phoUECPHOWTU; tonB ECTONB; hisreg ECIHIS1; crp ECCRP; eltAECELTA; fur ECFUR; ompF ECOMPF; pheA ECTYRA; pyrD ECPYRD;rpsI ECRPSI; rpU ECRPOBC; toxA ECTOXA; araC ECARAC; hisGECHISI; malP ECMALP1; malT ECMALX; pldB ECPLDB; dnaBECDNAB; lpp ECLPPX; phoE ECPHOE; aceFECACEX; aph4 ECAPH4;pstB ECPHOWTU; cheYECCHEY; mc ECRNC1; recA ECRECA; hisBECHISCBH; cdh ECCDH; trmD ECTRMD; envZ ECOMPB; aceEECACEX; galK ECGALK; kdpA ECKDPABC; gdhA ECGDHA; pbpBECPBPB; trpA ECTRPX; livK ECLIVK; dye ECDYE; fnr ECFNR. ssbECSSB; nrdB ECNRDA; plsB ECPLSB; rplL ECRPOBC; tap ECTARX;leu4 ECLEUA; mailF ECMALF; pabA ECPABA; sdhC ECSDHACD; pstAECPHOWTU; rplB , rpsQ ECRPOS1O; ilvH ECILVIH; mtlA ECMTLA;rplS ECTRMD; glgA ECGLGC.

(b) Gene starts from E. coli that obey the new rule but have only threeconsecutive downstream nucleotides complementary to some part ofnucleotides 1-16 of E.coli 16S rRNA:ada ECADA; asd ECASDX; aspC ECASPC; deoC ECDEOCA1; dnaAECDNAAN; dut ECDUT; ecoRVmet ECECORV; gidA ECUNC; ks71AECKS71AP; lexA ECLEXA; mglB ECMGLB; molA ECLAMBA; nrdAECNRDA; ompA ECOMPA; ompC ECOMPC; pikA ECPFKA; phosECPHOS; phr ECPHRORF; pin ECPIN; rplC ECRPOS10; rplF ECSPC;rplW ECRPOSIO; sbp ECPFKA; tar ECTARX; usg ECHISTI; ef-gECSTR2;fol ECFOLX;fus ECFUSG; glnL ECGLNAL; ilvB ECILVBN;proC ECOC; spc ECSPCX; trpB ECTRPX; glyA ECGLYA; gnd ECGND;rpsC ECRPOS10; argC ECARGC; dam ECDAMX; hag ECHAGFLG;lep ECLEP; metA ECMFTA; pyrB ECPYRBIA; rpln ECSPC; serBECSERB; uncD ECUNC; rpmG ECRPMG; sucA ECSUCA; recFECRECF; adk ECADK; gpt ECGPT1; ileS ECRPST; kdpC ECKDPABC;rpoA ECRPA; sdhD ECSDHACD; argI ECARGI; aroB ECAROB; birAECBIRA; purF ECPURF; relB ECRELB; rplK ECRPOBC; rplX ECSPC;trpD ECTRPX; ams ECAMS; glnA ECGLNA; p.kB ECPFKB; rpmBECRPMB; tpi ECTPI; dnaG ECDNAG; galR ECGALR; mauKECMALK;hisT ECHISI; ilvI ECILVIH; ilvE ECILVE; pabB ECPABB; dapDECDAPD; sucB ECSUCA; uvrA ECUVRA; cds ECCDS; S13 ECRPA.

(c) Gene starts from E. coli that have fewer than three consecutive downstreamnucleotides complementary to nucleotides 1- 16 of E.coli 16S RNA:glnS ECGLNS; proB ECPROAB; rplQ ECRPOA; uvrC ECUVRC1.

A full listing of this database in the form of Tables I and II is availableon application to the authors.

3962