Missing HLA class I expression on Daudi cells unveils cytotoxicand proliferative responses of human cd T lymphocytes

Simon Rothenfusser,a Armin Buchwald,b Sylvia Kock,b Soldano Ferrone,c

and Paul Fischb,*

a Division of Clinical Pharmacology, Department of Medicine, University of Munich, Germanyb Section of Molecular Pathology, Department of Pathology, University of Freiburg, Albertstr. 19, Freiburg 79104, Germany

c Department of Immunology, Roswell Park Cancer Institute, Buffalo, NY 14263, USA

Received 10 October 2001; accepted 20 February 2002

Abstract

The major subset of human blood cd T lymphocytes expresses the variable-region genes Vc9 and Vd2. These cells recognize non-peptidic phosphoantigens that are present in some microbial extracts, as well as the b2-microglobulin-deficient Burkitt’s lymphomaDaudi. Most cytotoxic human Vc9=Vd2 T cells express inhibitory natural killer cell receptors for HLA class I that downmodulate

the responses of the cd T lymphocytes against HLA class I expressing cells. In this study we show that transfection of the human b2-microglobulin cDNA into Daudi cells markedly inhibits the cytotoxic and proliferative responses of human Vc9=Vd2 T cells. Thisprovides direct evidence that the ‘‘innate’’ specificity of human Vc9=Vd2 T-lymphocytes for Daudi cells is uncovered by the loss ofb2m by Daudi. However, Daudi cells that express HLA class I in association with mouse b2m at the cell surface are recognized by

human Vc9=Vd2 T cells close to the same degree as the parental HLA class I deficient Daudi cell line. Thus, proper conformation ofthe HLA class I molecules is required for binding to natural killer cell receptors. Cloning of the HLA class I A, B, and C molecules

of Daudi cells and transfer of the individual HLA class I molecules of Daudi cells into the HLA class I deficient recipient cell lines

.221 and C1R demonstrate that for some human cd T-cell clones cytolysis can be entirely inhibited by single HLA class I alleles

while for other clones single HLA class I alleles only partially inhibit cytotoxicity. Thus, most human Vc9=Vd2 T cells represent apopulation of killer cells that evolved like NK cells to destroy target cells that have lost expression of individual HLA class I

molecules but with a specificity that is determined by the Vc9=Vd2 TCR. � 2002 Elsevier Science (USA). All rights reserved.

Keywords: cd T cell; Vc9=Vd2 T cell; Killer cell inhibitory receptors; INMR; Daudi; MHC class I; HLA class I

1. Introduction

cd T lymphocytes typically represent less than 5% oflymphocytes in human blood [1,2] and, in contrast toconventional ab T cells, cd T cells express a limitedrepertoire of TCR V-region genes. The majority of cd Tcells in human peripheral blood (up to 90%) express adisulfide-linked TCR encoded by the V-genes Vc9 andVd2. Vc9=Vd2 T lymphocytes are barely detectable inumbilical cord blood but they markedly expand in thefirst decade of life [2]. In adults they have a phenotype ofCD4 and CD8 double negative memory cells (for re-views see [3,4]). An intriguing feature of Vc9=Vd2 T cells

is their ability to respond in an HLA-unrestrictedmanner to a group of non-processed, non-peptidicphosphoantigens, first isolated from bacterial extracts[5–7]. Vc9=Vd2 T cells also show potent cytotoxic ac-tivity against virus-infected target cells [8,9]. In addition,Vc9=Vd2 T lymphocytes display a peculiar ‘‘innate’’specificity for the human Burkitt’s lymphoma cell lineDaudi [10,11]. Although Vc9=Vd2 T lymphocytes iso-lated from peripheral blood have never been directlyexposed to Daudi cells, they proliferate to Daudi in vi-tro, similarly as they do in response to bacterialphosphoantigens [11,12]. In addition Vc9=Vd2 T-cellclones that have been derived independently of Daudishow strong cytotoxic and proliferative responses toDaudi cells as if they had been previously primed toDaudi [10,11].

Cellular Immunology 215 (2002) 32–44

www.academicpress.com

*Corresponding author. Fax: +49-761-203-6790.

E-mail address: fisch@mm11.ukl.uni-freiburg.de (P. Fisch).

0008-8749/02/$ - see front matter � 2002 Elsevier Science (USA). All rights reserved.

PII: S0008 -8749 (02 )00001-1

TCR transfer experiments demonstrated that recog-nition of non-peptidic antigens and Daudi cells dependson expression of the Vc9=Vd2 TCR [13]. Nevertheless,cellular target epitopes for the Vc9=Vd2 TCR such asthe putative ligand on Daudi cells remain unidentified.Daudi cells are well known because they do not expressHLA class I molecules at the surface due to deficientb2-microglobulin (b2m) synthesis [14,15]. Althoughtranslation of the HLA class I a-chains in Daudi cells isintact, they are retained in the cytoplasm due to lack ofb2m. It seemed intriguing to ask whether the absence ofHLA class I on Daudi cells directly induced stimulationof human Vc9=Vd2 T cells. However, initial experimentsusing Daudi cells transfected with the mouse b2m(m-b2m)-gene

1 argued against this hypothesis becauseDaudi cells expressing HLA class I associated withm-b2m induced virtually similar cd T-cell responses asthe parental HLA class I negative Daudi cells [10].Nevertheless, the discovery of receptors for HLA class Ion natural killer (NK) cells [16], cd T cells [17], andsome ab T cells [18] that deliver inhibitory signals tokiller cells upon binding to HLA class I molecules pro-vided further interest in this idea. Two groups of MHCclass I binding receptors have been identified belongingeither to the immunoglobulin or to the C-type lectinsuperfamilies and are here collectively referred to asinhibitory MHC class I receptors (INMR). The p58.1,p58.2, p70, and p140 receptors of the immunoglobulinsuperfamily, the killer cell inhibitory receptors (KIRs),recognize different supertypic epitopes of HLA-C, -B,and -A alleles (for review see [16,19]). The inhibitory C-type lectin receptors are heterodimers of CD94 associ-ated with NKG2 (A and B) molecules that bind toHLA-E [20].We performed this study to characterize the effects of

HLA class I expression of target cells on the activationof Vc9=Vd2 T cells expressing different INMR. Trans-fection of Daudi cells with human b2m (h-b2m), thetransfer of the various HLA class I alleles of Daudi cellsinto HLA class I deficient lymphoblastoid B-cell lines(LCL) .221 and C1R, as well as the use of b2m-deficientcell lines from solid tumors provide direct evidence thatmissing expression of HLA class I by Daudi cells in-duces recognition by human Vc9=Vd2 T cells.

2. Material and methods

2.1. Cell lines and culture media

The HLA class I deficient Daudi cell line originatesfrom the Burkitt’s lymphoma of an African patient and

lacks expression of b2m due to deletion of one allele anda point mutation in the translation initiation codon ofthe other allele [14,15]. A HLA class Iþ Daudi-varianthas been derived following transfection of Daudi cellswith the mouse b2m cDNA [21] and is designated hereDaudi/m-b2m. The HLA class I

þ somatic cell hybrid cellline 8A is the product of a fusion of the Daudi and Rajicell lines [22]. Further cell lines used in this study wereBurkitt’s lymphoma Raji and the b2m deficient solidtumor cell lines HCT (originating from a colon carci-noma) and FO-1 (originating from a melanoma), as wellas their HLA class Iþ variants (designated hereHCT=b2m and FO-1=b2m, respectively) derived fol-lowing transfection by the human b2m gene [23,24]. C1Ris an Epstein–Barr virus (EBV)-transformed B-cell linethat has lost most of its HLA class I alleles expressingonly Cw0401 and trace amounts of B3503 [25]. LCL721.221 (designated here .221) is a mutant of LCL 721that has lost expression of all HLA-A, -B, and -C alleles[26]. Both C1R and .221 have been shown to expressintact MHC class I molecules at the surface whentransfected with appropriate expression constructs ofthe HLA class I a-chains.All cell lines were grown in complete culture medium

(RPMI 1640 containing 2 mM L-glutamine, 100 IU/mlpenicillin, 100 lg=ml streptomycin, 25 mM Hepes buf-fer, all from BioWhittaker, Verviers, Belgium), supple-mented with 10% FCS (Hyclone, Logan, UT). For someexperiments the Daudi cell line and the HLA class Iþ

Daudi variants were grown under serum-free conditionsfollowing adaptation to 100% HL-1 medium (Bio-Whittaker). The purified human b2m used in this studywas from Biotrend (Cologne, Germany).

2.2. T-cell clones and NK-cell clones

Cytolytic Vc9=Vd2 T-cell clones and NK-cell cloneswere obtained as previously described [10,27]. Brieflyhuman peripheral blood mononuclear cells (PBMCs)were isolated from peripheral blood of healthy volun-teers by Ficoll-Hypaque density gradient centrifugation(Biochrom, Berlin, Germany) and double-labeled withfluorescent mAb. TCR cdþ and CD3�/CD56þ cells weresorted on a FACStarplus (Becton Dickinson, Heidelberg,Germany). Subsequently the sorted cells were cloned at0.7 cells/well. The phenotype and expression of theVc9=Vd2 TCR were confirmed by flow cytometry foreach clone used in the subsequent experiments. AllT-cell clones and NK clones were grown in completemedium supplemented with 10% heat-inactivated hu-man AB serum (Pel-Freez, Brown Deer, WI), 50–300IU/ml IL2 (Cetus, Emeryville, CA) and 0:25 lg=mlPHA (Murex Diagnostics, Dartford, UK). At 1–2-weekintervals the clones were passaged with feeder cells(3� 104 allogeneic PBMC plus 1:5� 104 721 LCL perwell).

1 Abbreviations used: INMR, inhibitory MHC class I receptor; LCL,

lymphoblastoid B-cell line; h-b2m, human b2m; m-b2m, mouse b2m.

S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44 33

2.3. Antibodies and surface marker analysis

The phenotypes of the T-cell clones, tumor cell lines,and their transfectants were analyzed by standardtechniques of direct and indirect immunofluorescence ona FACScan (BD, Heidelberg, Germany) instrument.Viable cells were gated on their forward and side scatterprofiles and by propidium iodide exclusion. The mAbconjugated to fluorescein (FITC) or phycoerythrin (PE)were specific for CD3 (anti-Leu-4 FITC), CD4 (anti-Leu-3a-PE), CD56 (anti-Leu-19-PE), HLA-DP (anti-HLA-DP-FITC) (all from BD, Heidelberg, Germany),TCR cd (anti-TCR-d1-FITC) (T-cell Diagnostics,Cambridge, MA), and HLA-A/B/C (anti-pan classI-FITC) (Coulter Immunotech, Hamburg, Germany).Unconjugated antibodies were hybridoma supernatants:G1 (specific for Vd2, IgG2a, provided by Dr. S. Ferrini,Genova, Italy), W6/32 (reactive with all b2m associatedHLA class I a-chains, IgG2a), Q1/28 (reactive with allb2m-bound and b2m-free HLA class I a-chains, IgG2a),B1.23.2 (reactive with HLA-B and -C alleles, IgG2a),LGIII-147.4 (specific for HLA-A, IgG1). Further mAbwere (all from Dr. L. Moretta, Genova, Italy) EB6 (anti-p58.1, IgG1), GL183 (anti-p58.2, IgG1), Z27 (anti-p70,IgG1), Q66 (anti-p140, IgM), XA185 (anti-CD94, IgG1)and Z199 (anti-CD94/NKG2A, IgG1). FITC-labeledgoat-anti-mouse antibodies (BD, Heidelberg, Germany)were used as secondary reagents in indirect immuno-fluorescence or, for two-color analysis, goat-anti-mouse-IgG1 or anti-IgM and goat-anti-mouse-IgG2a-PE (allfrom Southern Biotechnology, Birmingham, UK).

2.4. cd T-cell expansion assay

PBMC ð106Þ from healthy donors were stimulatedwith 105 irradiated (40 Gy) Daudi cells or the HLA classIþ Daudi variants in 24-well plates in 1 ml of completemedium supplemented with 10% human serum. Freshmedium was added at day 4. On day 7 cells were har-vested and the percentages of Vd2þ cells within all viablecells were determined by flow cytometry.

2.5. Cytotoxicity assay

In cell mediated lysis assays cd T-cell clones and NK-cell clones were plated in 96-well round bottom plates intriplicates and incubated with 5� 104 51Cr-labeled tar-get cells as described [10]. Following 4 h of incubation50 ll of the supernatants was harvested on Lumaplates(Packard, Groningen, NL) and counted using the Top-Count (Packard) microplate scintillation counter. Themeans of triplicate measurements are expressed as %specific lysis according to the formula [(experimentalcounts per minute) spontaneous counts per minute)/(maximum release) spontaneous counts per minute)]�100. In some experiments the targets were incubated

for 1 h with anti-HLA class I antibodies (B1.23.2 su-pernatant) before the effector cells were added.

2.6. Cloning and transfection of the human b2m cDNAinto Daudi cells

Raji cells ð107Þ, which express normal amounts ofb2m, were used to isolate total cytoplasmic RNA usingstandard protocols. The RNA was reverse transcribedinto oligo(dT)-primed cDNA with the first-strandcDNA Synthesis Kit (Pharmacia, Freiburg, Germany).The full-length coding sequence of the human b2mcDNA (approx. 400 bp) was amplified by PCR (1.5 min95 �C, 1.5 min 65 �C, 2 min 72 �C for 25 cycles) using the50 primer TAGAAGCTTCATTCCTGAAGCTGACA-GCATTC and the 30 primer TAGGGATCCCATCTT-CAACCTCCATGATGCTGC with the addedrestriction sites for HindIII and BamHI, respectively,being underlined. The PCR product was cloned into theM13mp19 vector and clones with correct sequences wereidentified. The b2m-cDNA was subcloned into the ex-pression vector p636 (kindly provided by Dr. B. Sudgen,Madison, WI, USA). This vector is similar to the pHebovector [28], but carries a CMV promoter for episomalcDNA expression in EBV-transformed cell lines.Transfection of Daudi cells with the p636=b2m constructwas performed by electroporation and Hygromycin(200 lg=ml) resistant clones were analyzed after 4 weeksfor surface expression of HLA class I by flow cytometry.One of the HLA class Iþ Daudi clones, designatedDaudi h-b2m, is described in the experiments for thisstudy although other clones gave similar results.

2.7. Cloning and transfection of HLA class I a-chainsfrom Daudi and Raji

For cloning of the HLA class I a-chains [25,29] totalcytoplasmic RNA was isolated from 107 Daudi and Rajicells and reverse transcribed into cDNA. HLA-A, -B,and -C a-chains were amplified by PCR (1.5 min 95 �C,1.5 min 65 �C, 2 min 72 �C for 24 cycles) using locusspecific primer pairs (Table 1). The primer pairs HLA99/HLA00 and HLA08/HLA12 are designed to amplifyHLA-C alleles, the pairs HLA01/HLA02 as well asHLA08/HLA10 amplify HLA-B alleles and the primerpairs HLA04/HLA06 as well as HLA08/HLA02 wereused for HLA-A alleles. The PCR fragments (1100 and1300 bp depending on the primer pair) were cloned intothe pBluescript II SK+ vector using the HindIII andBamHI restriction sites that had been added to theprimers. For each allele amplified by PCR at least 10clones of the expected length were sequenced. The re-sults were compared to the published HLA sequences[30]. Thus, we identified clones containing the correctsequences for each of the six HLA class I alleles fromDaudi (A*0102, A*6601, B*5801, B*5802, Cw0302,

34 S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44

Cw0602), as described before [31]. From Raji cells weisolated three alleles (A*0301, B*1510, Cw0304). Eachof these nine alleles was subcloned into the expressionvector p636 and transferred into C1R and .221 cellsusing electroporation. After an approximately 6-weekselection with Hygromycin B (200 lg=ml) the transfec-tants were stained with the anti-HLA class I monoclonalantibody (mAb) W6/32 and cells expressing the highestamounts of HLA class I were sorted on a MoFlo cellsorter (Freiburg, Germany). Sorting was repeated asrequired. Before being used as target cells in cytotoxicityexperiments the expression levels of the transfectedHLA class I alleles were confirmed by flow cytometry.

3. Results

3.1. Expression ofHLAclass I onDaudi and solid tumor celllines inhibits immune responses byVc9=Vd2T lymphocytes

Toprove directly that the absence of b2m inDaudi cellsinduces recognition by Vc9=Vd2 T lymphocytes, we

generated an expression construct for the human b2mcDNA and transfected our own Daudi cell line that is thesame parental Daudi cell line as that used previously togenerate the mouse b2m-transfected Daudi variant(Daudi/m-b2m) [21]. This approach allowed us to exam-ine several independently derived Daudi/h-b2m variants.In addition, we tested other pairs of b2m-deficient humantumor cell lines and the corresponding b2m transfectantssuch as the colon carcinomaHCT compared toHCT-b2mand the melanoma FO-1, compared to FO-1-b2m [23,24].In Fig. 1 we show the expression levels of HLA class I byflow cytometry of a representative cell line of our newDaudi/h-b2m variants compared to those of HCT=b2mand FO-1=b2m as well as their b2m-deficient parental celllines. LCL .221 expresses b2m, but lacks expression ofHLA class I A, B, andC antigens. LCL 721 is the parentalcell line of .221 expressing normal levels of HLA class I.The residual staining of .221 by anti-HLA class I mAb isdue to some remaining HLA class Ib molecules that areexpressed at low levels. Northern blot analysis of the b2m-deficient cell lines and the transfectants confirmed thatb2m-transfection markedly increased b2m RNA

Table 1

Primer sequences used to amplify HLA class I heavy chains

Primer Sequence 50-30

HLA99 CCGAAGCTTGCCGAGATGCGGGTCAT

HLA00 CCGGGATCCTCAGGCTTTACAAGCGATGAGA

HLA01 CCGAAGCTTGCCGAGATGCGGGTCAC

HLA02 GCCCGGATCCTCTCAGTCCCTCACAAGGCAGCTGTC

HLA04 GCGCAAGCTTCCCAGACGCCGAGGATGGCC

HLA06 CCGCGGATCCTTGGGGAGGGAGCACAGGTCAGCGTGGGAAG

HLA08 GGGCAAGCTTGGACTCAGAATCTCCCCAGACGCCGAG

HLA10 CCGCGGATCCCTGGGGAGGAAACACAGGTCAGCATGGGAAC

HLA12 CCGCGGATCCTCGGGGAGGGAACACAGGTCAGTGTGGGGAC

Note: The primers were derived from the untranslated regions that flank the 50 and 30 ends of the coding regions. The restriction sites for HindIII

and BamHI, respectively, are underlined.

Fig. 1. Expression of HLA class I in b2m-deficient cell lines and their HLA class Iþ variants. Daudi, FO-1 and HCT cells and the human b2m-transfected variants of these cell lines were stained for HLA class I expression using FITC-conjugated anti-pan HLA class I mAb (filled histograms).

The data are overlaid with the isotype-control mAb for each cell line (empty histograms). The surface HLA class I levels of the b2m expressing HLA

class I A-, B-, and C-deficient LCL .221 and the parental LCL 721 are shown for comparison.

S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44 35

expression levels in the b2m-deficient cell lines (data notshown).In functional assays we compared the effects of HLA

class I expression on the cytolytic activity of humanVc9=Vd2 T-cell clones (Fig. 2A). We compared ournewly generated Daudi/h-b2m variants with anotherHLA class I-expressing variant of the same parentalDaudi cells that had been transfected with the mouseb2m cDNA [21], designated here Daudi/m-b2m. Cytol-ysis of classical b2m-deficient Daudi cells, the Daudi/m-b2m cells, a representative cell line of our new Daudi/h-b2m variants, Raji cells and the Daudi/Raji hybrid 8A[22] by a large panel of cd T-cell clones correlatedstrikingly with the total levels of HLA class I expressionby these target cells (Fig. 2B). Importantly, also theproliferative responses of cd T cells to Daudi cells cor-related well with the level of HLA class I expression bythe HLA class Iþ Daudi variants (Fig. 2C). Followingstimulation of peripheral blood lymphocytes in vitro byb2m-deficient Daudi cells more than 30% of cd T cellsexpanded within one week. In contrast, following stim-ulations of PBMC by our new Daudi/h-b2m transfec-tants and by the Daudi/Raji hybrid 8A markedly lowerlevels of cd T cells were expanded. Practically no cd Tcells were expanded by Raji cells. Masking of HLA classI molecules with the anti-HLA class I mAb B1.23.2

restored cytolysis of the Daudi/h-b2m target cells by therepresentative cd T-cell clone GD25 in a concentration-dependent manner (Fig. 2D). In contrast, there was nosuch effect by isotype control mAb or by the B1.23.2mAb when tested on b2m-deficient parental Daudi cells.Similar results were obtained by masking HLA class Ion the Daudi/Raji-hybrid 8A (data not shown).In contrast to the proliferative responses of cd T cells

from PBMC to Daudi cells (Fig. 2C), Vc9=Vd2 T cellsdid not proliferate in response to the surface HLA classI deficient solid tumor cell lines FO-1 or HCT as well asto the HLA class I A-, B-, and C-deficient LCL .221(data not shown). Cytotoxic Vc9=Vd2 T-cell clones ef-ficiently lysed the LCL .221, HCT, and FO-1 and theexpression of HLA class I inhibited cytolysis (Fig. 3).However, the degree of inhibition was lower for the solidtumor cell lines, particularly for FO-1 which may beexplained by the fact that FO-1 is very sensitive to cy-tolysis by IL-2 activated killer cells due to factors be-yond HLA class I expression.

3.2. Cell surface expression of human b2m-free HLA classI a-chains fails to inhibit cytolysis by Vc9=Vd2 T cells

Since Daudi cells transfected with m-b2m were muchmore sensitive to lysis by Vc9=Vd2 T cells (Fig. 2A) than

Fig. 2. Cytotoxicity and proliferation by Vc9=Vd2 T cells are inhibited by HLA class I expression on Daudi cells. The parental Daudi cell line, Daudicells transfected with either the mouse or the human b2m cDNA, Raji cells and the Daudi�Raji hybrid 8A were tested for (A) cytolysis by cytotoxicVc9=Vd2 T-cell clones (the mean cytotoxicity of a panel of 28 clones at an E:T ratio of 5:1 and SEM are indicated); (B) the expression of HLA class I

[indirect fluorescence using mAb W6/32 with the mean fluorescence intensity (MFI) being indicated on a 4-log scale]; and (C) the stimulation of

proliferation of Vd2þ T cells from freshly isolated PBMC from two representative donors (out of a total of eight donors analyzed) using the cd T-cellexpansion assay. Panel (D) demonstrates a titration of the protective effect of the anti-pan HLA-B, -C antibody B1.23.2 on the cytolysis of the human

b2m-transfected Daudi-variant by cd T-cell clone GD25 at an E:T ratio of 5:1. The effects of the isotype control and the use of the parental b2m-deficient Daudi cells line are shown as negative controls.

36 S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44

the cells transfected with h-b2m, we investigated thedifferences of HLA class I expression of these two celllines in more detail. The levels of b2m mRNA expressionas estimated by Northern blotting in Daudi cells trans-fected with h-b2m or with m-b2m were rather similar(data not shown). Thus, the diminished HLA class I cellsurface expression in Daudi/m-b2m, as compared toDaudi/h-b2m (Fig. 2B), was probably caused by a lessefficient rescue of the human HLA class I a-chains bym-b2m [32] rather than by the b2m levels in both celllines. We adapted the Daudi cell lines transfected with

h-b2m and m-b2m to serum-free medium in order toprevent exchange of HLA class I a-chain associated b2mwith b2m from the bovine and human sera in flow cy-tometry analysis and cytotoxic assays. Strikingly, incontrast to the Daudi/h-b2m cells, the Daudi/m-b2mcells cultured under serum-free conditions were devoidof HLA class I fluorescence as measured by mAb W6/32while they still expressed HLA class I a-chains asmeasured by mAb Q1/28 which recognizes HLA classI a-chains even when they are associated with m-b2m(Fig. 4A). There was a marked time- and temperature-

Daudi LCL 721

0

5

10

15

20

25

HCT FO1

0

10

20

30

40

50

60

0

10

20

30

40

50

60

0

5

10

15

20

25

30

35

GD1 GD25 GD4 GD1 GD25 GD4 GD1 GD25 GD4 GD1 GD25 GD4

HLA class Inegative variant

HLA class Ipositive variant

Per

cent

spe

cific

lysi

s

Fig. 3. Cytolysis by Vc9=Vd2 T-cell clones of HLA class Iþ and HLA class I� variants of Daudi, LCL 721 and the solid tumor cell lines HCT andFO-1. The representative cd T-cell clones GD1, GD25, and GD4 were tested at an E:T ratio of 10:1 for lysis of HLA class Iþ and HLA class I�

variants of Daudi, LCL 721, HCT, and FO-1 cells. SD was less than 5% cytotoxicity. The HLA-A, -B, and C-deficient variant of 721 is LCL .221.

Fig. 4. Mouse-b2m associated human HLA class I molecules: binding of anti-HLA class I mAb and effects on the cytolysis by cd T-cell clones. (A)Daudi cells transfected with mouse or human b2m were cultured in the serum-free medium HL-1 or medium containing 10% human serum and

analyzed by flow cytometry for their binding of W6/32 and Q1/28 (filled histograms). The data are overlaid with the appropriate isotype controls

(empty histograms). (B) 10% human serum or 3 mg/ml purified human b2m was added to the mouse-b2m-transfected Daudi cells that had beencultured for 2 weeks in serum-free medium. Following 1 and 24 h of incubation the cells were analyzed by flow cytometry for binding of mAbW6/32.

(C) Cytotoxic Vc9=Vd2 clones (n ¼ 15) were tested for lysis (E:T ratio 5:1) of Daudi cells transfected with mouse b2m that had been cultured for 2

weeks in medium supplemented with serum or under serum-free conditions and the parental Daudi cells. The labeling of all target cells, their washing

and the incubation of the effectors with the target cells were performed in 100% HL1 serum-free medium. (D) Cytotoxic Vc9=Vd2 clones (n ¼ 5) were

tested for lysis (E:T ratio 5:1) of Daudi cells transfected with mouse b2m (Daudi/m-b2m) or human b2m (Daudi/h-b2m) that had been cultured for 2weeks under serum-free conditions and the parental Daudi cells. The labeling of the target cells, their washing and the incubation of the effectors with

the target cells were performed in either HL1 serum-free medium or in medium containing 10% human serum.

S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44 37

dependent increase of W6/32-fluorescence upon incu-bation of Daudi/m-b2m cells that had been culturedunder serum-free conditions with human serum or withpurified human b2m (Fig. 4B and data not shown). Themost likely explanation for this finding is that W6/32mAb recognizes HLA class I a-chains in associationwith human or bovine, but not mouse b2m [33,34].It is possible that bovine b2m associated HLA class I-

a chains show a lower reactivity with W6/32 mAb thanh-b2m associated ones. Thus, lower staining of Daudi/m-b2m as compared to Daudi/h-b2m cells with anti-HLA class I mAb (Figs. 2B, 4A, and B) may be ex-plained by less efficient rescue of HLA class I molecules

by m-b2m as compared to h-b2m cells and also by alower affinity of many anti-HLA class I mAb for HLAclass I a-chains that are associated with mouse andbovine b2m. To investigate the effect of free HLA class Ia-chains on NK receptor expressing killer cells westudied cytolysis of Daudi/m-b2m cells adapted to se-rum-free medium with the cytotoxicity assays performedunder serum-free or -containing conditions (Figs. 4Cand D). Although Daudi cells transfected with m-b2mclearly expressed HLA-class I a-chains at the cell surfaceunder serum-free conditions there was only a marginalprotection from lysis by cytotoxic cd T cells unless hu-man serum containing b2m was added to the medium inthe course of the cytotoxicity assay. As expected, thiseffect was not observed with Daudi/h-b2m cells thatexpress human b2m-bound class I molecules even ifthese cells were cultured under serum-free conditions(Fig. 4D). Thus, the conformational change of HLAclass I-a chains upon binding of human b2m is necessaryfor effective protection of target cells from lysis byVc9=Vd2 T-cell clones.

3.3. HLA class I allele-specific inhibition of individual cdT-cell clones

Since re-expression of HLA class I on Daudi cellsmarkedly decreased the activation of Vc9=Vd2 T cellsby Daudi cells we examined the expression patterns ofINMR receptors on fresh Vc9=Vd2 T cells as well as onthe cytotoxic clones used in these experiments (Table 2).Most Vc9=Vd2 T cells in peripheral blood of normaldonors expressed at least one of the inhibitory naturalkiller cell receptors p58.1, p58.2, p70, p140, or CD94.All cytotoxic Vc9=Vd2 clones tested expressed one ormore INMR and the analysis of clones from the samedonor showed a clonally distributed expression patternof INMR that appeared to be stable on our establishedcd T-cell clones in the course of in vitro expansion. Thispresence of INMR on Vc9=Vd2 T cells provides anexplanation for the reduced response of Vc9=Vd2 Tcells to our HLA class I expressing Daudi-variants, aswell as to the Daudi�Raji Hybrid 8A (Fig. 2 andTable 3).

Table 2

Expression of inhibitory MHC class I receptors on Vc9=Vd2 T cells

Cell surface expression of

P58.1 P58.2 p70 p140 CD94

Unstimulated

V c9=V d2 T cells

Donor 1 9% 12% 17% 50% 85%

Donor 2 9% 23% 21% 42% 89%

V c9=V d2 T-cell

clones

GD1 ) ) + + )GD4 ) ) ) ) +

GD6 ) + ) + )GD25 ) + ) + )GD32 + ) ) ) +

Note: The expression of INMR was analyzed by staining with

specific mAb and FACS analyses. Freshly isolated PBMC were

double stained with mAb G1 (anti-Vd2, IgG2 (a) and mAb against

the indicated INMR (all IgG1 or IgM), followed by IgG-subclass-

specific secondary reagents conjugated to FITC and PE. The per-

centages of Vd2þ cells expressing a particular INMR are shown for

two representative donors. Donor 1 had 3% Vd2þ T cells and 1%

Vd1þ T cells while donor 2 had 4% Vd2þ T cells and only 0.2% Vd1þ

T cells of the total PBMC. Representative cytotoxic Vc9=Vd9 T-cellclones expressing different patterns of INMR out of more than 50

clones from different donors analyzed are shown. The clones were

either positive (+) or negative ()) for the INMR indicated. Both

CD94-positive clones GD4 and GD32 expressed the inhibitory form

of CD94 (CD94/NKG2A), as determined by functional assays [27]

and for clone GD4 by staining with mAb Z199 against NKG2A (data

not shown).

Table 3

Target cell recognition by Vc9=Vd2 T-cell clones and NK clones

Clone Type Percent specific lysis of

Daudi h-b2m Daudi Daudi�Raji hybrid 8A Raji

GD1 Vc9=Vd9 40 4 1 1

GD6 Vc9=Vd9 45 20 3 4

GD25 Vc9=Vd9 45 20 11 3

GD32 Vc9=Vd9 55 15 7 4

NK30 NK 95 13 3 76

NK29 NK 81 29 12 63

Note: Representative Vc9=Vd2 T-cell clones and NK clones from the same donor are shown. The clones were tested in 51Cr release assays against

the indicated targets in an E:T ratio of 5:1.

38 S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44

Transfection of h-b2m into Daudi cells allowed us toassess the effects of the full panel of HLA class I mole-cules of Daudi cells on the lytic activity of clonedVc9=Vd2 T cells as well as NK cells (Table 3). However,we asked how single HLA class I alleles influenced lysisby individual Vc9=Vd2 T-cell clones. Thus, we expressedeach of the 6 HLA class I alleles of Daudi (A*0102,A*6601, B*5801, B*5802, Cw0302, Cw0602) and ofthree further alleles derived from Raji (A*0301, B*1510,Cw0304) individually in the mutant LCL lines C1R and

.221. The LCL C1R only expresses HLA-Cw4 and verylittle HLA-B35, but not the other HLA-A, -B, and -Cmolecules [25] while LCL .221 does not express any ofthe polymorphic HLA class I A, B, and C molecules[26]. The HLA class I transfectants of these two mutantLCLs expressed the transferred allele at significant lev-els, as demonstrated by flow cytometry using anti-HLAclass I antibodies, some of which were specific for HLA-A and others for HLA-B or -C alleles (Fig. 5). As afurther control, the expression levels of the HLA-class II

Fig. 5. Surface expression of individual HLA class I alleles in C1R and .221 cells. The 9 different HLA class I a-chain cDNA expression constructsderived from Daudi and Raji cells were transferred into (A) C1R and (B) .221 cells. In (A) expression of HLA class I following transfection was

analyzed by flow cytometry using mAb reactive against all human HLA class I A, B and C molecules (W6/32), against HLA class I B, C (B1.23.2) and

HLA class I A-alleles (LGIII-147.4) and, as a control, HLA-DP (filled histograms). In (B) the .221 cells are stained with an FITC conjugated mAb

against HLA class I, A, B and C. The data are overlaid with control cells that had been transfected with the p636 vector without the cDNA insert and

stained with the same mAb (empty histograms).

S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44 39

antigen DP were not affected by transfection of the di-verse HLA class I antigens. Cytolysis by individual cy-totoxic Vc9=Vd2 T-cell clones was effectively blocked bysingle HLA class I alleles that are known to bind indi-vidual INMR, as demonstrated by four representativeclones (Fig. 6). Clone GD1 (p70þ and p140þ) is effec-tively blocked by the HLA-B alleles B*5801/B*5802derived from Daudi, as well as B*1510 from Raji. Allthese B-alleles carry the Bw4 epitope that binds to thep70 INMR (reviewed in [16,19]). Similarly, lysis by cloneGD1 is markedly inhibited by the Raji allele HLA-A*0301 which binds to the p140 INMR (binding theHLA alleles A03 and A11). In contrast, the alleleA*0102 fails to inhibit cytolysis while A*6601 is onlymoderately inhibitory (Fig. 6) with all these HLA-Aalleles being expressed at similar levels in the C1Rtransfectants (Fig. 5). Clones GD6 and GD25 (bothp58.2þ and p140þ) are specifically blocked by the HLA-C 03 alleles via the p58.2 INMR (binding HLA-C 01, 03,07, 08 alleles) and to a similar degree by HLA-A*0301via p140. Clone GD32 expresses p58.1 (binding HLA-C02, 04, 05, 06 alleles), as well as the inhibitory form ofCD94 (binding HLA-E). Since C1R cells naturally ex-press the Cw0401 allele, cd T-cell clones expressingp58.1 did not lyse C1R cells and could only be testedusing .221 transfectants. Indeed, cytolysis by cloneGD32 was inhibited by the Cw0602 allele, but not by theother HLA class I alleles transferred. Since Clones GD1,

GD6 and GD25 did not express CD94, we can excludethe possibility that inhibition by the HLA class I alleletransferred depended on the interaction of CD94 withHLA-E [20]. HLA-E probably can be expressed in C1Rcells following binding of leader peptides of some HLAclass I molecules that are transferred into C1R cells,similarly as previously shown for .221 cells [35].

4. Discussion

Since the recognition by human Vc9=Vd2 T cells ofBurkitt’s lymphoma cell line Daudi was described[10,11] the relevance of missing HLA class I expressionon Daudi cells for responses by cd T cells remainedunclear. Particularly, the peculiar proliferative responsesof fresh Vd9=Vc2 T cells from peripheral blood andestablished Vc9=Vd2 T-cell clones have not been eluci-dated. Transfer of the Vc9=Vd2 TCR into TCR-defi-cient Jurkat cells provided initial evidence thatrecognition by non-peptidic bacterial antigens andDaudi cells by human Vc9=Vd2 T cells is mediated di-rectly via the Vc9=Vd2 TCR [13]. The data reported inthis study provide further proof for the idea that besidesspecificity of the Vc9=Vd2 TCR the proliferative andcytotoxic responses of Vc9=Vd2 T cells critically dependon the missing expression of b2m by Daudi cells. Wedemonstrate three aspects of the HLA class I expression

Fig. 6. The lysis of C1R and .221 cells by individual cd T-cell clones is inhibited by single HLA class I alleles. Four representative Vc9=Vd2 clonesexpressing different INMR (Table 3) were tested for cytolysis (E:T ratio 25:1) of C1R and .221 cells and their transfectants expressing the different

HLA class I alleles from Daudi and Raji cells. The bars indicating cytolysis of the transfected cells carrying HLA alleles that bind to the known

INMR of the particular clone are shown in black.

40 S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44

on target cells that are important to control the re-sponses of Vc9=Vd2 T cells. First, there is a quantitativerelationship between the amount of HLA molecules onthe surface and the grade of inhibition of lysis by manycytotoxic cd T-cell clones. Second, depending on theINMR pattern of an individual cd T-cell, not the overallamount of HLA class I molecules may be important, butthe expression of specific alleles on target cells that arerecognized by these INMR. If the target cell loses ex-pression of a critical allele it may become sensitive tolysis by this clone even though it still express high levelsof other HLA class I molecules. Third, our results withthe Daudi-variant expressing only m-b2m in serum-freemedium suggest that also the conformation of the HLAclass I molecules in association with h-b2m are impor-tant for transmitting the inhibitory signal via INMR.This idea is supported by mapping studies of the mouseinhibitory NK receptor Ly49A indicating that the NKreceptor interacts with a site on the a1 or a2 domain ofthe MHC class I a-chain and requires the associationwith b2m [36]. The specificity of the human p58.1, p58.2,and p70 NK receptors for certain HLA class I alleles isdetermined by the polymorphisms in single amino acidsin the a1-domain of the HLA molecules [19].The present results corroborate data from our pre-

vious studies that examined recognition of Daudi�melanoma and Daudi�Burkitt’s lymphoma hybrids bycytotoxic and T-helper type Vc9=Vd2 T-cell clones[27,37], as well as data from other groups [38–40].INMR that had been first identified on NK cells [41] areexpressed by most cytotoxic Vc9=Vd2 T cells. In con-trast, no INMR were found on non-cytotoxic CD4þ

Vc9=Vd2 cells, a very rare subpopulation in humanblood [27], and on most cd T cells of the Vd1 subgroup[27,38]. Only a small minority of ab T cells (<5%) ex-press INMR. These INMRþ ab T cells are mostly CD8þ

and carry the phenotype of oligoclonally expandedchronically activated cytotoxic cells [17]. Examples areVa24þ NKT cells [42] and differentiation- or testis-an-tigen specific ab T cells that have been identified fromindividual patients suffering from metastatic melanoma[43,44].Vc9=Vd2 T cells do not proliferate to other b2m-de-

ficient cell lines such as HCT and FO-1 and Vc9=Vd2T-cell clones do not secrete TNF in response to theseb2m-deficient tumor cell lines [27]. Thus, recognition byhuman Vc9=Vd2 T lymphocytes of Daudi cells probablycannot be explained solely on the basis of missing in-hibitory signals but it appears that activating signals arealso required. Data from TCR transfer experimentssuggested that expression of the Vc9=Vd2 TCR in aTCR-deficient Jurkat variant may transfer the reactivitytowards Daudi cells [13]. These data strongly supportthe general idea that Daudi cells express cell surfacetarget epitopes for the Vc9=Vd2 TCR [45]. The nature ofthese putative cd-ligands on Daudi remains unresolved,

however, they could be related to the non-peptidicphosphoantigens first isolated from mycobacterial ex-tracts [5]. Cellular cd T-cell ligands could be hapten-likemolecules that are part of a larger protein such as heat-shock proteins that undergo post-translational phos-phorylation [11,45]. Ligands for Vc9=Vd2 T cells do notseem to be restricted to Daudi cells but appear to bepresent on many other B-cell lymphomas because IN-MR� Vc9=Vd2 T-cell clones secrete TNF in response tomost B-cell lymphomas [27]. The lack of proliferation ofcd T cells to HLA class I A, B, and C deficient LCL .221cells may be explained by residual expression of HLAclass Ib molecules on .221 (Fig. 1) which may inhibit cdT-cell activation or, alternatively, by an absence of theVc9=Vd2 TCR ligand on EBV-transformed B cells.Another explanation for the peculiar specificity of

some cd T cells than antigen recognition via the TCR isthe expression of activating NK-type receptors on cd Tcells [46,47] that may bind yet unidentified molecules onB-cell lymphomas. Recently, a new activating NK re-ceptor NKG2D, a molecule that is expressed as a ho-modimer and does not associate with CD94, was shownto be present on almost all Vc9=Vd2 T cells beside itsexpression on NK cells [48–50]. The stress inducibleMHC class I related molecules MICA and MICB [48]and novel MHC class I-related molecules, the ULBPs,[51] were identified as ligands triggering NK cell and Tcell activation via NKG2D. The MICA or MICB mol-ecules are not expressed by Daudi cells [50] but Daudicells express ULBP1, 2, and 3, although at very lowlevels [50,51]. Activation via NKG2D ligands has beenshown to be relevant for the lysis of Daudi cells by NKcells [50] and may play a role as an activating signal forthe lysis of Daudi cells by Vc9=Vd2 T cells. However, itis unlikely that activation via NKG2D is the only ex-planation for the specificity of Vc9=Vd2 T cells forDaudi cells because the levels of ULBP expression byDaudi are rather low [51] and because NKG2D is ex-pressed by cd T-cell clones that do no react towardsDaudi cells (A. Buchwald, P. Fisch, unpublished re-sults). We propose that expression of ULBPs by Daudimight provide an additional activating signal besides thepostulated ligand on Daudi cells for the Vc9=Vd2 TCR.Differential expression of activating NK receptors onNK clones and cd T-cell clones may partially explain thefinding that most NK cell clones strongly kill Raji cellswhile Raji cells are typically not killed by cytotoxicVc9=Vd2 T-cell clones (Table 3).A common feature of all INMR-expressing cells, NK

cells, cd T cells, and rare ab T cells is that these cellsdisplay strong cytotoxicity and a potential for self-re-activity. Such killer cells have been shown to destroyautologous lymphoblasts in the presence of some anti-HLA class I antibodies that block the interaction of theHLA class I molecules on the target cells and the INMRon the killer cells and thus ‘‘unprotect’’ the target cells

S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44 41

[52]. cd T cells were described that kill erythrocyte pre-cursors expressing only low amounts of HLA class Imolecules and this mechanism may cause auto-immuneanemia [53]. The INMR bearing T cells from tumorpatients recognized antigens overexpressed in tumorcells as compared to normal tissues [43,44]. The primaryfunction of INMR expression on these killer cells maybe the maintenance of peripheral tolerance of self-reac-tive potentially harmful lymphocytes that are not de-leted in the thymus. Indeed, there may be twoadvantages for the immune system to preserve thesepotentially harmful self-reactive cells that have to besilenced via INMR. First, it is important for the or-ganism to recognize cells that have down-regulated theirHLA class I molecules under the selective pressure of theHLA-restricted ab T cells as seen in virus-infected cellsor tumors [54,55]. The second advantage is the ability torecognize cells that differ from normal cells only in aquantitative overexpression of a cellular stress signal ora HLA-restricted peptide of a differentiation antigen.Then, the negative signal via INMR provides a thresh-old ensuring that the activating signal has to be at acertain security margin above the normal level wheninitiating an immune response. The down-regulation ofHLA class I molecules and overexpression of ‘‘self’’-li-gands are frequent features of tumor cells and virus-in-fected cells. The expression of INMR on Vc9=Vd2 Tcells suggests a role for these cells in the defense againsttumors and viral infections.

Acknowledgments

We thank Dr. William Sugden for the p636 vector,Dr. S. Gattoni-Celli for the HCT-cell line and the b2m-transfected HCT cells, Dr. J. Parnes for the Daudi cellline and the mouse b2m-transfected Daudi variant, Dr.G. Klein for the Daudi�Raji hybrid 8A, Dr. L. Mo-retta for antibodies against inhibitory NK receptors,and Dr. P. Coulie for mAb B1.23.2. Further, we thankDr. M. Follo and K. Geiger for sorting by flow cy-tometry. The work was supported by the SFB 364-B4 bythe Deutsche Forschungsgemeinschaft.

References

[1] L.L. Lanier, J. Ruitenberg, R.L. Bolhuis, J. Borst, J.H. Phillips,

R. Testi, Structural and serological heterogeneity of c=d T cell

antigen receptor expression in thymus and peripheral blood, Eur.

J. Immunol. 18 (1988) 1985–1992.

[2] C.M. Parker, V. Groh, H. Band, S.A. Porcelli, C. Morita, M.

Fabbi, D. Glass, J.L. Strominger, M.B. Brenner, Evidence for

extrathymic changes in the T cell receptor cd repertoire, J. Exp.Med. 171 (1990) 1597–1612.

[3] W. Haas, P. Pereira, S. Tonegawa, cd cells, Annu. Rev. Immunol.11 (1993) 637–685.

[4] A.C. Hayday, cd cells: a right time and a right place for a

conserved third way of protection, Annu. Rev. Immunol. 18

(2000) 975–1026.

[5] P. Constant, F. Davodeau, M.A. Peyrat, Y. Poquet, G. Puzo,

M. Bonneville, J.J. Fournie, Stimulation of human cd T cells bynonpeptidic mycobacterial ligands, Science 264 (1994) 267–

270.

[6] Y. Tanaka, C.T. Morita, E. Nieves, M.B. Brenner, B.R. Bloom,

Natural and synthetic non-peptide antigens recognized by human

cd T cells, Nature 375 (1995) 155–158.[7] M.R. Burk, L. Mori, G. De Libero, Human Vc9-Vd9 cells are

stimulated in a cross-reactive fashion by a variety of phosphor-

ylated metabolites, Eur. J. Immunol. 25 (1995) 2052–2058.

[8] R. Maccario, M.G. Revello, P. Comoli, D. Montagna, F.

Locatelli, G. Gerna, HLA-unrestricted killing of HSV-1-infected

mononuclear cells. Involvement of either c=dþ or a=bþ human

cytotoxic T lymphocytes, J. Immunol. 150 (1993) 1437–1445.

[9] J.F. Bukowski, C.T. Morita, M.B. Brenner, Recognition and

destruction of virus-infected cells by human cd CTL, J. Immunol.153 (1994) 5133–5140.

[10] P. Fisch, M. Malkovsky, E. Braakman, E. Sturm, R.L. Bolhuis,

A. Prieve, J.A. Sosman, V.A. Lam, P.M. Sondel, cd T cell clonesand natural killer cell clones mediate distinct patterns of non-

major histocompatibility complex-restricted cytolysis, J. Exp.

Med. 171 (1990) 1567–1579.

[11] P. Fisch, M. Malkovsky, S. Kovats, E. Sturm, E. Braakman, B.S.

Klein, S.D. Voss, L.W. Morrissey, R. DeMars, W.J. Welch,

R.L.H. Bolhuis, P.M. Sondel, Recognition by human Vc9=Vd2 Tcells of a GroEL homolog on Daudi Burkitt’s lymphoma cells,

Science 250 (1990) 1269–1273.

[12] C.T. Morita, E.M. Beckman, J.F. Bukowski, Y. Tanaka, H. Band,

B.R. Bloom, D.E. Golan, M.B. Brenner, Direct presentation of

nonpeptide prenyl pyrophosphate antigens to human cd T cells,Immunity 3 (1995) 495–507.

[13] J.F. Bukowski, C.T. Morita, Y. Tanaka, B.R. Bloom, M.B.

Brenner, H. Band, Vc2Vd9 TCR-dependent recognition of non-peptide antigens and Daudi cells analyzed by TCR gene transfer,

J. Immunol. 154 (1995) 998–1006.

[14] C. De Preval, B. Mach, The absence of b2-microglobulin in Daudicells: active gene but inactive messenger RNA, Immunogenetics 17

(1983) 133–140.

[15] F. Rosa, M. Fellous, M. Dron, M. Tovey, M. Revel, Presence of

an abnormal b2-microglobulin mRNA in Daudi cells: induction

by interferon, Immunogenetics 17 (1983) 125–131.

[16] A. Moretta, C. Bottino, M. Vitale, D. Pende, R. Biassoni, M.C.

Mingari, L. Moretta, Receptors for HLA class-I molecules in

human natural killer cells, Annu. Rev. Immunol. 14 (1996) 619–

648.

[17] M.C. Mingari, F. Schiavetti, M. Ponte, C. Vitale, E. Maggi, S.

Romagnani, J. Demarest, G. Pantaleo, A.S. Fauci, L. Moretta,

Human CD8þ T lymphocyte subsets that express HLA class I-

specific inhibitory receptors represent oligoclonally or monoclo-

nally expanded cell populations, Proc. Natl. Acad. Sci. USA 93

(1996) 12433–12438.

[18] J.H. Phillips, J.E. Gumperz, P. Parham, L.L. Lanier, Superanti-

gen-dependent, cell-mediated cytotoxicity inhibited by MHC class

I receptors on T lymphocytes, Science 268 (1995) 403–405.

[19] L.L. Lanier, NK cell receptors, Annu. Rev. Immunol. 16 (1998)

359–393.

[20] V.M. Braud, D.S. Allan, C.A. O’Callaghan, K. Soderstrom, A.

D’Andrea, G.S. Ogg, S. Lazetic, N.T. Young, J.I. Bell, J.H.

Phillips, L.L. Lanier, A.J. McMichael, HLA-E binds to natural

killer cell receptors CD94/NKG2A, B and C, Nature 391 (1998)

795–799.

[21] R.H. Seong, C.A. Clayberger, A.M. Krensky, J.R. Parnes, Rescue

of Daudi cell HLA expression by transfection of the mouse b2-microglobulin gene, J. Exp. Med. 167 (1988) 288–299.

42 S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44

[22] G. Klein, P. Terasaki, R. Billing, R. Honig, M. Jondal, A. Rosen,

J. Zeuthen, G. Clements, Somatic cell hybrids between human

lymphoma lines. III. Surface markers, Int. J. Cancer 19 (1977) 66–

76.

[23] Gattoni-S.K. Celli, K. Kirsch, R. Timpane, K.J. Isselbacher, b2-microglobulin gene is mutated in a human colon cancer cell line

(HCT) deficient in the expression of HLA class I antigens on the

cell surface, Cancer Res. 52 (1992) 1201–1204.

[24] C.M. D’Urso, Z.G. Wang, Y. Cao, R. Tatake, R.A. Zeff, S.

Ferrone, Lack of HLA class I antigen expression by cultured

melanoma cells FO-1 due to a defect in b2m gene expression, J.

Clin. Invest. 87 (1991) 284–292.

[25] J. Zemmour, A.M. Little, D.J. Schendel, P. Parham, The HLA-A,

B ‘‘negative’’ mutant cell line C1R expresses a novel HLA-B35

allele, which also has a point mutation in the translation initiation

codon, J. Immunol. 148 (1992) 1941–1948.

[26] Y. Shimizu, R. DeMars, Production of human cells expressing

individual transferred HLA-A, -B, -C genes using an HLA-A, -B, -

C null human cell line, J. Immunol. 142 (1989) 3320–3328.

[27] P. Fisch, E. Meuer, D. Pende, S. Rothenfusser, O. Viale, S. Kock,

S. Ferrone, D. Fradelizi, G. Klein, L. Moretta, H.G. Rammensee,

T. Boon, P. Coulie, P. van der Bruggen, Control of B cell

lymphoma recognition via natural killer inhibitory receptors

implies a role for human Vc9=Vd2 T cells in tumor immunity,

Eur. J. Immunol. 27 (1997) 3368–3379.

[28] B. Sugden, K. Marsh, J. Yates, A vector that replicates as a

plasmid and can be efficiently selected in B-lymphoblasts trans-

formed by Epstein-Barr virus, Mol. Cell. Biol. 5 (1985) 410–413.

[29] J.D. Domena, A.M. Little, A.J. Madrigal, W.H. Hildebrand, L.

Johnston-Dow, E. du Toit, W.B. Bias, P. Parham, Structural

heterogeneity in HLA-B70, a high-frequency antigen of black

populations, Tissue Antigens 42 (1993) 509–517.

[30] K.L. Arnett, P. Parham, HLA class I nucleotide sequences, 1995,

Tissue Antigens 46 (1995) 217–257.

[31] M.J. Browning, J.A. Madrigal, P. Krausa, H. Kowalski, C.E.

Allsopp, A.M. Little, S. Turner, E.J. Adams, K.L. Arnett, W.F.

Bodmer, The HLA-A, B, C genotype of the class I negative cell

line Daudi reveals novel HLA-A and -B alleles, Tissue Antigens 45

(1995) 177–187.

[32] R.S. Rein, G.H. Seemann, J.J. Neefjes, F.M. Hochstenbach, N.J.

Stam, H.L. Ploegh, Association with b2-microglobulin controlsthe expression of transfected human class I genes, J. Immunol. 138

(1987) 1178–1183.

[33] P. Ferrier, C. Layet, D.H. Caillol, B.R. Jordan, F.A. Lemonnier,

The association between murine b2-microglobulin and HLA classI heavy chains results in serologically detectable conformational

changes of both chains, J. Immunol. 135 (1985) 1281–1287.

[34] W.A. Jefferies, G.G. MacPherson, Expression of the W6/32 HLA

epitope by cells of rat, mouse, human and other species: critical

dependence on the interaction of specific MHC heavy chains with

human or bovine b2-microglobulin, Eur. J. Immunol. 17 (1987)1257–1263.

[35] N. Lee, M. Llano, M. Carretero, A. Ishitani, F. Navarro, M.

Lopez-Botet, D.E. Geraghty, HLA-E is a major ligand for the

natural killer inhibitory receptor CD94/NKG2A, Proc. Natl.

Acad. Sci. USA 95 (1998) 5199–5204.

[36] M. Orihuela, D.H. Margulies, W.M. Yokoyama, The natural

killer cell receptor Ly-49A recognizes a peptide-induced confor-

mational determinant on its major histocompatibility complex

class I ligand, Proc. Natl. Acad. Sci. USA 93 (1996) 11792–11797.

[37] O. Viale, P. van der Bruggen, E. Meuer, R. Kunzmann, H.

Kohler, R. Mertelsmann, T. Boon, P. Fisch, Recognition by

human Vc9=Vd2 T cells of melanoma cells upon fusion with

Daudi cells, Immunogenetics 45 (1996) 27–34.

[38] F. Halary, M.A. Peyrat, E. Champagne, M. Lopez-Botet, A.

Moretta, L. Moretta, H. Vie, J.J. Fournie, M. Bonneville, Control

of self-reactive cytotoxic T lymphocytes expressing cd T cell

receptors by natural killer inhibitory receptors, Eur. J. Immunol.

27 (1997) 2812–2821.

[39] L. Battistini, G. Borsellino, G. Sawicki, F. Poccia, M. Salvetti, G.

Ristori, C.F. Brosnan, Phenotypic and cytokine analysis of

human peripheral blood cd T cells expressing NK cell receptors,

J. Immunol. 159 (1997) 3723–3730.

[40] F. Poccia, B. Cipriani, S. Vendetti, V. Colizzi, Y. Poquet, L.

Battistini, M. Lopez-Botet, J.J. Fournie, M.L. Gougeon, CD94/

NKG2 inhibitory receptor complex modulates both anti-viral

and anti-tumoral responses of polyclonal phosphoantigen-re-

active Vc9Vd9 T lymphocytes, J. Immunol. 159 (1997) 6009–

6017.

[41] A. Moretta, C. Bottino, D. Pende, G. Tripodi, G. Tambussi, O.

Viale, A. Orengo, M. Barbaresi, A. Merli, E. Ciccone, Identifi-

cation of four subsets of human CD3-CD16+ natural killer (NK)

cells by the expression of clonally distributed functional surface

molecules: correlation between subset assignment of NK clones

and ability to mediate specific alloantigen recognition, J. Exp.

Med. 172 (1990) 1589–1598.

[42] S. Norris, D.G. Doherty, C. Collins, G. McEntee, O. Traynor,

J.E. Hegarty, C. O’Farrelly, Natural T cells in the human liver:

cytotoxic lymphocytes with dual T cell and natural killer cell

phenotype and function are phenotypically heterogenous and

include Va24-Ja Q and cd T cell receptor bearing cells, Hum.

Immunol. 60 (1999) 20–31.

[43] H. Ikeda, B. Lethe, F. Lehmann, N. van Baren, J.F. Baurain, C.

de Smet, H. Chambost, M. Vitale, A. Moretta, T. Boon, P.G.

Coulie, Characterization of an antigen that is recognized on a

melanoma showing partial HLA loss by CTL expressing an NK

inhibitory receptor, Immunity 6 (1997) 199–208.

[44] D.E. Speiser, M.J. Pittet, D. Valmori, R. Dunbar, D. Rimoldi, D.

Lienard, H.R. MacDonald, J.C. Cerottini, V. Cerundolo, P.

Romero, In vivo expression of natural killer cell inhibitory

receptors by human melanoma-specific cytolytic T lymphocytes, J.

Exp. Med. 190 (1999) 775–782.

[45] P. Fisch, A. Moris, H.G. Rammensee, R. Handgretinger, Inhib-

itory MHC class I receptors on cd T cells in tumour immunity andautoimmunity, Immunol. Today 21 (2000) 187–191.

[46] L. Moretta, R. Biassoni, C. Bottino, M.C. Mingari, A. Moretta,

Human NK-cell receptors, Immunol. Today 21 (2000) 420–422.

[47] H. Das, V. Groh, C. Kuijl, M. Sugita, C.T. Morita, T. Spies, J.F.

Bukowski, MICA engagement by human Vc2Vd9 T cells enhancestheir antigen-dependent effector function, Immunity 15 (2001) 83–

93.

[48] S. Bauer, V. Groh, J. Wu, A. Steinle, J.H. Phillips, L.L. Lanier, T.

Spies, Activation of NK cells and T cells by NKG2D, a receptor

for stress-inducible MICA, Science 285 (1999) 727–729.

[49] J. Wu, Y. Song, A.B. Bakker, S. Bauer, T. Spies, L.L. Lanier, J.H.

Phillips, An activating immunoreceptor complex formed by

NKG2D and DAP10, Science 285 (1999) 730–732.

[50] D. Pende, C. Cantoni, P. Rivera, M. Vitale, R. Castriconi, S.

Marcenaro, M. Nanni, R. Biassoni, C. Bottino, A. Moretta, L.

Moretta, Role of NKG2D in tumor cell lysis mediated by human

NK cells: cooperation with natural cytotoxicity receptors and

capability of recognizing tumors of nonepithelial origin, Eur. J.

Immunol. 31 (2001) 1076–1086.

[51] D. Cosman, J. Mullberg, C.L. Sutherland, W. Chin, R. Armitage,

W. Fanslow, M. Kubin, N.J. Chalupny, ULBPs, novel MHC class

I-related molecules, bind to CMV glycoprotein UL16 and

stimulate NK cytotoxicity through the NKG2D receptor, Immu-

nity 14 (2001) 123–133.

[52] E. Ciccone, D. Pende, M. Vitale, L. Nanni, C. Di Donato, C.

Bottino, L. Morelli, O. Viale, A. Amoroso, A. Moretta, Self class I

molecules protect normal cells from lysis mediated by autologous

natural killer cells, Eur. J. Immunol. 24 (1994) 1003–1006.

[53] R. Handgretinger, A. Geiselhart, A. Moris, R. Grau, O. Teuffel,

W. Bethge, L. Kanz, P. Fisch, Pure red-cell aplasia associated

S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44 43

with clonal expansion of granular lymphocytes expressing

killer-cell inhibitory receptors, N. Engl. J. Med. 340 (1999)

278–284.

[54] S. Ferrone, F.M. Marincola, Loss of HLA class I antigens

by melanoma cells: molecular mechanisms, functional signifi-

cance and clinical relevance, Immunol. Today 16 (1995) 487–

494.

[55] E.J. Wiertz, S. Mukherjee, H.L. Ploegh, Viruses use stealth

technology to escape from the host immune system, Mol. Med.

Today 3 (1997) 116–123.

44 S. Rothenfusser et al. / Cellular Immunology 215 (2002) 32–44