The mouse neurotrophin receptor trkB gene is transcribed from two different promoters

The mouse neurotrophin receptor trkB gene is transcribed from twodi¡erent promoters

Domingo Barettino a; b, Pilar M.G. Pombo a, Gemma Espliguero a,Angeles Rodr|guez-Pen¬a a;*

a Instituto de Investigaciones Biomedicas (CSIC), Arturo Duperier, 4, 28029 Madrid, Spainb Instituto de Biomedicina de Valencia (CSIC), Jaime Roig, 11, 46010 Valencia, Spain

Received 6 July 1998; received in revised form 1 April 1999; accepted 13 April 1999

Abstract

We have analysed a 7-kb region upstream of the mouse trkB coding sequence. The region showed promoter activity intransient transfection experiments and conferred tissue-specific expression to a reporter gene. Deletion analysis of this regiondemonstrated the presence of two alternative promoters named P1 and P2 that have been mapped by RNase protection. P1has been located to 1.8 kb and P2 to 0.5 kb upstream of the trkB translation start site. From the P1 promoter, alternativesplicing generates various transcripts. Interestingly, P2 is located in an intron of the transcripts produced from the P1promoter. This peculiar arrangement results in different mRNA species that encode the same protein(s) but differ in their 5P-untranslated regions. In addition, transcription of the trkB locus results in two different trkB isoforms (kinase and truncatedreceptors) originated by alternative splicing of the mRNA, that possess differential spatial and temporal expression patterns.Using RT-PCR, we demonstrated that there was no linkage between promoter usage and alternative splicing, sincetranscripts initiated from each promoter encoded both kinase and truncated receptor proteins. ß 1999 Elsevier ScienceB.V. All rights reserved.

Keywords: trkB; Neurotrophin receptor; Promoter; Alternative promoter; Transcriptional regulation; Alternative splicing

1. Introduction

The complexity of the vertebrate nervous systemrequires multiple neurotrophic factors to modulateits precise developmental programmes and to providethe necessary plasticity to the adult brain. The nervegrowth factor (NGF) family of neurotrophins areknown to play an important role in mediating thesurvival of neurones and promoting proliferationand di¡erentiation of neuronal and glial precursors

(reviewed in [1,2]). In addition to NGF, this neuro-trophin family includes brain-derived neurotrophicfactor (BDNF), neurotrophin-3 (NT-3) and neuro-trophin-4 (NT-4). These neurotrophins act throughthe trk family of tyrosine kinase receptors (reviewedin [3,4]). NGF is the ligand for TrkA, whereasBDNF and NT-4 bind to the products of the trkBgene and NT-3 binds TrkC. Besides, these neurotro-phins bind with low a¤nity to a common receptorknown as p75 [5].

The trkB gene is a large (100 kb) and complexlocus encoding multiple transcripts that give rise totwo types of receptors, one with protein tyrosine ki-nase activity, gp145trkB and another which lacks the

0167-4781 / 99 / $ ^ see front matter ß 1999 Elsevier Science B.V. All rights reserved.PII: S 0 1 6 7 - 4 7 8 1 ( 9 9 ) 0 0 0 5 6 - 1

* Corresponding author. Fax: +34 (91) 5854587;E-mail : [email protected]

BBAEXP 93272 22-6-99

Biochimica et Biophysica Acta 1446 (1999) 24^34

www.elsevier.com/locate/bba

kinase catalytic domain, gp95trkB [6^8]. In situ hy-bridisation studies have shown that the trkB gene iswidely expressed in multiple regions of the centraland peripheral nervous systems [6,7,9], though witha rather distinct pattern of expression for the cata-lytic and non-catalytic trkB receptors. For instance,in the adult mouse brain, gp145trkB transcripts havebeen detected in the cerebral cortex, thalamus, andthe pyramidal cell layer of the hippocampus. In con-trast, transcripts encoding the non-catalytic gp95trkB

receptor appear to be most prominent in structurescontaining non-neuronal cells such as the ependymalcell layer of the ventricles and the choroid plexus [9].Thus, trkB expression is tightly regulated during de-velopment. In addition, in the adult brain, trkB ex-pression should be able to respond to external stim-uli, as described in the adult hippocampus, where arapid and transient increase of trkB expression isproduced by cerebral ischaemia or seizures [10].

As a step towards understanding the regulation ofthe trkB gene we have characterised a 7-kb DNAfragment of the 5P-£anking region of the mousetrkB gene. This 7-kb regulatory fragment conferredtissue-speci¢c expression to a reporter gene. Wefound that the mouse trkB gene transcription is con-trolled by two alternative promoters, located 1.8 and0.5 kb upstream of the trkB translation start, respec-tively. The use of these two promoters, as well asalternative splicing resulted in di¡erent mRNA spe-cies that di¡ered in their 5P-untranslated regions. Fi-nally, we tested the involvement of each promoter inin£uencing the choice for alternative splicing givingrise to the kinase and the truncated trkB receptorforms. Our results showed no linkage between pro-moter usage and the presence of the kinase or trun-cated cytoplasmic domain exons.

2. Materials and methods

2.1. RNA analysis

2.1.1. Preparation of RNATotal RNA from adult mouse brain was prepared

by the method of GITC/caesium chloride [11].

2.1.2. RNase protection assays32P-labelled antisense riboprobes were prepared by

in vitro transcription with T3 or T7 RNA polymer-ase (Promega) in the presence of [K-32P]CTP. Map-ping of the transcription starts of the mouse trkBtranscripts was done using antisense cRNA probesspanning di¡erent trkB promoter regions: BE-0.4(intron sequences from 3711 to 3339), NC-0.6 (se-quences from 3869 to 3320) and NP-0.5 (sequencesfrom 32082 to 31611). RNase protection assayswere performed using the RPAII Ribonuclease Pro-tection Assay Kit (Ambion). In each reaction, 15 Wgof total RNA from mouse brain was hybridised withthe labelled probes as recommended by the manufac-turer. Protected fragments were separated on 6%polyacrylamide sequencing gels. The gels were thendried and exposed to X-ray ¢lms at 370³C with in-tensifying screen.

2.2. DNA sequencing

Subclones in pBluescript-KS derived from the 7-kbmouse trkB genomic DNA fragment (from plasmidpSJ54, a gift of Dr M. Barbacid, Bristol MyersSquibb, Princeton, NJ, USA) were generated usingthe available restriction enzyme sites. Automated se-quencing of these subcloned fragments was done us-ing an Applied Biosystems automatic DNA se-quencer 373A, by the method of £uorescentdideoxynucleotide terminators. Both strands were se-quenced by means of vector-derived primers, as wellas internal primers when required. Oligonucleotideprimers were obtained from Isogen. The accessionnumber for the nucleotide sequence described hereat the EMBL, DJJB and GenBank databases isY12067.

2.3. Transient transfections

2.3.1. PlasmidsA 7-kb fragment from the 5P-£anking region of the

mouse trkB gene was subcloned in a derivative of thepromoterless pBLCAT-3 plasmid. This construct,spanning from 37059 (SalI) to 3325 (ClaI) withrespect to the mouse trkB translation start(37059.CAT), was used to construct the followingseries of 5P-deletion mutants by means of convenientrestriction sites: 35130.CAT, 32698.CAT,31606.CAT and 3871.CAT. A second series of con-structs combined the 5P deletions with deletion of the

BBAEXP 93272 22-6-99

D. Barettino et al. / Biochimica et Biophysica Acta 1446 (1999) 24^34 25

3P-sequences between 3871 and 3325 (37059/3871.CAT, 35130/3871.CAT and 32698/3871.CAT); Sequences between 35130 and 32698were included in construct 35130/32698.CAT. Se-quences included in plasmid 3711/3339.CAT andplasmid 3462/3339.CAT were generated by PCR.

2.3.2. Cell culture and transfection experimentsCOS-7 or Neuro-2a (N2a) cells were grown in

DMEM supplemented with 10% foetal calf serum.Cells were plated at a density of 120 000 cells per3-cm dish 1 day before transfection. Before transfec-tion, medium was removed and transfection was per-formed by the calcium phosphate method. Each dishreceived up to 5 Wg of plasmid DNA, including 2 Wgof the appropriate CAT construct and 1 Wg of theinternal control plasmid RSV-LacZ. After overnightexposure to the DNA precipitates, the medium wasreplenished and cells were incubated for a further24 h before being harvested for determination ofL-galactosidase and CAT activities.

2.4. RT-PCR

2.4.1. Reverse transcription1 Wg of mouse brain total RNA was retro-tran-

scribed with 400 units MMLV-RT (Promega) in a40-Wl reaction mixture containing 50 mM Tris-HCl(pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT,0.4 mM dNTPs, 2 Wg of dT�12ÿ18� primer (Pharma-cia), and 40 units of RNasin (Promega). The reactionproceeded at 42³C for 30 min and the samples werestored at 320³C until use.

2.4.2. Primers for PCRPrimers with comparable Tm were designed and

obtained from Isogen. The sequence and positionsof these primers are shown in Table 1. In additionto the primers derived from the trkB 5P-untranslatedregion, lower primer K was designed to hybridise tothe sequence of the cDNA encoding the trkB kinasereceptor (pFRK43 [6]), and lower primer T to hy-bridise to the sequence of the cDNA for trkB trun-cated receptor (pFRK42 [9]).

2.4.3. RT-PCRPCR reactions (25 Wl) were set with 1 Wl of the

above RT reaction, in 75 mM Tris-HCl (pH 9.0),2 mM MgCl2, 50 mM KCl, 20 mM (NH4)2SO4,0.001% BSA, 0.2 mM dNTPs, 1 unit of BIOTOOLSDNA polymerase, 5 pmol of lower primer (TR7) and5 pmol of upper primer (E1-1, E1-2, E1-3 or E1-4).PCR was performed in a Perkin Elmer 2400 thermalcycler. Samples were denatured 2 min at 94³C, fol-lowed by 20 cycles of 94³C for 10 s, 60³C for 20 sand 72³C for 1 min. Subsequently, 20 more cycleswere performed, with the same pro¢le but increasingthe extension step for 5 s per cycle. 15 Wl of eachreaction was loaded to a 2% agarose gel run in1UTAE during 30 min at 100 V. For long and ac-curate RT-PCR, reactions (25 Wl) were set with 1 Wlof the above RT reaction, in 40 mM tricine-KOH(pH 9.2), 15 mM potassium acetate, 3.5 mM magne-sium acetate, 3.75 Wg/ml BSA, 0.2 mM dNTPs,5 pmol of lower primer (K or T), 5 pmol of upperprimer (E1-1, E1-2, E1-3 or E1-4) and 0.5 Wl of Klen-Taq-LA polymerase mix (Clontech). Samples were

Table 1Oligonucleotide primers used in these experiments

Primer Sequence (5P-3P) Positiona Polarityb

E1-1 AGTTTCTGCCCCTGCTCTGC 3939/3920 DE1-2 AGGGTCGGTGCAAAGCATTT 31733/31714 DE1-3 AGGGACCAAAGGAAGCATCG 31253/31234 DE1-4 AGAGCGCGGAGGGACTGTGT 3420/3401 DTR7 TCTTGCTGCTTGGTGCTGGT 3110/391 UtrkB-K GGGCTGGCAGAGTCATCGTC 1928/1947c UtrkB-T TCAGGCAACAAGCACCACAG 1461/1480d UaPosition: according to trkB translation start site (+1), except when stated.bPolarity: downstream (D) or upstream (U).cPosition according to the sequence of pFRK43 [6], accession number X17647.dPosition according to the sequence of pFRK42 [7], accession number M33385.

BBAEXP 93272 22-6-99

D. Barettino et al. / Biochimica et Biophysica Acta 1446 (1999) 24^3426

overlaid with 40 Wl of mineral oil. For competitiveRT-PCR, reactions were set as above, but 2.5 pmolof each of E1-3 and E1-4 upper primers was com-bined in the same reaction with 5 pmol of either K orT lower primer. Samples were denatured 2 min at94³C, and afterwards 16 cycles of 94³C for 10 s,65³C for 30 s and 68³C for 5 min were performed,followed by another 16 cycles with the same pro¢lebut increasing the extension period for 20 s per cycle.15 Wl of each reaction was loaded into a 1% agarosegel run in 1UTAE for 2 h at 100 V.

3. Results

3.1. trkB 5P-£anking region drives transcription in atissue-speci¢c manner

The reporter construct 37059.CAT, containing thetrkB 5P-£anking genomic sequences from 37059 to

3325 linked to the chloramphenicol acetyltransferase(CAT) gene, was transfected into N2a mouse neuro-blastoma cells. We observed a strong enhancement ofCAT activity, as compared to the basal activity driv-en by the promoterless reporter construct pBLCAT-3(data not shown). We have produced a series of5P deletions of this fragment that were placed up-stream of the CAT gene. The activity of these dele-tion constructs was assayed by transient transfectionin N2a cells (Fig. 1A) and was expressed as % of theactivity shown by the 37059.CAT reporter (arbitrari-ly set at 100%). Every 5P-deletion construct showedtranscriptional activity up to 3711/3339, suggestingthat a promoter, called P2, was present in this frag-ment (shadowed region). In addition, negative regu-lation elements appear to be present between 37059and 32698, since removal of those sequences in-creased the activity of the reporter. The maximalactivity was seen with the construct 31606.CAT.The activity of the promoter P2 was 76% for the

Fig. 1. Deletion analysis of the activity of the mouse trkB promoters. The transcriptional activity of di¡erent 5P-deletion constructs de-letions of the 7-kb promoter region (A) and combinations of 5P- and 3P-deletion constructs (B) was tested in transient transfection ex-periments in N2a cells. Each 30-mm dish received 5 Wg of plasmid DNA, including 2 Wg of the indicated CAT reporter and 1 Wg ofthe in RSV-LacZ internal control plasmid. After transfection, the medium was replenished and the cells were further incubated for24 h before harvesting for determination of L-galactosidase and CAT activities. CAT activities were normalised with the correspondingL-galactosidase activity. Each reporter construct is named after the end-points of the deletions (numbers referred to trkB translationstart site) and is schematically depicted on the left side of the ¢gure. On the right side, the bars indicate the activity of each reporter(expressed as the mean þ S.D. of at least three independent experiments) referred to that of the 37059.CAT plasmid (A) or to that of37059/3871.CAT (B), which were arbitrarily set at 100%. The two shadowed regions represent the putative location of two alterna-tive promoters, as deduced from the deletion analysis data.

BBAEXP 93272 22-6-99


3871.CAT construct and 94% when intron sequen-ces (3711/3339) were cloned in front of CAT. Thepresence of a second promoter, called P1, locatedupstream of P2 became evident when the fragment3871/3325 was removed to generate the 37059/3871.CAT construct. This construct retains approx-imately 38% of the activity of the 37059.CAT re-porter (data not shown). As shown in Fig. 1B, se-quences between 37059 and 35130 showed strongnegative regulation. Activity of the P1 promoterwas enhanced by sequences located between 35130and 32698, since the removal of this fragment re-sulted in a 10-fold reduction of the transcriptionalactivity. Deletion of the sequences from 32698 and3871 resulted in a reduction of the activity to back-ground levels, suggesting that this fragment con-tained the transcription start of P2 promoter.

As trkB is mainly expressed in the nervous system[6,7,9], we wanted to determine the contribution ofthe trkB promoter sequences in providing neural tis-sue-speci¢c expression. For this purpose, we assayedsome of the trkB promoter reporter constructs in themonkey kidney cell line COS-7, and compared theiractivities to those obtained in N2a neuroblastomacells, that are able to express the endogenous trkBgene [12]. The results, shown in Table 2, indicate thatall the deletion constructs assayed were transcribedmore e¤ciently in N2a than in COS-7 cells. How-ever, maximum di¡erences occurred with the report-er 35130/3871.CAT, indicating that sequences re-sponsible for conferring this property to the P1promoter are contained within this fragment.

3.2. Sequence of the 7-kb 5P-£anking trkB promoterfragment

Since the 7-kb 5P-£anking genomic fragment wasnot previously characterised, we next proceeded toobtain its complete sequence. Comparison with thereported cDNA sequence [6] indicated that the 5P-end point of this trkB genomic fragment was at37059 and the 3P at 3325 with respect to the ATGcodon, with the presence of an intron £anked byconsensus splicing sites located between 3716 and3344.

Fig. 2. Sequence of the region surrounding trkB P2 promoter.The sequence of the fragment 31606/3325 of the trkB 5P-£ank-ing region is shown (numbers referred to the trkB translationstart site). The sequences matching transcription factor consen-sus binding sites from the TRANSFAC database, obtained withthe MatInspector 2.2 software [28], are shown boxed, and thetrkB P2 promoter transcription start is indicated by an arrow.Table 2

Cell speci¢city of TrkB promoter activity in transiently trans-fected cells

Reporter Relative CAT activitya

(mean þ S.D.)RatioN2a/COS-7

N2a COS-7

37059.CAT 28 þ 7 16 þ 5 1.7532698.CAT 55 þ 4 25 þ 3 2.2031606.CAT 85 þ 2 36 þ 9 2.363462/3339.CAT 33 þ 7 19 þ 4 1.7435130/3871.CAT 49 þ 10 8 þ 1 6.13aCAT activity values were corrected for transfection e¤ciency.The activity values, expressed as the mean þ S.D. of at leastthree independent experiments, are related to that obtained forthe construct 3871.CAT in N2a cells, arbitrarily set at 100%.

BBAEXP 93272 22-6-99


Fig. 3. Mapping of the transcription start sites of the two trkB alternative promoters by RNAse protection assay (RPA). (A) Ribo-probes used for RPA. The restriction map of the region analysed is schematically depicted, showing the positions of the restriction orPCR fragments used to generate the riboprobes, and the deduced structure for the two alternative transcripts. The positions of thetranscription initiation sites, with respect to the translation start codon, are indicated by the numbers between brackets close to thestart of each transcripts. (B^D) RNase protection assays with riboprobes NC-0.6 (B), NP-0.5 (C) and BE-0.4 (D). For each riboprobe,the autoradiograms show the undigested riboprobe (lanes: `probe'), the protected fragments obtained with 15 Wg of mouse brain totalRNA (lanes: `brain RNA') and, as negative control, the result of an equivalent assay using 15 Wg of yeast total RNA (lanes: `yeastRNA'). The positions of the molecular weight markers are shown on the left side of each picture (size in nucleotides). The positionsof the di¡erent undigested probes, and those of the protected fragments resulting from the mRNAs generated in each promoter are in-dicated by arrows on the right side of each picture. Numbers indicate the size of the protected fragments in nucleotides.

BBAEXP 93272 22-6-99


The dinucleotide CpG was clustered within tworegions located between 32550/31650 and 31250/3400, overlapping those that showed promoter ac-tivity in transient transfection experiments. In addi-tion, several blocks of short repetitive microsatellite-like sequences were found scattered in the 7-kb frag-ment, at positions 35323/35273, 34860/34790,34560/34390, 32890/32710, and 31120/3960.

A search for transcription factor consensus bind-ing sites from the TRANSFAC database using theMatInspector 2.2 software [13] revealed several hun-dreds of matches to dozens of di¡erent consensussites, even when the search was made with high strin-gency. These sites included those for general tran-scription factors like NF-I/CAAT box, CACCC-box, CEBP or AP2. These putative binding sites ac-cumulate preferentially on the fragment located from35134 and 32702, which showed strong enhanceractivity on transient transfection experiments. Sofar, no functional data are available on those puta-tive regulatory elements, but we want to bring theattention to an arrangement of sites located on theregion surrounding the most downstream promoter,that included, among others, a cluster of sp1 sites,two CRE sites arranged in tandem and a consensussite for the POU-domain transcription factor Brn-2(Fig. 2).

3.3. The transcription initiation sites from the twoalternative promoters

The transcription starts of the two promoters de-¢ned in the previous deletion analysis were preciselymapped by RNase protection assays with RNA frommouse brain using di¡erent speci¢c probes (Fig. 3A).According to the known cDNA sequence [6], theprobe NC-0.6, covering the region between 3871and 3325, protected a 152-nt fragment. Neverthe-less, an additional 129-nt band was present, whichclearly indicated the presence of a novel transcriptoriginated in the region encompassing the intron lo-cated between 3716 and 3344 (Fig. 3B). Two otherriboprobes were used to precisely map the initiationsites. The most distal, NP-0.5 was located between32082 and 31615 and protected a band of 195 nt,thus locating the transcription initiation site from theP1 promoter at 31800 (Fig. 3C). The other probe,called BE-0.4, covering the intron region (3711/

3339), protected a 109-nt band, therefore de¢ningthe transcription starts from the P2 promoter at3448 (Fig. 3D). Both initiation sites showed a con-sensus site sequence (CANYYY), although noTATA box could be found.

To con¢rm the results obtained with RNase pro-tection experiments, oligonucleotide primers corre-sponding to di¡erent regions of the transcripts origi-nated from promoters P1 and P2 were designed andused in RT-PCR experiments with mouse brain totalRNA. As shown in Fig. 4A, ampli¢ed fragments ofunexpected size were generated with the primers de-rived from the P1 promoter initiated transcript,pointing the presence of alternatively splicedmRNAs. These PCR fragments were gel-puri¢edand sequenced to locate the splicing junctions. Inaddition, the bands marked with an asterisk in Fig.4A represent `phantom bands', since enrichmentafter gel puri¢cation and reampli¢cation was notpossible. These spurious bands were probably pro-duced by heteroduplex formation during RT-PCR[14]. The results are summarised in Fig. 4B. Threealternatively used 5P-splice donor sites, located at31541, 31148 and 3716, respectively, were joinedto a unique 3P-splice acceptor site at 3344. The5P-splice donor sites as well as the 3P-acceptor siteshowed high conservation with their consensus se-quences (Fig. 4C).

Thus, alternative promoter usage and alternativesplicing generate several mRNA isoforms that di¡erin their 5P-untranslated region but, in principle, havethe same coding capacities, as summarised in Fig.4B. The upper promoter, P1, gives rise to threemRNA species (mRNAs 1.1, 1.2 and 1.3) di¡eringin their exon 1 (exons 1A, 1B and 1C respectively).Usage of the second promoter, P2, generates a noveltranscript, called mRNA 2, lacking exon 1, in whichthe sequences from 3448 to 3344 are transcribed,resulting in a new exon 1D, from 3448 and spanningbeyond the start of the previously de¢ned exon 2.

3.4. Transcripts generated in P1 or P2 promoter havethe potential to encode both the kinase and thetruncated forms of the trkB receptor

Transcription of the trkB locus results in two dif-ferent trkB isoforms (kinase and truncated receptors,gp145trkb and gp95trkB, respectively) originated by

BBAEXP 93272 22-6-99


alternative splicing of the mRNA, that possess di¡er-ential spatial and temporal expression patterns[6,7,9]. Using long and accurate RT-PCR, we havestudied the possible relationship between the use ofeach promoter and the choice for the di¡erent splic-ing forms of trkB transcripts. Upper primers derivedfrom the sequences of the di¡erent 5P-UTR alterna-tives were combined with lower primers speci¢c forthe transcripts encoding the full-length (kinase) orthe truncated (non-catalytic) form of the mousetrkB. The results showed no linkage between pro-moter usage and alternative splicing, as transcripts

originated in each of the promoters encoded bothkinase and truncated receptor proteins (Fig. 5A). Itwas still possible that transcripts encoding full-lengthor truncated receptors were favourably produced byone of the promoters. To study this, we performed aseries of experiments based on large di¡erences in themRNA isoforms levels that would be revealed byprimers competition in a PCR reaction. Equalamounts of upper primers, speci¢c for transcriptsgenerated either in the P1 or P2 promoters, wereset to compete in the RT-PCR reaction for ampli¢-cation of kinase or truncated receptor transcripts.

Fig. 4. Analysis of the transcripts generated in trkB promoter region by RT-PCR. (A) RT-PCR of trkB transcripts. Total RNA frommouse brain was retro-transcribed with MMLV-RT and the resulting cDNA used for PCR reactions in which the TR7 primer wasused as lower primer together with primer E1-1 (lane 1), E1-2 (lane 2), E1-3 (lane 3) and E1-4 (lane 4). The PCR fragments were re-solved in a 1.5% agarose gel. The lane labelled as M shows the 100 bp-ladder as molecular weight standard. Bands marked with anasterisk in lanes 2 and 3 are `phantom bands' (see text). The arrow in the right part of the ¢gure shows the electrophoresis origin. (B)Schematic representation of the transcripts originated in trkB promoter. The bands obtained in the RT-PCR experiment representedin (A) were gel-puri¢ed and sequenced in order to identify and locate the splice junctions. The results obtained are schematically de-picted. The genomic DNA is represented by the black bar, in which the positions of the two trkB transcription start sites are shown.The locations of the primers used in (A) are represented at the top. The di¡erent mRNAs, derived from the primary transcripts, arerepresented with the exon regions as dark boxes and the positions of the 5P-splice donor sites (SD I^III) and the common 3P-splice ac-ceptor site (SA) are shown in the ¢gure. (C) Sequence of the splice sites in trkB transcripts. The consensus sequences of 5P-splice do-nor sites and 3P-splice acceptor site are shown, with the conserved bases £anking the splice site underlined. For comparison, the se-quence of trkB 5P-splice donor sites I, II and III and 3P-splice acceptor site are aligned to their respective consensus sequences, andthe bases matching with the consensus shown in capital letters.

BBAEXP 93272 22-6-99


However, no preference for one of the transcriptsproduced in each promoter and the presence of thecatalytic or truncated domain exons could be estab-lished (Fig. 5B).

4. Discussion

In the mouse, trkB expression shows a rather com-plex spatial and temporal pattern. It is predomi-nantly expressed in both central as well as in peri-pheral nervous systems. In addition, the receptorexists as two isoforms (truncated and kinase,gp95trkB and gp145trkb, respectively) which show dis-tinct expression patterns [6,7,9]. The thyroid hor-mone is a regulator of trkB expression in the devel-oping rodent brain (P.M.G. Pombo, D. Barettino,M. Metsis, A. Rodr|guez-Pen¬a, submitted), and ec-topic expression of thyroid hormone receptor acti-vates transcription of the trkB gene in neuroblasto-ma cells [15]. trkB expression is also enhanced duringretinoic acid-induced di¡erentiation of embryonalcarcinoma and neuroblastoma cells [16,17]. In theadult brain, the levels of trkB mRNAs can be in-creased following external stimuli, such as cerebral

insults, seizures, ischaemia and hypoglycaemia[10,18^21]. Hence, there must be regulatory regionswithin the trkB gene that would account for the mo-lecular mechanism of trkB expression. We have char-acterised a 7-kb fragment of the 5P-£anking region ofthe mouse trkB gene. We have identi¢ed two pro-moters that are located in regions enriched in thedinucleotide CpG and have a consensus initiator el-ement, but lack a TATA box. We demonstrated thatthis trkB upstream regulatory region can confer neu-ral-speci¢c expression to a heterologous reportergene, though tissue-speci¢c expression could not beassigned to discrete regions of the sequence.Although a complete analysis of the distal P1 pro-moter is not yet available, we have identi¢ed severalcandidate regulatory elements in the vicinity of theproximal P2 promoter that may contribute to neural-speci¢c expression. This may be the case for bindingsites of the POU factor Brn-2 [22] and ets domainprotein family, that include factors restricted to orenriched in neuronal cells [23^25]. In addition, otherubiquitous factors whose consensus binding sitescould be found in trkB P2 upstream region, likeATF/CREB, Egr and AP-2 protein family members,play an important role in neuronal expression [26^

Fig. 5. Analysis of the transcripts encoding trkB kinase or truncated receptors by RT-PCR. (A) RT-PCR. Total RNA from mousebrain was retro-transcribed with MMLV-RT and the resulting cDNA used for PCR reactions. Lower primers hybridising to the re-gion encoding the kinase (K, lanes 1, 3, 5 and 7) or the truncated (T, lanes 2, 4, 6 and 8) intracellular domains of trkB were com-bined with upper primers E1-1 (lanes 1 and 2), E1-2 (lanes 3 and 4), E1-3 (lanes 5 and 6) and E1-4 (lanes 7 and 8), hybridising to thedi¡erent alternative exon regions. The resulting RT-PCR fragments were resolved in a 0.9% agarose gel. M: Molecular weightmarkers. (B) Competitive RT-PCR. PCR reaction were set as above, with lower primers hybridising to the region encoding the kinase(K, lanes 1, 2 and 5) or the truncated (T, lanes 3, 4 and 6) intracellular domains of trkB were combined with upper primers E1-4(lanes 1 and 3), E1-3 (lanes 2 and 4), together with an equimolar mixture of both E1-3 and E1-4 (lanes 5 and 6). The RT-PCR frag-ments generated were resolved in a 0.9% agarose gel. M: Molecular weight markers.

BBAEXP 93272 22-6-99


28]. Nevertheless, it is also possible that additionalnovel regulatory elements exist within the trkB P2regulatory region that remain to be identi¢ed.

The proximal promoter sequence of the humanneurotrophin receptor trkA has recently been de-scribed [29]. Although the sequence informationavailable is limited, the trkA proximal promoterstructure resembles that described here for trkB, de-spite important di¡erences in their expression pat-terns. Like the mouse trkB promoters, the humantrkA promoter is located in a CpG-rich region, lacksa TATA box and contains consensus sites for tran-scription factors of the ATF/CREB, ets domain,AP2, Egr and sp1 families. These appear to be fea-tures common to the promoters of several neuronal-speci¢c genes [30^33].

Transcription of the trkB locus results in a com-plex pattern of transcripts in rodent nervous system.Alternatively spliced transcripts giving rise to the ty-rosine kinase (gp145trkB) and to the non-catalytictruncated (gp95trkB) receptor forms, and the use ofalternative polyadenylation signals has been pro-posed to be responsible for this pattern of transcripts[6^8]. In addition, we show here that the use of dif-ferent promoters and alternative splicing producedtranscripts that di¡er in their 5P-untranslated regionto contribute to the generation of the complex set oftrkB transcripts. At least four di¡erent 5P-UTR alter-natives have been detected that resulted in transcriptssharing the same coding abilities but di¡ering in theirleader sequences. Although the role of these di¡erent5P-UTR remains to be established, we have to notethat in two of the transcripts generated in P1 andpresenting longer leader sequences (mRNAs 1.2and 1.3), short ORFs could be detected upstreamof the trkB translation initiation codon, that donot appear in the 5P-UTR of the other transcripts(mRNAs 1.1 and 2). These small ORFs have beenimplicated in the regulation of the translational e¤-ciency of the mRNAs [34]. This observation opensthe possibility that the di¡erent trkB 5P-UTR alter-native transcripts may have di¡erent translationalproperties, and hence regulation of promoter usageand alternative splicing of the upstream exons mightindirectly regulate the translation of trkB mRNAs.

The contribution of trkB promoters and of theirregulatory elements to the generation of the actualtemporal and spatial expression pattern remains to

be investigated. Further characterisation will requirethe generation of promoter-speci¢c probes for in situhybridisation, and the analysis of di¡erent promoterregions in transgenic mice.

Acknowledgements

This work has been supported by grants from Di-reccion General de Ensen¬anza Superior (PB94-0090and PM97-0066 to A.R.-P. and PM96-0073 to D.B.).The authors thank Dr M. Barbacid for supplyingplasmid pSJ54; Dr R. Klein for supplying plasmidsand communicating unpublished information; Dr G.Rodr|guez-Tarduchy (IIB, Madrid) and Dr E. Grau(IBMCP, Valencia) for help with automated sequenc-ing; and P. Franco de Sarabia (BIOTOOLS) for gen-erously supplying DNA polymerase. D.B. is indebtedto Dr L. Moreno, to the members of Prof. Serrano'sgroup and the sta¡ at the IBMCP (CSIC-UPV, Va-lencia, Spain) for contributions and help. P.M.G.P.was supported by a pre-doctoral fellowship from Co-munidad Autonoma de Madrid. During the initialpart of this work D.B. was supported by a contractfrom Programa de Contratacion Temporal de Inves-tigadores del CSIC (convocatoria MEC/94).

References

[1] R. Levi-Montalcini, Science 237 (1987) 1154^1162.[2] Y.A. Barde, J. Neurobiol. 25 (1994) 1329^1333.[3] M. Barbacid, J. Neurobiol. 25 (1994) 1386^1403.[4] M. Barbacid, Ann. NY Acad. Sci. 766 (1995) 442^458.[5] M.V. Chao, B.L. Hempstead, Trends Neurosci. 18 (1995)

321^326.[6] R. Klein, L.F. Parada, F. Coulier, M. Barbacid, EMBO J. 8

(1989) 3701^3709.[7] R. Klein, D. Conway, L.F. Parada, M. Barbacid, Cell 61

(1990) 647^656.[8] D.S. Middlemas, R.A. Lindberg, T. Hunter, Mol. Cell. Biol.

11 (1991) 143^153.[9] R. Klein, D. Mart|n-Zanca, M. Barbacid, Development 109

(1990) 845^850.[10] J.-P. Merlio, P. Ernfors, Z. Kokaia, D.S. Middlemas, J.

Bengzon, M. Kokaia, B.K. Siesjo« , T. Hunter, O. Lindvall,H. Persson, Neuron 10 (1993) 151^164.

[11] J.M. Chirgwin, A.E. Przybyla, R.J. MacDonald, W.J. Rut-ter, Biochemistry 18 (1979) 5294^5299.

[12] S. Zolotukhin, M. Potter, W. Hauswirth, J. Guy, N. Mu-zyczka, J. Virol. 70 (1996) 4646^4654.

BBAEXP 93272 22-6-99


[13] K. Quandt, K. Frech, H. Karas, E. Wingender, T. Werner,Nucleic Acids Res. 23 (1995) 4878^4884.

[14] D. Zacharias, N. Garamszegi, E. Strehler, BioTechniques 17(1994) 652^655.

[15] R. Pastor, J. Bernal, A. Rodr|guez-Pen¬a, Oncogene 9 (1994)1081^1089.

[16] A.M. Salvatore, M. Cozzolino, N. Gargano, S. Galanti, A.Levi, S. Alema, NeuroReport 6 (1995) 873^877.

[17] D.R. Kaplan, K. Matsumoto, E. Lucarelli, C.J. Thiele, Neu-ron 11 (1993) 321^331.

[18] G. Mudo, X.H. Jiang, T. Timmusk, M. Bindoni, N. Belluar-do, Epilepsia 37 (1996) 198^207.

[19] N. Belluardo, T. Salin, P. Dell'Albani, G. Mudo, M. Cor-saro, X.H. Jiang, T. Timmusk, D.F. Condorelli, Neurosci.Lett. 196 (1995) 1^4.

[20] T. Salin, G. Mudo, X.H. Jiang, T. Timmusk, M. Metsis, N.Belluardo, Neurosci. Lett. 194 (1995) 181^184.

[21] M. Dugich-Djordjevic, F. Ohsawa, T. Okazaki, N. Mori,J.R. Day, K.D. Beck, F. Hefti, Neuroscience 66 (1995)861^877.

[22] X. He, M. Treacy, D. Simmons, H. Ingraham, L. Swanson,R. MG, Nature 340 (1989) 35^41.

[23] D. Fyodorov, T. Nelson, E. Deneris, J. Neurobiol. 34 (1998)151^163.

[24] P. Oettgen, Y. Akbarali, J. Boltax, J. Best, C. Kunsch, T.Libermann, Mol. Cell. Biol. 16 (1996) 5091^5106.

[25] J. Xin, A. Cowie, P. Lachance, J. Hassell, Genes Dev. 6(1992) 481^496.

[26] D. Petersohn, S. Schoch, D.R. Brinkmann, G. Thiel, J. Biol.Chem. 270 (1995) 24361^24369.

[27] G. Di Rocco, M.I.B. Pennuto, N. Canu, G. Filocamo, E.Trani, A.M. Rinaldi, R. Possenti, G. Mandolesi, M.I. Siri-nian, R. Jucker, A. Levi, S. Nasi, Mol. Cell. Biol. 17 (1997)1244^1253.

[28] H. Chu, Y. Tan, L. Kobierski, L. Balsam, M. Comb, Mol.Endocrinol. 8 (1994) 59^68.

[29] B. Chang, S. Persengiev, J. de Diego, M. Sacristan, D. Mar-tin-Zanca, D. Kilpatrick, J. Biol. Chem. 273 (1998) 39^44.

[30] H. Tsuda, K. Takebayashi, S. Nakanishi, R. Kageyama,J. Biol. Chem. 273 (1998) 6327^6333.

[31] N. Zambrano, S. De Renzis, G. Minopoli, R. Faraonio, V.Donini, A. Scaloni, F. Cimino, T. Russo, Biochem. J. 328(1997) 293^300.

[32] A. Kouzmenko, A. Pereira, B. Singh, Biochem. Biophys.Res. Commun. 240 (1997) 807^811.

[33] M. Mieda, T. Haga, D.W. Sa¡en, J. Biol. Chem. 271 (1996)5177^5182.

[34] M. Kozak, Proc. Natl. Acad. Sci. USA 92 (1995) 2662^2666.

BBAEXP 93272 22-6-99


Documents

The mouse neurotrophin receptor trkB gene is transcribed from two different promoters