HUMAN MUTATION 3:44-51 (1994)

RESEARCH ARTICLE

Mutations in the Retinobnastona Gene and ression in Somatic and Tumor Cells

Mitsuo V. Kato’, Kanji Ishizaki, Junya Toguchida, Akihiro Kaneko, Jun Takayama, Hiroshi Tanooka, Tomohisa Kato, Takashi Shimizu, and Masao S. Sasaki Radiation Biology Center, Kyoto University, Yoshidu-konoecho, Sakyo-ku, Kyoto 606, Japan (M. V. K., K. I., T. K., T. S., M. S. S.), Laboratory of Molecular Oncology, Tsukuba Life Science Center, Institute of Physical and Chemical Research (RIKEN), Koyadai, Tsukuba, Ibaraki 305, Japan (M. V. K. ), Department of Orthopaedic Surgery, Faculty of Medicine, Kyoto University, Shogoin-Knwaharacho, Snkyo-ku, Kyoto 606, Japan (J. To.), Department of Ophthalmology (A. K.) and Department of Pediatrics (J. Ta.), National Cancer Center Hospital and Radiobiology Division (H. T.), National Cancer Center Research Institute, Tsukiji, Chuo-ku, Tokyo 104, Japan; Fax: 812-9836-9020

Communicated by Thaddeus P. Dryja

Two intragenic deletions (exon 18-19 and exon 24) and two point mutations (one missense mutation in exon 21 and one mutation at splice-donor site for exon 13) were detected in the retinoblastoma gene in somatic and tumor cells of patients with hereditary retinoblastoma. Three mutations were located in a domain essential for binding to oncoproteins encoded by DNA tumor viruses (Hu et al., 1990; Huang et al., 1990). One mutation (deletion of exon 24) was outside this domain but it is in the region essential for binding to transcriptional factor E2F, and for suppression of malignant phenotypes (Qian et al., 1992; Qin et aI., 1992). A minisatellite-like sequence and short repeated sequences were located at the breakpoint of the deletion of exon 24, suggesting that two deletions on both sides of the minisatellite-like sequence may be generated by a “DNA slippage and misalignment” mechanism. Upon amplification of cDNA by the polymerase chain reaction, no transcript of gene with frameshift mutation (deletion of exon 24) was detected in skin fibroblasts, while transcripts of genes with missense mutations were detected. The results, in combination with previous reports (Dunn et al., 1989; Hashimoto et al., 1991), suggest the instability of transcripts with a premature stop codon or the suppressed expression of alleles with a premature stop codon in the retinoblastoma gene in somatic cells of hereditary patients. o 1994 Wiley-Liss, Inc.

KEY WORDS: Retinoblastoma, Mutation, Minisatellite sequence, Expression

INTRODUCTION

Retinoblastoma (RB) is a pediatric malignant tumor of the eye. The RB gene has been cloned as a deleted gene in RB and osteosarcoma cells, and functional inactivation of the RB gene is critical for the development of RB (Friend et al., 1986; Lee et al., 1987; Fung et al., 1987). Patients with hereditary RB who inherit a mutant allele of the RB gene are usually affected by bilateral multifocal tumors and the onset of such tumors is earlier than that of nonhereditary tumors. About 30% of pa- tients appear to have hereditary RB (Vogel, 1979). Identification of the germ-line mutations in such patients is important for early diagnosis and ge- netic counseling of relatives of RB patients (Yan- dell et al., 1989).

0 1994 WILEY-LISS, INC.

To identify the germinal mutations in patients with hereditary RB, analysis by karyotyping, Southern blotting, and polymerase chain reaction (PCR) of constitutional cells (lymphoblasts or skin fibroblasts) can be performed. About 8% of new germinal mutations can be detected by karyotype analysis (Ejima et al., 1988). Southern blot anal- ysis has revealed structural abnormalities in only about 10% of tumors (Goddard et al., 1988). The

Received April 21, 1993; accepted June 29, 1993. *To whom reprint requestsicorrespondence should be ad-

dressed.

MUTATIONS IN THE RB GENE AND THEIR EXPRESSION 45

majority of mutations are expected to be subtle mutations such as point mutations, short dele- tions, or insertions that cannot be detected by Southern blot analysis. Therefore, a more sensitive method, such as PCR, is necessary for identifying them (Dunn et al., 1988; Yandell et al., 1989; Hogg et al., 1992).

In this study, we analyzed germ-line mutations in 10 patients with hereditary RB, using Southern blotting and reverse transcription (RT)-PCR, and we detected four mutations in the RB gene. Mech- anisms for the generation of mutations and of tran- scription of mutant alleles in somatic cells are also discussed.

MATERIALS AND METHODS Patients and Samples

Ten hereditary patients, two bilaterally affected patients with family history (RBI34 and RB361) and eight bilaterally affected patients without fam- ily history (RB188, RB210, RB219, RB229, RB266, RB313, RB344, and RB368), were stud- ied. Three nonhereditary patients, unilaterally af- fected without family history (RB346, RB366, and RB367), were also included in this study. Tumor tissue and skin biopsies from RB patients were ob- tained at the National Cancer Center Hospital. Fibroblast cells, expanded from skin biopsies, and tumor cells were cultured in modified Eagle's min- imum essential medium (Irvine, Santa Ana, CA) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT) and in L15 medium (Irv- ine) supplemented with 15% FBS, respectively. Fi- broblast cells were obtained from all patients except for RB361. Three tumor cell lines, a met- astatic tumor cell line from RB134 (RB134TM), a recurrent tumor cell line from RBI88 (RB188TR), and a rhabdomyosarcoma cell line from RB361 (RB361Rd), were also used for this analysis.

Southern Blot Analysis

DNA was extracted from skin fibroblasts and cultured tumor cell lines as described previously (Kato et al., 1993). Ten micrograms of purified DNA was digested by restriction endonuclease Hind111 (TOYOBO, Osaka, Japan), fractionated by electrophoresis on a 0.7% agarose gel, and transferred to a nylon filter (HybondTM N, Amer- sham Japan, Tokyo, Japan). DNA on the filters was allowed to hybridize with 32P-labeled cDNA probe specific for the RB gene (Lee et al., 1987) and signals were detected by autoradiography. The intensity of each band on the X-ray film (Fuji,

Tokyo, Japan) was determined with an automated densitometer (ACT-18, Gelman).

Genomic Analysis by PCR

For PCR, the reaction mixture contained 100 ng of template DNA, 10 mM Tris (pH 8.6), 1.5 mM MgCl,, 50 mM KC1, 0.01% gelatin, 0.2 mM dNTP mix, 20 pmol each primer, 0.25 unit Taq DNA polymerase (Perkin-Elmer Cetus, Nonvalk, CT), and Perfect MatchTM Enhancer as appropri- ate (Stratagene, La Jolla, CA). Forty amplifica- tion cycles were carried out, with each cycle con- sisting of incubation for 1.1 min at 93"C, for 1 min at 56"C, and for 2.5 min at 72°C. After electro- phoresis on a 1.5% agarose gel, the amplified DNA fragments were stained with 0.5 pg/ml ethidium bromide and visualized under ultraviolet (UV) irradiation. PCR primers used for ampli- fication of exon 13 were as follows: MK120, GATTACACAGTATCCTCGAC, and MK121, CGAACTGGAAAGATGCTG, and those for amplification of exon 24 were MK103, GGG- CAATGGCAGAATATG, and MK104, GC- CAGGAATTCAATACCAATC. Primer se- quences for exon 13 and exon 24 were designed by reference to the DNA sequence published by Mc- Gee et al. (1989) and the genomic sequence data of the RB gene (Toguchida et al. 1993, GenBank accession number L11910). Sequences of amplified fragments were determined with Sequenase I1 (USB, Cleveland, OH) either directly or after cloning into plasmid vectors.

RT-PCR Analysis

RNA was extracted by a single-step, acid guani- dine thiocyanate-phenol-chloroform, method (Chomczynski and Sacchi 1987). cDNA was gen- erated by M-MLV reverse transcriptase (BRL, Gaithersburg, MD) from 10 kg of total RNA with priming by oligo(dT) (16mer; Pharmacia, Milton Keynes, UK). cDNAs were directly amplified by PCR, with the following primers:

MK46 (exon 3) , TATTCAAAAGAAAAAGGAACTG (sense) MK23 (exon 6) , GCTAAAAGTTTCTTGGATC (sense) MK48 (exon 8 ) , TTCAATAATTCTTGTATC (anti-sense) MK24 (exon 19), ATGCAGAGACACAAGCAACC (sense) MK56 (exon 20), GTATGAACTCATGAGAGAC (sense) MK55 (exon 21), CAATGATTTTGAATTTAAGG (anti-sense) MK57 (exon 23), GTTCACCCTTACGGATTCC (sense) and MK73 (exon 27), TCCAGAGGTGTACACAGTG (anti-sense)

After electrophoresis on an agarose gel, amplified fragments were stained with ethidium bromide and visualized under UV irradiation.

46 KATOETAL.

A 1 2 3 B 62kh 2 Ikb J 5kh 5.Skb 100kh

f-----)- -U

Normalalle'e -fl 13-IJ

Hind 111 s i lc i

H i d 111 rims

horn (del ex.24) i l l 7 I 8 19 10 21-23 2526 27

Mutant allele - *--u 7 . P b 5.3kb 10.0kb lO.Okb 2.lkb

FIGURE 1. Deletion of exon 24 of the RB gene in a patient with family history (RB134). (A) Example of Southern blot anal- ysis of the 3' region of the RB gene. Lane 1 shows a typical pattern of a normal healthy individual. Lanes 2 and 3 show

results of fibroblasts and a metastatic tumor cell line derived from RB134, respectively. (B) Schematic representation of the deletion in RB134. Black boxes and horizontal lines in- dicate exons and Hind111 sites, respectively.

RESULTS Structural Abnormality in the RB Gene in RB134

Figure 1A shows an example of Southern blot analysis for a patient with family history (RB134). The intensity of the 6.2-kilobase pair (kbp) frag- ment from fibroblasts of the patient (lane 2) was only half of that of a normal healthy individual (lane l ) , while that of a 10-kbp fragment was in- creased to 1.5 times of the normal intensity. The 6.2-kbp fragment was completely lost in the case of a metastatic tumor cell line (lane 3). Deletion of three Hind111 sites in downstream of exon 24 might convert the 6.2-kbp fragment to a new 10-kbp fragment (Fig. 1B). When cDNA from the tumor cell line was amplified and sequenced, deletion of exon 24 with a premature stop codon in exon 25 was revealed (Figs. 2 and 3). By contrast, only the normal transcript was amplified in fibroblasts (Fig. 2).

In order to identify the breakpoint of the dele- tion, we amplified the region around exon 24 in genomic DNA. A 2-kbp fragment, which was ex- pected from the normal sequence, was amplified in fibroblasts of the healthy mother (I-I) , whereas a shorter fragment (of about 300 bp) was amplified in fibroblasts (11) and a tumor cell line (11-T) of the patient and in fibroblasts (1-2) from the father, who was also affected by unilateral RB (Fig. 4B). The maternally derived normal fragment was not detected in the tumor. Figure 4C shows the results of sequencing around the breakpoint of the mutant allele. As expected, a 1.7-kbp region that included

exon 24 was deleted. However, it was not a simple deletion and an additional 25-bp sequence had been inserted at the breakpoint. Eighteen bp out of this 25-bp sequence was identical to the sequence located in the middle of the normal sequence which was deleted in the mutant allele. The se- quence also exhibited very high homology to a previously reported minisatellite sequence, lambda 33.4 (Jeffreys et al., 1985). A 3-bp direct repeat and a 10-bp symmetric element also located at the 5' breakpoint of the normal allele, and a 4-bp in- verted repeat was found at the 3' breakpoint.

RT-PCR Analysis

Figure 5 shows an example of RT-PCR analysis. Shorter fragments were detected in fibroblasts of RB229 and in cultured rhabdomyosarcoma cells of RB361 (RB361Rd). Shorter fragment of RB229 lacked exon 13 and a point mutation (Ggtaac + Gttaac) at the splice-donor site for exon 13 was confirmed by the genomic DNA sequence (Fig. 3). In RB361Rd, a deletion of the exon 18-19 region was found, which resulted in a premature stop codon in exon 20 (Fig. 3). Deletion of genomic DNA was also detected by Southern blot analysis in peripheral blood lymphocytes and rhabdomyo- sarcoma cells of RB 361, indicating that this mu- tation was constitutional in this patient (data not shown). We also directly sequenced the products of PCR for other samples and detected a heterozy- gous missense point mutation (TGT, cysteine +

MK56

22

MUTATIONS IN THE RB GENE AND THEIR EXPRESSION

RT-PCR Analysis

23 24 25 26 21

M K57

22

Stop &

23 24 25 26 21

47

FIGURE 2. RT-PCR analysis of RB134. cDNA was amplified using two sets of primers (MK56 and MK73 or MK57 and MK73). N and T indicates samples of skin fibroblasts and the metastatic tumor cell line derived from RB134, respectively. M, molecular-weight markers (HincII-digested 4 x 1 7 4 DNA).

TAT, tyrosine at codon 706 in exon 21) in fibro- blasts of RB210 (Fig. 6).

DISCUSSION

We found constitutional mutations (two intra- genic deletions and two point mutations) of the RB gene in 4 out of 10 patients with hereditary RB. The missense point mutation (TGT, cysteine + TAT, tyrosine) at codon 706 in exon 21 is in the domain of the gene product that is essential for binding to the large T antigen of Simian virus 40 and to the E1A protein of adenovirus (Hu et al., 1990; Huang et al., 1990). A somatic mutation (TGT, cysteine -+ TTT, phenylalanine) at the same codon was reported in small cell lung carci- noma, and the mutant protein was shown to be defective in phosphorylation and in binding to on- coproteins encoded by DNA tumor viruses (Kaye et al., 1990). Substitution of this codon by other amino acids with bulky R side chains (e.g., phe- nylalanine and tyrosine) has also been suggested to interfere with binding to oncoproteins in vitro and with protein phosphorylation in vivo (Kratzke et al., 1992). A point mutation at the splice-donor site for exon 13 and truncated mRNA were de- tected in skin fibroblasts of RB229 (Fig. 3). These results provide direct evidence that a base substi- tution at a splice site results in a deletion of an exon in mRNA. Several mutations at splice sites

have previously been reported with and without evidence to indicate that they give rise to abnor- mal mRNA (Dunn et al., 1989; Horowitz et al., 1989; Yandell et al., 1989; Onadim et al., 1992). While deletion of exon 13 does not alter the read- ing frame downstream of exon 13, this mutation results in the partial deletion of the oncoprotein- binding region (Hu et al., 1990; Huang et al., 1990). Since deletion of exon 18-19 in RB361, which is located between two regions that encode oncoprotein-binding sites, results in a premature stop codon in exon 20 (Fig. 3), the RB protein may be inactivated as a result of truncation of the carboxy-terminal region. Deletion of exon 24 in RB134 also results in a premature stop codon in exon 25 (Fig. 3 ) . Although exon 24 encodes amino acids outside the oncoprotein-binding re- gion, the carboxy-terminal including this region has been reported to be essential for binding to transcriptional factor E2F and for suppression of malignant phenotypes (Qian et al., 1992; Qin et al., 1992). All the mutations that we found in this study seem to potentially disrupt normal function of the RB protein.

A sequence with close homology to a minisat- ellite sequence was found at the breakpoint of the intragenic deletion in RB134 (Fig. 4). Minisatel- lite sequences are known to be mutable (Jeffreys et al., 1985) and involvement of minisatellite se- quences in meiotic recombination was reported for

48 KATOETAL.

RB134 Junction

EXON 23 4 EXON25

CCA AGA TCA AGA CTT CTG AGA AGT TCC AGA AAA TAA ATC Pro Arg Ser Arg Leu Leu Arg Ser Ser Arg Lys Stop

CYS RB210 TGT

4 EXON 21

ATT ATG ATG TAT TCC ATG TAT GGC ATA TGC Ile Met Met Tyr Ser Met Tyr Gly Ile Cys

RB229 Junction

EXON12 4 EXON14

TCC TAT TTT AAC CGA TAC AAA CTT Ser Tyr Phe Asn Arg Tyr Lys Leu

EXON 13 INTRON 13 TCA CAG tta act +

g Junction RB361

EXON 17 4 EXON20

GCA TGG CTC TCA TGT ATC GGC TAG Ala Trp Leu Ser Lys Ile Gly Stop

FIGURE 3. Mutant transcripts, with their corresponding puta- tive amino acid sequences, detected in RB tumors and fibro- blasts in this study. In RB134, exon 24 was deleted in the mutant transcript, with a premature stop codon in exon 25. In RB210, a missense point mutation at codon 706 in exon 21

was found. In RB229, in-frame deletion of exon 13 was found in the mutant transcript, and a point mutation at a splice- donor site for exon 13 was also found in the genomic se- quence of the mutant allele. In RB361, deletion of exon 18-19 was detected, with a premature stop codon in exon 20.

B

FIGURE 4. Analysis of the breakpoint of the intragenic deletion of the RB gene in RB134. (A) Physical map of the exon 24 region of the RE gene. (B) PCR analysis of the family of RB134. The left lane shows the molecular-weight markers (Hindlll-digested X phage DNA and HincII-digested 4x174 DNA). (C) Genomic sequences around the breakpoint of the

deletion of exon 24. The sequence indicated with capitals in minisatellite sequence was identical to the genomic sequence at the breakpoint. A 3-bp direct repeat (ACC) and a 10-bp symmetric element [ACCT(A/T)TAACT] at the 5’ break- point, as well as a 4-bp inverted repeat (TGGA) at the 3’ breakpoint, are indicated by arrows.

MUTATIONS IN THE RB GENE AND THEIR EXPRESSION 49

FIGURE 5. Example of RT-PCR analysis of the region from exon 6 to exon 21. cDNAs derived from skin fibroblasts (RB188, RB210, RB219, RB229, RB266, RB313, RB344, RB345, RB366, RB367, and RB368) and tumor cell lines (RB188TR, RB361Rd, Y79, WERI) were amplified. (Friend et al., 1987) were reported previously.

RB188TR is a recurrent tumor cell line and RB361Rd is a rhabdomyosarcoma cell line from patients with bilateral RB. The heterozygous 5’ deletion of the RB gene in Y79 (Lee et al., 1988) and the homozygous total deletion in WERI

FIGURE 6. Example of direct sequencing of the product of PCR. A heterozygous missense point muta- tion at codon 706 of exon 21 was found in skin fibroblasts of RB210.

the human P-globin gene (Old et al., 1986), the murine MHC gene (Kobori et al., 1986), and the human HLA-DQ region (Satyanarayana and Strominger, 1992). Chi-like sequences have also been found at sites of translocation of oncogenes (Krowczynska et al., 1990). I t is possible that this minisatellite-like sequence was associated with the deletion in RB134, though we have no direct ev- idence for the sequence is a true hypervariable minisatellite or not. Alternatively, a “DNA slip-

page and misalignment” mechanism might be in- volved in the deletion in RB134, in which 3-bp direct and 4-bp inverted repeats were found on both sides of the minisatellite-like sequence. Short repeated sequences were previously found at the site or in the vicinity of breakpoints of intragenic deletions in the RB gene (Canning and Dryja, 1989; Greger et al., 1990; Hashimoto et al., 1991; Bookstein et al., 1989). Two deletions, at the both sides of the minisatellite-like sequence, in

50 KATOETAL.

the RB gene may result in the mutation found in RB134.

We were able to analyze the transcription of mutant alleles of the RB gene in skin fibroblasts in three cases with constitutional mutations. The transcript of the allele with the nonsense mutation (deletion of exon 24) was not detected in cultured skin fibroblasts, but those of two alleles with mis- sense mutations (missense point mutation and de- letion of exon 13) were detected in fibroblasts, while the transcripts of all four mutant alleles were detected in tumor cells (Figs. 2 and 4). Absence of transcripts of nonsense-mutant alleles in lympho- blasts has also been reported (Dunn et al., 1988, 1989), whereas transcripts of alleles with in-frame deletions have been detected in skin fibroblasts (Hashimoto et al., 1991). When we combine our data with those in the cited reports, it seems that transcripts of mutant alleles with premature stop codon may not be detectable in normal somatic cells. Two explanations for the lack of detection of transcripts with nonsense mutation are possible. The first is instability of premature mRNA. Re- duced stability and decrease in steady-state level of mRNA with premature translation termination codon were reported in the triosephosphate isomerase gene (Daar and Maquat, 1988) and the P-globin gene (Baserga and Benz, 1988). The sec- ond is an autoregulation of transcription of the RB gene by RB protein in normal somatic cells, which have a normal allele of the RB gene, as originally suggested by Dunn et al. (1989). RB protein can bind to a transcription factor E2F and inhibit its activity (Chellappan et al., 1991; Bagchi et al., 1991; Chittenden et al., 1991). Since an EZF- binding DNA sequence was recently mapped to the promoter region of the RB gene (Ouellette et al., 1992), RB protein may down-regulate the ex- pression of the RB gene itself. In support of this hypothesis, a high level of expression of the RB gene was observed in retina cells transformed by adenovirus (Goddard et al., 1988), where E1A protein binds to RB protein and free E2F may stim- ulate the expression of the RB gene. Inactivation of RB protein in tumor cells may allow the in- creased expression of the RB gene and the tran- scripts with nonsense mutation might be detect- able in tumor cells.

ACKNOWLEDGMENTS

We are very grateful to Dr. T.P. Dryja for gen- erously providing the genomic sequence data around exon 24 of the RB gene prior to the pub- lication, and to Dr. W.-H. Lee for generous gifts of

DNA probes. This work was supported by a Cancer Research Grant from the Ministry of Health and Welfare, and by a Grant-in-Aid for Scientific Re- search from the Ministry of Education, Science and Culture, Japan.

NOTE ADDED IN PROOF

PCR condition and mutations mentioned in this article were deposited in Genome Data Base with an accession number GOO-213-521.

REFERENCES Bagchi S, Weinmann R, Raychaudhuri P (1991) The retinoblas-

toma protein copurifies with E2F-I, an E1A-regulated inhibitor of the transcription factor E2F. Cell 65: 1063-1072.

Baserga SJ, Benz EJ Jr (1988) Nonsense mutations in the human P-globin gene affect mRNA metabolism. Proc Natl Acad Sci USA 85:2056-2060.

Bookstein R, Lee E-Y, Peccei A, Lee W-H (1989) Human retin- oblastoma gene: Long-range mapping and analysis of its dele- tion in a breast cancer cell line. Mol Cell Biol 9:1628-1634.

Canning S, Dryja TP (1989) Short direct repeats at the break- points of deletions of the retinoblastoma gene. Prof Natl Acad Sci USA 865044-5048.

Chellappan SP, Hiebert S, Mudryj M, Horowitz JM, Nevins JR (1991) The E2F transcription factor is a cellular target for the RB protein. Cell 65:1053-1061.

Chittenden T, Livingston DM, Kaelin WG Jr (1991) The TIElA- binding domain of the retinoblastoma product can interact selectively with a sequence-specific DNA-binding protein. Cell 65:1073-1082.

Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159.

Daar 10, Maquat LE (1988) Premature translation termination mediates triosephosphate isomerase mRNA degradation. Mol Cell Biol 8:802-813.

Dunn JM, Phillips RA, Becker A, Gallie BL (1988) Identification of germline and somatic mutations affecting the retinoblastoma gene. Science 241:1797-1800.

Dunn JM, Phillips RA, Zhu X, Becker A, Gallie BL (1989) Mu- tations in the RB1 gene and their effects on transcription. Mol Cell Biol 9:4596-4604.

Ejima Y, Sasaki MS, Kaneko A, Tanooka H (1988) Types, rates, origin and expressivity of chromosome mutations involving 13q14 in retinoblastoma patients. Hum Genet 79:118-123.

Friend SH, Bernards R, Rojelj S, Weinberg RA, Rapaport JM, Albert DM, Dryja TP (1986) A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature (London) 323:643 -646.

Friend SH, Horowitz JM, Gerber MR, Wang X-F, Bogenmann E, Li FP, Weinberg RA (1987) Deletions of a DNA sequence in retinoblastomas and mesenchymal tumors: Organization of the sequence and its encoded protein. Proc Natl Acad Sci USA

Fung Y-KT, Murphree AL, T'Ang A, Qian J , Hinrichs SH, Bene- dict WF (1987) Structural evidence for the authenticity of the human retinoblastoma gene. Science 236: 1657-1661.

Goddard AD, Balakier H, Canton M, Dunn J , Squire J , Reyes E, Becker A, Phillips RA, Gallie BL (1988) Infrequent genomic rearrangement and normal expression of the putative Rbl gene in retinoblastoma tumours. Mol Cell Biol 8:2082-2088.

Greger V, Passarge E, Horsthemke B (1990) Somatic mosaicism in

84:9059-9063.

MUTATIONS IN THE RB GENE AND THEIR EXPRESSION 51

a patient with bilateral retinoblastoma. Am J Hum Genet 46: 1187-1 193.

Hashimoto T, Takahashi R, Yandell DW, Xu H-J, Hu S-X, Gun- nell S, Benedict WF (1991) Characterization of intragenic de- letions in two sporadic germinal mutation cases of retinoblas- toma resulting in abnormal gene expression. Oncogene 6463- 469.

Hogg A, Onadim Z, Baird PN, Cowell JK (1992) Detection of heterozygous mutations in the RBI gene in retinoblastoma pa- tients using single strand conformation polymorphism (SSCP) analysis and PCR sequencing. Oncogene 7: 1445-145 1.

Horowitz JM, Yandell DW, Park S-H, Canning S, Whyte P, Buchkovich K, Harlow E, Weinberg RA, Dryja TP (1989) Point mutational inactivation of the retinoblastoma antionco- gene. Science 243:937-940.

Hu Q, Dyson N, Harlow E (1990) The regions of the retinoblas- toma protein needed for binding to adenovirus ElA or SV40 large T antigen are common sites for mutations. EMBO J

Huang S, Wang N-P, Tseng BY, Lee W-H, Lee EH-HP (1990) Two distinct and frequently mutated regions of retinoblastoma protein are required for binding to SV40 T antigen. EMBO J

Jeffreys AJ, Wilson V, Thein SL (1985) Hypervariable “minisat- ellite” regions in human DNA. Nature (London) 314:67-73.

Kato MV, lshizaki K, Ejima Y, Kaneko A, Tanooka H, Sasaki MS (1993) Loss of heterozygosity on chromosome 13 and its asso- ciation with delayed growth of retinoblastoma. Int J Cancer 54:922-926.

Kaye FJ, Kratzke RA, Gerster JL, Horowitz ]M (1990) A single amino acid substitution results in a retinoblastoma protein de- fect in phosphorylation and oncoprotein binding. Proc Natl Acad Sci USA 87:6922-6926.

Kobori ]A, Struss E, Minard K, Hood L (1986) Molecular analysis of the hotspot of recombination in murine major histocompat- ibility complex. Science 234:173-179.

Kratzke RA, Otterson GA, Lin AY, Shimizu E, Alexandrova N, Zajac-Kaye M, Horowitz JH, Kaye FJ (1992) Functional anal- ysis at the Cys706 residue of the retinoblastoma protein. ] Biol Chem 267:25998-26003.

Krowczynska AM, Rudders RA, Krontiris TG (1990) The human minisatellite consensus at breakpoints of oncogene transloca- tions. Nucl Acids Res 18:1121-1127.

9:1147-1155.

9:1815-1822.

Lee, EY-HP, Bookstein, R, Young L-J, Lin C-j, Rosenfeld MG, Lee, W-H (1988) Molecular mechanism of retinoblastoma gene inactivation in retinoblastoma cell line Y79. Proc Natl Acad Sci USA 85:6017-6021.

Lee W-H, Bookstein R, Hong F, Young L-J, Shew J-Y, Lee EY-H (1987) Human retinoblastoma susceptibility gene: Cloning, identification, and sequence. Science 235:1394-1399.

McGee TL, Yandell DW, Dryja TP (1989) Structure and partial genomic sequence of the human retinoblastoma susceptibility gene. Gene 80:119-128.

Old JM, Heath C, Fitches A, Thein SL, Jeffreys AJ, Petrou M, Modell B, Weatherall DJ (1986) Meiotic recombination be- tween two polymorphic restriction sites within the beta-globin cluster. J Med Genet 23:14-18.

Onadim 2, Hogg A, Baird PN, Cowell JK (1992) Oncogenic point mutations in exon 20 of the RBI gene in families showing incomplete penetrance and mild expression of the retinoblas- toma phenotype. Proc Natl Acad Sci USA 89:6177-6181.

Ouellette MM, Chen J , Wright WE, Shay JW (1992) Complexes containing the retinoblastoma gene product recognize different DNA motifs related to the E2F binding site. Oncogene 7:1075-1081.

Qian Y, Luckey C, Horton L, Esser M, Templeton DJ (1992) Biological function of the retinoblastoma protein requires dis- tinct domains for hyperphosphorylation and transcription fac- tor binding. Mol Cell Biol 12:5363-5372.

Qin X-q, Chittenden T, Livingston DM, Kaelin WG Jr (1992) Identification of a growth suppression domain within the retin- oblastoma gene product. Genes Dev 6:953 -964.

Satyanarayana K, Strominger JL (1992) DNA sequences near a meiotic recombinational breakpoint within the human HLA-DQ region. Immunogenetics 35:235-240.

Toguchida J , McGee TL, Ciccarelli JA, Eagle JR, Tucker S, Yan- dell DW, Dryja TP (1993) Complete genomic sequence of the human retinoblastoma susceptibility gene. Genomics, in press.

Vogel F (1979) Genetics of retinoblastoma. Hum Genet 52:l-54.

Yandell DW, Campbell TA, Dayton SH, Petersen R, Walton D, Little JB, McConkie-Rosell A, Buckley E, Dryja TP (1989) Oncogenic point mutations in the human retinoblastoma gene: their application to genetic counselling. N Engl J Med 321: 1689-1695.