Supplementary data

The same site on LEDGF IBD domain represents therapeutic target for MLL leukemia and

HIV

Marcelo J. Murai, Jonathan Pollock, Shihan He, Hongzhi Miao,Trupta Purohit, Adam Yokom,

Jay L. Hess, Andrew G. Muntean, Jolanta Grembecka and Tomasz Cierpicki

Department of Pathology, University of Michigan, Ann Arbor, MI, 48109, USA

* Correspondence: tomaszc@umich.edu (T. C.), Phone: 734-615-9324, Fax 734-615-0688

Supplementary Methods

Molecular biology

Constructs for bacterial expression encoding human LEDGF IBD domain (amino acids 347–

442), MLL fragments MLL1-160, MLL1-137 and MLL100-200, MLL-IBD (MLL residues 110–160,

Gly-Ser linker and LEDGF residues 337–442) were ordered from GenScript and cloned into

pET32a(+) vector (Novagen). MLL1-160 F129A and double mutant MLL1-160 F148A,L149A

(FLAA) were generated using site-directed mutagenesis using QuikChange kit (Stratagene). Full

length LEDGF cDNA was amplified using rt-PCR from mRNA extracted from HEK293 cells

and subcloned into pCMV and pMSCV with HA tag to generate pCMV-LEDGF-HA and

pMSCV-LEDGF-HA. The expression vector pCMV Flag-MLL-AF9 was prepared using

pMSCV Flag-MLL-AF9 as template (1). The F129A, F148A and F148A,L149A mutations were

introduced according to QuikChange protocol (Stratagene). cDNA encoding for HIV integrase

was ordered from Genscript and subcloned into pMIGR1 in frame with a Kozak sequence, HA

tag and a Nuclear Localization Signal (NLS). For bacterial expression, the integrase fragment

encoding fragment 51-212 including solubilizating mutations (2) was subcloned into pET28b.

cDNA encoding myc-HIV-IN, myc-MLL110-160, myc-MLL110-160 FLAA and myc-MLL110-160

F129A were synthesized by GeneArt Strings (Invitrogen) and cloned into MSCV-puro vector.

Nuclear localization sequences were included in MLL110-160 constructs to facilitate nuclear

localization.

Isothermal Titration Calorimetry

Menin-MLL1-160 complex was purified by size exclusion chromatography using column HiLoad

16/60 Superdex 75 pg (GE Healthcare). Menin-MLL1-160 complex and IBD were extensively

dialyzed at 4ºC against the same buffer (50 mM phosphate, pH 7.5, 50 mM NaCl, 1mM β-

mercaptoethanol) and degassed prior to measurement. The titrations were performed using a VP-

ITC titration calorimetric system (MicroCal) at 25ºC. The calorimetric cell, containing menin-

MLL1-160 complex or MLL mutants (concentration of 20 μM), was titrated with the IBD (200

μM) injected in 10 μl aliquots. Menin-MLL1-160 complex was used at 20μM concentration, 1000-

fold above Kd for menin-MLL1-160 interaction (3) to assure stable complex during ITC

experiment. Data was analyzed using Origin 7.0 (OriginLab) to obtain Kd.

Assignment and structure determination of MLL-IBD

Backbone assignment was obtained from 3D HNCA, HN(CO)CA, HNCACB, CBCA(CO)NH,

HNCO and HN(CA)CO spectra. Side-chain chemical shifts were assigned from CC(CO)NH-

TOCSY, HC(CO)NH-TOCSY, and HCCHTOCSY. Assignment of aromatic side chains was

achieved based on 2D TOCSY and 2D NOESY spectra for 0.54mM unlabeled MLL-IBD in

100% D2O.

For the structure determination, we measured 3D 15

N-edited NOESY-HSQC (120-msec mixing

time) and 13

C-edited NOESY-HSQC spectrum (120-msec mixing times). Additional 2D NOESY

(120-msec mixing time) was collected for unlabeled MLL-IBD in D2O. All NMR spectra were

processed and analyzed using NMRPipe (4) and Sparky (T.D. Goddard and J.M. Kneller,

University of California, San Francisco). The assignment of NOESY cross-peaks and structure

calculations have been carried out in an automated manner using Cyana 2.1 (5). The input for

Cyana calculations included manually assigned chemical shifts, cross-peaks derived from

NOESY spectra and dihedral angle restraints derived from Talos+ analysis (6). 20 lowest energy

structures were selected for analysis.

Cell line generation for bone marrow co-transduction assay

C57BL/6 mice were injected intraperitoneally with 5-fluorouracil (Sigma) at 150mg/kg dose.

Five days after injections the bone marrow cells were harvested from mouse femurs and tibias.

Lin-c-Kit+ cells were isolated using the EasySep Mouse hematopoietic progenitor cell

enrichment kit (Stem Cell Technologies) following manufacturer’s manual and grown overnight

in stimulation media: Iscove modified Dulbecco medium (Gibco) with 15% fetal bovine serum

(StemCell Technologies), Pen/Strep (100 U/mL; Gibco), IL-3 (10 ng/mL, R&D Systems), IL-6

(10 ng/mL, R&D Systems) and stem cell factor (SCF) (100 ng/mL, R&D Systems). Cells were

transduced with MSCV-neo-Flag-MLLAF9 and on the following day with MSCV-puro-IN,

MSCV-puro-MLL110-160, MSCV-puro-MLL110-160 FLAA, MSCV-puro-MLL110-160 F129A

packaged retrovirus in the presence of polybrene (5µg/ml, Milipore) by spinoculation for 90

minutes at 3200rpm RT. Cells were recovered in the stimulation media for 2 days and then

selected with G418 (1mg/ml, Gibco) and puromycin (2µg/ml, Sigma) for a week.

Growth curve assay

After selection, the media was changed in all cell lines to the growth media: Iscove modified

Dulbecco medium (Gibco) with 15% fetal bovine serum (StemCell Technologies), Pen/Strep

(100 U/mL; Gibco), IL-3 (10 ng/mL), G418 (1mg/ml, Gibco) and puromycin (2µg/ml, Sigma).

Cells were seeded at 3x105/ml in 12 well plates in duplicates. Viable cell concentrations were

counted with trypan blue staining and restored in fresh growth media at 3x105/ml every 2 or 3

days for 2 weeks.

Expression of c-Kit

1x105 cells were harvested and incubated with APC conjugated c-Kit antibody (Biolegend) for

30 minutes at 4°C. Cells were applied to BD LSRII flow cytometer (BD Biosciences) and the

data was analyzed with Winlist software (Verity Software).

Wright-Giemsa staining

1x105 cells were harvested and placed in Shandon EZ Single Cytofunnel (Thermo Electron).

Samples were centrifuged at 550 g for 5 minutes. The slides were air-dried before staining with

the Hema-3 kit (Fisher Scientific). Cytospin pictures were taken at room temperature using an

Olympus BX41 microscope and Olympus DP71 camera with Olympus DP Controller software.

Colony formation assay

Two days after spinoculation, the transduced murine bone marrow cells were plated in 12-well

plates at the concentration of 5×103

cells/ml with 1 ml methylcellulose medium M3234

(StemCell Technologies) containing 20% IMDM medium, pen/Strep (100U/ml), IL-3 (10

ng/mL), IL-6 (10 ng/mL), SCF (100 ng/mL) G418 (1mg/ml) and puromycin (2µg/ml). Colonies

were counted six days after plating the cells. For the second round of colony formation assay,

cells were washed out with PBS buffer, resuspended in IMDM medium and 5×103 cells/ml were

plated using the same medium as in the first round. Colonies were counted 6 days later. For the

third round of colony assay, cells were washed out and replated using the same condition as for

round 2, but without IL-6 and SCF present in the medium. At day 6, colonies were stained with

100 μl iodonitrotetrazolium chloride (Sigma-Aldrich) at a final concentration of 1 mg ml−1

,

incubated at 37 °C for 30 min and counted.

Quantitative RT-PCR

Expression of IN and MLL110-160 fragments was confirmed by qRT-PCR using primers that

recognize myc tag and respective gene sequences:

Myc-IN-F GAGCAGAAGCTGATCTCAGAGG

Myc-IN-R TCACTAGCCATTGCTCTCCA

Myc-MLL-F GAACAGAAGCTGATCTCCGAAGAGG

Myc-MLL-R GTTCCAGCACCTTGCGTTTC

In Vivo leukemogenesis

Lin- bone marrow cells were isolated from 8-10 week old C57BL/6 mice injected with 5-FU at

150 mg/kg. Five days later, lin- cells were retrovirally transduced with MSCV, MSCV-NRAS or

co-transducted with MSCV-NRAS (to accelerate leukemia development) and MSCV-MLL-AF9

or MSCV-MLL-AF9 F129A or MSCV-MLL-AF9 FLAA. NRAS Cells were injected

intravenously through the tail vein to cohorts of lethally irradiated (900 rads) C57BL/6 recipients

(n=7-9). Recipient mice were maintained on Baytril (Enrofloxacin) added to the drinking water

for a period of 2 weeks after transplantation. Mice were sacrificed upon signs of distress/disease.

Development of leukemia was confirmed by analysis of spleen (size, weight and histopathology),

bone marrow (cytospins), blood samples (blood smears) and detection of infiltration by

histopathology analysis of different organs (liver, kidney, spleen).

Supplementary References

1. Muntean AG, et al. (2010) The PAF complex synergizes with MLL fusion proteins at

HOX loci to promote leukemogenesis. Cancer Cell 17(6):609-621.

2. Wielens J, et al. (2010) Crystal structure of the HIV-1 integrase core domain in complex

with sucrose reveals details of an allosteric inhibitory binding site. FEBS letters

584(8):1455-1462.

3. Grembecka J, Belcher AM, Hartley T, & Cierpicki T (2010) Molecular basis of the

mixed lineage leukemia-menin interaction: implications for targeting mixed lineage

leukemias. J Biol Chem 285(52):40690-40698.

4. Delaglio F, et al. (1995) NMRPipe: a multidimensional spectral processing system based

on UNIX pipes. J Biomol NMR 6(3):277-293.

5. Guntert P (2004) Automated NMR structure calculation with CYANA. Methods in

molecular biology 278:353-378.

6. Shen Y, Delaglio F, Cornilescu G, & Bax A (2009) TALOS+: a hybrid method for

predicting protein backbone torsion angles from NMR chemical shifts. J Biomol NMR

44(4):213-223.

Supplementary Figures

Figure S1. Binding of MLL fragments to IBD domain. A. MLL100-200 binds to IBD domain in

identical mode as MLL1-160. HSQC for 15

N-IBD is black and 15

N-IBD mixed with MLL100-200 in

1-1 ratio is red. B. MLL1-137 does not bind to IBD domain. HSQC for 15

N-IBD is black and 15

N-

IBD mixed with MLL1-137 in 1-2 ratio is red.

Figure S2. Spectrum of MLL-IBD fusion is similar to IBD saturated with MLL1-160. Spectrum

for 70M IBD domain is black; 70uM IBD with 280uM MLL1-160 is blue and 200uM MLL-

IBD fusion protein is red.

Figure S3. Binding of MLL1-160 and mutants F129A and FLAA. A. 70M IBD and 280M

MLL1-160 (red). B. 70M IBD and 280M MLL1-160 F129A (red). C. 70M IBD and 280M

MLL1-160 F148A (red). D. 70M IBD and 280M MLL1-160 FLAA (red). Reference spectrum of

70M IBD is black.

Figure S4. Mice transformed with MLL-AF9/NRAS develop acute leukemia. A. representative

spleen size for MLL-AF9/NRAS and normal C57BL/6 mice; B. spleen weights for MLL-

AF9/NRAS and normal C57BL/6 mice (n=3); C. representative bone marrow cytospins for

NRAS/MLL-AF9 and normal C57BL/6 mice; D. infiltration of blasts in liver of mice

transformed with MLL-AF9/NRAS compared to normal C57BL/6.

Figure S5. A. Growth curves for BMC co-transduced with MSCV-neo-MLL-AF9 and one of the

following vectors: empty MSCV-puro and MSCV-puro containing IN, MLL110-160, MLL110-160

F129A or MLL110-160 FLAA. The number of cells is shown in logarithmic scale. B. qRT-PCR

using Myc-IN primers demonstrating expression of IN in BMCs co-transduced with MLL-AF9

and IN (day 0). C. qRT-PCR using Myc-MLL primers demonstrating expression of MLL

fragments in BMCs co-transduced with MLL-AF9 and different variants of MLL (day 0).

Sequences of primers are included in Supplementary methods. GAPDH was used as a reference.

Supplementary Table 1.

NMR Distance and Dihedral Constraints

Distance constraints

Total NOE 1255

Intraresidue 326

Sequential (|i – j| = 1) 324

Medium range (|i – j| < 4) 253

Long range (|i – j| > 5) 352

Intermolecular 86

Total dihedral angle restraints 154

ϕ 77

ψ 77

Structure Statisticsa

CYANA target function value (Å2) 0.59

Violations

R.m.s.d. distance constraints (Å) 0.0044

Maximum distance constraints (Å) 0.22

R.m.s.d. dihedral angle constraints (°) 0.111

Maximum dihedral angle constraints (°) 1.00

Sum of VdW 3.6

Maximum VdW 0.24

Structure Analysis

Average pairwise r.m.s.d.a (Å)

Heavy 1.43 ± 0.47

Backbone (MLL-IBD) 2.03 ± 0.46

Heavy (IBD) 0.68 ± 0.12

Backbone (IBD) 1.46 ± 0.17

a – average values calculated for ensemble of 20 structures; r.m.s.d. is calculated for residues

124-133 (MLL, MBM1), 148-152 (MLL MBM2) and 348-430 (IBD).