Targeted mutagenesis of the ring-exported protein-1of Plasmodium falciparum disrupts the architectureof Maurer’s cleft organelles

Eric Hanssen,1,2 Paula Hawthorne,3

Matthew W. A. Dixon,3 Katharine R. Trenholme,3

Paul J. McMillan,1,2 Tobias Spielmann,4

Donald L. Gardiner3* and Leann Tilley1,2**1Department of Biochemistry and 2Centre of Excellencefor Coherent X-ray Science, La Trobe University,VIC 3086, Australia.3Infectious Diseases Division, Queensland Instituteof Medical Research, 300 Herston Rd, Herston,QLD 4006, Australia.4Bernhard Nocht Institute for Tropical Medicine, MalariaII, 20359 Hamburg, Germany.

Summary

Mature red blood cells have no internal traffickingmachinery, so the intraerythrocytic malaria parasite,Plasmodium falciparum, establishes its own trans-port system to export virulence factors to the redblood cell surface. Maurer’s clefts are parasite-derived membranous structures that form an impor-tant component of this exported secretory system. Aprotein with sequence similarity to a Golgi tetheringprotein, referred to as ring-exported protein-1 (REX1),is associated with Maurer’s clefts. A REX1–GFPchimera is trafficked to the Maurer’s clefts and pref-erentially associates with the edges of these struc-tures, as well as with vesicle-like structures and withstalk-like extensions that are involved in tethering theMaurer’s clefts to other membranes. We have gener-ated transfected P. falciparum expressing REX1 trun-cations or deletion. Electron microscopy reveals thatthe Maurer’s clefts of REX1 truncation mutants havestacked cisternae, while the 3D7 parent line hasunstacked Maurer’s clefts. D10 parasites, which havelost the right end of chromosome 9, including therex1 gene, also display Maurer’s clefts with stackedcisternae. Expression of full-length REX1–GFP in D10

parasites restores the 3D7-type unstacked Maurer’scleft phenotype. These studies reveal the importanceof the REX1 protein in determining the ultrastructureof the Maurer’s cleft system.

Introduction

The malaria parasite, Plasmodium falciparum, causes upto two million deaths per year. The stages of parasitedevelopment within the red blood cells (RBCs) of itshuman host are often associated with major pathologicalconsequences, such as cerebral and placental malaria,which can lead to death (Haldar et al., 2007). The particu-lar virulence of P. falciparum is due in part to the presen-tation of cytoadherence proteins at the surface of the hostRBCs. These proteins mediate adhesion of infected RBCswithin the microvasculature – a process that results in theocclusion of these vessels within vital organs. The best-characterized of these parasite-encoded molecules is afamily of proteins known as P. falciparum erythrocytemembrane protein 1 (PfEMP1) encoded by the var multi-gene family (Kyes et al., 2001; Kraemer and Smith, 2006).

As the parasite develops within an RBC, it is separatedfrom the RBC plasma membrane by its own plasma mem-brane, the membrane of the parasitophorous vacuole(PV) and the host cell cytoplasm. Despite this seclusion,the parasite has developed mechanisms for export of arange of virulence factors and for insertion of PfEMP1 intothe host membrane. Given that the mature RBC lacks anyendogenous protein-trafficking machinery, the mecha-nism for trafficking of PfEMP1 to its final destination at theRBC membrane is clearly unusual (Marti et al., 2005;Tilley et al., 2008). This has led to significant interest inthe membranous structures that the parasite elaborates inthe host cell cytoplasm. These comprise a tubulovesicularnetwork (TVN) that consists of extensions and whorlsemanating from the PV membrane (Haldar and Mohan-das, 2007) as well as structures known as Maurer’s clefts(Elford et al., 1995, 1997; Atkinson et al., 1988; Krieket al., 2003; Lanzer et al., 2006). The Maurer’s clefts arethought to originate from the PV membrane then matureto form functionally independent structures that are teth-ered to the RBC plasma membrane (Spycher et al., 2006;

Accepted 2 June, 2008. For correspondence. *E-mail: don.gardiner@qimr.edu.au; Tel. 61-7-33620432; Fax: 61-7-33620104. **E-mail:l.tilley@latrobe.edu.au; Tel. (+61) 3 94791375; Fax: (+61) 394792467.

Molecular Microbiology (2008) 69(4), 938–953 � doi:10.1111/j.1365-2958.2008.06329.xFirst published online 28 June 2008

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd

Hanssen et al., 2008). Maurer’s clefts are believed to bean important intermediate compartment involved in thesorting and trafficking of PfEMP1 and other virulencedeterminants en route to the RBC membrane (Marti et al.,2005; Tilley et al., 2008).

The Maurer’s clefts have a number of resident integralmembrane proteins (Lanzer et al., 2006) that are tran-scribed in the early ring stage as these structuresare being generated. These include the membrane-associated histidine-rich protein-1 (MAHRP1; Spycheret al., 2006), the skeleton binding protein-1 (SBP1; Blis-nick et al., 2000; Cooke et al., 2006; Maier et al., 2007)and the ring-exported protein-2 (Spielmann et al., 2006a).Deletion of SBP1 prevents export of PfEMP1 to thesurface of infected RBCs, revealing the potential impor-tance of the Maurer’s cleft-resident proteins (Cooke et al.,2006; Maier et al., 2007). Similarly, deletion of MAHRP1alters the Maurer’s cleft structure and compromises thetrafficking of PfEMP1 (Spycher et al., 2008).

A number of peripheral membrane proteins are alsoassociated with the Maurer’s clefts. The knob-associatedhistidine-rich protein (KAHRP) and P. falciparum erythro-cyte membrane protein-3 (PfEMP3) are transiently asso-ciated with the cytoplasmic surface of the Maurer’s cleftsbefore redistribution to the cytoplasmic face of the RBCplasma membrane (Waterkeyn et al., 2000; Wickhamet al., 2001). Ring-exported protein-1 (REX1) is a Maur-er’s cleft resident that appears to be peripherally associ-ated with the cytoplasmic surface of this compartment(Hawthorne et al., 2004; Spielmann et al., 2006a).

Despite their importance in the delivery of PfEMP1 andother virulence factors, relatively little is known of thefine structure of the Maurer’s clefts. We have recentlyemployed electron tomography to examine the 3D ultra-structure of Maurer’s cleft (Hanssen et al., 2008). TheMaurer’s clefts are revealed as flattened structures with aconvoluted morphology. We described novel stalk-likeextensions involved in connecting Maurer’s clefts tothe RBC membrane and the PV membrane and alsoobserved nodular protrusions and vesicle-like structures,with a diameter of about ~25 nm. Fluorescence pho-tobleaching shows that there is no lipid continuumbetween the Maurer’s clefts and the parasite or hostmembranes (Spielmann et al., 2006a; Spycher et al.,2006; Hanssen et al., 2008). Immunogold labelling withanti-PfEMP1 showed that this protein is largely restrictedto the Maurer’s cleft bodies while SBP1 is associated withboth the Maurer’s cleft bodies and the tethers (Hanssenet al., 2008).

In the present study, we have used immuno-electrontomography to examine the subcellular location of theperipheral Maurer’s cleft protein, REX1. A region of theREX1 sequence shows some similarity to vesicle tether-ing proteins, such as Uso1p and p115 (Hawthorne et al.,

2004). The similarity is in a region of sequence (aminoacids 186–342), which gives a strong prediction forforming a coiled-coil structure. Coiled-coil regions arepredicted to form pairs of a-helices that wrap aroundeach other to form a super helix and are often involvedin protein–protein interactions (Burkhard et al., 2001).Coiled-coil domains in the Bin/amphiphysin/Rvs super-family of proteins are curvature-sensing modules that areinvolved in membrane sculpting (Gallop et al., 2006;Henne et al., 2007). This suggests that REX1 could play arole in determining the Maurer’s cleft architecture. We findthat REX1 is indeed concentrated on the edges of thedisc-shaped Maurer’s cleft and depleted from the flattersurfaces. It is also associated with vesicle-like structuresand with the stalk-like extensions that link the Maurer’sclefts to other membrane compartments.

In an effort to further delineate the role of REX1 inmaintaining Maurer’s cleft architecture, we have exam-ined parasites that have lost the rex1 gene. Deletion of theright arm of chromosome 9 in the D10 strain of P. falci-parum leads to the loss of 22 genes, including rex-1, -2, -3and -4 and CLAG9, with accompanying loss of cytoadher-ence (Day et al., 1993; Barnes et al., 1994; Bourke et al.,1996; Spielmann et al., 2006a). We find that the Maurer’sclefts of D10 strain parasites show stacked lamellaewhile 3D7 strain parasites have mostly single lamellae(Hanssen et al., 2008). P. falciparum transfectantsexpressing a truncated rex1 gene have been generatedpreviously (Hawthorne et al., 2004). We have generatedtransfectants expressing a more extensive rex1 truncationand a complete gene deletion. Deletion or truncation ofREX1 causes stacking of the Maurer’s cleft lamellaewhich leads to an apparent decrease in Maurer’scleft numbers when examined by immunofluorescencemicroscopy. Expression of full-length REX1–GFP inD10 parasites restores the unstacked Maurer’s cleftphenotype.

Results

REX1–GFP is associated with the Maurer’s cleftorganelles

The REX1 has been described as a marker of theMaurer’s cleft compartments (Hawthorne et al., 2004). Wehave generated P. falciparum transfectants expressingfull-length REX1 fused to GFP using proceduresdescribed by Dixon et al. (2008) and used fluorescencemicroscopy of live cells to examine the location of thechimera in RBCs infected with early and late stage para-sites (Fig. 1A and B). Immunofluorescence microscopyconfirms that the REX1–GFP chimera is associated withpunctuate structure in the RBC cytoplasm and shows thatthese structures are also recognized by an antiserum

REX1 and Maurer’s cleft morphology 939

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

raised against the C-terminal domain of endogenousREX1 (Fig. 1C). These structures are also labelled usingantisera against two other known Maurer’s cleft residentproteins, MAHRP1 and SBP1 (Spycher et al., 2003;Cooke et al., 2006) (Fig. 1D and E). An antiserum againstPfEMP1 cytoplasmic domain is partly colocated withREX1 but also recognizes a population of PfEMP1 at theRBC membrane and within the parasite (Fig. 1F).

Ultrastructural organization of REX1

In an effort to obtain information about the location and

organization of REX1 at the ultrastructural level, wehave employed a method that involves permeabilizinglightly fixed infected RBCs with the pore-forming toxin,Equinatoxin II (EqtII; Anderluh et al., 1996; Jackson et al.,2004). This allows the release of haemoglobin and theintroduction of primary antibodies recognizing epitopesthat are exposed to the host cytoplasm. In thin (~70 nm)sections of 3D7 or REX1–GFP transfectant-infectedRBCs, which have been stained and prepared for trans-mission electron microscopy (EM), the Maurer’s cleftsare usually observed as single slender cisternae withan electron-lucent lumen and an electron-dense coat(Fig. 2). Transverse sections through some of theMaurer’s clefts reveal the flattened surface of theMaurer’s cleft bodies (Fig. 2C and D, arrows). In somesections, vesicle-like structures are observed at the RBCmembrane (Fig. 2A) or at the edges of the Maurer’s clefts(Fig. 2D). Occasionally, regions of the Maurer’s clefts areobserved that are tethered to the PV membrane or theRBC membrane (Fig. 2B and D, thick arrows).

When the permeabilized infected RBCs are labelledwith an antiserum recognizing the C-terminal domain ofREX1, the gold particles decorate the Maurer’s cleft coat(Fig. 2A and B). Labelling of 3D7_REX1–GFP transfec-tants with anti-GFP gives a similar labelling profile toendogenous REX1 (Fig. 2C and D). Interestingly, whenthe Maurer’s cleft is observed in transverse section, thegold particles appear to be concentrated at the edges ofthe organelle (Fig. 2C). While the Maurer’s clefts are quiteheavily decorated with gold particles, the RBC membraneand the PV membrane are largely devoid of REX1labelling. Interestingly, some gold particles are observedin association with the tethers linking the Maurer’s clefts tothe PV and RBC membranes (Fig. 2B and D) and with thevesicle-like structures (Fig. 2D). In control labelling experi-ments, in which the primary antibodies are omitted, or inwhich anti-GFP is used with the untransfected 3D7 strain,virtually no gold particles are observed in the samples(data not shown).

Electron tomographic analysis reveals that REX1 isassociated with the edges of the Maurer’s clefts

Electron tomography is an invaluable tool for obtaining 3Dinformation from samples that have been prepared for EM(Frank, 1992; Baumeister et al., 1999; Lucic et al., 2005;McIntosh et al., 2005; Subramaniam, 2005). We haverecently developed methods for electron tomography ofimmunogold-labelled infected RBCs (Hanssen et al.,2008). P. falciparum-infected RBCs (3D7 strain) were per-meabilized with EqtII, labelled with antibodies recognizingendogenous REX1, then fixed, dehydrated and embed-ded in resin. Semi-thin sections (~300 nm) were cut, con-trasted with lead citrate and observed at 200 kV. IMOD

Fig. 1. Live cell and immunofluorescence microscopy of3D7_REX1–GFP P. falciparum transfectants. The first image ineach panel is a differential interference contrast image.A and B. RBCs infected with live ring (A) and late trophozoite (B)stage parasites show puncta of fluorescence in the RBC cytoplasm,which are likely to represent Maurer’s clefts (arrowheads).C–F. Trophozoite stage-infected 3D7_REX1–GFP transfectant-infected RBCs were labelled with mouse (C, E and F) or rabbit(D) anti-GFP antiserum (green) and rabbit (C, E and F) or mouse(D) antiserum recognizing REX1 (C), MAHRP1 (D), SBP1 (E) andPfEMP1 (F) (red). Overlap of the signals confirms the Maurer’s cleftlocations of these proteins. PfEMP1 is also partly located at theRBC membrane and within the parasite. The intensities of theimages were adjusted to optimize the fluorescence signals. Barsare 5 mm.

940 E. Hanssen et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

software was used to align the tilt series and performsegmentations.

One of the virtual slices of 20 nm thickness is presentedin Fig. 3A. The section depicts a region of a Maurer’s cleftwith a translucent lumen and an electron-dense coat bor-dered by less well-defined regions with uniform but amor-phous staining (arrows). Three dimensional renderingreveals that the central region is in fact a flattened lamellarstructure with weakly stained internal contents. The 3Dshape of the Maurer’s cleft is best appreciated by exam-ining a rotation of the rendered structure (Video S1). TheMaurer’s cleft is bordered by tubular extensions with adiameter of about 30 nm (Fig. 3B, arrows). These arepresumably equivalent to the tethers that are observed inthin-section projection images (Fig. 2D). The tethers haveelectron-dense contents (best observed in a translationthrough the virtual sections, see Video S2). Analysis oftomogram and thin-section electron microscopy data(20 examples) indicates that the tether-like extensionsare attached to the edges of the Maurer’s cleft bodies.Vesicle-like structures (Fig. 3A, B and D, arrowheads)with a diameter of about 25 nm are also observedattached to the Maurer’s cleft bodies and tethers. Thetethers and vesicle-like structures have been describedpreviously (Hanssen et al., 2008).

Anti-REX1 antibodies decorate the Maurer’s clefts(Fig. 3B, yellow spheres). Rotation of the reconstructedmodels reveals that the gold particles are preferentiallyassociated with the edges of the disc-shaped Maurer’sclefts (see Video S1). Similarly in the Maurer’s cleftsdepicted in Fig 3C and D, the gold particles are concen-

trated at the edge of the Maurer’s clefts. Some anti-REX1antibodies are also associated with the tethers and with thevesicle-like structures (Fig. 3B and D). In some sections,we observed double membrane-bound haemoglobin-containing structures that probably represent regions ofTVN wrapping around, and trapping regions of RBC cyto-plasm (Hanssen et al., 2008). Maurer’s clefts sometimesappeared to be directly attached to these TVN structures;however, the protein composition is strongly delineated(Fig. 3D).

We have analysed the density of REX1 epitopes indifferent regions of the Maurer’s clefts on 3D7-parasitized RBCs by counting the number of gold par-ticles per unit area (analysis of 1.05 mm2 of Maurer’scleft surface area). We found 774 gold particles mm-2 onthe edges of the Maurer’s clefts and 65 gold particlesmm-2 on the flatter regions of the Maurer’s clefts. Wealso examined 18 vesicle-like structures (correspondingto an area of 0.054 mm2) and found 167 gold particlesmm-2. We also analysed two tethers (corresponding toan area of 0.073 mm2) and found 357 gold particlesmm-2. The standardized epitope distributions are pre-sented in Fig. 4. For comparison, we analysed the dis-tribution of Maurer’s clefts-associated gold particles intransfected parasites expressing MAHRP–GFP labelledwith anti-GFP antiserum (analysis of 1.4 mm2 of Maurer’scleft surface area) and in 3D7-infected RBCs labelledwith an antiserum against PfEMP1 (analysis of 0.8 mm2).In both cases, we found that the ratio of gold particlesassociated with the edges and the flatter regions wasvery close to 1:1 (35 gold particles mm-2 in both regions

Fig. 2. Immuno-EM of thin sections throughMaurer’s clefts. Sections throughEqtII-permeabilized RBCs infected with 3D7strain parasites (A and B) or 3D7_REX1–GFPtransfectants (C and D) showing Maurer’sclefts (MC) with an electron-lucent lumen andan electron-dense membrane. Connections tothe PV membrane (B, PVM) and the RBCmembrane (D, RBCM) are indicated with thickarrows. Flattened regions of the Maurer’sclefts observed in transverse section (C andD) are indicated with smaller arrows. Theinfected RBCs were labelled with anti-REX1(A and B) or anti-GFP (D and E) antiserumfollowed by protein A-gold (6 nm conjugate).Bars are 200 nm.

REX1 and Maurer’s cleft morphology 941

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

for anti-MAHRP–GFP; 43 gold particles mm-2 in bothregions for anti-PfEMP1).

REX1–GFP adopts a similar Maurer’s cleft distributionto endogenous REX1

We have also generated tomograms of the REX1–GFPtransfectant-infected RBCs labelled with anti-GFP(Fig. 3E–H). Again Maurer’s cleft bodies are heavily deco-rated with gold while the RBC membrane (green) and PVmembrane (aqua) are largely devoid of gold particles(Fig. 3E and F). Again the flatter regions of the Maurer’scleft bodies (for example the region marked with an aster-isk) have few gold particles while the edges are heavilydecorated (See Video S3 for a rotation of the model).In some of the tomograms, a number of vesicle-likestructures (white spheres) and fragments of tether-likestructures (pink tubes) are apparent; these also havegold particles associated with them (Fig. 3H). As for the

labelling of endogenous REX1, we observed doublemembrane-bound structures that probably representregions of the TVN (Fig. 3G and H, arrows). Again thesestructures have no REX1–GFP labelling even though theyare in close contact with the Maurer’s clefts.

As for endogenous REX1, the GFP-tagged protein inthe transfectants is mainly associated with the edge of theMaurer’s clefts. We analysed tomograms (representing1.8 mm2 of Maurer’s cleft surface area) and found 621 goldparticles mm-2 on the edges of the Maurer’s clefts and 54gold particles mm-2 on the flatter regions of the Maurer’sclefts. We also examined 49 vesicle-like structures (cor-responding to an area of 0.147 mm2) and found 170 goldparticles mm-2. Three tethers were analysed (correspond-ing to an area of 0.06 mm2) and found to have 309 goldparticles mm-2. The distribution ratio is similar to thatobserved for endogenous REX1 (Fig. 4), indicating thatthe transgene product adopts a very similar subcellularorganization to endogenous REX1.

Fig. 3. Immunoelectron tomography of permeabilized 3D7- and 3D7_REX1–GFP transfectant-infected RBCs showing the subcellular locationof REX1.A–D. EqtII-permeabilized 3D7-infected RBC labelled with anti-REX1 antiserum followed by protein A-gold (6 nm conjugate).A. Virtual 20 nm section through a tomogram showing a Maurer’s cleft body flanked by two tether-like structures.C. A whole tomogram was projected and averaged with ImageJ using minimum intensity. The segmentation was performed semi-automaticallyusing the IMOD-auto routine and the contours were assigned manually (B and D, red, Maurer’s cleft; green, RBC membrane; yellow, goldparticles). The gold particles are concentrated at the edges of the Maurer’s cleft bodies. Vesicle-like structures (grey spheres, arrowheads) areobserved associated with the Maurer’s clefts and RBC membrane (B and D). Regions with extended stalk-like profiles, which may be parts oftethers linking to the RBC membrane, are depicted as pink tubes (A and B, arrows). These regions are also labelled with gold particles.C and D. A double membrane-bound haemoglobin-containing structure which may be part of the TVN is indicated in magenta. This structureis not labelled with anti-REX1. A REX1-labelled Maurer’s cleft appears to be connected to the TVN.E–H. EqtII-permeabilized 3D7_REX1–GFP transfectants were labelled with anti-GFP and prepared for semi-thin sectioning (300 nm).E and G. Re-projections of the whole thickness of tomograms in planes parallel (E) and perpendicular (G) to the transverse surfaces ofMaurer’s clefts. The whole tomograms were used to generate the models and drive the rendering process (F and H: red, Maurer’s cleft; green,RBC membrane; aqua, PV membrane; blue, double membrane-bound compartment/TVN; grey spheres, vesicle-like structures; pink tubes,tether-like structures; yellow, gold particles). The asterisk marks a flatter region of a Maurer’s cleft body that is depleted of gold particles. Barsare 100 nm. A translation through tomogram (A) and rotations of models (B) and (F) are shown in Videos S1–3.

942 E. Hanssen et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

Generation and characterization of transfectants withREX1 truncations or deletion

The main structural features of REX1, including a recessedN-terminal hydrophobic stretch (red), a predicted coiled-coil region (hatched) and a C-terminal repeat region (blue)are depicted in Fig. 5D. The predicted molecular massof the mature protein (assuming cleavage of the signalsequence) is 76 kDa. We have previously generated trans-fected P. falciparum expressing a REX1 truncation (SKO,Aand B clones). In SKO parasites, the REX1 open readingframe (ORF) is truncated to 362 amino acids. The trun-cated REX1 protein is not recognized by an antiserumagainst the C-terminal repeat region of REX1 (Hawthorneet al., 2004). We have now generated an antiserum againstamino acids 66–169 of the translated protein. The speci-ficity of the antiserum was confirmed by Western blotanalysis and immunofluorescence microscopy of the para-site clones, D10, 3D7 and SKO.

The REX166-169 antiserum recognizes a band of approxi-mately 115 kDa in 3D7 parasites but not in D10 which hasa genetic deletion of the region of chromosome 9 contain-ing REX1 (Fig. 5A). This banding pattern is equivalent tothat observed with the C-terminal antiserum used in ourprevious study (Hawthorne et al., 2004). The apparentmolecular mass is somewhat larger than predicted;however, the identity of the 115 kDa band was previouslyconfirmed by mass spectrometry (Hawthorne et al.,2004). Anomalous migration of parasite proteins is oftenobserved and is assumed to be due to unusual orrepetitive amino acid sequence (Cowman et al., 1984;Wickham et al., 2001). The REX166-169 antiserum recog-

nizes a protein with an apparent molecular mass ofapproximately 55 kDa in the SKO (A clone) (Fig. 5A,predicted molecular mass ~35 kDa). A band of the samesize was observed in a second transfectant (B clone)generated using the same truncation construct (datanot shown).

We have now generated additional transfectantsexpressing a further REX1 truncation and an effectiveREX1 deletion. In TK1 parasites, the REX1 ORF is trun-cated to a fragment representing amino acids 1–259 of thetranslated REX1 protein. In TK2 parasites, the REX1 ORFis truncated to a fragment representing the first 63 aminoacids of REX1 (see Fig. 5D for diagrams). Integration bydouble homologous recombination was confirmed by PCRanalysis (data not shown). The parasite lines were clonedby limiting dilution. PCR analysis confirmed that no full-length REX1 could be detected in these clones.

Northern blot analysis using a probe to the completeREX1 coding sequence indicated that the TK2 cloneswere not expressing any rex1 mRNA (Fig. S1). Thus theTK2 clones represent a true genetic deletion of rex1.Western analysis of TK1 transfectant-infected RBCsreveals a band with an apparent molecular mass of about42 kDa (Fig. 5A; predicted molecular mass for the matureprotein ~23 kDa). As expected, no protein band isobserved in a Western blot of the TK2 parasites probedwith the antiserum against amino acids 66–169 and nobands were observed for either of these transfectantsusing the antiserum against the C-terminal region (datanot shown).

Truncated REX1 protein fragments are exportedto the Maurer’s clefts

We have used immunofluorescence microscopy to detectMaurer’s clefts and to analyse the locations of the REX1fragments in the truncation mutant transfectants (Fig. 5B).Maurer’s clefts are observed as punctate structures in theRBC cytoplasm in 3D7 parasites labelled with the knownMaurer’s cleft protein, SBP1 (Cooke et al., 2006) or withthe antiserum against REX166-169 (Fig. 5B, top row). Bycontrast, RBCs infected with D10 parasites are notlabelled with either REX1 antiserum (data not shown). Inthe SKO (clone A, Fig. 5B, second row; and clone B, datanot shown), the antiserum against REX166-169 also recog-nized the truncated REX1 protein at the Maurer’s clefts.However, an antiserum against the C-terminal regiondoes not recognize the truncated REX1 protein (Haw-thorne et al., 2004 and data not shown). The Maurer’sclefts location was confirmed by dual labelling withanti-SBP1 antiserum (Fig. 5B, second row). Interestingly,there appeared to be fewer antibody-labelled structures inthe SKO-infected RBCs compared with 3D7 controls(Fig. 5C).

Fig. 4. Distribution of gold particles on different Maurer’s cleftregions and Maurer’s cleft-associated structures. The total numberof gold particles on Maurer’s clefts and associated structures wascounted in regions totalling 1.5 mm2 and 0.9 mm2 for 3D7 (filledbars) and 3D7_REX1–GFP transfectants (open bars), respectively.The density of gold particles per mm2 associated with the edge, flatpart, vesicle-like structures (VLS) and tether-like structures wascompared with the overall density. Edges were modeled asdescribed in Materials and Methods.

REX1 and Maurer’s cleft morphology 943

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

Fig. 5. Western blot andimmunofluorescence microscopy analyses ofREX1 truncation and deletion mutants.A. Saponin-insoluble (pellet, P) andsupernatant (S) material from RBCs infectedwith 3D7 or D10 parasites or from REX1truncation (SKO, TK1) and deletion (TK2)mutants was subjected to SDS-PAGE (10%acrylamide), transferred to nitrocellulose andprobed with the anti-REX166-169 antiserumfollowed by a horseradish peroxidase-labelledanti-mouse IgG antiserum. The membranewas stripped and re-probed with a rabbitanti-GAPDH antiserum.B. Immunofluorescence microscopy ofparaformaldehyde-fixed RBCs infected with3D7, SKO, TK1 or TK2 parasites probed withanti-REX166-169 antiserum and anti-SBP1. Thenuclei were visualized with Hoechst staining.Bar is 5 mm.C. The average number of SBP1-labelledpuncta per infected RBC was determined.Only infected RBCs with single nuclei wereincluded. 3D7 had an average of 12.9 � 0.8(SE) SBP1-labelled structures per singlenucleated parasite. SKO and TK1 parasiteclones had an average of 2.5 � 0.2 (SE) and2.7 � 0.2 (SE) SBP1-labelled structures persingle nucleated parasite. TK2 and D10parasite clones had an average of 5.6 � 0.4(SE) and 4.5 � 0.4 (SE) SBP1-labelledstructures per single nucleated parasite. *Thedifference in the number of SBP1-labelledstructures between 3D7 and TK2 and D10 issignificant (P < 0.001). **The differencebetween 3D7 and SKO and TK1 is significant(P < 0.0001). #The difference between thetruncated REX1 clones, SKO and TK1, andthe true knockout clones, D10 and TK2, isalso significant (P < 0.01).D. Diagrammatic representation of thefull-length REX1 protein in 3D7 and the SKO,TK1 and TK2 mutants. Red bar, signalsequence; hatched region, coiled-coil domain;blue region, C-terminal repeats.

944 E. Hanssen et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

Immunofluorescence microscopy of TK1 transfectant-infected RBCs (which express REX1 deleted in the middleof the predicted coiled-coil region) reveals punctate struc-tures that are labelled with both the antiserum againstREX166-169 and the anti-SBP1 antiserum (Fig. 5B, thirdrow). The number of antibody-labelled puncta was alsosmaller in these mutants (Fig. 5C). As expected, therewas no labelling of Maurer’s clefts with the anti-REX166-169

antiserum in the TK2 clones (Fig. 5B, fourth row). Therewas labelling of punctate structures with anti-SBP1;however, the number of labelled structures was againsignificantly lower than in the 3D7 parent strain. An analy-sis of D10-infected RBCs also revealed a decreasednumber of SBP1-labelled structures compared with 3D7parasites (Fig. 5C). These data indicate that truncation ofREX1 at the C-terminal end is sufficient to cause anapparent decrease in the number of Maurer’s cleftstructures. It is interesting that RBCs infected with D10parasites or the TK2 parasites with a complete REX1deletion apparently have more SBP1-labelled structuresthan the parasites with partial truncations of REX1 (SKOand TK1) potentially indicating a dominant negative effect.

Truncation or deletion of REX1 leads to a stackedMaurer’s clefts phenotype

We have previously reported that RBCs infected with 3D7parasites have Maurer’s clefts that usually appear as

single lamella in EM thin sections (Fig. 6A and Hanssenet al., 2008). By contrast, RBCs infected with D10 strainparasites often display Maurer’s clefts with multiple lamel-lae (Fig. 6B; Culvenor et al., 1987; Hanssen et al., 2008).We have therefore undertaken an ultrastructural analysisof the morphology of the Maurer’s clefts in the REX1deletion mutants. In each case, the mutant parasitesshowed stacked Maurer’s clefts (Fig. 6C–E). An analysisof thin-section data from 3D7-infected RBCs reveals thatonly 8% of the Maurer’s clefts have more than onelamella, while in D10-infected RBCs 64% of the Maurer’sclefts have two or more lamellae (Hanssen et al., 2008).In RBCs infected with the SKO, TK1 and TK2 parasites,64%, 74% and 48%, respectively, of the Maurer’s cleftsappear to have two or more lamellae. These data indicatethat loss of the C-terminal region of REX1 is sufficient togenerate a stacked Maurer’s cleft phenotype. Tomo-graphic analysis of regions of a Maurer’s cleft stack fromthe SKO parasites reveals closely packed lamellae(Fig. 6G) and whorl-like structures (Fig. 6H). These dataconfirm the much more complex nature of this organelle inthese parasites compared with Maurer’s clefts from 3D7-infected RBCs (Fig. 6F). The 3D shape of the Maurer’sclefts in these 3D7 and SKO parasites is best appreciatedby examining rotations of the rendered models (Videos S4and 5). The stacking of the Maurer’s clefts is presumablyalso responsible for the apparent decrease in thenumbers of SBP1-labelled structures when the mutant

Fig. 6. EM of sections through Maurer’sclefts in REX1 truncation and deletionmutants. Sections through RBCs infected with3D7 (A) or D10 (B) parasites or with 3D7transfectants expressing REX1 truncations,SKO (C) and TK1 (D) or a REX1 deletion,TK2 (E). The Maurer’s clefts (MC) haveelectron-lucent luminal compartments andelectron-dense membranes. The 3D7Maurer’s clefts are usually comprised ofsingle lamellae while the D10 and REX1mutant parasites have stacked lamellae.Whorl-like structures are apparent in somesections (for example, see C, arrowed). Barsin A-C, F are 100 nm. Bar in D is 250 nm.(F–H) Semi-thin sections (300 nm) of intactRBCs infected with 3D7 (F) and SKO (G andH) parasites were prepared for electrontomography. The entire tomograms were usedto generate the models and drive therendering process. The rendered Maurer’sclefts are depicted in red. Rotation of models(F) and (H) are shown in Videos S4 and 5.

REX1 and Maurer’s cleft morphology 945

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

cell lines are examined by immunofluorescence micro-scopy. However, we found no difference in the averagethickness of the Maurer’s cleft lamellae in the differentparasites. The values for the Maurer’s cleft thickness(lumen and both membranes) for 3D7, D10, SKO, TK1and TK2 parasites are 29 � 5, 31 � 4, 30 � 3 and28 � 5 nm respectively. This indicates that while thelamellae become stacked and whorled, there is no grosschange in the shape of the individual lamella.

To further investigate the role of REX1 in controllingMaurer’s cleft architecture, we complemented D10 para-sites with a plasmid encoding REX1–GFP, resulting in aline referred to as D10_REX1–GFP. To check for thepresence of REX1 in the complemented line, we per-formed immunoblot analyses probing with anti-REX1 afterseparation of the samples into soluble and membrane-associated fractions (Fig. 7A). In the 3D7 strain, REX1migrates with an apparent molecular mass of about115 kDa and is largely associated with the insolublefraction as previously reported (Hawthorne et al., 2004).No REX1 protein is detected in the D10-infectedRBCs; however, a band of ~140 kDa was detected inD10_REX1–GFP parasites. The REX1–GFP proteinchimera is also associated with the insoluble fractionD10_REX1–GFP parasites, indicating that it mimics theorganization of the protein in the 3D7 strain; however, it isapparently expressed at a lower level than in 3D7parasites. An anti-SBP1 reactive band was detected ineach of the parasite lines; however, the protein has aslightly lower apparent molecular mass in the D10 andD10_REX1–GFP lines. This is due to variability in theC-terminal region of the protein as has been reportedpreviously (Blisnick et al., 2000).

To confirm the presence of REX1 in the D10_REX1–GFP transfectants at the cellular level and to determinewhether the presence of REX1 in D10_REX1–GFP alsorestored the unstacked Maurer’s cleft phenotype, weprobed fixed cells with antibodies recognizing REX1 andSBP1 (Fig. 7B). RBCs infected with D10 parasites showno signal for REX1 although the presence of Maurer’sclefts is indicated by anti-SBP1 labelling (Fig. 7B, toprow). In the D10_REX1–GFP transfectants, punctatestructures in the RBC cytoplasm are labelled with bothanti-REX1 and anti-SBP1 antisera (Fig. 7B, middle row).The presence of REX1–GFP in these samples was con-firmed by labelling with anti-GFP (Fig. 7C). The RBCsinfected with D10_REX1–GFP transfectants had anaverage of 12.8 � 0.9 SBP1-labelled structures per cell,which was similar to the number (12.9 � 0.9 per cell) for3D7 and substantially higher than the number (4.5 � 0.4per cell) for D10-infected RBCs (Fig. 7D).

We assessed the ultrastructural morphology of theMaurer’s clefts in RBCs infected with the D10_REX1–GFP transfectants (Fig. 7E). The transfectants displayed

flattened, mainly single lamellar Maurer’s clefts with amorphology that appeared very similar to that of 3D7parasites. An analysis of thin-section data fromD10_REX1–GFP-infected RBCs revealed 87% of theMaurer’s clefts with a single lamella and 13% with morethan one lamella. Thus the replacement of REX1 geneappears to have restored the unstacked Maurer’s cleftsphenotype.

Discussion

The parasite line, D10, a clone of FC27, is characterizedby a natural deletion of a region of approximately 55 kb onthe right arm of chromosome 9 of P. falciparum (Anderset al., 1983; Day et al., 1993; Barnes et al., 1994; Bourkeet al., 1996). This results in the loss of 22 genes includingrex-1, -2, -3 and -4, and CLAG9, which in turn leads to theloss of the cytoadherence phenotype, the loss of aggluti-nation by hyperimmune sera and the loss of the ability toundergo gametocytogenesis. We have recently shownthat RBCs infected with D10 parasites display a stackedMaurer’s cleft phenotype while RBCs infected with 3D7parasites have dispersed Maurer’s clefts (Hanssen et al.,2008). In this work, we have characterized the potentialrole of REX1, one of the gene products that is deleted inD10 parasites, in determining Maurer’s cleft morphology.

The REX1 is the largest member of a cluster of genes(rex-1 to -4) transcribed during the intraerythrocytic ringstages of P. falciparum. REX1 shows no significantsequence similarity to proteins in other Plasmodiumspecies or in other organisms. It is transcribed only in ringstages; however, the protein persists throughout thelife cycle of the parasite (Spielmann and Beck, 2000;Hawthorne et al., 2004; Spielmann et al., 2006a). REX1appears to have a recessed signal sequence that presum-ably directs entry into the endoplasmic reticulum. Recentstudies (Hiller et al., 2004; Marti et al., 2004) have identi-fied a pentameric amino acid sequence that serves as ahost cell targeting sequence. The host targeting/proteinexport element (HT/PEXEL) motif is usually located about40 amino acids downstream from the hydrophobic signalsequence (and is usually encoded near the start of exon2 in a two-exon gene). REX1 lacks an obvious HT/PEXELmotif; however, we have recently identified a region fol-lowing the signal sequence that appears to be involved inexport to the RBC cytoplasm (Dixon et al., 2008).

We have examined the location of REX1–GFP inP. falciparum 3D7 transfectants. The chimeric protein islocated in punctuate compartments dispersed throughoutthe RBC cytoplasm. In an effort to understand the orga-nization and precise location of the REX1-containingcompartments, we have undertaken immuno-electrontomography studies. This method provides 3D ultrastruc-tural information, although electron absorption, radiation

946 E. Hanssen et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

damage and signal to noise problems limit the thicknessof the sections that can be examined to ~400 nm(Baumeister et al., 1999; Ladinsky et al., 1999; Lucicet al., 2005; McIntosh et al., 2005).

In agreement with our recent study (Hanssen et al.,2008), the tomographic reconstructions reveal the

Maurer’s clefts as flattened sack-like bladders withsurface crevices and convoluted edges. Adjacent Maur-er’s cleft bodies appear to be connected to each other viaregions with a slimmer profile and, in some sections,stalk-like tethers are observed that appear to connect theMaurer’s clefts to the RBC membrane and to the PV

Fig. 7. Expression of REX1–GFP in D10transfectants restores the unstacked Maurer’scleft phenotype.A. Percoll-purified 3D7, D10 andD10_REX1–GFP-infected RBCs weresubjected to lysis with saponin. Supernatant(S) and pellet (P) fractions were prepared forWestern blot analysis. The top panel wasprobed with an antiserum against theC-terminal region of REX1, the middle panelwith rabbit anti-SBP1 and the bottom panelwith anti-GAPDH. REX1-specific band wereobserved in 3D7 and in the D10_REX1–GFP-infected RBCs but not in the D10 parentstrain.B and C. Immunofluorescence microscopy ofparaformaldehyde-fixed RBCs infected withD10 or D10_REX1–GFP parasites probedwith anti-SBP1 antiserum and anti-REX1antiserum (B) or anti-GFP (C). Each rowrepresents a Hoechst stain of the parasitenuclei, the REX1 (or GFP) and SBP1immunofluorescence signals and a merge ofthe three channels. Scale bar = 5 mm.D. The average number of SBP1-labelledpuncta per infected RBC with a single nucleuswas determined.E. Transmission EM of a thin section throughan RBC infected with a D10_REX1–GFPparasite.

REX1 and Maurer’s cleft morphology 947

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

membrane. Individual vesicle-like structures are alsoobserved in some sections. Immunogold labelling ofEqtII-permeabilized infected RBCs showed that bothendogenous REX1 and REX1–GFP are concentrated atthe Maurer’s clefts and highly depleted from the PVM/TVN membranes and from the RBC plasma membrane.Even in regions where nascent Maurer’s clefts appearedto be physically connected to the PVM/TVN, the PVM andTVN were completely devoid of REX1 labelling. As REX1is a peripheral membrane protein, it presumably binds toa protein (or possibly lipid) component that is concen-trated in the Maurer’s clefts. The data support the sug-gestion that as the Maurer’s clefts form, there is lateralsegregation of Maurer’s clefts resident proteins from theproteins destined to remain in the PV/TVN membranes(Tilley et al., 2008).

Interestingly, both REX1 and REX1–GFP are concen-trated at the edge of the Maurer’s clefts. The number ofgold particles decorating the edges is about 10-fold higherthan the number decorating the flatter regions. Goldparticles are also associated with the tethers and thevesicle-like structures. By contrast, PfEMP1 and anotherMaurer’s cleft resident protein, MAHRP1, are evenly dis-tributed between the edges and flatter regions of theMaurer’s cleft bodies and are depleted from the tethersand vesicle-like structures.

The REX1 has a region of amino acids (186–342) thatis strongly predicted to form a coiled-coil structure. Coiled-coils comprise two a-helices that wrap around each otherto generate a super-helix and are often involved inprotein–protein interactions and membrane shaping(Burkhard et al., 2001; Short et al., 2005; Henne et al.,2007). Indeed this region of REX1 shows some sequencesimilarity to vesicle tethering proteins such as Uso1p andp115 (Hawthorne et al., 2004). We have recently shownthat a GFP chimera of a REX1 fragment that is missingthe coiled-coil domain does not interact with the Maurer’sclefts (Dixon et al., 2008). Given the concentration ofREX1 at the Maurer’s cleft edges, it is possible that thecoiled-coil region of REX1 preferentially associates with aprotein that is concentrated at the edges, extensions andbudding regions of the Maurer’s clefts. Indeed it may playa role in the shaping of the Maurer’s clefts.

In an effort to further define the role of REX1 in control-ling Maurer’s cleft architecture, we examined a series oftransfectants expressing truncation or deletion mutants ofthis protein. We have compared these mutants with D10parasites, which have lost a subtelomeric region of chro-mosome 9, including the rex1 locus. The mutants eitherlack the C-terminal region including the repeat region(SKO), or lack this region plus half the coiled-coil region(TK1), or express no REX1 (TK2). Using an antiserumraised against a region just after the predicted signalsequence, we showed that the truncated REX1 proteins

in the SKO and TK1 parasites are still produced andexported to the Maurer’s clefts. However, truncation ordeletion of REX1 results in a decrease in the number ofSBP1-labelled puncta in the RBC cytoplasm that areobserved by immunofluorescence microscopy.

We have undertaken an ultrastructural analysis of theREX1 truncation and deletion mutants. The Maurer’sclefts are still formed and are still comprised of flattenedcisternae. This indicates that REX1 is not essential for theformation of the Maurer’s clefts. However while RBCsinfected with 3D7 wild-type parasites have dispersedMaurer’s cleft lamellae (greater than 90% single cister-nae), D10-infected RBCs, and each of the truncationand deletion mutants, display a stacked Maurer’s cleftphenotype. This stacking of the lamellae is presumablyresponsible for the apparent decrease in the numbersof Maurer’s clefts observed by immunofluorescencemicroscopy. Interestingly, the complete loss of the REXlocus is associated with a less dramatic phenotype thanpartial truncation of REX1. For example, D10 parasitesdisplay similar numbers of SBP1-labelled structures to theTK2 mutants (complete deletion of REX1), which areslightly (but significantly) higher than for the SKO and TK1parasites. Truncation of another Maurer’s cleft protein,PfEMP3, has previously been shown to have a moredeleterious effect on Maurer’s cleft morphology andPfEMP1 trafficking than deletion of the gene (Waterkeynet al., 2000).

Given that the stacked morphology is observed even inthe SKO transfectants, which retain the coiled-coil regionof REX1 but lack the C-terminal region, it appears that it isthis region that is responsible for preventing stackingof the lamellae. The C-terminal region (amino acids371–579) contains several repeats exactly or partlyrelated to the sequences PQAEKDASKLTTTYDQTKEVKor PQAEKDALAKTENQNGELL. This region is highlycharged with an overall pI of 4.88. It is possible thataccumulation of REX1 at the edges of Maurer’s cleftsgenerates a region of negative charge that prevents closeassociation of Maurer’s cleft lamellae. Alternatively REX1may play a role in fission of extended Maurer’s cleftstructures into individual units. However, further workis needed to confirm these suggestions.

To provide further evidence that REX1 is responsible forthe unstacked Maurer’s cleft phenotype, we have comple-mented D10 parasites with a plasmid encoding full-lengthREX1 linked to GFP. We showed by immunofluorescencemicroscopy and ultrastructural analyses that in therestored presence of REX1, the Maurer’s clefts adopt anunstacked morphology very similar to that observed in3D7-infected RBCs. This confirms that it is REX1, ratherthan one of the other chromosome 9 gene products, thatis responsible for the observed effect on Maurer’s cleftmorphology.

948 E. Hanssen et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

In conclusion, we have identified a protein that plays animportant role in controlling the overall architecture of theMaurer’s clefts. It is possible that the altered morphologyof Maurer’s clefts in D10-infected RBCs is responsible forthe previously reported changes in cytoadherence andagglutination (Day et al., 1993; Barnes et al., 1994; Bourkeet al., 1996). Further work is needed to examine the role ofREX1 in these virulence-related phenotypes. Interestinglywe have found that D10-infected RBCs and the REX1deletion mutant have an increased tendency to undergotruncation of the subtelomeric region of chromosome 2(including the genes encoding KAHRP and PfEMP3)during in vitro culture (M.W.A. Dixon, K.R. Trenholme andD.L. Gardiner, unpubl. data). This complicates any analysisof the role of REX1 in cytoadherence, and we are currentlyinvestigating these events in detail. Further analysis of theroles of different P. falciparum Maurer’s cleft-associatedproteins in underpinning the function of these unusualorganelles may provide new ways of interfering with theexport of PfEMP1, which may in turn lead to new ways oftackling this important human pathogen.

Experimental procedures

Parasites

The P. falciparum parasites (3D7 strain and REX1–GFP trans-fectants) were cultured in vitro in RPMI medium supplementedwith 4% human serum plus 0.25% AlbuMAX as describedpreviously (Spycher et al., 2003). RBCs and pooled serumwere obtained from the Red Cross Transfusion Service (Mel-bourne, Vic., Australia). Growth synchronization at the ringstage was achieved by sorbitol lysis (Lambros and Vander-berg, 1979). For the purification of infected RBCs, trophozoitestage-infected RBCs were harvested by flotation on a Percoll/sorbitol gradient (Aley et al., 1986). The 3D7 strain is a cytoad-herent clone possessing a complete chromosome 9, whileD10 is a non-cytoadherent clone of FC27 lacking the right endof chromosome 9 (Anders et al., 1983; Barnes et al., 1994).The procedure for the generation of the D10_REX1–GFP and3D7_REX1–GFP transfectants is described elsewhere (Dixonet al., 2008). The D10_REX1–GFP parasite line was gener-ated by transfecting a vector containing full-length REX1derived from 3D7 cDNA using REX1F (5′-agatctATGGCTGATT-ATAGTAGTAA-3′) and REX1R (5′-ctgcagATTAAATACAGAACTTTCTAG-3′). Primers contained BglII and PstIrestriction sites (in bold) for the forward and reverse primers,respectively, to facilitate directional cloning.

Targeted gene disruption of rex1

Two independent parasite clones, SKOA and SKOB, contain-ing a truncation of the REX1 (PlasmoDB PFI1735c) geneinduced by a single homologous recombination event, weregenerated previously (Hawthorne et al., 2004). Two transfec-tion vectors intended to disrupt the rex1 gene by doublehomologous recombination were designed using a positive/

negative selection strategy (Duraisingh et al., 2002). The TKvector uses the human DHFR gene for positive selectionvia resistance to the anti-folate drug, WR92210 (Fidockand Wellems, 1997), and the thymidine kinase (tk) geneof Herpes simplex for negative selection via sensitivity togancyclovir (Duraisingh et al., 2002).

The TK vector was extensively modified using theGATEWAY cloning system (Invitrogen USA). The GATEWAYsystem is based on lambda phage site-specific recombina-tion, permitting the transfer of DNA fragments between twovectors with compatible recombination sites, while maintain-ing orientation (Tonkin et al., 2004). The GFP tag from theoriginal vector (Tonkin et al., 2004) had been removed viadigestion using the restriction endonucleases Pst1 and BglII.The tk gene was inserted into this site by directional cloning.The tk was under the control of the P. falciparum heat shockprotein 86 (hsp86) promoter. This entry vector was furthermodified by the addition of a ClaI site 10 bp from the uniqueSalI site upstream of the hsp86 promoter, allowing the inser-tion of the 5′-targeting sequence by directional cloning. Thedestination vector contained the hDHFR coding sequenceunder the control of the P. falciparum calmodulin promoterand, downstream, the unique AvrII/ClaI cloning site. The3′-targeting sequence was inserted into this site via direc-tional cloning. Clonase reaction of the entry and destinationvectors produced the final transfection vectors.

The first REX1 transfection vector pHH1-TK1 contained a5′-targeting sequence generated by PCR amplification ofDNA from P. falciparum (clone 3D7) using the primersREX1TK15F (atcgatcgtaagtacacaatctt) and REX1TK15R(gtcgacgcactgctggatctacat). Restriction endonuclease sitesare listed in bold. This generated an 859 bp fragment repre-senting amino acids 35–259 of the translated REX1 protein.This PCR fragment was cloned into a pGEM Teasy vector(Promega), and sequenced to confirm the sequence. Diges-tion of this vector with the appropriate restriction endonu-cleases allowed directional cloning of the fragment into theentry vector. The second REX1 transfection vector pHH1-TK2 contained a 710 bp 5′-targeting sequence generatedusing primers REX1TK25F (atcgatgcacgttcttttacatat) andREX1TK25R (gtcgaccattgtaccattttgcac). This represented510 bp of the 5′ untranslated region, upstream of the rex1start codon, as well as the codons representing the first 63amino acids of the translated protein. Both vectors containedan identical 873 bp 3′-targeting sequence generated usingthe primers REX1TK3F (atcgatggcgcaagcaaaagatga) andREX1TK3R (cctaggtctgcattttgttgttct).

Plasmid DNA was generated and transfected into P. falci-parum 3D7 or D10 parasites as previously described (Wuet al., 1995; Spielmann et al., 2006b). Parasites resistant toWR92210 were detected 30 days post transfection. Parasiteswere cycled on both WR99210 and gancyclovir (Duraisinghet al., 2002) until integration of the vector into the genomiccopy of rex1 was detected by PCR. These cultures werecloned by limiting dilution (Rosario, 1981; Trenholme et al.,2000).

Northern blotting

Northern blotting was performed using total RNA extractsprepared with TRIzol (Invitrogen) (Hawthorne et al., 2004).

REX1 and Maurer’s cleft morphology 949

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

Blots were probed with a purified PCR fragment correspond-ing to 5′ fragments of rex1 introduced into the pHH1-TK1 orpHH1-TK2 transfection vectors respectively. These PCRproducts were amplified from genomic P. falciparum DNA.Probes were labelled with [a-32P]-ATP by random priming(DECAprime II, Ambion). The probe was hybridized overnightat 40°C in a hybridization buffer containing formamide (North-ern Max; Ambion). The filter was washed once at low strin-gency and twice at high stringency (Northern Max; Ambion),then exposed overnight.

Production of antiserum recognizing REX166-169

The primers REX1NTF (aattctataaaggagaatgcc) andREX1NTR (tccatgatattcgtttttgtc) were used to PCR-mplify a312 bp fragment of the 5′ region of the rex1 gene from P.falciparum clone 3D7. This fragment represented aminoacids 66–169 of the translated protein. This fragmentwas blunt end-loned into the pGEX6P-2 vector (AmershamBiosciences). A 40 kDa recombinant protein with anN-terminal fusion of Schistosoma japonicum glutathioneS-transferase was expressed in Escherichia coli strain BL21.Recombinant protein was purified on glutathione-Sepharose4B (Amersham Biosciences). Mice were immunized using20 mg of recombinant protein and boosted as previouslydescribed (Gardiner et al., 2004).

Western blotting

Proteins in the pellets and supernatants of saponin-lysedparasites (Dixon et al., 2008) were resolved on reducingSDS-PAGE gels (10% acrylamide), transferred to nitro-cellulose membranes and probed with anti-REX1 antiseraagainst the N- or C-terminal regions (1:250 dilution)followed by horseradish peroxidase-conjugated anti-IgG anti-serum (1:5000 dilution, Chemicon International). The mem-brane was stripped and re-probed with rabbit anti-SBP1(Cooke et al., 2006) and/or a rabbit anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) antiserum (1:5000dilution; Daubenberger et al., 2003).

Fluorescence microscopy

Live cell imaging was performed using an inverted LeicaTCS SP2 confocal microscope equipped with a 100¥(1.4 NA) oil immersion lens. Samples were mounted inculture medium onto a glass slide and covered with acoverslip. Images were processed using NIH ImageJ (http://rsb.info.nih.gov/ij). For immunofluorescence microscopy, thinsmears of P. falciparum-infected RBCs on glass slides werefixed with acetone : methanol for 10 min at -20°C and incu-bated for 1 h at room temperature with rabbit anti-REX1C-terminal domain (1:500; Hawthorne et al., 2004), mouseanti-MAHRP1 (1:50; Spycher et al., 2003), mouse anti-SBP1(Blisnick et al., 2000), rabbit anti-GFP (1:500; Roche) orrabbit anti-PfEMP1 cytoplasmic domain (Frankland et al.,2007). Slides were incubated with fluorescein-labelled anti-mouse IgG (1:100, Kierkegaard KPL) or Alexa Fluor 568conjugated anti-rabbit IgG (1:100; Invitrogen). Samples weremounted and observed with a Leica TSC-SP2 confocal

microscope. Alternatively slides were coated with con-canavalin A (0.5 mg ml-1), and infected RBCs were bound asdescribed (Spielmann et al., 2006a). The cells were fixed in4% formaldehyde/0.005% glutaraldehyde and probed withmouse anti-REX166-169 antiserum (1:500) followed by goatanti-mouse IgG-Cy2 (10 mg ml-1), or with rabbit anti-SPB1antiserum (1:500) followed by goat anti-rabbit IgG-TexasRed. Parasite DNA was visualized by adding Hoechst dye(0.5 mg ml-1) to the secondary antibody incubation. Fluores-cence and phase contrast images were collected with aZeiss Axioscope 2 Mot+ microscope.

Electron microscopy

Intact infected RBCs were fixed in 2.5% glutaraldehyde,embedded in 10% gelatin in bovine serum albumin in (PBS)and refixed with 2.5% glutaraldehyde. Alternatively infectedRBCs were permeabilized with EqtII as described previously(Jackson et al., 2007). Briefly, infected RBCs were fixed inRPMI containing 2% paraformaldehyde, treated with EqtII,refixed in PBS containing 2% paraformaldehyde and blockedwith 3% bovine serum albumin in PBS. Permeabilized cellswere incubated with primary antibody (rabbit anti-GFP, fromM. Ryan, La Trobe University) or rabbit anti-SBP1 (Cookeet al., 2006), at 1:20 in 3% PBS. Cells were washed andincubated with 6 nm gold-conjugated protein A (Aurion) andfixed with glutaraldehyde. Samples were postfixed in osmiumtetroxide and ‘en-bloc’ stained with uranyl acetate prior toembedding in LR White resin. For thin sections, the blockswere sectioned to a thickness of 70–80 nm stained withuranyl acetate and lead citrate and observed using a JEOL2010HC at 80 kV.

Electron tomography

The tomography was performed as described previously(Hanssen et al., 2008). Briefly sections were cut to a thick-ness of 200–300 nm and collected on a carbon-coated grid.Fiducials (15 nm Protein A gold, Aurion) were deposited onboth sides. Sections were stained with lead citrate andimaged using a Tecnai G2 TF30 (FEI Company) operating at200 kV equipped with a 2k ¥ 2k CCD camera (Gatan, Pleas-anton, CA, USA). Tilt series for tomographic reconstructionwere acquired using the Xplore 3D tomography software(FEI Company). The section was rotated from -66° to +66°with capture of images at 2° intervals. Tomograms and seg-mentation models were generated using the IMOD software(Kremer et al., 1996; Mastronarde, 1997). The Maurer’s cleftsare flattened disc-like structures with an average thickness of~50 nm. The edges of the Maurer’s cleft discs were modelledwith a hemi-cylindrical surface with a diameter equal to thethickness of the Maurer’s cleft. The number of gold particlesper unit area was determined using the IMOD package.

Acknowledgements

We would like to thank the following colleagues for pro-viding for antibodies: Cornelia Spycher and Peter Beck(anti-MAHRP1), Claudia Daubenberger (anti-GAPDH), SwissTropical Institute, Brian Cooke, Monash University (anti-

950 E. Hanssen et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

SBP1) and Mike Ryan, La Trobe University (rabbit anti-GFP).We thank Dr Kenneth Goldie, Microscopy and Nanobiotech-nology Centre, Bio21 Institute, for help with the electrontomography, Sam Deed, La Trobe University, for technicalsupport and Dr Gregor Anderluh, University of Ljubljana, Slo-venia, for supplying the EqtII expression construct. This workwas supported by funds from the Australian ResearchCouncil and the National Health and Medical ResearchCouncil of Australia. M.W.A.D. is supported by an ANZ Trust-ees PhD scholarship. T.S. gratefully acknowledges the SwissNational Science Foundation and the Alexander von Hum-boldt Foundation. D.G. and K.T. gratefully acknowledgesupport from Australian NHMRC and Mark Nicholson, AliceHill and The Tudor Foundation. P.L.H. was funded by anNHMRC postgraduate scholarship.

References

Aley, S.B., Sherwood, J.A., Marsh, K., Eidelman, O., andHoward, R.J. (1986) Identification of isolate-specific pro-teins on sorbitol-enriched Plasmodium falciparum infectederythrocytes from Gambian patients. Parasitology 92: 511–525.

Anderluh, G., Pungercar, J., Strukelj, B., Macek, P., andGubensek, F. (1996) Cloning, sequencing, and expressionof equinatoxin II. Biochem Biophys Res Commun 220:437–442.

Anders, R.F., Brown, G.V., and Edwards, A. (1983) Charac-terization of an S antigen synthesized by several isolates ofPlasmodium falciparum. Proc Natl Acad Sci USA 80:6652–6656.

Atkinson, C.T., Aikawa, M., Perry, G., Fujino, T., Bennett, V.,Davidson, E.A., and Howard, R.J. (1988) Ultrastructurallocalization of erythrocyte cytoskeletal and integralmembrane proteins in Plasmodium falciparum-infectederythrocytes. Eur J Cell Biol 45: 192–199.

Barnes, D.A., Thompson, J., Triglia, T., Day, K., and Kemp,D.J. (1994) Mapping the genetic locus implicated in cytoad-herence of Plasmodium falciparum to melanoma cells. MolBiochem Parasitol 66: 21–29.

Baumeister, W., Grimm, R., and Walz, J. (1999) Electrontomography of molecules and cells. Trends Cell Biol 9:81–85.

Blisnick, T., Morales Betoulle, M.E., Barale, J., Uzureau, P.,Berry, L., Desroses, S., et al. (2000) Pfsbp1, a Maurer’scleft Plasmodium falciparum protein, is associated with theerythrocyte skeleton. Mol Biochem Parasitol 111: 107–121.

Bourke, P.F., Holt, D.C., Sutherland, C.J., and Kemp, D.J.(1996) Disruption of a novel open reading frame ofPlasmodium falciparum chromosome 9 by subtelomericand internal deletions can lead to loss or maintenance ofcytoadherence. Mol Biochem Parasitol 82: 25–36.

Burkhard, P., Stetefeld, J., and Strelkov, S.V. (2001) Coiledcoils: a highly versatile protein folding motif. Trends CellBiol 11: 82–88.

Cooke, B.M., Buckingham, D.W., Glenister, F.K., Fernandez,K.M., Bannister, L.H., Marti, M., et al. (2006) A Maurer’scleft-associated protein is essential for expression of themajor malaria virulence antigen on the surface of infectedred blood cells. J Cell Biol 172: 899–908.

Cowman, A.F., Coppel, R.L., Saint, R.B., Favaloro, J.,

Crewther, P.E., Stahl, H.D., et al. (1984) The ring-infectederythrocyte surface antigen (RESA) polypeptide ofPlasmodium falciparum contains two separate blocks oftandem repeats encoding antigenic epitopes that are natu-rally immunogenic in man. Mol Biol Med 2: 207–221.

Culvenor, J.G., Langford, C.J., Crewther, P.E., Saint, R.B.,Coppel, R.L., Kemp, D.J., et al. (1987) Plasmodium falci-parum: identification and localization of a knob proteinantigen expressed by a cDNA clone. Exp Parasitol 63:58–67.

Daubenberger, C.A., Tisdale, E.J., Curcic, M., Diaz, D.,Silvie, O., Mazier, D., et al. (2003) The N-terminal domainof glyceraldehyde-3-phosphate dehydrogenase of theapicomplexan Plasmodium falciparum mediates GTPaseRab2-dependent recruitment to membranes. Biol Chem384: 1227–1237.

Day, K.P., Karamalis, F., Thompson, J., Barnes, D.A., Peter-son, C., Brown, H., et al. (1993) Genes necessary forexpression of a virulence determinant and for transmissionof Plasmodium falciparum are located on a 0.3-megabaseregion of chromosome 9. Proc Natl Acad Sci USA 90:8292–8296.

Dixon, M.W., Hawthorne, P.L., Spielmann, T., Anderson,K.L., Trenholme, K.R., and Gardiner, D.L. (2008) Targetingof the ring exported protein 1 to the Maurer’s clefts ismediated by a two phase process. Traffic in press.

Duraisingh, M.T., Triglia, T., and Cowman, A.F. (2002) Nega-tive selection of Plasmodium falciparum reveals targetedgene deletion by double crossover recombination. Int JParasitol 32: 81–89.

Elford, B.C., Cowan, G.M., and Ferguson, D.J. (1995)Parasite-regulated membrane transport processes andmetabolic control in malaria-infected erythrocytes.Biochem J 308: 361–374.

Elford, B.C., Cowan, G.M., and Ferguson, D.J. (1997) Trans-port and trafficking in malaria-infected erythrocytes. TrendsMicrobiol 5: 463–465; discussion 465–466.

Fidock, D.A., and Wellems, T.E. (1997) Transformation withhuman dihydrofolate reductase renders malaria parasitesinsensitive to WR99210 but does not affect the intrinsicactivity of proguanil. Proc Natl Acad Sci USA 94: 10931–10936.

Frank, J. (1992) Electron Tomography: Three-DimensionalImaging with the Transmission Electron Microscope. NewYork: Plenum Press.

Frankland, S., Elliott, S.R., Yosaatmadja, F., Beeson, J.G.,Rogerson, S.J., Adisa, A., and Tilley, L. (2007) Serumlipoproteins promote efficient presentation of the malariavirulence protein PfEMP1 at the erythrocyte surface.Eukaryot Cell 6: 1584–1594.

Gallop, J.L., Jao, C.C., Kent, H.M., Butler, P.J., Evans, P.R.,Langen, R., and McMahon, H.T. (2006) Mechanism ofendophilin N-BAR domain-mediated membrane curvature.EMBO J 25: 2898–2910.

Gardiner, D.L., Spielmann, T., Dixon, M.W., Hawthorne, P.L.,Ortega, M.R., Anderson, K.L., et al. (2004) CLAG 9 islocated in the rhoptries of Plasmodium falciparum. Parasi-tol Res 93: 64–67.

Haldar, K., and Mohandas, N. (2007) Erythrocyte remodelingby malaria parasites. Curr Opin Hematol 14: 203–209.

Haldar, K., Murphy, S., Milner, D., and Taylor, T. (2007)

REX1 and Maurer’s cleft morphology 951

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

Malaria: Mechanisms of erythrocytic infection and patho-logical correlates of severe disease. Annu Rev Pathol –Mech Dis 2: 217–249.

Hanssen, E., Sougrat, R., Frankland, S., Deed, S., Klonis, N.,Lippincott-Schwartz, J., and Tilley, L. (2008) Electrontomography of the Maurer’s cleft organelles of Plasmodiumfalciparum-infected erythrocytes reveals novel structuralfeatures. Mol Microbiol 67: 703–718.

Hawthorne, P.L., Trenholme, K.R., Skinner-Adams, T.S.,Spielmann, T., Fischer, K., Dixon, M.W., et al. (2004) Anovel Plasmodium falciparum ring stage protein, REX, islocated in Maurer’s clefts. Mol Biochem Parasitol 136:181–189.

Henne, W.M., Kent, H.M., Ford, M.G., Hegde, B.G., Daumke,O., Butler, P.J., et al. (2007) Structure and analysis ofFCHo2 F-BAR domain: a dimerizing and membranerecruitment module that effects membrane curvature.Structure 15: 839–852.

Hiller, N.L., Bhattacharjee, S., van Ooij, C., Liolios, K., Har-rison, T., Lopez-Estrano, C., and Haldar, K. (2004) A host-targeting signal in virulence proteins reveals a secretomein malarial infection. Science 306: 1934–1937.

Jackson, K.E., Klonis, N., Ferguson, D.J.P., Adisa, A.,Dogovski, C., and Tilley, L. (2004) Food vacuole-associated lipid bodies and heterogeneous lipid environ-ments in the malaria parasite, Plasmodium falciparum. MolMicrobiol 54: 109–122.

Jackson, K.E., Spielmann, T., Hanssen, E., Adisa, A., Sepa-rovic, F., Dixon, M.W., et al. (2007) Selective permeabili-zation of the host cell membrane of Plasmodiumfalciparum-infected red blood cells with streptolysin O andequinatoxin II. Biochem J 403: 167–175.

Kraemer, S.M., and Smith, J.D. (2006) A family affair: vargenes, PfEMP1 binding, and malaria disease. Curr OpinMicrobiol 9: 374–380.

Kremer, J.R., Mastronarde, D.N., and McIntosh, J.R. (1996)Computer visualization of three-dimensional image datausing IMOD. J Struct Biol 116: 71–76.

Kriek, N., Tilley, L., Horrocks, P., Pinches, R., Elford, B.C.,Ferguson, D.J., et al. (2003) Characterization of thepathway for transport of the cytoadherence-mediatingprotein, PfEMP1, to the host cell surface in malariaparasite-infected erythrocytes. Mol Microbiol 50: 1215–1227.

Kyes, S., Horrocks, P., and Newbold, C. (2001) Antigenicvariation at the infected red cell surface in malaria. AnnuRev Microbiol 55: 673–707.

Ladinsky, M.S., Mastronarde, D.N., McIntosh, J.R., Howell,K.E., and Staehelin, L.A. (1999) Golgi structure in threedimensions: functional insights from the normal rat kidneycell. J Cell Biol 144: 1135–1149.

Lambros, C., and Vanderberg, J.P. (1979) Synchronizationof Plasmodium falciparum erythrocytic stages in culture.J Parasitol 65: 418–420.

Lanzer, M., Wickert, H., Krohne, G., Vincensini, L., and BraunBreton, C. (2006) Maurer’s clefts: a novel multi-functionalorganelle in the cytoplasm of Plasmodium falciparum-infected erythrocytes. Int J Parasitol 36: 23–36.

Lucic, V., Forster, F., and Baumeister, W. (2005) Structuralstudies by electron tomography: from cells to molecules.Annu Rev Biochem 74: 833–865.

Maier, A.G., Rug, M., O’Neill, M.T., Beeson, J.G., Marti, M.,Reeder, J., and Cowman, A.F. (2007) Skeleton-bindingprotein 1 functions at the parasitophorous vacuole mem-brane to traffic PfEMP1 to the Plasmodium falciparum-infected erythrocyte surface. Blood 109: 1289–1297.

Marti, M., Baum, J., Rug, M., Tilley, L., and Cowman, A.F.(2005) Signal-mediated export of proteins from themalaria parasite to the host erythrocyte. J Cell Biol 171:587–592.

Marti, M., Good, R.T., Rug, M., Knuepfer, E., and Cowman,A.F. (2004) Targeting malaria virulence and remodelingproteins to the host erythrocyte. Science 306: 1930–1933.

Mastronarde, D.N. (1997) Dual-axis tomography: anapproach with alignment methods that preserve resolution.J Struct Biol 120: 343–352.

McIntosh, R., Nicastro, D., and Mastronarde, D. (2005)New views of cells in 3D: an introduction to electrontomography. Trends Cell Biol 15: 43–51.

Rosario, V. (1981) Cloning of naturally occurring mixed infec-tions of malaria parasites. Science 212: 1037–1038.

Short, B., Haas, A., and Barr, F.A. (2005) Golgins andGTPases, giving identity and structure to the Golgiapparatus. Biochim Biophys Acta 1744: 383–395.

Spielmann, T., and Beck, H.P. (2000) Analysis of stage-specific transcription in Plasmodium falciparum reveals aset of genes exclusively transcribed in ring stage parasites.Mol Biochem Parasitol 111: 453–458.

Spielmann, T., Dixon, M.W., Hernandez-Valladares, M., Han-nemann, M., Trenholme, K.R., and Gardiner, D.L. (2006b)Reliable transfection of Plasmodium falciparum using non-commercial plasmid mini preparations. Int J Parasitol 36:1245–1248.

Spielmann, T., Hawthorne, P.L., Dixon, M.W., Hannemann,M., Klotz, K., Kemp, D.J., et al. (2006a) A cluster of ringstage-specific genes linked to a locus implicated in cytoad-herence in Plasmodium falciparum codes for PEXEL-negative and PEXEL-positive proteins exported into thehost cell. Mol Biol Cell 17: 3613–3624.

Spycher, C., Klonis, N., Spielmann, T., Kump, E., Steiger, S.,Tilley, L., and Beck, H.P. (2003) MAHRP-1, a novel Plas-modium falciparum histidine-rich protein, binds ferriproto-porphyrin IX and localizes to the Maurer’s clefts. J BiolChem 278: 35373–35383.

Spycher, C., Rug, M., Klonis, N., Ferguson, D.J., Cowman,A.F., Beck, H.P., and Tilley, L. (2006) Genesis of andtrafficking to the Maurer’s clefts of Plasmodium falciparum-infected erythrocytes. Mol Cell Biol 26: 4074–4085.

Spycher, C., Rug, M., Pachlatko, E., Hanssen, E., Ferguson,D., Cowman, A.F., et al. (2008) The Maurer’s cleft proteinMAHRP1 is essential for trafficking of PfEMP1 to thesurface of Plasmodium falciparum-infected erythrocytes.Mol Microbiol 68: 1300–1314.

Subramaniam, S. (2005) Bridging the imaging gap: visualiz-ing subcellular architecture with electron tomography. CurrOpin Microbiol 8: 316–322.

Tilley, L., Sougrat, R., Lithgow, T., and Hanssen, E. (2008)The twists and turns of Maurer’s cleft trafficking in P.falciparum-infected erythrocytes. Traffic 9: 187–197.

Tonkin, C.J., van Dooren, G.G., Spurck, T.P., Struck, N.S.,Good, R.T., Handman, E., et al. (2004) Localization of

952 E. Hanssen et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953

organellar proteins in Plasmodium falciparum using a novelset of transfection vectors and a new immunofluorescencefixation method. Mol Biochem Parasitol 137: 13–21.

Trenholme, K.R., Gardiner, D.L., Holt, D.C., Thomas, E.A.,Cowman, A.F., and Kemp, D.J. (2000) clag9: a cytoadher-ence gene in Plasmodium falciparum essential for bindingof parasitized erythrocytes to CD36. Proc Natl Acad SciUSA 97: 4029–4033.

Waterkeyn, J.G., Wickham, M.E., Davern, K.M., Cooke, B.M.,Coppel, R.L., Reeder, J.C., et al. (2000) Targetedmutagenesis of Plasmodium falciparum erythrocyte mem-brane protein 3 (PfEMP3) disrupts cytoadherence ofmalaria-infected red blood cells. EMBO J 19: 2813–2823.

Wickham, M.E., Rug, M., Ralph, S.A., Klonis, N., McFadden,G.I., Tilley, L., and Cowman, A.F. (2001) Trafficking andassembly of the cytoadherence complex in Plasmodiumfalciparum-infected human erythrocytes. EMBO J 20:5636–5649.

Wu, Y., Sifri, C.D., Lei, H.H., Su, X.Z., and Wellems, T.E.(1995) Transfection of Plasmodium falciparum withinhuman red blood cells. Proc Natl Acad Sci USA 92: 973–977.

Supplementary material

This material is available as part of the online article from:http://www.blackwell-synergy.com/doi/abs/10.1111/j.1365-2958.2008.06329.x(This link will take you to the article abstract).

Please note: Blackwell Publishing is not responsible for thecontent or functionality of any supplementary materials sup-plied by the authors. Any queries (other than missing mate-rial) should be directed to the corresponding author for thearticle.

REX1 and Maurer’s cleft morphology 953

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 938–953