lable at ScienceDirect

Fish & Shellfish Immunology 45 (2015) 608e618

Contents lists avai

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate/ fs i

Full length article

Modulation of immunity and gut microbiota after dietaryadministration of alginate encapsulated Shewanella putrefaciens Pdp11to gilthead seabream (Sparus aurata L.)

H�ector Cordero a, Francisco A. Guardiola a, Silvana Teresa Tapia-Paniagua b,Alberto Cuesta a, Jos�e Meseguer a, M. Carmen Balebona b, M. �Angel Mori~nigo b,M. �Angeles Esteban a, *

a Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, Regional Campus of International Excellence “CampusMare Nostrum”, University of Murcia, 30100 Murcia, Spainb Group of Prophylaxis and Biocontrol of Fish Diseases, Department of Microbiology, Campus de Teatinos s/n, University of Malaga, 29071 M�alaga, Spain

a r t i c l e i n f o

Article history:Received 3 March 2015Received in revised form28 April 2015Accepted 5 May 2015Available online 21 May 2015

Keywords:Shewanella putrefaciens Pdp11Alginate encapsulationProbioticImmunityMicrobiotaGilthead seabream (Sparus aurata)

* Corresponding author. Tel.: þ34 868887665; fax:E-mail address: aesteban@um.es (M.�A. Esteban).

http://dx.doi.org/10.1016/j.fsi.2015.05.0101050-4648/© 2015 Elsevier Ltd. All rights reserved.

a b s t r a c t

The potential benefits of probiotics when administering to fish could improve aquaculture production.The objective of this study was to examine the modulation of immune status and gut microbiota ofgilthead seabream (Sparus aurata L.) specimens by a probiotic when administered encapsulated. Com-mercial diet was enriched with Shewanella putrefaciens Pdp11 (SpPdp11, at a concentration of 108 cfu g�1)before being encapsulated in calcium alginate beads. Fish were fed non-supplemented (control) orsupplemented diet for 4 weeks. After 1, 2 and 4 weeks the main humoral and cellular immune pa-rameters were determined. Furthermore, gene expression profile of five immune relevant genes (il1b, bd,mhcIIa, ighm and tcrb) was studied by qPCR in head kidney. On the other hand, intestinal microbiota offish was analysed at 7 and 30 days by DGGE. Results demonstrated that administration of alginateencapsulated SpPdp11 has immunostimulant properties on humoral parameters (IgM level and serumperoxidase activity). Although no immunostimulant effects were detected on leucocyte activities, sig-nificant increases were detected in the level of mRNA of head-kidney leucocytes for mhcIIa and tcrb after4 weeks of feeding the encapsulated-probiotic diet. The administration of SpPdp11 encapsulated inalginate beads produced important changes in the DGGE patterns corresponding to the intestinalmicrobiota. Predominant bands related to lactic acid bacteria, such as Lactococcus and Lactobacillusstrains, were sequenced from the DGGE patterns of fish fed the probiotic diet, whereas they were notsequenced from fish receiving the control diet. The convenience or not of probiotic encapsulation isdiscussed.

© 2015 Elsevier Ltd. All rights reserved.

1. Introduction

The use of probiotics is a key tool to protect or treat farmed fish,in many cases predisposed to stress and/or infection under inten-sive culture conditions [1]. In our days, they are seen as an effectiveand sustainable strategy to prevent or combat fish diseases. Incontrast, many adverse effects are known as a consequence of thearbitrary use of antibiotics in fish, a usual practice that not onlyleads to the emergence of antibiotic-resistant pathogenic bacteria

þ34 868883963.

but also causes a strong environmental impacts [2,3]. Probioticswere initially defined as live microbial culture added to feed or tothe water to increase viability (survival) of the fish [4]. This defi-nition has been in continuous actualization in order to correlate thedefinition itself with the proven benefits of the use of probiotics. Inthis sense, according to Merrifield et al. [5], probiotics in an aqua-culture context are live, dead or component(s) of a microbial cellthat, when administered into the feed or to the rearing water,benefits the host by improving either disease resistance, healthstatus, growth performance, feed utilization or stress response,among other functions. Most of the available literature concerningthe use of probiotics in fish is focus on the effects of dietaryadministration of live probiotics [6,7].

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618 609

Curiously, despite the many available works on probiotics in fish,so little is known of its mode of action, and the same applies tostudies in other animals. The precise way of action of probiotics is yetto be established in fish because they frequently exert host specificand strain specific differences in their activities. Furthermore, manyother factors like source or way, dosage and administration time ofsupplementation of probiotics can significantly affect their activities[7]. However, it is considered that in fish, as occurs in mammalianand other vertebrates, gut colonization of the probiotic bacterialstrains is one of the initial steps in order to exert their positive effectsin the host [8]. Despite the aforementioned advantages of probiotics,the viability of live bacteria during large-scale production of food(i.e., commercial diets), during long-term storage [9] and duringtransition through the gastrointestinal tract (i.e., the presence ofacids, pepsin, bile salts and pancreatic secretions) is not reliable[10]. Therefore, there is currently much interest in getting better orprolong the viability of probiotics to be administered in the diet.

Among all the methods developed to preserve probioticviability, encapsulation is one of most relevant due to ensure thesurvival of bacteria in order to guarantee not only the viability ofthe probiotic but also the multiplication at the targeted region(posterior intestinal tract) when supplied orally [11e13]. Severaltypes of biopolymers and coated materials have been tested forprobiotics encapsulation (e.g. alginate, gelatine, chitin, chitosan,pectin, cellulose derivatives) [9,14,15]. Sometimes, even combina-tions of two materials such as alginate-chitosan [16], alginate-gelatine [17], alginate/chitosan/alginate [18] or alginate-skim milkmicrospheres [19,20] have been used. On the other hand, severalencapsulation methods such as spray drying, extrusion or emulsionhave been reported [9,14,15]. It is important to appreciate that mostof these studies about the effects of encapsulated probiotics havebeen developed using in vitro approaches thinking in the possibletherapeutic applications of such probiotics as functional foods forhumans. The final aim of these works was to probe the efficiency ofencapsulation on probiotic viability [21] although more recently,few studies have also focused on the probiotic release behaviourwhen administered encapsulated [22]. Surprisingly, there arealmost no studies focused on whether probiotic encapsulation iscorrelated or not with greater benefits in the host. Regarding fish,the studies about the use of encapsulation of probiotics are juststarting. One of the major benefits of probiotics on fish is theirimmunostimulant effects; furthermore, immunomodulation is ausual prophylactic strategy in teleosts and probiotics possess thisbeneficial feature. Other important aspect, it is the effect that theseagents can exert on the host intestinal microbiota, considering thekey role played by it on the host immunity through the immu-nostimulation and development of the associated lymphoid tissues[23,24]. Due to all these main considerations, the aim of the presentwork was to study the effect of the dietary administration of theprobiotic Shewanella putrefaciens Pdp11 encapsulated on alginatebeads on themain innate immune parameters of gilthead seabream(Sparus aurata L.). Furthermore, the expression profile of five im-mune relevant genes [interleukin 1b (il1b), b-defensin (bd), majorhistocompability complex class IIa (mhcII), immunoglobulin M(ighm) and T-cell receptor b (tcrb)] was analysed in the head-kidneyas well as the changes produced in gut microbiota. A comparisonbetween the previous determined effects of non-encapsulatedprobiotics and encapsulated enriched diets is provided.

2. Materials and methods

2.1. S. putrefaciens Pdp11 growth and maintenance

The strain Pdp11 was isolated from the skin of healthy speci-mens of S. aurata [25]. Bacteria cells were grown in agar plates for

24 h and, afterwards, one colonywas inoculated in tubes containing5 ml of trypticase soy broth (TSB, SigmaeAldrich) supplementedwith 1.5% NaCl (TSBs). Bacteria cell culture was incubated (20 h,22 �C) and the number of bacteria was adjusted at 108 cfu ml�1 andaliquots were stored at 4 �C until use.

Pdp11 cells were grown in tubes containing 5 ml of trypticasesoya broth (Oxoid) supplemented with 1.5% NaCl (TSBs) at 22 �C,with continuous shaking for 18 h, according to Salinas et al. [26]. Avolume of the culture was spread onto plates of tryticase soya agar(Oxoid) supplemented with 1.5% NaCl (TSAs), using a cotton swabto achieve bacterial mass, and the plates were then incubated at22 �C for 24 h. The bacterial suspensions were prepared by scrapingthe cells from plates and washing them in sterile phosphate-buffered saline (PBS, pH 7.4) with continuous shaking. The num-ber of bacterial cells present per milliliter of culture medium of thebacteria cultures was measured by using a Z2 Coulter ParticleCounter (Beckman Coulter, Barcelona, Spain), and adjusted to therequired concentrations.

2.2. Experimental diets

Commercial pellet diet (Skretting) was crushed and mixed withphosphate buffer saline (PBS), sodium alginate (SigmaeAldrich)and bacterial suspensions at the desired concentration rate(108 cfu g�1) [21]. Bacterial suspensions in a saline solution ob-tained as mentioned above were centrifuged (2.000 g, 15 min, 4 �C)and resuspended in aqueous alginate solutions (25 ml) containing1% alginate concentration (SigmaeAldrich) to achieve 108 cfu g�1

(final concentration). The final bacterial concentrations in alginatewere determined by plate count on TSAS. Then, droplets of themixture of commercial pellet diet crushed, alginate and cells wereadded drop wise using a peristaltic pump, through a silicone tube,with a 16G needle attached at the end into different 40 ml calciumchloride solutions containing 1% CaCl2 (w/v). This solution wasconstantly homogenized using a magnetic stirrer situated at thebottom of the vessel, in order to prevent the droplets from stickingtogether. A dropping height of 7 cm was used to ensure thatspherical droplets were formed. Capsules were maintained in thecalcium chloride solution for 30 min and then transferred to a sa-line solution. The control diet was processed in the same mannerwithout adding probiotic. The diets were maintained during theexperimental trial at 4 �C till used.

2.3. Fish maintenance

Forty-eight specimens of gilthead seabream (S. aurata L.) ob-tained from Culmarex S.A. (Murcia, Spain) (average weight41.6 ± 3.6 g and average length 14.2 ± 0.4 cm) were kept in runningseawater acuaria (flow water 900 l h�1) at 28‰ salinity, 20 ± 2 �Cand a photoperiod of 12 h light: 12 h dark. They were acclimated for2 weeks prior to the experimental period. Specimens weredistributed in four groups and each one was placed in differentaquaria. Fish from two aquaria were fed encapsulated probioticsupplemented diet (probiotic groups) whilst fish in the other twoaquaria were fed non-supplemented diet (control groups). Fishwere fed daily at 2% rate of the biomass (2 g per fish and per day)and the experimental trial lasted 28 days. Fishwere sampled after 7,14 and 28 days of treatment. All experimental trials were approvedby Ethical Committee of the University of Murcia.

2.4. Fish sampling

Blood samples were collected from the caudal vein with an in-sulin syringe, allowed to clot at 4 �C for 4 h and later the serumwascollected after centrifugation (1.500� g, 5 min) and stored at�80 �C

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618610

until use. Fish were dissected and head-kidney (HK) fragmentswere transferred to 8 ml sRPMI-1640 culture medium [RPMI-1640culture medium (Gibco) supplemented with 0.35% sodium chlorideto adjust the medium's osmolarity to gilthead seabream plasmaosmolarity of 353.33 mOs], 2% (v/v) foetal calf serum (FCS, Gibco),10 ml ml�1 heparin (SigmaeAldrich), 100 IU ml�1, penicillin (Flow)and 100 mg ml�1 streptomycin (Flow) [27]. Cell suspensions wereobtained by forcing fragments of the organ through a nylon mesh(mesh size 100 mm), washed twice (400� g, 10 min), counted (Z2Coulter Particle Counter) and adjusted to 107 cells ml�1 in sRPMI.Cell viability was higher than 98%, as determined by trypan blueexclusion test. HK fragments were also stored in TRIzol Reagent(Life Technologies) at �80 �C for later isolation of RNA.

2.5. Humoral parameters

2.5.1. Alternative complement activityThe alternative complement pathway was assayed using sheep

red blood cells (SRBC, Biomedics) as targets according to Ortu~noet al. [28]. Briefly, 100 ml of SRBC suspension (6%) in phenol red-freeHank's buffer (HBSS) (SigmaeAldrich) containing Mg2 and EGTAweremixed with 100 ml of serially diluted serum to give final serumconcentrations ranging from 10% to 0.078%. After incubation(90 min, 22 �C), the samples were centrifuged (400� g, 5 min, 4 �C)to avoid unlysed erythrocytes. The relative haemoglobin content ofthe supernatants was assessed bymeasuring their optical density at550 nm in a plate reader (BMG, Fluostar Omega). The values ofmaximum (100%) and minimum haemolysis were obtained byadding 100 ml of distilled water or HBSS to 100 ml samples of SRBC,respectively. The volume yielding 50% haemolysis was determinedand used for calculating the complement activity of the sample(ACH50) as follows:ACH50 value (units/ml) ¼ 1/K � (reciprocal ofthe serum dilution) � 0.5.

Where K is the amount of serum (ml) giving 50% lysis and 0.5 isthe correction factor since this assay was performed on half scale ofthe original method.

2.5.2. Serum peroxidase activityTotal peroxidase content present in serum was measured ac-

cording to Quade and Roth [29]. Briefly, 50 ml serum was dilutedwith 135 ml of Caþ2 and Mgþ2 free HBSS (SigmaeAldrich) in flat-bottomed 96 well plates. Then, 50 ml of 20 mM 3,30,5,50-tetrame-thylbenzidine hydrochloride (TMB, Sigma) and 5 mM H2O2 (Sig-maeAldrich) were added (both substrates of peroxidase). Thecolour-change reaction was stopped after 2 min by adding 50 mlof 4 M sulphuric acid (H2SO4). The optical density was read at450 nm in a plate reader (BMG, Fluostar Omega). Standard sampleswithout serum were also analysed as negative controls.

2.5.3. Serum immunoglobulin M assayTotal serum IgM levels were analysed using the enzyme-linked

immunosorbent assay (ELISA) [29]. Thus, 20 ml of diluted serum (1/100) were placed in flat-bottomed 96-well plates in triplicate andcoated by overnight incubation at 4 �C with 200 ml of carbo-nateebicarbonate buffer (35 mM NaHCO3 and 15 mM Na2CO3, pH9.6). The plates were rinsed three times with low salt buffer (LSB,20 mM TriseHCl, 380 mM NaCl and 0.05% Tween 20, pH 7.3) beforeblocking for 2 h at room temperature with blocking buffer (3%bovine serum albumin, BSA in LSB). After three rinses with LSB andfive with high salt buffer (HSB, 20 mM TriseHCl, 500 mM NaCl and0.1% Tween 20, pH 7.7), the plates were then incubated for 1 h with100 ml per well of mouse anti-gilthead seabream IgM mono-clomonoclonal antibody (1/100 in blocking buffer, Aquatic Di-agnostics, Scotland), washed and incubated with the secondaryantibody anti-mouse IgG-HRP (1/1000 in blocking buffer, Aquatic

Diagnostics, Scotland). After exhaustive rinsing with HSB the plateswere developed using 100 ml of a 0.42 mM solution of 3,30,5,50-tetramethylbenzidine hydrochloride (TMB, Sigma) prepared dailyin a 100 mM citric acid/sodium acetate buffer, pH 5.4, containing0.01% H2O2. The reaction was stopped after 10 min by adding 50 mlof 2 M H2SO4. The plates were read at 450 nm in a plate reader(BMG, Fluostar Omega). Negative controls were samples withoutserum or without primary antibody.

2.6. Cellular parameters

2.6.1. Leucocyte peroxidase activityHead-kidney leucocytes peroxidase activity was measured ac-

cording to Quade and Roth [30]. To determine leucocyte peroxidasecontent, 106 HK leucocytes in sRPMI were lysed with 0.002%cetyltrimethylammonium bromide (SigmaeAldrich) and, aftercentrifugation (400� g, 10 min), supernatant was transferred to afresh 96-well plate containing 10mM TMB and 5mMH2O2. Colour-change reaction was stopped after 2 min by adding 50 ml of 2 Msulphuric acid and the optical density was read at 450 nm in a platereader (BMG, Fluostar Omega). Standard samples without leuco-cytes were used as blanks.

2.6.2. Respiratory burst activityRespiratory burst of gilthead seabream HK leucocytes was

studied by a chemiluminescence method [25]. For in vivo assay,100 ml of HK leucocyte suspension (obtained from fish fed thedifferent experimental diets) were placed in triplicate in wells of a96-well flat-bottomed plate. Then, 100 ml of HBSS (Hank's balancedsalt solution, Gibco) containing 1 mgml�1 phorbol myristate acetate(PMA, SigmaeAldrich) and 10�4 M luminol, (SigmaeAldrich) wereadded to each well. The plates were shaken and immediately readin a plate reader for 1 h at 2 min intervals. The kinetic of the re-actions was analysed and the maximum slope of each curvecalculated. Backgrounds of luminescence were calculated usingreactant solutions containing luminol but not PMA.

2.6.3. Phagocytic activityPhagocytosis of Saccharomyces cerevisiae (strain S288C) by gilt-

head seabream HK leucocytes was studied by flow cytometry [31].Heat-killed and lyophilized yeast cells were labelled with fluores-cein isothiocyanate (FITC; SigmaeAldrich), washed and adjusted to5 � 107 cells ml�1 in sRPMI (Gibco). Samples consisted of 125 ml oflabelled-yeast cells and 100 ml of HK leukocytes in sRPMI. Sampleswere centrifuged (400� g, 5 min, 22 �C), before being resuspendedand incubated at 25 �C for 30 min. At the end of the incubationtime, the samples were placed on ice to stop phagocytosis and400 ml ice-cold PBS were added to each sample. The fluorescence ofthe extracellular yeasts was quenched by adding 40 ml ice-coldtrypan blue (0.4% in PBS). Standard samples of FITC-labelled S.cerevisiae or HK leucocytes were included in each phagocytosisassay. All samples were analysed in a flow cytometer (BectonDickinson) with an argon-ion laser adjusted to 488 nm. Analyseswere performed on 3000 cells, which were acquired at a rate of300 cells s�1. Datawere collected in the form of two-parameter sidescatter (granularity) (SSC) and forward scatter (size) (FSC), andgreen fluorescence (FL1) and red fluorescence (FL2) dot plots orhistogramswere made on a computerised system. The fluorescencehistograms represented the relative fluorescence on a logarithmicscale. The cytometer was set to analyse the phagocytic cells,showing highest SSC and FSC values. Phagocytic ability was definedas the percentage of cells with one or more ingested yeast cells(green-FITC fluorescent cells) within the phagocytic cell popula-tion. The relative number of ingested yeasts per cell (phagocyticcapacity) was assessed in arbitrary units from the mean

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618 611

fluorescence intensity of the phagocytic cells. The quantitativestudy of the flow cytometry results was made using the statisticaloption of the Lysis Software Package (Becton Dickinson).

2.7. Gene expression analysis

Relative gene expression was analysed in six fish per treatmentusing quantitative real-time PCR (qRT-PCR) and the Total RNA wasextracted from 0.5 g of seabream HK samples using TRIzol Reagent(Life Technologies), quantified and the purity was assessed byspectrophotometry; the 260:280 ratios were 1.8e2.0. The RNA wasthen treated with DNase I (Promega) to remove genomic DNAcontamination. Complementary DNA (cDNA) was synthesized from1 mg of total RNA using the SuperScript III reverse transcriptase(SSIII; Life Technologies) with an oligo-dT18 primer. The expressionof selected genes was analysed by real-time PCR with 2�DDCT

method [32], which was performed with an ABI PRISM 7500 in-strument (Applied Biosystems) using SYBR Green PCR Core Re-agents (Applied Biosystems). Reactionmixtures (containing 10 ml of2 � SYBR Green supermix, 5 ml of primers (0.6 mM each) and 5 ml ofcDNA template) were incubated for 10 min at 95 �C, followed by 40cycles of 15 s at 95 �C, 1 min at 60 �C, and finally 15 s at 95 �C, 1 minat 60 �C and 15 s at 95 �C. Specific PCR primers were designed forthe amplification of products (~100 bp) from the constant region ofall genes analysed and elongation factor 1a (ef1a) as reference gene.The primers are shown in Table 1. In all cases, each PCR was per-formed with triplicate samples.

2.8. Analysis of the intestinal microbiota

After 7 and 30 days of treatment with control and probiotictreatments, four individual intestinal lumen contents werecollected with 1 ml PBS pH 7.2, and a 1 ml aliquot per sample wascentrifuged (1000� g, 5 min). Total DNA was extracted from eachsample as described elsewhere [33]. Pure cultures of the probioticstrain SpPdp11 were grown to exponential phase in TSBs, and thencentrifuged (2500� g, 15 min). Pellets were washed with PBS andused for DNA extraction following the instructions of the Fast DNASpin kit (Qbiogene, CA. USA). DNA was amplified using the 16SrDNA bacterial domain-specific primers 968-GC-F(50GAACGCGAAGAACCTTAC-30) and 1401-R(50CGGTGTGTACAAGACCC-30). Primer 968-CG-F carries a 35 pb GCclamp. PCR mixtures and conditions to perform PCR were thosepreviously described by Tapia-Paniagua et al. [34]. Amplicons ob-tained were separated by DGGE according to the specifications ofMuyzer et al. [35] using a Dcode TM system (Bio-Rad Laboratories,Hercules, CA). The gels were subsequently stained with AgNO3 [36].

Table 1Oligonucleotide primers used for real-time PCR.

Gene Abbreviation GenBankID

Primer sequence (50 / 30)

Elongation factor 1alpha

ef1a AF184170 F: CTGTCAAGGAAATCCGTCGTR: TGACCTGAGCGTTGAAGTTG

Interleukin 1-b il1b AJ277166 F: GATAAGGCGGGTGGGTTTATR: GGTGTTCCATATCGGCTGTT

b-defensin bd FM158209 F: CCCCAGTCTGAGTGGAGTGTR: AATGAGACACGCAGCACAAG

Majorhistocompabilitycomplex IIa

mhcIIa DQ019401 F: CTGGACCAAGAACGGAAAGAR: CATCCCAGATCCTGGTCAGT

Immunoglobulin M ighm AM493677 F: CAGCCTCGAGAAGTGGAAACR: GAGGTTGACCAGGTTGGTGT

T-cell receptor b tcrb AM261210 F: AAGTGCATTGCCAGCTTCTTR: TTGGCGGTCTGACTTCTCTT

DGGE banding patterns were analysed using FPQuest Softwareversion 4.0 (Applied Maths BVBA, Sint-Martens-Latem, Belgium). Amatrix of similarities for the densitometric curves of the bandpatterns was calculated using the BrayeCurtis index. Clustering ofDGGE patterns was achieved by construction of dendrograms usingthe Unweighted Pair Groups Method with Arithmetic Averages(UPGMA). Structural diversity of the microbial community wasdetermined with an analysis of the DGGE-patterns considering thata relevant band must be present in the DGGE profiles of at leastthree out to five specimens analysed per diet. In order to determinethe structural diversity of the microbial community correspondingto the DGGE banding pattern, the following parameters werecalculated: (1) Species richness (R) was calculated based on thetotal number of bands; (2) Shannon index (H0) was also calculatedfollowing the function: H0 ¼ �S Pi log Pi, where Pi is defined as (ni/N), ni is the peak surface of each band, and N is the sum of the peaksurfaces of all bands; and (3) the range-weighted richness index(Rr) [37], calculated as the total number of bands multiplied by thepercentage of denaturing gradient needed to describe the totaldiversity of the sample analysed, according to the following for-mula: Rr¼ (N2�Dg), where N represents the total number of bandsin the pattern and Dg is the denaturing gradient comprised be-tween the first and the last band of the pattern. These authorsproposed ranges to classify Rr, such as values higher than 30 cor-responding to environments with high capability, whilst valuesfrom 10 to 30 and lower than 10 correspond to systems showing amedium and low capability, respectively.

Predominant bands in the DGGE gels representing �2% of thetotal intensity of bands were retrieved for sequencing using sterilepipette tips, placed in 100 ml of double distilled water (ddH2O) andincubated at 4 �C overnight. Five microliters were used as templatein a PCR amplification reaction performed as described above. Theproduct was re-run on DGGE to confirm its position and furthersubjected to cycle sequencing with primers 968-without the GCclamp (50-AACGCGAAGAACCTTAC-30) and 1401-R. The PCR wasperformed in a T1 thermocycler (Whatman Biometra, G€ottingen,Germany) using one cycle at 94 �C for 2 min, 28 cycles of 95 �C for30 s, 56 �C for 40 s and 72 �C for 1 min, followed by one cycle at72 �C for 5 min. Products were purified using the High Pure Spin KitPCR purification kit (Roche). Amplicons were sequenced on ABIPRISM 377 sequencer (PerkineElmer). The sequence was read fromboth directions with primers RV-M and M13-47, respectively. Theresulting sequences (~500 bp) were compared with those from theNational Center for Biotechnology Information (NCBI) or Greengenes DNA sequence database using the BLAST sequence algorithm[38]. Database sequences showing the highest identity were usedto infer identity. Due to that the high resolution of DGGE does notexclude the possibility that two different 16S rDNA sequencesmight migrate to exactly the same position; all sequences thatmigrated to the same positionwere sequenced. Phylogenetic tree ofbacterial 16S rRNA gene sequences was constructed from the se-quences obtained in this study related to Lactobacillus strains, andthose references sequences by neighbour-joining procedures [39].

2.9. Statistical analysis

The results are expressed as mean ± standard error (SE). Datawere statistically analysed by one-way analysis of variance(ANOVA) to determine differences between groups. Normality ofthe data was previously assessed using a ShapiroeWilk test andhomogeneity of variance was also verified using the Levene test.Non-normally distributed data were log-transformed prior toanalysis and a non-parametric KruskaleWallis test, followed by amultiple comparison test (Duncan multiple range test) was usedwhen data did not meet parametric assumptions. Statistical

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618612

analyseswere conducted using Statistical Package for Social Science(SPSS for Windows; v19.0) and differences were considered sta-tistically significant when p � 0.05.

3. Results

The present results demonstrated that some humoral innateimmune parameters of gilthead seabream were enhanced afterdietary administration of alginate encapsulated probioticS. putrefaciens Pdp11.

3.1. Humoral innate immune parameters

No significant differences were detected in serum complementactivity from fish fed supplemented and control diets at anyassayed time (Fig. 1A). Regarding serum peroxidase activity ofgilthead seabream specimens fed with encapsulated probiotic dietwas always increased in a statistical significant way respect to thelevel found in the sera from control fish (fed control diet) (Fig. 1B).

Fig. 1. Serum complement activity (ACH50 units ml�1) (A), peroxidase activity(units ml�1) (B) and immunoglobulin M level (OD 450 nm) (C) from gilthead seabreamspecimens fed control diet (black bars) or encapsulated probiotic diet (white bars) after1, 2 and 4 weeks of experiment. Bars represent the mean ± SE (n ¼ 8). Asterisks denotesignificant differences between treatment groups (p � 0.05).

Similarly, serum IgM level of fish fed encapsulated probiotic diet for2 weeks was also increased in a significant extend; however, theserum IgM levels from fish fed supplemented diet for 1 or 4 weekswere no statistically significant respect to the values obtained forfish from control group (Fig. 1C).

3.2. Cellular innate immune parameters

In regard to cellular innate immune parameters, any of thecellular activities tested (leucocyte peroxidase content, respiratoryburst activity and phagocytic activity and capacity) showed a sta-tistical significant differences between fish fed probiotic diet andcontrol (non-supplemented) diet at any time of the experimentaltrial (Fig. 2AeD).

3.3. Immune relevant gene expression

Gene expression profile of five immune relevant genes on HKgilthead seabream leucocytes from fish fed probiotic encapsulateddiet or control diet (non-supplemented) were studied by real-timePCR. Results demonstrated a general increase in probiotic-encapsulated group compared with control group. Moreconcretely, significant up-regulation was found for mhcIIa and tcrbgene expression profile after four weeks of experimental trial. Fortcrb gene expression showed 2.4 fold in probiotic-encapsulatedgroup, whilstmhcIIa gene expressionwasmore than 17 fold (Fig. 3).

3.4. Microbiota

The results obtained in this study showed that the supple-mentation of the diet with the encapsulated probiotic SpPdp11 didnot promoted significant differences in the values of the richness(R) and the biodiversity (H0) of the intestinal microbiota, in com-parison with the values observed in control fish (Table 2). On thecontrary, and according to the criteria proposed by Marzorati et al.[37], the values of the range-weighted richness (Rr) for all fishcorresponded to environments with very high capability to supporthigh variety of phylogenetically different species. However, theDGGE patterns of fish fed with the probiotic treatment showedsignificant higher values (136.12 and 122.50 at 7 and 30 days,respectively), in comparison with fish receiving the control treat-ment (110.26 at 7 and 30 days).

When predominant DGGE bands were sequenced in fish fedwith the probiotic diet important differences regards to the intes-tinal microbiota of control fish from 7 days of treatment (Table 3). Inthis way, fish treated with the probiotic showed: the reduction ofDGGE bands related to g-Proteobacteria, especially after 30 days oftreatment; absence of predominant bands related to cyanobacteriaand Vibrio genus; and the presence of bands related to Lactic AcidBacteria (LAB). The similitude of two of these bands was 100% withLactococcus lactis and Lactobacillus fermentum, whereas othersthree bands (10, 17 and 22) were related to uncultured strains ofLactobacillus (Table 3). A phylogenetic tree was made to check thesimilitude of these bands with some Lactobacillus species, such asLactobacillus crispatus, Lactobacillus gasseri or Lactobacillus johnsonii(Fig. 4).

4. Discussion

Encapsulation of probiotic bacteria is generally used to enhancethe viability of such bacteria during processing, and also for thetarget delivery in the gastrointestinal tract. Furthermore, for humanconsume, probiotics are used with fermented dairy products orwith pharmaceutical products, although both of them appearedalways related to consumer health. To our days, the survival of

Fig. 2. Leucocyte peroxidase activity (units 10�7 leucocytes) (A), respiratory burstactivity (slope min�1) (B) and phagocytic ability (%) (C) and phagocytic capacity (a.u.)(D) of head-kidney leucocytes from gilthead seabream specimens fed with control diet(black bars) and encapsulated probiotic diet (white bars) after 1, 2 and 4 weeks ofexperiment. Bars represent the mean ± SE (n ¼ 8). Asterisks denote significant dif-ferences between treatment groups (p � 0.05).

Fig. 3. Gene expression profile of five immune relevant genes determined by real timePCR in head-kidney from gilthead seabream fed with encapsulated probiotic diet after1 (black bars), 2 (white bars) and 4 (grey bars) weeks of experiment. Bars represent themean ± SEM (n ¼ 8) fold increase relative to control. Asterisks denote significantdifferences between treatment groups (p � 0.05).

Table 2Species richness (R) (expressed as number of different bands) and Shannon index(H0) values of intestinal microbiota of gilthead seabream specimens untreated(Control) or receiving commercial diet supplemented with the probiotic Shewanellaputrefaciens Pdp11 (SPPdp11) for 7 and 30 days. Values with different letter aresignificantly different (p < 0.05) compared to the control.

Time of treatment

7 days 30 days

Control SpPdp11 Control SpPdp11

Richness (R) 24.75 ± 5.58 27.50 ± 2.69 24.75 ± 3.34 25.00 ± 3.74Shannon index

(H0)2.98 ± 0.37 3.16 ± 0.77 3.07 ± 0.12 2.98 ± 0.28

Range-weightnedrichness (Rr)

110.26 ± 5.61a 136.12 ± 1.30b 110.26 ± 2.01a 122.50 ± 2.52b

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618 613

these bacteria in the human gastrointestinal system is question-able. For this main reason, in order to protect the viability of theprobiotic bacteria, several types of biopolymers such as alginate,chitosan, gelatin, whey protein isolate and cellulose derivativeshave been used for probiotic encapsulation. At the same time,

several methods of encapsulation such as spray drying, extrusion oremulsion have been reported [9,14,15].

In previous works, our group has evaluated the effects of theprobiotic SpPdp11 on gilthead seabream and Senegalese sole (Soleasenegalensis). Regarding seabream, we have checked the effect ofthe probiotic heat-inactivated both in vitro and in vivo conditions[26,40], and its effect when administered alone or combined withdifferent immunostimulants such as b-1,3/1,6-glucan [41] and datepalm extracts [42]. In the present work, we focus on the effects ofSpPdp11 alive and encapsulated in calcium alginate beads on innateimmune parameters and gut microbiota in gilthead seabream.Although probiotics are of a major potential therapeutic interest,their efficacy is usually limited by poor bioavailability of viablemicroorganisms on site. However, the ability to colonize the in-testine by SpPdp11 of farmed fish such as Senegalese sole has beenreported [43,44]. Calcium alginate beads were selected for thepresent study since calcium alginate is recognized as a simple,inexpensive, and non-toxic method for using when thinking in thefood and pharmaceutical industries application [45]. Furthermore,encapsulationwith alginate is also one of the most commonly usedpractice for using probiotics to be consumed for human beings [46]and, more recently, this methodology has been starting to test onfish probiotic Pdp11 by our research team [21]. More concretely,different alginate and calcium chloride concentrations wereassayed to establish optimum conditions for bead preparation.Furthermore, the obtained capsules were characterized and theinfluence of the storage temperature and passage through fish GITon probiotics viability were also determined. Results indicate thatPdp11 can be encapsulated successfully in calcium alginate beads

Table 3Mean percentage of intensity of bands showing �2% of the total intensity, and nearest-match identification of 16S rDNA sequences corresponding tointestinal microbiota of gilthead seabream specimens with the control treatment and groups treated with the probiotic Shewanella putrefaciens Pdp11(SpPdp11) during 7 and 30 days. ND: Non detected.

Related microorganism GenBank accession Similarity % Control treatment SpPdp11 treatment

7 days 30 days 7 days 30 days

g-ProteobacteriaUncultured gamma proteobacterium clone RBE1CI-38 EF111061 96 2.00 2.09 2.11 NDGamma proteobacterium 6.1.12 GU352683 99 3.08 0 4.30 0Gamma proteobacterium 7.1.14_S GU352879 99 4.15 8.32 8 8.12Enterobacteriaceae bacterium GGC-D12 FJ348020 100 4.20 ND 4.22 4.35Pseudomonas fluorescens strain XXPFMDU1 GU048851 100 3.10 2.89 3.29 NDPseudomonas putida 5IIANH AF307869 98 2.25 4.75 ND NDPseudomonas putida GU060497 99 3.09 ND 2.38 NDUncultured Pseudomonadaceae LW9m-3-63 EU641589 98 ND ND 4.13 4.30Serratia sp. GIST-WP4w1 EF428994 99 2.19 2.22 2.39 NDSerratia sp. W2Dec25 JN106438 100 4.32 2.25 ND NDSerratia proteaxmaculans strain KBx22 JF327454 99 4.12 4.05 ND NDVibrio sp AB457052 99 8.07 8.11 ND NDCyanobacteriaUncultured cyanobacterium FJ178040 100 4.23 4.01 ND NDFirmicutesLactococcus lactis subsp. lactis strain MD EU337106 98 ND ND 4.22 4.54Lactobacillus fermentum AM117157 100 ND ND 4.25 6.33Uncultured Lactobacillus clone 4EV9 (Band 10) AM117146 100 ND ND 5.09 4.00Uncultured Lactobacillus 4EV10 (Band 17) AM117146 100 ND ND 4.15 4.05Uncultured Lactobacillus sp. (Band 22) AM117177 100 ND ND 4.50 6.12Unidentified bacteriaUncultured bacterium clone OTU34 KC120618 98 ND 3.39 ND 3.36Uncultured bacterium clone BR01AD06 DQ857141 99 4.01 3.99 ND NDUncultured bacterium clone RMAM1304 HQ320228 99 2.00 2.17 2.05 2.31

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618614

(the percentages of encapsulated cells were above 80%). In addition,results corroborated that capsules containing viable Pdp11 can bestored at 4 �C for at least onemonth, survival rates being above 90%.Besides that, the viability of encapsulated probiotics through fishgastrointestinal tract was demonstrated. All these previous datawere considered to design the present work.

Fig. 4. Phylogenetic tree of bacterial 16S rRNA constructed from gene sequences ob-tained in this study and related with uncultured Lactobacillus strains and referencesequences by neighborjoining procedures, using a bacterial filter, as implemented inARB [39].

Greater viability of the probiotic in the hostile environment ofthe host digestive system or during storage [12] have been themoststudied effect of encapsulationwhen applied to bacterial probiotics,as well as the bacteria behaviour upon release [22]. However, to ourknowledge, no previous studies have focused on whether or notprobiotic encapsulation is correlated with major beneficial effectsof probiotics on host immune system. This is just the intention ofthe present work. There are very few results demonstrated signif-icant positive consequences of the application of the encapsulationtechnique to protect and/or enhance the functional properties ofthe probiotic cells and those available have been in vitro assays. Forexample, Zhao et al. [20] studied the ability of an encapsulationtechnique to protect the functional properties of cells of Lactoba-cillus reuteri during passage through a simulated gastrointestinaltract. Afterwards, the functional properties of the cells were studiedand the recovered cells showed no diminution in functional prop-erties (e.g. growth kinetics, ability to adhere to epithelial cells andability to inhibit the adhesion of Escherichia coli to epithelial cells).Furthermore, the bacteriostatic and bactericidal properties of therecovered cells against some pathogens were significantly greaterthan those of the original cells and production of reuterin (anantimicrobial compound produced by L. reuteri cells) by therecovered cells was significantly greater than that of the originalcells. Similarly, Lactobacillus plantarum 25 encapsulated into algi-nate/chitosan/alginate microcapsules were characterized to assesstheir efficacy in oral delivery. Such microcapsules induced thesecretion of tumour necrosis factor alpha (TNFa) and interleukin-6(IL6) from macrophages and dendritic cells proving the immuno-modulatory effect of such probiotic [18]. There are also some in vitroresults on the effect of microencapsulation of Lactobacillus salivarus29 into alginate/chitosan/alginate microcapsules on cytokine in-duction in RAW264.7 which showed high level of induction of TNFaand IL10. These results support the hypothesis that the L. salivariusmight have a balanced immunomodulatory effect [47].

Some health benefits have been observed for several probiotics,whose deciphering mechanism(s) of action can be of utmost

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618 615

significance. Perhaps, one of the major modes of action of theprobiotics is through modulation of the host immune system, asthey are hypothesized to invigorate the intestinal immune barriers[48]. The immune-enhancing effects obtained from probiotics inmammals may be attributed to (a) enhancement of secretion ofimmunoglobulin A, (b) stimulation of pro-inflammatory pathway,(c) regulation of interleukins, and (d) activation of cytokine path-ways [49].

Teleosts have a more diffuse gut associated lymphoid systemthan mammals, which is morphological and functional clearlydifferent from the mammalian gut associated lymphoid tissue(GALT). All immune cells necessary for a local immune responseare abundantly present in the gut mucosa of the species studiedand local immune responses can be monitored after intestinalimmunization [24]. Teleost intestine can be exploited for oralvaccination strategies and probiotic immune stimulation. A va-riety of encapsulation methods, to protect vaccines againstdegradation in the foregut, have been also reported with prom-ising results but in most cases they appear not to be cost effectiveyet [24]. Present results demonstrated that administration ofSpPdp11 encapsulated in calcium alginate beads have differentimmunomodulatory effect, depending on the humoral immuneparameter tested while no effects were observed at cellular level.No significant effect was observed in complement activity whilstincreased serum peroxidase activity of gilthead seabream speci-mens fed encapsulated probiotic diet, respect to serum levelsfrom control fish (fed non-supplemented diet) were detected.These results agree with our previous results on the immunos-timulant effects of heat-inactivated SpPdp11 on gilthead seab-ream [26]. It is known that elevation of immunoglobulin level byprobiotics supplementation (either in viable or non-viable form)is reported in many animals including fish (review by Ref. [7]). Inthe present results, serum IgM level of fish fed encapsulatedprobiotic diet for 2 weeks was also increased in a significantextend although the observed increments in such parameterwhen fed fish for 1 or 4 weeks with the enriched diet were nostatistically significant respect to the values obtained for fishfrom control group.

In order to evaluate whether encapsulated-probiotic Pdp11 diethad any effect on immune system at genomic level, five immunerelevant genes were analysed by real-time PCR. Bd is considered anantimicrobial peptide which play an essential role against bacterialinfections [50]. Different immunostimulants such as glucans pro-mote Bd up-regulation [51]. Our Bd gene expression profile(although without statistically significant differences) may suggestalso an up-regulation as a consequence of the feeding withencapsulated probiotic, respect to the values obtained in controlgroup. However, the role of Bd regarding probiotic needs to beelucidated [7]. Regarding il1b, it is one of most important cytokines,especially involved in inflammatory process as pro-inflammatorycytokine [52]. Furthermore, il1b gene expression profile in HK iscorrelatedwith radical oxygen species (ROS) production [53]. In thepresent work, neither a significant increase respiratory burst norsignificant up-regulation mRNA il1b expression levels wereobserved during the experiment, suggesting that encapsulated-probiotic SpPdp11 diet had no effect on the inflammatory pro-cesses. This could be considered a very important result because apositive effect of a probiotic administration on inflammation couldhave negative impacts on host.

Regarding ighm gene expression, its expression profile was notcorrelated with IgM serum levels. No differences in ighm mRNAtranscript levels were found between both experimental groups offish (in other words, fed Pdp11 encapsulated diet and fed non-supplemented diet) which is an indicative of a slow response ongene expression profile after dietary administration of

immunostimulants or probiotics, which is in agreement with pre-vious studies [41]. However, as it was explained before, giltheadseabream serum IgM level increased in a significant extend after 2weeks of fed encapsulated-probiotic diet. These results seem tosuggest only an increase in the release of IgM to seabream serumwithout being necessary for this increment an increase in theproduction of such immunoglobulin at genomic level. Finally, tcrband mhcIIa gene expression profiles were studied because both ofthem could promote a response in antigen presenting cells (APC's)[54,55]. Both gene expressions were up-regulated, achieving themaximum increase after 4 weeks of fed encapsulated probioticPdp11 diet which should provide a more effective immuneresponse against a possible infection.

Ecosystem function and stability are influenced by species andfunctional group richness [56] biodiversity being essential in theprotection of ecosystems against declines in their functionality [57].In this sense, the results obtained demonstrated that the dietarysupplementation with the encapsulated probiotic did not showsignificant differences in the values of richness and biodiversity. Onthe contrary, the values of Rr obtained for all fish were high, andbased on criteria proposed by Ref. [37], they corresponded to en-vironments supporting a high variety of phylogenetically differentspecies. However, values of Rr calculated for fish receiving theprobiotic treatment were significantly different from 7 days afterthe beginning of the probiotic treatment. The values calculatedfrom fish fed with the probiotic diet were higher than those for fishfed the control diet. It could indicate ecological shifts in the intes-tinal microbiota promoted by the probiotic treatment. In this sense,when the predominant DGGE bands were sequenced importantchanges among the intestinal microbiota of fish treated with bothtreatments were detected. In comparison with fish receiving thecontrol treatment, fish treated with the probiotic showed theabsence of a band corresponding to an uncultured cyanobacterium,a reduction of the number of bands corresponding togeProteobacteria (especially marked at 30 days) and the presenceof bands corresponding to LAB.

Tapia-Paniagua et al. [34] reported the presence in the intestinalmicrobiota of Senegalese sole juveniles of one predominant bandrelated to an uncultured cyanobacterium, and the absence of thisband in those specimens fed the diet supplemented with the pro-biotic SpPdp11.

geProteobacteria is the phylogenetic group most frequentlyidentified from the intestinal microbiota of freshwater and marinefish [34,58e60], including gilthead seabream [61]. The reduction ofpredominant bands corresponding to this phylogenetic groupdetected in this study, contrasts with the results obtained in a studycarried out by Tapia et al. [43] applying SpPdp11 to Senegalese solejuveniles for 30 days, in which the percentage of predominantbands corresponding to g-Proteobacteria was very similar to thatobserved in control specimens. Tapia-Paniagua et al. [43] alsoobserved the ability of the probiotic treatment to reduce thenumbers of clones related to Vibrio genus, and it is in accordance tothe absence of predominant bands related with this genus detectedin this study in gilthead seabream specimens receiving the treat-ment with SpPdp11.

In this study, predominant bands related to Lactococcus lactisand Lactobacillus were demonstrated in fish receiving the probiotictreatment but not in control fish [62,63]. Isolated and identified LABfrom the intestine of farmed gilthead seabream fed with a com-mercial diet, whereas in our study the predominant bands relatedto LAB were not demonstrated in the DGGE patterns of fish fed thecontrol diet. However [64,65], analysed the intestinal microbiotausing a culture medium, such as Man Rogosa and Shape Agar, toselect Lactobacillus species. In this way, although the level of LAB inthe gut of fish could have been very low, the possibility to detect

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618616

them increased very much. On the other hand, the absence of thesebands in fish fed with control diet may not exclude the presence ofLAB in the samples, since they could be below the detection limit ofthe DGGE technique [66]. Previously, Tapia-Paniagua et al. [43,67]demonstrated that the administration of SpPdp11 to farmed Sen-egalese sole promoted the presence of predominant DGGE bandsrelated to Lactobacillus helveticus and L. fermentum. In our studybands related to L. fermentum and L. jensenii were sequenced fromDGGE patterns of fish fed the probiotic diet.

Different Lactobacillus species showing probiotic abilities havebeen isolated from the intestinal microbiota of farmed fish [68],and the ability of a commercial probiotic containing Lactobacillusspp to increase significantly the specific activities of pancreaticand intestinal enzymes in gilthead seabream larvae has beendemonstrated [69]. The capability of different Lactobacillus spe-cies to increase the immunological response has also been re-ported in fish such as sea bass [67] and gilthead seabream [70]. Inaddition, specimens of Senegalese sole farmed under highstocking density and receiving a diet supplemented with SpPdp11showed a higher resistance to disease in comparison with fish fedthe diet without the probiotic [67], and this higher resistance wasrelated to important changes in the intestinal microbiota, such asthe presence of L. fermentum only in fish fed the diet supple-mented with the probiotic [43]. Strains of L. crispatus have beenassociated with the ability to exert competitive exclusion andantimicrobial against vaginal human pathogens [69e71], beingproposed as potential vaginal probiotic [72]. On the other hand,some trains of L. gasseri and L. johnsonii have also shown probioticcharacteristics such as immunomodulatory [73] and anti-infective[74e76].

Regards to Lactococcus, several studies have suggested syner-gistic effects by the administration of a mixture of several probioticspecies of Lactobacillus, exerting better immunostimulatory anddisease protective effects in mammals [77]. In the case of fish, theprobiotic effect of strains of L. lactis have reported for farmed fishsuch olive flounder and Siberian sturgeon including interferencewith pathogens [78] and immunomodulatory effects [78,79], suchas the increased phagocytic activity of the mucosal leukocytes [3].Different strains of Lactobacillus and L. lactis showed the ability toinhibit the adhesion to intestinal mucus and activity against Vibriospecies [80,81]. These observations could explain the reduction theDGGE bands related to Vibrio detected in our study from the DGGEpatterns of fish receiving the probiotic treatment. In addition, it hasbeen reported that probiotic mixtures including L. lactis andLactobacillus species have also shown improvements of theimmunological response and resistance against pathogens infarmed fish such as olive flounder [82].

More studies are needed to understand the complexes re-lationships between probiotics and modulation of immune systemand probiotics and immune related gene expression as well as tounderstand the mechanisms by which probiotics exert theirbeneficial effects on the host, which remain largely unknown.Present results indicate that the same probiotic exert different ef-fects on each one of the immune parameters when studied in vivo.For this, is not estranging that the mechanism(s) by which pro-biotics are able to modulate the fish immune system remain(s) stillpoorly understood. Furthermore, future research is likely relatingnovel technologies involving microencapsulation of probiotic bac-terial cells; besides this, it is possible that new active ingredientsdelivered using new techniques, such as hydrogels, nanoemulsions,and nanoparticles will help to understand the effects of probioticson immune and microbiota modulation. Future research is likely tofocus on aspects of delivery and the potential use of co-encapsulation methodologies, where two or more bioactive in-gredients can be combined to have a synergistic effect.

Acknowledgements

H. Cordero wishes to thank the Ministerio de Economía y Com-petitividad for a F.P.I. fellowship. Authors appreciate SAI and CAIDservices for the technical support. This work was co-funded by anational project of the Ministerio de Economía y Competitividad(AGL2011-30381-C03-01 and 02) and Fundaci�on S�eneca de la Regi�onde Murcia (Grupo de Excelencia 04538/GERM/06).

References

[1] J.L. Balc�azar, I. De Blas, I. Ruiz-Zarzuela, D. Cunningham, D. Vendrell,J.L. Múzquiz, The role of probiotics in aquaculture, Vet. Microbiol. 114 (2006)173e186.

[2] E. De la Cruz, M.L. Fournier, F. García, A. Molina, G. Chavarría, M. Alfaro,F. Ramírez, C. Rodríguez, Hazard prioritization and risk characterization ofantibiotics in an irrigated Costa Rican region used for intensive crop, livestockand aquaculture farming, J. Environ. Biol. 35 (2013) 85e98.

[3] J.L. Balc�azar, O. Decamp, D. Vendrell, I. De Blas, I. Ruiz-Zarzuela, Health andnutritional properties of probiotics in fish and shellfish, Microb. Ecol. HealthDis. 18 (2006) 65e70.

[4] L. Gram, Prospects of fish probiotics, Microb. Ecol. Grow. Anim. (2005)379e417.

[5] D.L. Merrifield, A. Dimitroglou, A. Foey, S.J. Davies, R.T.M. Baker, J. Bøgwald, etal., The current status and future focus of probiotic and prebiotic applicationsfor salmonids, Aquaculture 302 (2010) 1e18.

[6] H. Cordero, M.�A. Esteban, A. Cuesta, Use of probiotic bacteria against bacterialand viral infections in shellfish and fish aquaculture, Sustain. Aquac. Tech. 8(2014) 239e265.

[7] S.K. Nayak, Probiotics and immunity: a fish perspective, Fish ShellfishImmunol. 29 (2010) 2e14.

[8] S. Mohapatra, T. Chakraborty, A.K. Prusty, K. PaniPrasad, K.N. Mohanta,Beneficial effects of dietary probiotics mixture on hemato-immunology andcell apoptosis of Labeo rohita fingerlings reared at higher water temperatures,PLoS One 9 (2014) 1e9.

[9] T. Huq, A. Khan, R.A. Khan, B. Riedl, M. Lacroix, Encapsulation of probioticbacteria in biopolymeric system, Crit. Rev. Food Sci. Nutr. 53 (2013) 909e916.

[10] E. Ringø, R.E. Olsen, I. Jensen, J. Romero, H.L. Lauzon, Application of vaccinesand dietary supplements in aquaculture: possibilities and challenges, Rev.Fish Biol. Fish. 24 (2014) 1005e1032.

[11] S.D. Todorov, J.G. Leblanc, B.D.G.M. Franco, Evaluation of the probiotic po-tential and effect of encapsulation on survival for Lactobacillus plantarumST16Pa isolated from papaya, World J. Microbiol. Biotechnol. 28 (2012)973e984.

[12] L.E. Dos Santos, E.A. De Araújo, L.L. Da Conceiç~ao, C.A. De Moraes, A.F. DeCarvalho, Survival of Lactobacillus delbrueckii UFV H2b20 in ice cream pro-duced with different fat levels and after submission to stress acid and bilesalts, J. Funct. Foods 5 (2013) 503e507.

[13] A.V. Rao, N. Shiwnarain, Survival of microencapsulated Bifidobacterium pseu-dolongum in simulated gastric and intestinal juices, Can. Inst. Food Sci.Technol. 22 (1989) 345e349.

[14] L.E. Shi, Z.H. Li, D.T. Li, M. Xu, H.Y. Chen, Z.L. Zhang, et al., Encapsulation ofprobiotic Lactobacillus bulgaricus in alginateemilk microspheres and evalua-tion of the survival in simulated gastrointestinal conditions, J. Food Eng. 117(2013) 99e104.

[15] W. Tee, R. Nazaruddin, Y. Tan, M. Ayob, Effects of encapsulation on theviability of potential probiotic Lactobacillus plantarum exposed to high aciditycondition and presence of bile salts, Food Sci. Technol. Int. 20 (2014) 399e404.

[16] S. Graff, S. Hussain, J.C. Chaumeil, C. Charrueau, Increased intestinal delivery ofviable Saccharomyces boulardii by encapsulation in microspheres, Pharm. Res.25 (2008) 1290e1296.

[17] X.Y. Li, L.J. Jin, J.E. Uzonna, S.Y. Li, J.J. Liu, H.Q. Li, et al., Chitosan-alginate mi-crocapsules for oral delivery of egg yolk immunoglobulin (IgY): in vivo eval-uation in a pig model of enteric colibacillosis, Vet. Immunol. Immunopathol.129 (2009) 132e136.

[18] T. Jiang, Y.K. Kim, B. Singh, S.K. Kang, Y.J. Choi, C.S. Chol, Effect of microen-capsulation of Lactobacillus plantarum 25 into alginate/chitosan/alginate mi-crocapsules on viability and cytokine induction, J. Nanosci. Nanotechnol. 13(2013) 5291e5295.

[19] L.X. Pan, X.J. Fang, Z. Yu, Y. Xin, X.Y. Liu, L.E. Shi, et al., Encapsulation inalginate-skim milk microspheres improves viability of Lactobacillus bulgaricusin stimulated gastrointestinal conditions, Int. J. Food Sci. Nutr. 64 (2013)380e384.

[20] Q. Zhao, A. Mutukumira, S.J. Lee, I. Maddox, Q. Shu, Functional properties offree and encapsulated Lactobacillus reuteri DPC16 during and after passagethrough a simulated gastrointestinal tract, World J. Microbiol. Biotechnol. 28(2012) 61e70.

[21] P. Rosas-Ledesma, J.M. Le�on-Rubio, F.J. Alarc�on, M.A. Mori~nigo, M.C. Balebona,Calcium alginate capsules for oral administration of fish probiotic bacteria:assessment of optimal conditions for encapsulation, Aquac. Res. 43 (2012)106e116.

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618 617

[22] N. Kamalian, H. Mirhosseini, S. Mustafa, M.Y.A. Manap, Effect of alginate andchitosan on viability and release behavior of Bifidobacterium pseudocatenula-tum G4 in simulated gastrointestinal fluid, Carbohydr. Polym. 111 (2014)700e706.

[23] S. Picchietti, M. Mazzini, A.R. Taddei, R. Renna, A.M. Fausto, V. Mulero, et al.,Effects of administration of probiotic strains on GALT of larval giltheadseabream: immunohistochemical and ultrastructural studies, Fish ShellfishImmunol. 22 (2007) 57e67.

[24] J.H.W.M. Rombout, L. Abelli, S. Picchietti, G. Scapigliati, V. Kiron, Teleost in-testinal immunology, Fish Shellfish Immunol. 31 (2011) 616e626.

[25] M. Chabrill�on, R.M. Rico, S. Arijo, P. Díaz-Rosales, M.C. Balebona,M.A. Mori~nigo, Interactions of microorganisms isolated from gilthead seabream, Sparus aurata L., on Vibrio harveyi, a pathogen of farmed Senegalesesole, Solea senegalensis (Kaup), J. Fish Dis. 28 (2005) 531e537.

[26] I. Salinas, P. Díaz-Rosales, A. Cuesta, J. Meseguer, M. Chabrill�on, M.A. Mori~nigo,et al., Effect of heat-inactivated fish and non-fish derived probiotics on theinnate immune parameters of a teleost fish (Sparus aurata L.), Vet. Immunol.Immunopathol. 111 (2006) 279e286.

[27] M.A. Esteban, V. Mulero, J. Mu~noz, J. Meseguer, Methodological aspects ofassessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seab-ream (Sparus aurata L.) by flow cytometry and electron microscopy, CellTissue Res. 293 (1998) 133e141.

[28] J. Ortu~no, M.A. Esteban, V. Mulero, J. Meseguer, Methods for Studying theHaemolytic, Chemoattractant and Opsonic Activities of Seabream (Sparusaurata L.) Serum. Methodology in Fish Diseases Research, Albion Press,Aberdeen, United Kingdom, 1998.

[29] A. Cuesta, J. Meseguer, M.A. Esteban, Total serum immunoglobulin M levelsare affected by immunomodulators in seabream (Sparus aurata L.), Vet.Immunol. Immunopathol. 101 (2004) 203e210.

[30] M.J. Quade, J.A. Roth, A rapid, direct assay to measure degranulation of bovineneutrophil primary granules, Vet. Immunol. Immunopathol. 58 (1997)239e248.

[31] A. Rodri, Phagocytosis and peroxidase release by seabream (Sparus aurata L.)leucocytes in response to yeast cells 423 (2003) 415e423.

[32] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(�Delta Delta C(T)) Method, Methods 25(2001) 402e408.

[33] G. Martínez, E.M. Shaw, M. Carrillo, S. Zanuy, Protein salting-out methodapplied to genomic DNA isolation from fish whole blood, Biotechniques 24(1998) 238e239.

[34] S.T. Tapia-Paniagua, M. Chabrill�on, P. Díaz-Rosales, I.G. De la Banda, C. Lobo,M.C. Balebona, et al., Intestinal microbiota diversity of the flat fish Soleasenegalensis (Kaup, 1858) following probiotic administration, Microb. Ecol. 60(2010) 310e319.

[35] G. Muyzer, E.C. De Waal, A.G. Uitterlinden, Profiling of complex microbialpopulations by denaturing gradient gel electrophoresis analysis of polymerasechain reaction-amplified genes coding for 16S rRNA, Appl. Environ. Microbiol.59 (1993) 695e700.

[36] C.J. Sanguinetti, E.D. Neto, A.J.G. Simpson, Rapid silver staining and recovery ofPCR products separated on polyacrylamide gels, Biotechniques 17 (1994)914e921.

[37] M. Marzorati, L. Wittebolle, N. Boon, D. Daffonchio, W. Verstraete, How to getmore out of molecular fingerprints: practical tools for microbial ecology,Environ. Microbiol. 10 (2008) 1571e1581.

[38] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, Basic local alignmentsearch tool, J. Mol. Biol. 215 (1990) 403e410.

[39] W. Ludwig, O. Strunk, R. Westram, L. Richter, H. Meier, A. Yadhukumar, et al.,ARB: a software environment for sequence data, Nucleic Acids Res. 32 (2004)1363e1371.

[40] P. Díaz-Rosales, I. Salinas, A. Rodríguez, A. Cuesta, M. Chabrill�on,M.C. Balebona, et al., Gilthead seabream (Sparus aurata L.) innate immuneresponse after dietary administration of heat-inactivated potential probiotics,Fish Shellfish Immunol. 20 (2006) 482e492.

[41] L.T. Guzm�an-Villanueva, D. Tovar-Ramírez, E. Gisbert, H. Cordero,F.A. Guardiola, A. Cuesta, et al., Dietary administration of b-1,3/1,6-glucan andprobiotic strain Shewanella putrefaciens, single or combined, on giltheadseabream growth, immune responses and gene expression, Fish ShellfishImmunol. 39 (2014) 34e41.

[42] M.A. Esteban, H. Cordero, M. Martínez-Tom�e, A.M. Jim�enez-Monreal,A. Bakhrouf, A. Mahdhi, Effect of dietary supplementation of probiotics andpalm fruits extracts on the antioxidant enzyme gene expression in themucosae of gilthead seabream (Sparus aurata L.), Fish Shellfish Immunol. 39(2014) 532e540.

[43] S. Tapia-Paniagua, C. Lobo, X. Moreno-Ventas, I.G. De la Banda, M.A. Mori~nigo,M.C. Balebona, Probiotic supplementation influences the diversity of the in-testinal microbiota during early stages of farmed senegalese sole (Solea sen-egalensis, Kaup 1858), Mar. Biotechnol. 16 (2014) 716e728.

[44] C. Lobo, X. Moreno-Ventas, S. Tapia-Paniagua, C. Rodríguez, M.A. Mori~nigo,I.G. De La Banda, Dietary probiotic supplementation (Shewanella putrefaciensPdp11) modulates gut microbiota and promotes growth and condition inSenegalese sole larviculture, Fish Physiol. Biochem. 40 (2014) 295e309.

[45] B.L. Strand, Y.A. Mørch, G. Skjåk-Bræk, Alginate as immobilization matrix forcells, Minerva Biotecnol. 12 (2000) 223e233.

[46] R. Vidhyalakshmi, R. Bhakyaraj, R.S. Subhasree, Encapsulation “the future ofprobiotics”, Adv. Biol. Res. 3 (2009) 96e103.

[47] P. Bajracharya, M.A. Islam, T. Jiang, S.-K. Kang, Y.-J. Choi, C.-S. Cho, Effect ofmicroencapsulation of Lactobacillus salivarus 29 into alginate/chitosan/algi-nate microcapsules on viability and cytokine induction, J. Microencapsul. 29(2012) 429e436.

[48] P. Forsythe, N. Sudo, T. Dinan, V.H. Taylor, J. Bienenstock, Mood and gutfeelings, Brain Behav. Immun. 24 (2010) 9e16.

[49] S. Parvez, K.A. Malik, S. Kang, H.Y. Kim, Probiotics and their fermented foodproducts are beneficial for health, J. Appl. Microbiol. 100 (2006) 1171e1185.

[50] A. Cuesta, J. Meseguer, M.�A. Esteban, Molecular and functional characteriza-tion of the gilthead seabream b-defensin demonstrate its chemotactic andantimicrobial activity, Mol. Immunol. 48 (2011) 1432e1438.

[51] M. Van Der Marel, M. Adamek, S.F. Gonzalez, P. Frost, J.H.W.M. Rombout,G.F. Wiegertjes, et al., Molecular cloning and expression of two b-defensin andtwo mucin genes in common carp (Cyprinus carpio L.) and their up-regulationafter b-glucan feeding, Fish Shellfish Immunol. 32 (2012) 494e501.

[52] M.I.R. Reis, A. Vale, P.J.B. Pereira, J.E. Azevedo, N.M.S. Santos, Caspase-1 and IL-1b processing in a teleost fish 7 (2012) 1e14.

[53] M. Reyes-Becerril, I. Salinas, A. Cuesta, J. Meseguer, D. Tovar-Ramirez,F. Ascencio-Valle, et al., Oral delivery of live yeast Debaryomyces hanseniimodulates the main innate immune parameters and the expression ofimmune-relevant genes in the gilthead seabream (Sparus aurata L.), FishShellfish Immunol. 25 (2008) 731e739.

[54] R. Castro, D. Bernard, M.P. Lefranc, A. Six, A. Benmansour, P. Boudinot, T celldiversity and TcR repertoires in teleost fish, Fish Shellfish Immunol. 31 (2011)644e654.

[55] A. Cuesta, M.A. Esteban, J. Meseguer, Cloning, distribution and up-regulationof the teleost fish MHC class II alpha suggests a role for granulocytes asantigen-presenting cells, Mol. Immunol. 43 (2006) 1275e1285.

[56] T. Bell, J.A. Newman, B.W. Silverman, S.L. Turner, A.K. Lilley, The contributionof species richness and composition to bacterial services, Nature 436 (2005)1157e1160.

[57] L. Wittebolle, H. Vervaeren, W. Verstraete, N. Boon, Quantifying communitydynamics of nitrifiers in functionally stable reactors, Appl. Environ. Microbiol.74 (2008) 286e293.

[58] P. Navarrete, F. Magne, P. Mardones, M. Riveros, R. Opazo, A. Suau, et al.,Molecular analysis of intestinal microbiota of rainbow trout (Oncorhynchusmykiss), FEMS Microbiol. Ecol. 71 (2010) 148e156.

[59] Tanu, D.D. Deobagkar, R. Khandeparker, R.A. Sreepada, S.V. Sanaye,H.B. Pawar, A study on bacteria associated with the intestinal tract of farmedyellow seahorse, Hippocampus kuda (Bleeker, 1852): characterization andextracellular enzymes, Aquac. Res. 43 (2012) 386e394.

[60] D. Kim, Microbial diversity in the intestine of olive flounder (Paralichthysolivaceus), Aquaculture 414e415 (2013) 103e108.

[61] F.C. Silva de P, J.R. Nicoli, J.L. Zambonino-Infante, S. Kaushik, F.J. Gatesoupe,Influence of the diet on the microbial diversity of faecal and gastrointestinalcontents in gilthead sea bream (Sparus aurata) and intestinal contents ingoldfish (Carassius auratus), FEMS Microbiol. Ecol. 78 (2011) 285e296.

[62] O. Carnevali, L. De Vivo, R. Sulpizio, G. Gioacchini, I. Olivotto, S. Silvi, et al.,Growth improvement by probiotic in European sea bass juveniles (Dicen-trarchus labrax, L.), with particular attention to IGF-1, myostatin and cortisolgene expression, Aquaculture 258 (2006) 430e438.

[63] O. Carnevali, M.C. Zamponi, S. Silvi, M. Caggiano, M. Polzonetti, A. Cresci,Administration of probiotic strain to improve sea bream wellness duringdevelopment, Aquacult. Int. 12 (2004) 377e386.

[64] N. Fromin, J. Hamelin, S. Tarnawski, D. Roesti, K. Jourdain-Miserez,N. Forestier, et al., Statistical analysis of denaturing gel electrophoresis (DGE)fingerprinting patterns, Environ. Microbiol. 4 (2002) 634e643.

[65] S.T. Tapia-Paniagua, S. Vidal, C. Lobo, M.J. Prieto-�Alamo, J. Jurado, H. Cordero,et al., The treatment with the probiotic Shewanella putrefaciens Pdp11 ofspecimens of Solea senegalensis exposed to high stocking densities to enhancetheir resistance to disease, Fish Shellfish Immunol. 41 (2014) 209e221.

[66] S. Picchietti, A.M. Fausto, E. Randelli, O. Carnevali, A.R. Taddei, F. Buonocore, etal., Early treatment with Lactobacillus delbrueckii strain induces an increase inintestinal T-cells and granulocytes and modulates immune-related genes oflarval Dicentrarchus labrax (L.), Fish Shellfish Immunol. 26 (2009) 368e376.

[67] C. Suzer, D. Çoban, H.O. Kamaci, S. Saka, K. Firat, €O. Otgucuo�glu, et al., Lacto-bacillus spp. bacteria as probiotics in gilthead sea bream (Sparus aurata, L.)larvae: effects on growth performance and digestive enzyme activities,Aquaculture 280 (2008) 140e145.

[68] I. Salinas, A. Cuesta, M.A. Esteban, J. Meseguer, Dietary administration ofLactobacillus delbrüeckii and Bacillus subtilis, single or combined, on giltheadseabream cellular innate immune responses, Fish Shellfish Immunol. 19(2005) 67e77.

[69] T. Ojala, M. Kankainen, J. Castro, N. Cerca, S. Edelman, B. Westerlund-Wikstr€om, et al., Comparative genomics of Lactobacillus crispatus suggestsnovel mechanisms for the competitive exclusion of Gardnerella vaginalis, BMCGenomics 15 (2014) 1070.

[70] V. Abramov, V. Khlebnikov, I. Kosarev, G. Bairamova, R. Vasilenko, N. Suzina, etal., Probiotic properties of Lactobacillus crispatus 2,029: homeostatic interac-tion with cervicovaginal epithelial cells and antagonistic activity to genito-urinary pathogens, Probiotics Antimicrob. Proteins 6 (2014) 165e176.

[71] J.P. Ghartey, B.C. Smith, Z. Chen, N. Buckley, Y. Lo, A.J. Ratner, et al., Lactoba-cillus crispatus dominant vaginal microbiome is associated with inhibitoryactivity of female genital tract secretions against Escherichia coli, PLoS One 9(2014) 1e8.

H. Cordero et al. / Fish & Shellfish Immunology 45 (2015) 608e618618

[72] G. Donnarumma, A. Molinaro, D. Cimini, C. De Castro, V. Valli, V. De Gregorio,et al., Lactobacillus crispatus L1: high cell density cultivation and exopoly-saccharide structure characterization to highlight potentially beneficial effectsagainst vaginal pathogens, BMC Microbiol. 14 (2014) 137.

[73] K. Baltova, Z. Dimitrov, Probiotic and cultural characteristic of strain Lacto-bacillus gasseri 4/13 of human origin, Biotechnol. Biotechnol. Equip. 28 (2014)1084e1088.

[74] N. Pandey, R.K. Malik, J.K. Kaushik, G. Singroha, A. Gassericin, A circularbacteriocin produced by Lactic acid bacteria Lactobacillus gasseri, World J.Microbiol. Biotechnol. 29 (2013) 1977e1987.

[75] V. Li�evin-Le Moal, A.L. Servin, Anti-infective activities of Lactobacillus strainsin the human intestinal microbiota: from probiotics to gastrointestinal anti-infectious biotherapeutic agents, Clin. Microbiol. Rev. 27 (2014) 167e199.

[76] R. Hertzberger, J. Arents, H.L. Dekker, R.D. Pridmore, C. Gysler,M. Kleerebezem, et al., H2O2 production in species of the Lactobacillus Aci-dophilus group, a Central role for a novel nadh dependent flavin Reductase,Appl. Environ. Microbiol. 80 (2014) 2229e2239.

[77] S. Lavasani, B. Dzhambazov, M. Nouri, F. Fåk, S. Buske, G. Molin, et al., A novelprobiotic mixture exerts a therapeutic effect on experimental autoimmuneencephalomyelitis mediated by IL-10 producing regulatory T cells, PLoS One 5(2010) 1e11.

[78] Z. Geraylou, M.P.M. Vanhove, C. Souffreau, E. Rurangwa, J. Buyse, F. Ollevier,In vitro selection and characterization of putative probiotics isolated from thegut of Acipenser baerii (Brandt, 1869), Aquac. Res. 45 (2014) 341e352.

[79] D. Kim, B.R. Beck, S.B. Heo, J. Kim, H.D. Kim, S.M. Lee, et al., Lactococcus lactisBFE920 activates the innate immune system of olive flounder (Paralichthysolivaceus), resulting in protection against Streptococcus iniae infection andenhancing feed efficiency and weight gain in large-scale field studies, FishShellfish Immunol. 35 (2013) 1585e1590.

[80] E. Mu~noz-Atienza, C. Araújo, S. Magad�an, P.E. Hern�andez, C. Herranz,Y. Santos, et al., In vitro and in vivo evaluation of lactic acid bacteria of aquaticorigin as probiotics for turbot (Scophthalmus maximus L.) farming, FishShellfish Immunol. 41 (2014) 570e580.

[81] P. Varma, K.R. Dinesh, K.K. Menon, R. Biswas, Lactobacillus fermentum isolatedfrom human colonic mucosal biopsy inhibits the growth and adhesion ofenteric and foodborne pathogens, J. Food Sci. 75 (2010) 546e551.

[82] B.R. Beck, D. Kim, J. Jeon, S.-M. Lee, H.K. Kim, O.J. Kim, et al., The effects ofcombined dietary probiotics Lactococcus lactis BFE920 and Lactobacillusplantarum FGL0001 on innate immunity and disease resistance in oliveflounder (Paralichthys olivaceus), Fish Shellfish Immunol. 42 (2015)177e183.