Traffic 2011; 12: 627–643 © 2011 John Wiley & Sons A/S

doi:10.1111/j.1600-0854.2011.01172.x

The Recycling Endosome Protein Rab17 RegulatesMelanocytic Filopodia Formation and MelanosomeTrafficking

Kimberley A. Beaumont1,

Nicholas A. Hamilton1, Matthew T. Moores1,

Darren L. Brown1, Norihiko Ohbayashi2,

Oliver Cairncross1, Anthony L. Cook1,

Aaron G. Smith1, Ryo Misaki1,

Mitsunori Fukuda2, Tomohiko Taguchi1,

Richard A. Sturm1 and Jennifer L. Stow1,∗

1Institute for Molecular Bioscience, The University ofQueensland, Brisbane 4072 QLD, Australia2Laboratory of Membrane Trafficking Mechanisms,Department of Developmental Biology andNeurosciences, Graduate School of Life Sciences,Tohoku University, Aobayama, Aoba-ku, Sendai, Miyagi980-8578, Japan*Corresponding author: Jennifer L. Stow,j.stow@imb.uq.edu.au

Rab GTPases including Rab27a, Rab38 and Rab32

function in melanosome maturation or trafficking in

melanocytes. A screen to identify additional Rabs

involved in these processes revealed the localiza-

tion of GFP-Rab17 on recycling endosomes (REs) and

melanosomes in melanocytic cells. Rab17 mRNA expres-

sion is regulated by microphthalmia transcription factor

(MITF), a characteristic of known pigmentation genes.

Rab17 siRNA knockdown in melanoma cells quantita-

tively increased melanosome concentration at the cell

periphery. Rab17 knockdown did not inhibit melanosome

maturation nor movement, but it caused accumulation

of melanin inside cells. Double knockdown of Rab17 and

Rab27a indicated that Rab17 acts on melanosomes down-

stream of Rab27a. Filopodia are known to play a role

in melanosome transfer, and in Rab17 knockdown cells

filopodia formation was inhibited. Furthermore, we show

that stimulation of melanoma cells with α-melanocyte-

stimulating hormone induces filopodia formation, sup-

porting a role for filopodia in melanosome release. Cell

stimulation also caused redistribution of REs to the

periphery, and knockdown of additional RE-associated

Rabs 11a and 11b produced a similar accumulation of

melanosomes and melanin to that seen after loss of

Rab17. Our findings reveal new functions for RE and

Rab17 in pigmentation through a distal step in the pro-

cess of melanosome release via filopodia.

Key words: filopodia, melanin, melanocyte, melanosome,

MITF, Rab11, Rab17, recycling endosome

Received 12 October 2010, revised and accepted for

publication 1 February 2011, uncorrected manuscript

published online 3 February 2011, published online 25

February 2011

Melanosomes are specialized organelles responsiblefor melanin synthesis and storage in pigment cells.In melanocytes of the skin and hair, melanosomesare trafficked away from the perinuclear area alongmicrotubules as they mature, and are captured onto actinfilaments at the cell periphery/dendrite tips where they aresubsequently transferred to surrounding keratinocytes byan as yet poorly understood mechanism [reviewed in 1].This process results in pigmentation of the skin and hair, anadaptation offering protection from UV damage and skincancer. Melanin synthesis (2,3), melanocyte dendricity (4),melanosome trafficking to and capture at dendritetips (5) and melanin secretion/transfer to keratinocytes (6)can be increased by stimulation of melanocytes withmelanocortin peptides, such as α-melanocyte-stimulatinghormone (α-MSH), which are produced by keratinocytesand melanocytes in response to UV light (7–9). Thistanning response is dependant on melanocortin 1 receptor(MC1R)-mediated cyclic AMP (cAMP) signalling andupregulation of the microphthalmia transcription factor(MITF) [reviewed in 10], which is a master regulator ofgenes involved in pigmentation, as well as differentiation,proliferation and survival of melanocytes (11).

Multiple Rab GTPases regulate different aspects of vesi-cle trafficking via specific effectors (12). A number ofRabs have now been implicated in melanosome matu-ration and trafficking, the most notable example beingRab27a. Studies of the human disease Griscelli syndromeand the ashen mouse coat colour mutation have revealedthat the molecular complex required for transfer ofmelanosomes from microtubules to actin filaments at thecell periphery consists of Rab27a, its effector melanophilin(Slac2-a) and MyosinVa (13–19). Mutations in any one ofthese genes results in accumulation of melanosomes atthe perinuclear region of the melanocyte and hypopig-mentation of the skin and hair, because of inefficienttransfer of melanosomes to keratinocytes [reviewed in20]. Rab38 has been identified as the gene responsi-ble for the chocolate mouse coat colour mutation (21).Rab38 and Rab32 are known to control trafficking ofmelanogenic enzymes to the melanosome, thus regulat-ing melanosome maturation (22,23). Proteomics studieshave also identified a number of additional Rabs associatedwith the melanosome but with no known roles (24,25).

Recently, transferrin (Tfn)-positive recycling endosomes(REs) have been implicated in the maturation ofmelanosomes (26). REs, and RE-associated Rabs suchas Rab11, are also known to be involved in exocytic/secretory pathways in other cell types (27–30). We werethus prompted to investigate RE-associated Rabs in

www.traffic.dk 627

Beaumont et al.

melanocytic cells. Of these, Rab17 emerged as a keyprotein of interest (POI). Previously only thought to beexpressed in polarized epithelial cells (31,32), we findRab17 is expressed in melanocytic cells where its knock-down produced a dramatic pigmentation phenotype. Ourfindings point to distinct and novel roles for Rab17 andREs in melanosome trafficking and release, with filopodiaformation underlying this process.

Results

Rab17 localizes to REs and melanosomes

We screened known RE-associated Rabs for expres-sion and possible involvement in melanosome traffickingin melanocytic cells. Q-RT-PCR showed no evidenceof Rab25 expression (data not shown), while Rab11a,Rab11b and Rab17 were expressed in melanocytic cellsand are investigated herein.

Rab17 has previously been reported on the apical RE inepithelial cells (31,32) and here we show that GFP-Rab17expressed in B16 melanoma cells is also localized onREs where it overlaps significantly with Tfn, particularlyat the perinuclear region (Figure 1A). Internalized, fluores-cent Tfn is commonly used as a marker of RE (33) underthe conditions used; EEA1 staining did not colocalize withTfn, indicating that Tfn is not marking early endosomes(data not shown). We also show colocalization of GFP-Rab17 with the RE-resident Rab11a (Figure S1A). Analysisof colocalization confirmed that GFP-Rab17 does not colo-calize with staining of other organelles such as the Golgi(Figure 1C).

In B16 cells, GFP-Rab17 was also found in some periph-eral structures that did not contain Tfn (Figure 1A)nor Rab11a (Figure S1A). This peripheral GFP-Rab17co-immunolabeled with HMB45, an antibody to themelanosomal protein SILV (Figures 1B and S1A). TheHMB45 antibody is known to detect stage II and IIImelanosomes (34). A Pearson’s Correlation coefficientof 0.7 indicated that there was substantial colocalizationbetween GFP-Rab17 and HMB45 (Figure 1C). GFP-Rab17also colocalized with mature, melanin-filled granules posi-tive for Tyrosinase-related protein 1 (TYRP1 – or Tyrp1 forthe mouse protein), a protein enriched on stage III–IVmelanosomes (35) (Figure 1D). In an additional humanmelanoma line, vesicular GFP-Rab17 also partially colocal-ized with both HMB45 antibody and TYRP1 throughout thecell (Figure S1B,C). Live imaging of GFP-Rab17 and maturemelanosomes provided additional evidence of a spe-cific association of GFP-Rab17 with melanosomes (FigureS1E). Finally, confirming that endogenous Rab17 can alsobe found on the melanosome, we have detected Rab17 inpurified melanosome fractions in B16 cells (Figure S1F).

Importantly, GFP-Rab17 was also expressed in primaryhuman melanocytes where it partially colocalized withboth Tfn on REs and HMB45 on melanosomes (Figure 2).

We thus conclude that Rab17 is a resident of both REsand melanosome membranes in melanocytic cells. In con-trast, the quintessential RE Rab, Rab11a, is found onREs but is not evident on HMB45-labeled melanosomes(Figure S1A).

Rab17 is expressed in melanocytic cells

and is regulated by MITF

Previously, endogenous expression of Rab17 was thoughtto be restricted to epithelial cells (36); however, endoge-nous Rab17 mRNA and protein were detected in primaryhuman melanocytes (Figure 3A,B).

Pigmentation genes are characteristically regulated byMC1R-mediated cAMP signalling and the transcriptionfactor MITF. Stimulation of primary melanocytes withforskolin (FSK), which activates adenylate cyclase andcAMP signalling, resulted in upregulation of MITF proteinand mRNA (Figure S2A,B). TYRP1, a known target ofMITF, was also upregulated (Figure S2C). Notably, Rab17mRNA and protein were also upregulated in melanocytestreated with FSK (Figure 3A,B), and in human melanomacells treated with α-MSH or FSK (Figure 3E). Importantly,we show that increased expression of Rab17 is becauseof MITF regulation, as siRNA knockdown of MITF inmelanoma cells abrogated the Rab17 upregulation byα-MSH or FSK (Figure 3E). A small increase in Rab17expression after α-MSH or FSK treatment can still beseen in the MITF siRNA knockdown cells, indicating thatanother transcription factor induced by cAMP signallingmay also be involved in Rab17 regulation. Furthermore,siRNA knockdown of MITF resulted in a correspondingdownregulation of the expression of Rab17 in melanomacells and primary melanocytes (Figure 3C,D).

Thus, endogenous Rab17 is expressed in melanocyticcells where its transcription is regulated by MITF, in afashion characteristic of pigmentation genes.

Rab17 knockdown in melanoma cells causes

melanosome accumulation at the periphery

To explore the function of Rab17, siRNA was used toknockdown expression of the protein in B16 melanomacells. B16 cells were chosen for these studies as they areboth pigmented and α-MSH/FSK responsive. Two siRNAsdesigned to specifically knockdown Rab17 produced a70–90% reduction in Rab17 mRNA and protein levels,compared to a negative siRNA control (Figure 4B,C).

In control cells, melanosomes are distributed throughoutthe cell. After knockdown of Rab17, melanosomes wereaccumulated at the cell periphery, particularly in the den-drites (Figures 4A and S3A). This was evident with bothRab17 siRNAs. Incidentally, an increase in dendrite lengthwas seen in knockdown cells using Rab17.1 siRNA; how-ever, this effect was not replicated with Rab17.2 siRNA(Figure 6A). Overexpression of GFP-Rab17, even at highlevels, had no noticeable effect on melanosome distribu-tion or on cell dendricity (data not shown).

628 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

-0.1

0.1

0.3

0.5

0.7

Tfn-546

A

GFP-Rab17 Tyrp1 Overlay DIC

B

+ F

SK

HMB45Rab17

***

GolgiRab17

Pea

rso

ns

Co

rrel

atio

n

C

GFP-Rab17

GFP-Rab17 HMB45 Overlay

Overlay

D

Figure 1: GFP-Rab17 localization in B16 cells. B16 cells were transiently transfected with GFP-Rab17 for 24 h. Panel D was imagedusing the Delta Vision microscope, panel A and B were imaged via confocal microscopy. Brightness and contrast was adjusted for eachcolour channel individually in photoshop. Scale bars on full-size images represent 10 μm and scale bars on the zoom images represent5 μm. A) Transfected cells were incubated with mouse Tfn-Alexa-546 (Tfn-546). Left to right: GFP-Rab17 (green), Tfn-536 (red) and anoverlay of the coloured images also including DAPI (blue). White arrows indicate peripheral GFP-Rab17 that does not colocalize withTfn, yellow arrows indicate GFP-Rab17 colocalization with Tfn. B) Transfected cells were stained with the HMB45 Ab. Left to right:The distribution of GFP-Rab17 (green), the HMB45 melanosome marker (red), and a merge of the coloured images. Yellow indicatescolocalization between Rab17 and the melanosome. C) Pearson’s correlation coefficients for colocalization between GFP-Rab17 andmelanosome marker (HMB45) (white bar) or GFP-Rab17 and Golgi marker GM130 Ab in B16 cells (black bar). Error bars represent ±SDfrom 6 to 12 individual cells. D) Transfected cells were stimulated with FSK and stained with the TRP1 Ab to the Tyrp1 protein. FSK wasused to increase the number of cells with a high number of mature, Tyrp1-positive melanosomes. From left to right: The distribution ofthe GFP-Rab17 fusion protein (green), Tyrp1 (red), a merge of the coloured images and a differential interference contrast (DIC) imageof melanin distribution. The yellow arrow indicates colocalization between GFP-Rab17, Tyrp1 and melanin-filled melanosomes. Thewhite arrow indicates colocalization between GFP-Rab17 and a melanin-filled melanosome. Manual counting using IMAGEJ cell counterrevealed approximately 66% of the dark melanosomes in DIC colocalized with GFP-Rab17.

As a positive control we treated cells with α-MSH, whichstimulates maturation and transport of melanosomes tothe cell periphery for their subsequent release (5). α-MSHcaused a relocation of melanosomes to the cell peripheryas expected, mimicking the effect of Rab17 knockdown

and thus suggesting a role for Rab17 in melanosome traf-ficking. Finally, for comparison, siRNA was also used toknockdown Rab27a. It has previously been shown thatloss of Rab27a function results in perinuclear accumula-tion of mature melanosomes (14). Here, although siRNA

Traffic 2011; 12: 627–643 629

Beaumont et al.

OverlayMelanosomeHMB45

GFP-Rab17B

GFP-Rab17 Tfn-647 OverlayA

Figure 2: GFP-Rab17 localizes to the RE and melanosomes in primary melanocytes. Scale bars represent 10 μm. QF863 primarymelanocytes were transiently transfected with GFP-Rab17 for 24 h. A) Cells were incubated with human Tfn-Alexa647 before fixing.From left to right: The distribution of GFP-Rab17 (green), Tfn-647 (red) and a merge of the coloured images also including DAPI (blue).Arrow indicates colocalization of GFP-Rab17 with the RE. B) Cells were fixed, permeabilized and stained with the HMB45 Ab. From leftto right: The distribution of the GFP-Rab17 fusion protein (green), HMB45 (red) and a merge of the coloured images. This image is thetip of a melanocyte dendrite.

only produced an ∼50% reduction in protein (Figure 4D),this resulted in a marked accumulation of melanosomes inthe perinuclear area (Figure 4A). This was in stark contrastto the peripheral location of melanosomes accumulatedin Rab17 knockdown cells. Double siRNA knockdown ofRab17 and Rab27a resulted in melanosome accumulationin the perinuclear area, similar to the Rab27a knockdown(Figure 4A). From this we conclude that Rab27a is likelyto act on melanosome transport prior to Rab17.

We devised quantitative methods to assess melanosomedistribution in Rab17 knockdown and control cells.Melanosome placement, calculated relative to the cellboundary and nucleus, is shown in Figure 5 as a heat scaleand peak height corresponds to HMB45 staining pixelintensity. The results allow direct comparison of Rab17and Rab27a knockdown effects with controls. Quantifica-tion showed that Rab17 knockdown in B16 cells did indeedsignificantly increase the accumulation of melanosomesnear the cell surface by at least 1.5-fold (Figure 5B). Thisaccumulation reflected a significantly increased total num-ber of melanosomes per cell (Figure 5C). In contrast toRab17, Rab27a knockdown had the opposite effect onmelanosome distribution causing significant localizationto the perinuclear area (Figure 5A,B).

Rab17 knockdown accumulates melanin inside cells

The peripheral accumulation of melanosomes in responseto Rab17 knockdown could be because of changes inmelanosome movement. However, live-cell imaging ofmelanosome movement in control B16 cells or afterRab17 siRNA knockdown showed no significant per-turbation in the velocity of melanosome rapid move-ment on microtubules (>0.3 μm/second), nor on slowermovement on actin filaments (>0.1<0.3 μm/second)(Figure 6B). Although there were many fast-movingmelanosomes throughout the cell, the peripherally accu-mulated melanosomes in Rab17 knockdown cells werepresumably largely captured on actin filaments as thesemelanosomes were undergoing slow movements (FigureS3C). In addition, treatment with the microtubule-disrupting drug nocodazole did not alter the peripheraldistribution of these melanosomes. In contrast, treatmentof Rab27a knockdown cells with nocodazole resulted indispersion of perinuclear melanosome aggregations (datanot shown). There was also no change in the percentageof anterograde/retrograde movements (Figure S3C anddata not shown). These results suggest that loss of Rab17does not affect melanosome movement per se.

We next explored the possibility that loss of Rab17may inhibit the final steps of melanosome release from

630 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

B

A

Fo

ld R

ab17

mR

NA

re

lati

ve c

on

tro

l

Negative siRNA MITF siRNA

C

Melanocytes

Fo

ld R

ab17

mR

NA

re

lati

ve c

on

tro

l

0

1

2

3 ControlFSK

**

**

Melanocytes

NegsiRNAMITFsiRNA

** *

Melanoma0.0

0.2

0.4

0.6

0.8

1.0

0.00

0.25

0.50

0.75

1.00

1.25

1.50

1.75

2.00

2.25 Control

IBMX/MSH

FSK

E

Fo

ld R

ab17

mR

NA

re

lati

ve c

on

tro

l

***

Control FSK

Melanocytes

GAPDH

Rab17

GAPDH

Melanocytes

DNeg

MITFsi

HaCAT

Rab17

Melanoma

Figure 3: Rab17 expression in melanocytic cells and regula-

tion by MITF. The level of Rab17 mRNA was determined byQ-RT-PCR and normalized to B2M expression. A) Two differenti-ated melanocyte strains (QF1177 and QF1185) were stimulatedwith 20 μM FSK or dimethyl sulphoxide (DMSO) (control) for 12 hin the absence of cholera toxin (CT). Rab17 mRNA was expressedrelative to the control. Error bars indicate ±SEM (n = 3). B) West-ern blot of QF863 melanocytes stimulated with 10 μM FSK orDMSO (control) for 4 days in the absence of CT. Bands werecropped from the same blot at the same exposure. This resultwas replicated in the QF1177 and QF1185 strains. C) Rab17mRNA in MM96L cells or differentiated QF1160 melanocytestransfected with negative control or MITF siRNA for 48 h. Rab17mRNA was expressed as fold relative to the appropriate controlcells (negative siRNA). Error bars represent ±SEM (n = 3). D)Western blot of differentiated QF1177 melanocytes transfectedwith negative control or MITF siRNA for 48 h. This result wasreplicated in the QF1185 strain. E) Rab17 mRNA in A06MLC cellstransfected with either negative control or MITF siRNA (Ambion)as indicated. Twenty-four hours after transfection, cells werestimulated with normal media plus 0.25% BSA (control), 10 nM

NDP-MSH in the presence of 100 μM IBMX (MSH) or 10 μM FSKfor a further 24 h. A06MLC cells were used as they were knownto be responsive to both FSK and MSH (37). Rab17 mRNA wasexpressed as fold over the control cells. Error bars indicate ±SEM(n = 3–4). MITF siRNA transfected cells (control, MSH and FSK)are not significantly different to the negative siRNA (control).

the cell, thereby indirectly resulting in melanosomeaccumulation at the cell periphery. In bright-field imagesmany melanosomes in the Rab17 and Rab27a knockdown

cells were dark (Figure 4A), indicating the accumulationof mature melanin-filled melanosomes in both cases.This was further demonstrated by electron microscopy(EM), which indicated the presence of melanosomesrepresenting all four stages of maturation in Rab17 andRab27a knockdown cells, but also with accumulations ofstage III and mature stage IV melanosomes under bothconditions (Figure 6E).

Melanosome release could not be measured directlybecause of very low levels of melanin in the mediumof B16F0 cells. As an alternative, we assayed for achange in melanin content of the cells as an inversemeasure of melanosome release. Accordingly, we showa fivefold increase in melanin content in cells afterknockdown of Rab27a (Figure 6C), and this resulted inan obvious black colouration of cell pellets (Figure 6D).This result reflects the known requirement for Rab27ato transfer melanosomes to actin filaments at the cellperiphery for their subsequent release. Knockdown ofRab17 induced a smaller but still significant increase in cellmelanin content (Figure 6C), also increasing the coloura-tion of cell pellets (Figure 6D). α-MSH, which increasesmelanin synthesis and release, also produced a modestincrease in melanin content and colouration (Figure 6C).The increased melanin content correlates with our pre-vious results, including EM, showing accumulation ofmelanosomes in both the Rab27a and Rab17 knockdowncells (Figures 4, 5C and 6E). In addition, western blot-ting shows an increase in the melanosomal SILV proteindetected by HMB45 Ab in these knockdown cells (datanot shown). The SILV protein is known to be transferredto keratinocytes along with melanosomes (39). Accumu-lation of SILV again correlates with an accumulation ofmelanosomes. Together, this suggests that loss of Rab17,like Rab27a, inhibits melanosome release.

RE redistribution after α-MSH stimulation

and melanosome accumulation in Rab11 knockdown

cells

As Rab17 is localized on both REs and melanosomes,either or both of these pools could be involved inmelanosome release. REs are most commonly foundclustered at the microtubule organizing centre in a per-inuclear location (40); however in some cell types, suchas macrophages and melanoma cells, more peripherallylocated REs are also prominent (26,41,42). Indeed, REscan be found in both perinuclear and peripheral locations indifferent melanocytic cells (Figure S4). Moreover, there issignificant diversity of RE distribution between melanomacell lines (Figure S4). In B16 cells, treatment with α-MSHor FSK caused REs to move more peripherally, particu-larly to the dendrite tips (Figure 7). Quantification of thenumber of cells with Tfn concentrated in the dendritesconfirmed that this change in RE distribution is significantin α-MSH- and FSK-treated cells (Figure 7B). This suggeststhat the RE does have a role in melanocyte pigmentaryresponses, and its location at dendrite tips coincides with

Traffic 2011; 12: 627–643 631

Beaumont et al.

A Rab17.1 siRNA Rab17.2 siRNANegative siRNA Negative + MSHHMB45DAPI

Transmittedlight

Rab27a

GAPDHRab27asiRNA

NegsiRNA

D

Rab27a siRNA Rab27a/17.1 siRNA

Rab

17 m

RN

A(r

elat

ive

con

tro

l)

0.00

0.25

0.50

0.75

1.00**

**B

NegsiRNA

Rab17.1siRNA

Rab17.2siRNA

C

NegsiRNA

Rab17.1siRNA

Rab17.2siRNA

Rab17

GAPDH

Figure 4: B16 Rab17 siRNA treatment: imaging of morphology and melanosome distribution. B16 cells were transientlytransfected with negative control siRNA, Rab17 siRNA (17.1 and 17.2) or Rab27a siRNA. Some negative control cells were also treatedwith 10 nM NDP-MSH (MSH) for 24 h. Transfected cells were fixed after 48 h, permeabilized and stained with HMB45 Ab, Texas-redphalloidin and DAPI. All cells were imaged via confocal microscopy. Scale bars represent 20 μm. Arrows indicate accumulation ofmature melanosomes. A) Upper panel: Merged images are of HMB45 Ab staining (melanosome – green) and DAPI (blue). Lower panel:Transmitted light images. The outline of the Rab27a siRNA cells was drawn with coloured lines using Texas-red phalloidin staining as aguide. B) Q-RT-PCR analysis of mouse Rab17 mRNA in B16 cells transiently transfected with negative control siRNA or Rab17 siRNA.Rab17 mRNA was normalized to GAPDH expression then expressed as fold relative to the control cells. Error bars indicate ±SEM(n = 3). C) Rab17 western blot of B16 cells transiently transfected with negative control or Rab17 siRNA. This blot is representativeof three independent experiments. D) Rab27a western blot of B16 cells transiently transfected with negative control siRNA or Rab27asiRNA. This result is representative of three independent experiments.

the location of accumulated melanosomes prior to releasein α-MSH-treated cells.

To further test for RE function, we studied the prototypicalRE Rab, Rab11, in melanocytic cells. In melanomacells and primary melanocytes, GFP-Rab11a and GFP-Rab11b colocalized with internalized Tfn in perinuclearand peripheral RE (Figures 8 and S4). Interestingly, theoverexpression of GFP-Rab11 also resulted in an increasedlocalization of Tfn, and thus RE, to dendrite tips (Figure 8and Figure S4). Co-expression of GFP-Rab17 and mCherry-Rab11a colocalized in RE (Figure S1A). In contrast to GFP-Rab17, GFP-Rab11a and GFP-Rab11b did not specificallycolocalize with melanosome markers (Figure S1A and datanot shown), indicating their sole association with RE.

Next, Rab11a and Rab11b expression was knocked downby siRNA in B16 cells. Knockdown of Rab11a, and moreso of Rab11b, resulted in an intense accumulation ofmelanosomes at the cell periphery and in dendrites(Figure 9A). The accumulation of melanosomes wassimilar to Rab17 knockdown, but even more pronounced.The melanin content of cells and colouration of cell

pellets were also increased by Rab11a and Rab11bknockdown (Figure 9E,F). This is consistent with theRab17 knockdown phenotype, and may also indicate aninhibition of melanosome release in Rab11 knockdowncells. Double knockdown of Rab17 and Rab11a resulted inan increase of melanin content over that seen with Rab11aor Rab17 alone (Figure 9G), indicating that knocking outboth Rab17 and Rab11 gives a more severe melaninaccumulation phenotype. These findings suggest thatadditional RE-associated Rabs, and by inference REsthemselves, are involved at the periphery in one or moresteps required for melanosome release.

Taken together, the findings with Rab11a and Rab11b,which are only found on RE in melanocytic cells, serveto implicate RE in melanosome release and by analogywe conclude that the Rab17 on REs is similarly regulatingmelanosome release.

Rab17 is required for filopodia formation

In a recent elegant study, Singh and co-workers reportedthat filopodia emerging from dendrites on melanocytes arerequired for melanosome transfer to keratinocytes (43).

632 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

Rab17 siRNA

Negative siRNA

Melanosome localisation

Rab27a siRNAA

0.0

0.5

1.0

1.5

Neg si

RNA

Rab17

.1 si

Rab17

.2 si

Rab27

a si

MSH

Inte

nsi

ty R

atio

*****

***

B **

0

100

200

300

400

500

C

Mel

ano

som

e co

un

t

Neg si

RNA

Rab17

.1 si

Rab17

.2 si

**

Figure 5: Representation of melanosome marker intensity and distribution, quantification of melanosome localization and

numbers per cell. B16 cells were transiently transfected with negative control siRNA, Rab17.1 siRNA or Rab27a siRNA for 48 h asindicated. A) HMB45 fluorescence intensity is represented by the raised surfaces and colour indicates proximity to the cell membraneor nucleus. B) Quantification of melanosome localization in B16 siRNA knockdown cells. The boundary of individual cells is defined byactin staining, the nucleus is defined by DAPI staining and the intensity of the HMB45 Ab staining is used to determine melanosomedistribution. The intensity ratio is calculated by the average intensity of HMB45 pixels proximal to the cell boundary divided by theaverage intensity of pixels further from the cell boundary (closer to the nucleus). Therefore, a cell with a relatively high intensity ratiohas a relatively high proportion of melanosomes near the periphery of the cell. Error bars represent ±SEM (n ≥ 9 individual cells). C)Quantification of the numbers of HMB45-positive melanosomes per cell in negative siRNA- or Rab17 siRNA-treated cells as indicated.Error bars represent ±SEM (n ≥ 18 cells per treatment).

We thus examined filopodia as a possible mechanismfor Rab17-mediated melanosome release. The filopodialphenotype of Rab17 knockdown cells was determined byscanning EM. Control B16 cells were covered with a lawnof dorsal filopodia; notably, we found that the numberand density of filopodia increased markedly after stimula-tion with α-MSH or FSK (Figure 10A). In contrast, Rab17knockdown caused a dramatic reduction in filopodia, leav-ing cells with unusually smooth surfaces (Figure 10A).There was a significant increase in the number of smoothcells seen after Rab17 knockdown (Figure 10B). In com-parison, knockdown of Rab27a did not alter the numberof filopodia. Overexpression of GFP-Rab17 did not changethe number or appearance of filopodia (data not shown),suggesting that Rab17 is necessary but not sufficient forfilopodia formation. B16 Rab17 knockdown cells were alsolargely unable to respond to MSH by induction of filopodiaformation (Figure S5), although MSH-induced responses

in melanin synthesis and increased dendricity were seenin Rab17 knockdown cells (data not shown).

Our results complement those of Singh et al. (43), linkingfilopodia formation to melanosome release. Moreover, ourdata show that RE-associated Rab17 is a novel mediatorof both constitutive and MSH-induced filopodia formation,and that this is a possible mechanism for Rab17sinvolvement in distal stages of melanosome release.

Discussion

Our data show that Rab17 is expressed in melanocyticcells where its association with melanosomes, its functionin melanosome release and its MITF-regulated expressiondenote this as a new pigmentation gene. Moreover, ourdata reveal that Rab17 is also associated with REs in

Traffic 2011; 12: 627–643 633

Beaumont et al.

Negative siRNA Rab17.1 siRNA Rab27a siRNA

N

N

N

G

E

mc

mc

mc

mc

Neg si

RNA

Rab17

.1 si

Rab17

.2 si

Rab27

a si

MSH

D

A

Den

dri

te le

ng

th(r

elat

ive

con

tro

l)

Neg si

RNA

Rab17

.1 si

Rab17

.2 si

Rab27

a si

Neg +

MSH

Dendrite Extention

0.0

0.5

1.0

1.5

2.0

2.5 ****

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7 NegsiRNARab17siRNA

Vel

oci

ty

Actin Microtubules

Melanosome VelocityB

C

Mel

anin

(% r

elat

ive

con

tro

l)

0

100

200

300

400

500

600

Neg si

RNA

Rab17

.1 si

Rab17

.2 si

Rab27

a si

MSH

*

****

Figure 6: B16 Rab17 knockdown and dendrite length, melanosome velocity, melanin content and melanosome imaging by

EM. A) B16 dendrite length (distance in micrometers of the longest dendrite from the nucleus) was quantified using IMAGEJ. Lengthswere normalized to the control cells, error bars represent ±SEM (n = 4). B) Melanosome velocity in live B16 cells transfected withnegative control siRNA or Rab17 siRNA imaged via bright-field time-lapse microscopy. Error bars represent ±SEM of melanosomevelocity from 2 to 3 cells, with at least four individual melanosomes tracked per cell. Movements >0.1 μm/second but <0.3 μm/secondare thought to be actin movements and movements >0.3 μm/second are thought be microtubule movements (38). C) Total melanincontent in B16 cells was measured 3 days after transient siRNA transfection. Values were normalized to the negative control. Errorbars indicate ±SEM (n ≥ 4). D) Representative digital photo of cell pellets of transient siRNA knockdown B16 cells, or cells treated with10 nM NDP-MSH (MSH). E) Transmission electron micrographs of control, Rab17.1 knockdown or Rab27a knockdown cells. ControlB16 cells show low numbers of melanosomes near the cell body and in dendrites, while Rab17 knockdown cells show an increasein melanosomes which were mainly in peripheral regions of the cell body and in the dendrites. Rab27a knockdown cells showed aneven larger increase in melanosomes, which were concentrated throughout the cell body/perinuclear region. Yellow arrows indicatemature, stage IV melanosomes and black arrows indicate stage II–III melanosomes. N = Nucleus, G = Golgi, mc = mitochondria. Scalebars = 2 μm.

634 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

Control MSH FSKA

% C

ells

Tfn

at

tip

s

Control MSH FSK

10

0

20

30

40**

**

B

Figure 7: Tfn redistribution after α-MSH or FSK stimulation in B16 cells. B16 cells were treated with 10 nM NDP-MSH (MSH), FSKor vehicle (control – 0.1% BSA) for 2 days. Cells were then incubated with mouse Tfn-Alexa546 (Tfn-546) and then fixed and stainedwith DAPI for imaging. A) Cells were imaged using the Personal Deltavision microscope. Representative images show the distribution ofTfn (red) and DAPI (blue). Scale bars represent 20 μm. Arrows indicate concentrations of Tfn in dendrites after stimulation with α-MSHor FSK. B) Quantification of the number of cells with concentrations of Tfn in the dendrite, particularly at dendrite tips. Error bars indicate±SEM (n = 3 independent experiments).

melanocytic cells, as it is in other epithelial cell types,and through studying Rabs17 and 11, a second novel find-ing is that peripheral REs may have a key role in distalstages of melanosome release. Given the role of Rab17in filopodia formation and the potent stimulatory effectof α-MSH or FSK on filopodia, we propose that filopo-dia are the site for Rab17 or RE-regulated melanosomeexocytosis.

The expression of Rab17 is upregulated by stimulationwith the cAMP activator FSK or α-MSH and by MITF,this is characteristic of pigmentation genes such as

Rab27a (44). Of interest, we noted that in supplementarydata published by Hoek et al. (45), there is evidence forMITF-regulated Rab17 gene expression, although Rab17was not identified as an MITF target in this particular study.MITF is able to upregulate various pigmentation genes viathe M box or the E box found in the promoter (46). Ouranalysis of the region up to 2000 base pairs upstreamfrom the human Rab17 gene transcription site revealedthe presence of several E-box sequences (CAYRTG), twoalso being M-box sequences (5′ T or 3′ A flanking theE-box sequence), as potential MITF binding sites (11).

A

B

GFP-Rab11a Tfn-546 Overlay

GFP-Rab11b Tfn-546 Overlay

Figure 8: GFP-Rab11 localization in B16 cells. B16 cells were transiently transfected with GFP-Rab11a (A) or GFP-Rab11b (B), thenincubated with mouse Tfn-Alexa546 (Tfn-546). Left to right: GFP-Rab11 distribution (green), Tfn-546 (red) and an overlay, with yellowindicating colocalization. Zoom boxes illustrate the presence of Rab11 and Tfn at dendrite tips and membrane protrusions. Arrow in(A) indicates the presence of perinuclear Rab11 and Tfn. Note that arrow in (B) indicates the presence of mostly perinuclear Tfn inuntransfected cells, with little concentrations at the dendrite tips. Scale bars represent 20 μm, scale bars on zoom images represent5 μm.

Traffic 2011; 12: 627–643 635

Beaumont et al.

0

100

200

300

400

500

(% r

elat

ive

con

tro

l)M

elan

in

Neg si

RNA

Rab11

a.1 si

Rab17

.1 si

Rab17

.1 si

/Rab

11a .

1 si

0.00

0.25

0.50

0.75

1.00

Rab

11a

mR

NA

(rel

ativ

e co

ntr

ol)

Rab

11b

mR

NA

(rel

ativ

e co

ntr

ol)

Neg si

RNA

Rab11

b.1 si

Rab11

b.3 si

Rab11

a.1 si

Rab11

a.2 si

C

1.25

1.5

1.0

0.75

0.5

0.25

0

B

Neg si

RNA

Rab11

b.1 si

Rab11

b.3 si

Rab11

a.1 si

Rab11

a.2 si

Neg si

RNA

Rab11

a.1 si

Rab11

a.2 si

Rab11

b.1 si

Rab11

b.3 si

****F

Mel

anin

(% r

elat

ive

con

tro

l)

A Rab11a.1 Rab11a.2Rab11b.1 Rab11b.3Neg siRNA

NegsiRNA

Rab11

GAPDH

11a.1siRNA

11a.2siRNA

D

NegsiRNA

11b.1siRNA

11b.3siRNA

11a.1siRNA

11a.2siRNA

E

0

100

200

300

400

500

600

700 **

G *

*

**

Figure 9: Rab11 siRNA knockdown in B16 cells: melanosome imaging and melanin content. A) B16 cells were transientlytransfected with siRNA to Rab11a or Rab11b or a negative control for 2 days. Transmitted light images obtained via confocal microscopy.Scale bars represent 20 μm. HMB45 staining also showed accumulation at the cell periphery in Rab11 knockdown cells (data not shown).B and C) Q-RT-PCR analysis of mouse Rab11a or mouse Rab11b mRNA in B16 cells transiently transfected with negative control siRNAor Rab11 siRNA as indicated. Rab11a or 11b mRNA was normalized to GAPDH expression then expressed as fold relative to the controlcells. Error bars indicate ±SEM (n = 3). Rab11a expression in Rab11b knockdown cells was only performed once. D) Rab11 westernblot of Rab11a knockdown cells. This is representative of two independent experiments. Knockdown of Rab11a protein could be verifiedusing a Rab11 Ab (Figure 10D); however, Rab11b siRNA did not noticeably affect the levels of Rab11 by western blot (data not shown).This may be because of relatively high expression level of Rab11a compared to Rab11b in B16 cells. E) Representative digital photo ofcell pellets of transient siRNA knockdown B16 cells, or cells treated with 10 nM NDP-MSH. F) Total melanin content in B16 cells wasmeasured 3 days after transient siRNA transfection. Values were normalized to the negative control. Error bars indicate ±SEM (n = 3).G) Total melanin content in B16 cells transfected with 17.1 or 11a.1 siRNA individually or together. Error bars indicate ±SEM (n = 3).

636 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

Neg si

% S

mo

oth

cel

ls

% D

ense

filo

po

dia

cel

ls

C

MSH

A

Rab17

.1 si

Rab17

.2 si

Rab27

a si

**

B

**

05

1015202530354045

0

25

50

75

Control

MSHFSK

*

FSK

Negative siRNA Rab17 siRNA

Figure 10: Scanning EM assessment of filopodia in B16 Rab17 knockdown cells. B16 cells were transiently transfected with theindicated siRNA for 2 days or treated with 10 nM NDP-MSH (MSH) or 10 μM FSK for 1–2 days. Co-transfection of siRNA with EGFPindicated that transfection efficiency was approximately 50%. A) Representative scanning EM images of B16 cells. B) Quantification ofthe numbers of ‘smooth’ cells (five filopodia or less). Error bars indicate ±SEM (n = 3–4, except for Rab27a siRNA, which shows therange from n = 2 independent experiments). C) Quantification of the numbers of ‘dense’ filopodia cells. Control cells include negativesiRNA cells as well as untreated cells. Error bars indicate ±SEM (n = 4–5 independent experiments).

Traffic 2011; 12: 627–643 637

Beaumont et al.

Knockdown of Rab17 caused marked accumulation ofmelanosomes at the periphery, particularly in den-drites. This coincided with an accumulation of melanininside Rab17 knockdown cells. Reduction or inactiva-tion of Rab27a is known to accumulate melanosomesin cells (13,47), correlating here with the accumulation ofmelanin seen in our Rab27a knockdown cells. Rab27afunctions through the effector, melanophillin, to achievecapture of melanosomes onto cortical actin (16). As evi-dent in our data, failure to latch on to peripheral actin allowsmelanosomes to be returned to the perinuclear regionin Rab27a knockdown cells, and prevents melanosomerelease from the cell. The double knockdown of Rab17and Rab27a resembles the Rab27a loss phenotype, sug-gesting that Rab17 acts downstream of Rab27a and ata more distal step in melanosome release. Melanosomemovement in Rab17 knockdown cells was unaffected, andin these cells intact, mature melanosomes appear to reachthe cell periphery where they are presumably anchoredon actin filaments but cannot subsequently be released.However, to conclusively prove that melanosome releaseis inhibited in Rab17 knockdown cells, future experiments,perhaps using a co-culture melanosome transfer assay,will need to be performed.

The localization of Rab17 to both RE and melanosomesis in keeping with the functional, dynamic and physicalassociation of peripheral REs with melanosomes demon-strated previously in melanoma cells (26); however, Rab17appears to be the first protein that can bind to membranesof both organelles. Delevoye et al. (26) demonstrated thatAP-1 and KIF13A are responsible for RE transport tothe cell periphery. Our results similarly demonstrate thisperipheral movement of REs, and we now show that thismovement is induced by α-MSH and FSK. Peripheral REsare in close contact with melanosomes and deliver TYRP1to the maturing melanosomes (26). Loss of other pigmen-tation genes, such as Rab32/38, also affects the traffickingof melanogenic enzymes to melanosomes (22). Localiza-tion of TYRP1 in the Rab17 knockdown cells was notnoticeably altered and there was no consistent changein the total expression level of TYRP1 in the Rab17knockdowns (data not shown). Thus, changes in the degra-dation, trafficking or expression of TYRP1 are seeminglynot responsible for the accumulation of melanin in Rab17knockdown cells. Overall, the presence of melanin in theaccumulated melanosomes and the presence of stageI–IV melanosomes in EM images suggest that Rab17knockdown does not affect melanosome maturation.Accumulations of melanosomes after loss of Rab17 andthe RE-specific Rab11a and Rab11b suggest that theseRabs – in association with REs – are responsible for a dis-tal step directly related to melanosome release. The dou-ble knockdown of Rab17 and Rab11 gave additive effectson melanin accumulation over Rab17 or Rab11 alone. Thiscould indicate some redundancy of function; however,overexpression of GFP-Rab17 was unable to rescue Rab11knockdown and vice versa (data not shown). Rab17 andRab11 are therefore likely to have independent functions

in melanosome accumulation/release. It is still uncertainwhether the Rab17 localized on RE or melanosomes iscontributing to the melanosome accumulation. However,given that the RE-resident Rab11 knockdown gave a simi-lar phenotype, we hypothesize that Rab17 localized on themelanosomes themselves may have a separate function,which is yet to be explored.

The mode of melanin transfer to keratinocytes isstill controversial, and many mechanisms have beenproposed, including keratinocyte cytophagocytosis ofmelanocyte dendrite tips, exocytosis of melanin, sheddingof membrane-bound vesicles containing melanosomes,or transfer of melanosomes via fusion of keratinocyteand melanocyte plasma membranes (1). Recently, Singhet al. revealed that the finer filopodia extending fromdendrites are required for melanosome transfer to ker-atinocytes. In their study UV induced increased filopodiaformation (43) and this is complemented by our data,showing that filopodia are also increased by α-MSHand FSK. Thus, filopodia are formed as part of themelanocyte pigmentary responses. Our data reveal dra-matic loss of filopodia after knockdown of Rab17. Althoughmelanosomes are transferred to adjacent, co-culturedkeratinocytes via cytophagocytosis of melanocyte filopo-dia (43), this process is supplanted by constitutive releaseof melanosomes into the medium in monocultures of B16cells (48). Filopodia have previously been suggested asthe sites for melanosome exocytosis (49) and our find-ings would suggest that this is also the case in ourmonoculture model. We propose that in the absenceof Rab17-regulated filopodia formation, melanosome exo-cytosis is inhibited and melanosomes instead accumulatein the dendrites and at the cell periphery in Rab17 knock-down cells. Melanin accumulation in Rab17 knockdowncells was less than that of Rab27a knockdown cells, likelybecause of a low level of release of these peripherallytrapped melanosomes, correlating with the fact that filopo-dia are not completely absent in the knockdown cells. Theeffects of Rab17, alongside those of Rabs 11a and 11b,serve to implicate RE in this distal step of melanosomerelease and in filopodia formation. Perhaps Rab17 facili-tates transfer of membrane from RE to the surface forfilopodia formation; of note, RE and Rab11 in neuronscontribute membrane for the formation of neurites in aparallel situation (50,51).

In summary, our data make the case for Rab17 as anew pigmentation gene, alongside other known pigmen-tation/trafficking genes, including Rab27a, Rabs38 and 32,and AP-3 subunits whose loss, by genetic ablation or inac-tivation, results in diluted coat colour in mice, eye colourchanges in flies or in hair and skin colour changes inhumans (13,21,52–54). Whilst loss or mutation of Rab17in these organisms has not yet been reported, based onour findings indicating that Rab17 plays a role in distalmelanosome release from the melanocyte, we predictthat this would also result in dilution of pigmentation. Ourmain focus in this study was Rab17; however, preliminary

638 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

findings implicating Rabs11a and b in melanosome accu-mulation also suggest that these too may be genesinvolved in pigmentation. Notable in this regard, Rab11was able to partially rescue the eye colour defect inBLOC-1 mutant Drosophila (55).

Materials and Methods

Cell cultureMM96L, MM418 and AO6MLC human melanoma as well as B16-F0mouse melanoma cells were cultured as described previously (56), with5% heat-inactivated serum supreme instead of 3%. Primary melanocytes(QF863) were cultured from anonymous neonatal foreskin samples (57,58).The QF1160, QF1177, QF1236 and QF1185 strains of human melanoblastswere cultured as previously described (59). All melanoblasts were subse-quently differentiated into melanocytes through cultivation in melanocytegrowth medium for 7 days (60). COS-1 cells were cultured as previouslydescribed (40).

Antibodies and reagentsFor immunofluorescence and western blotting, the following antibodieswere used: Rab27a (Sigma), anti-TYRP1 [BG83 (61)], HMB45 (Lab Vision),GAPDH (R&D Systems), GM130 (Becton Dickinson), MITF (Zymed), DAPI(Molecular Probes), TRP1 (Ta99 – Santa Cruz) and Texas-red-X phalloidin(Molecular Probes). Anti-Rab17 rabbit polyclonal antibody was raisedagainst glutathione S-transferase (GST)-Rab17 and affinity-purified by expo-sure to antigen-bound Affi-Gel 10 beads (Bio-Rad Laboratories) as describedpreviously (62). For the melanosome purification experiments the follow-ing antibodies were used: anti-EEA1 (Cell Signaling Technology) and goatanti-Tyrp1 (Santa Cruz Biotechnology). Anti-Rab27a rabbit polyclonal anti-body was prepared as described previously (63). Anti-tyrosinase rabbitpolycolonal antibody was raised against a peptide corresponding to theC-terminal sequence (amino acid residues 520–533) of mouse Tyrosi-nase (64) and affinity-purified essentially as described previously (62).

Mouse Tfn-Alexa546 was made using apo-transferrin (Sigma), which wasloaded with Fe by dialysing it overnight in 10 mM NaHCO3/2 mM Nitrilotri-acetic acid trisodium salt/0.25 mM FeCl3/50 mM Tris (pH 8.0). The bufferwas then exchanged to 10 mM NaHCO3, and then holo-transferrin wasconjugated with Alexa546 with a kit from Invitrogen. Human Tfn-Alexa546or Tfn-Alexa647 was obtained from Molecular Probes.

[Nle4, D-Phe7]-α-MSH (NDP-MSH), FSK and IBMX were obtained fromsigma.

Plasmid and siRNA transfectionEGFP-Rab constructs were obtained from a mouse GFP-Rabslibrary (65–67). Twenty-four to forty-eight-hour transient transfection withlipofectamine 2000 (Invitrogen) was performed according to the manufac-turer’s guidelines.

Stealth negative control siRNA (catalogue 12935-300), mouse Rab17siRNA (17.1: MSS276682; 17.2: MSS276683), mouse Rab11a siRNA(11a.1: MSS225428; 11a.2: MSS225429) and mouse Rab11b siRNA (11b.1:MSS208343; 11b.2: MSS208345) were obtained from Invitrogen, siRNAagainst Rab27a (ID: 161927) and MITF (ID: 115142) were obtained fromAmbion (Catalogue AM16704). Forty-eight to seventy-two-hour siRNA tran-sient transfection of B16 cells with lipofectamine 2000 (Invitrogen) wasperformed as previously described (68).

Live imaging and melanosome trackingFor live-cell experiments, B16 cells were grown on 35-mm glass bottomdishes (MatTek). Live-cell imaging using bright field was performed using

an inverted microscope IX81 OBS (Olympus). During imaging, cells weremaintained at 37◦C in CO2-independent medium. Images were capturedat intervals of 1 second or 10 seconds using the 100× objective, for atotal of 120 frames. IMAGEJ manual tracking was used to track individualmelanosomes from the start of the movie, until they were no longervisible. Movements >0.3 μm/second were assumed to be microtubule-based movements, and movements >0.1<0.3 μm/second were assumedto be actin-based movements, these velocities have been describedpreviously (38).

Transferrin uptakeTo label the RE, B16 cells were incubated in serum-free media for 30 min,then loaded with 20 μg/mL of mouse Tfn-Alexa546 for approximately45 min. Cells were washed and incubated for 5–10 min in serum-freemedium before fixing in 4% paraformaldehyde (PFA). Human melanomacells or human melanocytes were incubated with 20 μg/mL human Tfn-Alexa647 for 45 min. COS-1 cells were incubated with human Tfn-Alexa546as previously described (40).

Indirect immunofluorescence microscopyCells were grown on coverslips and treated as required before fixing in 4%PFA. Cells were washed in PBS, then permeabilized in 0.1% Triton X-100for 3 min. Indirect immunofluorescence was then performed as previouslydescribed (29). The following primary antibody titres were used: TYRP1 Ab1:20, HMB45 1:100, GM130 1:100, TRP1 1:200.

Confocal images were captured using an LSM 510 META confocalmicroscope (Carl Zeiss) using optical spectral separation. Single imageswere captured with an optical thickness of 0.7–1.7 μm. Analysis wasperformed using LSM510 META software (Carl Zeiss MicroImaging) andphotoshop.

Epifluorescence images were captured using the Personal Deltavisionmicroscope (Olympus IX71). Z -stacks of 0.2 μm thickness were obtainedand then deconvolution was performed using the DELTAVISION software.

Pearson’s correlationQuantification of colocalization using Pearson’s correlation coefficient (R)was performed in VOLOCITY v3.7 (Improvision). The threshold intensity foreach fluorophore was predetermined using IMAGEJ.

Electron microscopy

Transmission EMCells were processed for resin EM as previously described (59).

Scanning EMCells were grown on glass coverslips and treated as required, then fixed in2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer for 2 h, post-fixed in1% osmium tetroxide, dehydrated through ethanol and finally dehydratedin hexamethyldisilazane overnight (all from ProSciTech). Coverslips werethen gold-coated and viewed on a JEOL JCM-5000 Neoscope Benchtopscanning electron microscope (Laboratory Scientific Engineering).

Filopodia scoringFor quantification of filopodia numbers random fields were obtained at1500× magnification. Dorsal membrane projections that were classified asfilopodia were on average greater than 1 μm in length and had a diameterof approximately 0.2 μm. Many cells (especially those treated with MSHor FSK) had too many filopodia to easily count. Therefore, cells in eachimage were scored as ‘smooth’ (less than 5 dorsal filopodia), ‘normal’ (theaverage number of filopodia in the control cells) or ‘dense’ filopodia. Atleast 25 cells were scored for each independent experiment.

Traffic 2011; 12: 627–643 639

Beaumont et al.

Quantification of melanosome localizationWe used the HMB45 Ab to mark the melanosome. Here we show HMB45immunofluorescence generally correlated with the presence of melanin-filled granules in transmitted light (Figure 4A), although in unpigmentedB16 cells vesicular HMB45 staining was still present, reflecting the abilityof HMB45 to also detect immature stage II melanosomes. The HMB45marker was also sometimes unable to detect particularly dark (presumablystage IV) melanosomes, as the HMB45 epitope is thought to be graduallycovered by melanin (34).

Cell region selectionEach cell was imaged in three channels: Phalloidin labelling of actin todelineate the cell perimeter, DAPI staining for the nuclei and a fluores-cently tagged POI (in this case SILV using the HMB45 Ab). The first stepwas to create binary images that delineate the nuclear and cellular regionsusing a custom macro in IMAGEJ (69). To the actin channel a median filter ofradius 5 is applied to smooth the image and then an auto-threshold (‘HuangDark’ method) applied to create a binary image. To remove small non-cellregion artefacts and fill in holes in the mask the ‘Analyse Particles’ plug-inis applied with a minimum particle size of 10 000 pixels. The resultingmask then delineates the cell regions. Similarly, nuclei are selected fromthe DAPI channel using a median filter radius 10 and auto-thresholding.As multiple cells are often present in each image, the images were thenmanually reviewed and individual cells selected and cropped from theimages. The result is then a three-channel image containing a cell regionmask, a nuclear region mask, and the image of the POI.

Intensity ratio calculationFor each cell, an intensity ratio was calculated within the developmentversion of the ILLOURA software environment (70). The first step is to defineregions that are proximal to the periphery of the cell. The actin and DAPImasks define the boundaries of the cell and nucleus, respectively. For anygiven pixel within the actin mask region (but not the nucleus region) wedefine dn to be the shortest distance from that pixel to the boundary of thenucleus. Similarly, dm is defined to be the shortest distance from the pixelto the actin mask boundary. The distance ratio dr is then given as dm/(dm +dn). Hence, every pixel in the actin mask region, but not within the nuclearregion, is assigned a distance ratio. The ratio takes values in the range 0 (onthe cell boundary) to 1 (on the nucleus boundary). Images showing pixelscoloured according to their distance ratio are shown in Figure 5. The aver-age intensity of pixels in proximal to the cell boundary (dr < 0.25) is denotedIm, and the intensity In of pixels further from the cell boundary (dr ≥ 0.25)are then calculated. The final intensity ratio is then given by Im/In. Hence fora protein that strongly expresses near the cell boundary but weakly in theperinuclear region, the ratio will be large in comparison with the one thatexpresses strongly in the perinuclear region but weakly in the periphery.

IMARIS quantification of melanosome numbersThe same HMB45 fluorescence images used in the quantification ofmelanosome localization were used for IMARIS (Bitplane AG) softwarequantification of melanosome numbers per cell. The same vesicle thresholdvalues were used for all images. At least 18 individual cells were processedfor each treatment.

Western blotting and melanin assayWestern blotting (37) and melanin assays (59) were performed aspreviously described.

Immunoaffinity purification of melanosomes with

anti-Rab27a antibodyImmunoaffinity purification of Rab27a-bound melanosomes with anti-Rab27a immunoglobulin G (IgG)-conjugated magnetic beads wasperformed as described previously (38). In brief, Dynabeads M-280(30 μL volume, wet volume) coated covalently with sheep anti-rabbit IgG

(Invitrogen) were incubated for 3 h at 4◦C with the anti-Rab27a antibodyor control rabbit IgG (5 μg) in PBS containing 0.1% BSA. B16-F1 cells(one confluent 10-cm dish) were homogenized in a homogenization buffer(5 mM HEPES–KOH at pH 7.2, 5 mM EDTA, 0.03 M sucrose, and appro-priate protease inhibitors), and after centrifugation at 800 × g for 10 min,the supernatant was incubated with the primary antibody-coated beadsfor 1 h at 4◦C in the homogenization buffer containing 10% FBS. Afterwashing the beads twice with PBS containing 2 mM EDTA, the boundfractions were analysed by 10% SDS–PAGE followed by immunoblottingwith anti-EEA1 antibody, anti-GM130 antibody, anti-Tyrosinase, anti-Tyrp1antibody, anti-Rab17 antibody and anti-Rab27a antibody.

Quantitative real-time PCRRNA extraction, DNase treatment and Q-RT-PCR using SYBR Green orTaqMan reagent was performed as described previously (37). TaqManassays (Applied Biosystems) included TYRP1 (Hs00167051_m1), MITF(Hs00165156_m1), GAPDH (Hs99999905_m1), 18S (4319413E), mouseRab17 (Mm00436205_m1), mouse Rab11a (Mm00444317_m1), mouseRab11b (Mm00784304_s1) and mouse Gapdh (Mm99999915_g1). Sybrgreen primers were designed using Primer Express (Applied Biosystems)and included β2-microglobulin (B2M); (FWD: 5′ TGCCGTGTGAACCATGT-GAC 3′, REV: 5′ ACCTCCATGATGCTGCTTACA 3′); RAB17 (FWD: 5′ CCA-GAAGTTGCTGTTCATGGAA 3′, REV: 5′ CCTCGTCGCTTCTCTGCAGTA 3′).

StatisticsStatistical significance was determined by one-way ANOVA followed byDunnett’s post hoc or Tukey’s test, or a student’s t-test using PRISM v5 asappropriate (Graphpad Software Inc.).

Acknowledgments

We thank Professor Peter Parsons for the gift of the TYRP1 antibody(B8G3) and Professor Kirill Alexandrov for the gift of the TRP1 antibody(Ta99). We thank Darren Smit for help with transfection experiments. Grantfunding was provided by the Australian Research Council (DP0771169 andDP1094964). T. T. was supported by the Core Research for EvolutionalScience and Technology (CREST) and Grants-in-aid for Scientific Research(18050019) by the Ministry of Education, Culture, Sports, and Technology(MEXT) of Japan. M. F. was supported by MEXT (20113006, 21370087)and by the Global COE Program (Basic & Translational Research Center forGlobal Brain Science) from MEXT of Japan. R. A. S. and J. L. S. are fellowsof the National Health and Medical Research Council of Australia. Confocalimaging was performed in the Australian Cancer Research Foundation(ACRF)/Institute for Molecular Bioscience Dynamic Imaging Facility forCancer Biology, which was established with the support of the ACRF.

Supporting Information

Additional Supporting Information may be found in the online version ofthis article:

Figure S1: GFP-Rab17 localization and co-purification of Rab17 with

melanosomes markers. All cells were imaged via confocal microscopy.Brightness and contrast was adjusted for each colour channel individuallyin photoshop. Scale bars on full-size images represent 10 μm, scale barson zoom images represent 5 μm. A) B16 cells transiently co-transfectedwith GFP-Rab17 (green) and mCherry-Rab11a (red) for 24 h, then fixed,permeabilized and stained with the HMB45 Ab (blue). Yellow arrowsindicate colocalization between Rab17 and Rab11a. B and C) MM96Lwere transiently transfected with GFP-Rab17, then fixed, permeabilizedand stained with the HMB45 or TYRP1 Ab (BG83). Images representthe distribution of GFP-Rab17 fusion protein (green), the melanosomemarkers (red) and a merge of the two coloured images as indicated. D)Cos-1 cells were transiently transfected with GFP-Rab17 (green), thenincubated with Tfn-Alexa546 (Tfn-546 – red). E) Time-lapse images ofmelanin-filled melanosomes (top) and GFP-Rab17 (bottom) in live B16

640 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

cells. Time (T ) = 10-second intervals. Scale bars represent 2 μm. Yellowarrows indicate a Rab17-positive melanosome. F) Immunoaffinity purifica-tion of melanosomes from B16 cells was performed by using anti-Rab27aIgG (Rab27a) or control IgG (Con) as described in Materials and Methods.Note that Rab17 was co-purified with three melanosome markers, Rab27a,Tyrosinase and Tyrp1, but not with GM130 or EEA1.

Figure S2: mRNA expression of pigment genes in melanocytic cells.

A, B and C) QF1177 or QF1185 differentiated melanocytes were stimulatedwith 20 μM FSK or DMSO (control) for 12 h before extraction. A) Westernblot of MITF protein levels. B) Q-RT-PCR of MITF mRNA normalized to18S. C) Q-RT-PCR of TYRP1 mRNA normalized to 18S. D) Q-RT-PCRanalysis of MITF mRNA in A06MLC cells transfected with either negativecontrol or MITF siRNA as indicated. Twenty-four hours after transfection,cells were stimulated with normal media plus 0.25% BSA (control), 10nM NDP-MSH in the presence of 100 μM IBMX (MSH) or 10 μM FSKfor a further 24 h. MITF mRNA was normalized to B2M mRNA, thenexpressed relative to negative control siRNA cells. Error bar represents±SEM (n = 3). E) Q-RT-PCR analysis of MITF mRNA in MM96L cellstransfected with negative control or MITF siRNA (Ambion) for 48 h. MITFmRNA was normalized to B2M mRNA, then expressed relative to controlcells. Error bar represents ±SEM (n = 3). F) Q-RT-PCR analysis of QF1160differentiated melanocytes transfected with either negative control or MITFsiRNA for 48 h. MITF mRNA was normalized 18S, then expressed relativeto the negative control. Error bar represents ±SEM (n = 3). F) Q-RT-PCRanalysis of QF1160 differentiated melanocytes transfected with eithernegative control or MITF siRNA for 48 h. TYRP1 mRNA was normalized18S, then expressed relative to the negative control. Error bar represents±SEM (n = 3).

Figure S3: Additional images of Rab17/Rab27a siRNA knockdown

cells, live imaging of melanosome movement. B16 cells were tran-siently transfected with negative control siRNA, Rab17 siRNA or Rab27asiRNA. Negative siRNA cells were also treated with 10 nM NDP-MSH asindicated. A) All cells were imaged via confocal microscopy. Scale bars rep-resent 10 μm. Merged images are of HMB45 Ab staining (melanosomes= green) and DAPI (blue). Accumulations of melanosomes can be seenin the Rab17 and Rab27a knockdown cells; however, they are not allmature, melanin-filled melanosomes as accumulations of HMB45-positivemelanosomes can still be seen in some unpigmented B16 cells (data notshown). B16 cells were transfected with (B) negative siRNA or (C) Rab17.1siRNA for 48 h, then pigmented granules were imaged over 1-secondintervals using bright field.

Figure S4: Recycling endosome and GFP-Rab11 localization in

melanocytic cells. A) Cells were imaged using the Personal Deltavisionmicroscope. Brightness and contrast was adjusted for each colour channelindividually in photoshop. Scale bars represent 20 μm. B16 melanoma,MM418 melanoma, MM96L melanoma and QF1236 primary melanocyteswere incubated with mouse Tfn-Alexa546 (Tfn-546) or human Tfn-Alexa647(Tfn-647) as indicated, then fixed for imaging. Arrows indicate perinuclearRE. B) MM418 melanoma cells, (C) MM96L melanoma and (D) QF863primary melanocytes were transiently transfected with GFP-Rab11a(green), then incubated with human Tfn-Alexa-647 (Tfn-647 – red). B andC) Cells were imaged via confocal microscopy. D) Cells were imaged usingthe Personal Deltavision microscope. Scale bars represent 10 μm, scalebar in the zoom box represents 5 μm. Note that Rab11 in all cell typesinduces more peripheral REs or REs concentrated at dendrite tips whencompared to untransfected cells (see Figure S4A).

Figure S5: Scanning EM assessment of filopodia in B16 Rab17 knock-

down cells stimulated with MSH. Scale bars represent 10 μm. B16 cellswere transiently transfected with the indicated siRNA for 24 h, then treatedwith 10 nM NDP-MSH (MSH) for a further 24 h. A) Representative scanningEM images of B16 cells from one experiment. Scale bar represents 10 μm.B) Quantification of the numbers of ‘smooth’ cells (five filopodia or less).C) Quantification of the numbers of ‘dense’ filopodia cells.

Please note: Wiley-Blackwell are not responsible for the content orfunctionality of any supporting materials supplied by the authors.Any queries (other than missing material) should be directed to thecorresponding author for the article.

References

1. Van Den Bossche K, Naeyaert JM, Lambert J. The quest for themechanism of melanin transfer. Traffic 2006;7:769–778.

2. Abdel-Malek Z, Swope VB, Suzuki I, Akcali C, Harriger MD, Boyce ST,Urabe K, Hearing VJ. Mitogenic and melanogenic stimulation ofnormal human melanocytes by melanotropic peptides. Proc Natl AcadSci U S A 1995;92:1789–1793.

3. Hunt G, Kyne S, Wakamatsu K, Ito S, Thody AJ. Nle4DPhe7 alpha-melanocyte-stimulating hormone increases the eumelanin:phae-omelanin ratio in cultured human melanocytes. J Invest Dermatol1995;104:83–85.

4. Hunt G, Todd C, Cresswell JE, Thody AJ. Alpha-melanocyte stimu-lating hormone and its analogue Nle4DPhe7 alpha-MSH affectmorphology, tyrosinase activity and melanogenesis in cultured humanmelanocytes. J Cell Sci 1994;107:205–211.

5. Passeron T, Bahadoran P, Bertolotto C, Chiaverini C, Busca R,Valony G, Bille K, Ortonne JP, Ballotti R. Cyclic AMP promotes aperipheral distribution of melanosomes and stimulates melanophilin/Slac2-a and actin association. FASEB J 2004;18:989–991.

6. Virador VM, Muller J, Wu X, Abdel-Malek ZA, Yu ZX, Ferrans VJ,Kobayashi N, Wakamatsu K, Ito S, Hammer JA, Hearing VJ. Influenceof alpha-melanocyte-stimulating hormone and ultraviolet radiationon the transfer of melanosomes to keratinocytes. FASEB J2002;16:105–107.

7. Chakraborty AK, Funasaka Y, Slominski A, Ermak G, Hwang J, PawelekJM, Ichihashi M. Production and release of proopiomelanocortin(POMC) derived peptides by human melanocytes and keratinocytesin culture: regulation by ultraviolet B. Biochim Biophys Acta 1996;1313:130–138.

8. Wintzen M, Yaar M, Burbach JP, Gilchrest BA. Proopiomelanocortingene product regulation in keratinocytes. J Invest Dermatol 1996;106:673–678.

9. Cui R, Widlund HR, Feige E, Lin JY, Wilensky DL, Igras VE, D’Orazio J,Fung CY, Schanbacher CF, Granter SR, Fisher DE. Central role ofp53 in the suntan response and pathologic hyperpigmentation. Cell2007;128:853–864.

10. Beaumont KA, Liu YY, Sturm RA. Chapter 4 The melanocortin-1receptor gene polymorphism and association with human skin cancer.Prog Mol Biol Transl Sci 2009;88C:85–153.

11. Cheli Y, Ohanna M, Ballotti R, Bertolotto C. Fifteen-year quest formicrophthalmia-associated transcription factor target genes. PigmentCell Melanoma Res 2010;23:27–40.

12. Stenmark H. Rab GTPases as coordinators of vesicle traffic. Nat RevMol Cell Biol 2009;10:513–525.

13. Wilson SM, Yip R, Swing DA, O’Sullivan TN, Zhang Y, Novak EK,Swank RT, Russell LB, Copeland NG, Jenkins NA. A mutation inRab27a causes the vesicle transport defects observed in ashen mice.Proc Natl Acad Sci U S A 2000;97:7933–7938.

14. Wu X, Rao K, Bowers MB, Copeland NG, Jenkins NA, Hammer JA3rd. Rab27a enables myosin Va-dependent melanosome capture byrecruiting the myosin to the organelle. J Cell Sci 2001;114:1091–1100.

15. Hume AN, Collinson LM, Hopkins CR, Strom M, Barral DC, Bossi G,Griffiths GM, Seabra MC. The leaden gene product is required withRab27a to recruit myosin Va to melanosomes in melanocytes. Traffic2002;3:193–202.

16. Wu XS, Rao K, Zhang H, Wang F, Sellers JR, Matesic LE, CopelandNG, Jenkins NA, Hammer JA 3rd. Identification of an organellereceptor for myosin-Va. Nat Cell Biol 2002;4:271–278.

17. Provance DW, James TL, Mercer JA. Melanophilin, the product of theleaden locus, is required for targeting of myosin-Va to melanosomes.Traffic 2002;3:124–132.

18. Fukuda M, Kuroda TS, Mikoshiba K. Slac2-a/melanophilin, the miss-ing link between Rab27 and myosin Va: implications of a tri-partite protein complex for melanosome transport. J Biol Chem2002;277:12432–12436.

19. Menasche G, Ho CH, Sanal O, Feldmann J, Tezcan I, Ersoy F,Houdusse A, Fischer A, de Saint Basile G. Griscelli syndromerestricted to hypopigmentation results from a melanophilin defect(GS3) or a MYO5A F-exon deletion (GS1). J Clin Invest 2003;112:450–456.

Traffic 2011; 12: 627–643 641

Beaumont et al.

20. Van Gele M, Dynoodt P, Lambert J. Griscelli syndrome: a modelsystem to study vesicular trafficking. Pigment Cell Melanoma Res2009;22:268–282.

21. Loftus SK, Larson DM, Baxter LL, Antonellis A, Chen Y, Wu X, JiangY, Bittner M, Hammer JA 3rd, Pavan WJ. Mutation of melanosomeprotein RAB38 in chocolate mice. Proc Natl Acad Sci U S A2002;99:4471–4476.

22. Wasmeier C, Romao M, Plowright L, Bennett DC, Raposo G, SeabraMC. Rab38 and Rab32 control post-Golgi trafficking of melanogenicenzymes. J Cell Biol 2006;175:271–281.

23. Tamura K, Ohbayashi N, Maruta Y, Kanno E, Itoh T, Fukuda M. Varpis a novel Rab32/38-binding protein that regulates Tyrp1 trafficking inmelanocytes. Mol Biol Cell 2009;20:2900–2908.

24. Chi A, Valencia JC, Hu ZZ, Watabe H, Yamaguchi H, Mangini NJ,Huang H, Canfield VA, Cheng KC, Yang F, Abe R, Yamagishi S,Shabanowitz J, Hearing VJ, Wu C, et al. Proteomic and bioinformaticcharacterization of the biogenesis and function of melanosomes. JProteome Res 2006;5:3135–3144.

25. Basrur V, Yang F, Kushimoto T, Higashimoto Y, Yasumoto K, ValenciaJ, Muller J, Vieira WD, Watabe H, Shabanowitz J, Hearing VJ,Hunt DF, Appella E. Proteomic analysis of early melanosomes:identification of novel melanosomal proteins. J Proteome Res2003;2:69–79.

26. Delevoye C, Hurbain I, Tenza D, Sibarita JB, Uzan-Gafsou S, Ohno H,Geerts WJ, Verkleij AJ, Salamero J, Marks MS, Raposo G. AP-1and KIF13A coordinate endosomal sorting and positioning duringmelanosome biogenesis. J Cell Biol 2009;187:247–264.

27. Sugawara K, Shibasaki T, Mizoguchi A, Saito T, Seino S. Rab11 and itseffector Rip11 participate in regulation of insulin granule exocytosis.Genes Cells 2009;14:445–456.

28. Reefman E, Kay JG, Wood SM, Offenhauser C, Brown DL, Roy S,Stanley AC, Low PC, Manderson AP, Stow JL. Cytokine secretion isdistinct from secretion of cytotoxic granules in NK cells. J Immunol2010;184:4852–4862.

29. Manderson AP, Kay JG, Hammond LA, Brown DL, Stow JL. Sub-compartments of the macrophage recycling endosome direct thedifferential secretion of IL-6 and TNFalpha. J Cell Biol 2007;178:57–69.

30. Khvotchev MV, Ren M, Takamori S, Jahn R, Sudhof TC. Divergentfunctions of neuronal Rab11b in Ca2+-regulated versus constitutiveexocytosis. J Neurosci 2003;23:10531–10539.

31. Hunziker W, Peters PJ. Rab17 localizes to recycling endosomes andregulates receptor-mediated transcytosis in epithelial cells. J BiolChem 1998;273:15734–15741.

32. Zacchi P, Stenmark H, Parton RG, Orioli D, Lim F, Giner A, Mellman I,Zerial M, Murphy C. Rab17 regulates membrane trafficking throughapical recycling endosomes in polarized epithelial cells. J Cell Biol1998;140:1039–1053.

33. Trowbridge IS, Collawn JF, Hopkins CR. Signal-dependent membraneprotein trafficking in the endocytic pathway. Annu Rev Cell Biol1993;9:129–161.

34. Harper DC, Theos AC, Herman KE, Tenza D, Raposo G, Marks MS.Premelanosome amyloid-like fibrils are composed of only golgi-processed forms of Pmel17 that have been proteolytically processedin endosomes. J Biol Chem 2008;283:2307–2322.

35. Raposo G, Tenza D, Murphy DM, Berson JF, Marks MS. Distinctprotein sorting and localization to premelanosomes, melanosomes,and lysosomes in pigmented melanocytic cells. J Cell Biol2001;152:809–824.

36. Lutcke A, Jansson S, Parton RG, Chavrier P, Valencia A, Huber LA,Lehtonen E, Zerial M. Rab17, a novel small GTPase, is specific forepithelial cells and is induced during cell polarization. J Cell Biol1993;121:553–564.

37. Newton RA, Smit SE, Barnes CC, Pedley J, Parsons PG, Sturm RA.Activation of the cAMP pathway by variant human MC1Ralleles expressed in HEK and in melanoma cells. Peptides2005;26:1818–1824.

38. Kuroda TS, Fukuda M. Rab27A-binding protein Slp2-a is requiredfor peripheral melanosome distribution and elongated cell shape inmelanocytes. Nat Cell Biol 2004;6:1195–1203.

39. Singh SK, Nizard C, Kurfurst R, Bonte F, Schnebert S, Tobin DJ. Thesilver locus product (Silv/gp100/Pmel17) as a new tool for theanalysis of melanosome transfer in human melanocyte-keratinocyteco-culture. Exp Dermatol 2008;17:418–426.

40. Misaki R, Nakagawa T, Fukuda M, Taniguchi N, Taguchi T. Spatialsegregation of degradation- and recycling-trafficking pathways inCOS-1 cells. Biochem Biophys Res Commun 2007;360:580–585.

41. Perret E, Lakkaraju A, Deborde S, Schreiner R, Rodriguez-Boulan E.Evolving endosomes: how many varieties and why? Curr Opin CellBiol 2005;17:423–434.

42. Murray RZ, Kay JG, Sangermani DG, Stow JL. A role for thephagosome in cytokine secretion. Science 2005;310:1492–1495.

43. Singh SK, Kurfurst R, Nizard C, Schnebert S, Perrier E, Tobin DJ.Melanin transfer in human skin cells is mediated by filopodia–a modelfor homotypic and heterotypic lysosome-related organelle transfer.FASEB J 2010;24:3756–3769.

44. Chiaverini C, Beuret L, Flori E, Busca R, Abbe P, Bille K, Bahadoran P,Ortonne JP, Bertolotto C, Ballotti R. Microphthalmia-associated tran-scription factor regulates RAB27A gene expression and controlsmelanosome transport. J Biol Chem 2008;283:12635–12642.

45. Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C,Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dum-mer R, Steingrimsson E. Novel MITF targets identified using atwo-step DNA microarray strategy. Pigment Cell Melanoma Res2008;21:665–676.

46. Busca R, Ballotti R. Cyclic AMP a key messenger in the regulation ofskin pigmentation. Pigment Cell Res 2000;13:60–69.

47. Westbroek W, Lambert J, Naeyaert JM. The dilute locus and Griscellisyndrome: gateways towards a better understanding of melanosometransport. Pigment Cell Res 2001;14:320–327.

48. Siegrist W, Eberle AN. In situ melanin assay for MSH using mouseB16 melanoma cells in culture. Anal Biochem 1986;159:191–197.

49. Zhang RZ, Zhu WY, Xia MY, Feng Y. Morphology of cultured humanepidermal melanocytes observed by atomic force microscopy.Pigment Cell Res 2004;17:62–65.

50. Shirane M, Nakayama KI. Protrudin induces neurite formation bydirectional membrane trafficking. Science 2006;314:818–821.

51. Sann S, Wang Z, Brown H, Jin Y. Roles of endosomal trafficking inneurite outgrowth and guidance. Trends Cell Biol 2009;19:317–324.

52. Menasche G, Pastural E, Feldmann J, Certain S, Ersoy F, Dupuis S,Wulffraat N, Bianchi D, Fischer A, Le Deist F, de Saint Basile G.Mutations in RAB27A cause Griscelli syndrome associated withhaemophagocytic syndrome. Nat Genet 2000;25:173–176.

53. Dell’Angelica EC, Shotelersuk V, Aguilar RC, Gahl WA, Bonifacino JS.Altered trafficking of lysosomal proteins in Hermansky-Pudlaksyndrome due to mutations in the beta 3A subunit of the AP-3adaptor. Mol Cell 1999;3:11–21.

54. Ma J, Plesken H, Treisman JE, Edelman-Novemsky I, Ren M. Lightoidand Claret: a rab GTPase and its putative guanine nucleotide exchangefactor in biogenesis of Drosophila eye pigment granules. Proc NatlAcad Sci U S A 2004;101:11652–11657.

55. Cheli VT, Daniels RW, Godoy R, Hoyle DJ, Kandachar V, Starcevic M,Martinez-Agosto JA, Poole S, DiAntonio A, Lloyd VK, Chang HC,Krantz DE, Dell’Angelica EC. Genetic modifiers of abnormal organellebiogenesis in a Drosophila model of BLOC-1 deficiency. Hum MolGenet 2010;19:861–878.

56. Beaumont KA, Shekar SL, Newton RA, James MR, Stow JL, DuffyDL, Sturm RA. Receptor function, dominant negative activity andphenotype correlations for MC1R variant alleles. Hum Mol Genet2007;16:2249–2260.

57. Beaumont KA, Newton RA, Smit DJ, Leonard JH, Stow JL, Sturm RA.Altered cell surface expression of human MC1R variant receptoralleles associated with red hair and skin cancer risk. Hum Mol Genet2005;14:2145–2154.

58. Leonard JH, Marks LH, Chen W, Cook AL, Boyle GM, Smit DJ,Brown DL, Stow JL, Parsons PG, Sturm RA. Screening of humanprimary melanocytes of defined melanocortin-1 receptor genotype:pigmentation marker, ultrastructural and UV-survival studies. PigmentCell Res 2003;16:198–207.

59. Cook AL, Chen W, Thurber AE, Smit DJ, Smith AG, Bladen TG,Brown DL, Duffy DL, Pastorino L, Bianchi-Scarra G, Leonard JH,Stow JL, Sturm RA. Analysis of cultured human melanocytes basedon polymorphisms within the SLC45A2/MATP, SLC24A5/NCKX5, andOCA2/P loci. J Invest Dermatol 2009;129:392–405.

60. Cook AL, Donatien PD, Smith AG, Murphy M, Jones MK, Herlyn M,Bennett DC, Leonard JH, Sturm RA. Human melanoblasts in culture:

642 Traffic 2011; 12: 627–643

Rab17 Regulates Filopodia and Melanosome Release

expression of BRN2 and synergistic regulation by fibroblast growthfactor-2, stem cell factor, and endothelin-3. J Invest Dermatol2003;121:1150–1159.

61. Takahashi H, Parsons PG. In vitro phenotypic alteration of humanmelanoma cells induced by differentiating agents: heterogeneouseffects on cellular growth and morphology, enzymatic activity, andantigenic expression. Pigment Cell Res 1990;3:223–232.

62. Fukuda M, Mikoshiba K. A novel alternatively spliced variant of synap-totagmin VI lacking a transmembrane domain. Implications for distinctfunctions of the two isoforms. J Biol Chem 1999;274:31428–31434.

63. Saegusa C, Tanaka T, Tani S, Itohara S, Mikoshiba K, Fukuda M.Decreased basal mucus secretion by Slp2-a-deficient gastric surfacemucous cells. Genes Cells 2006;11:623–631.

64. Jimenez M, Tsukamoto K, Hearing VJ. Tyrosinases from two differentloci are expressed by normal and by transformed melanocytes. J BiolChem 1991;266:1147–1156.

65. Kuroda TS, Fukuda M, Ariga H, Mikoshiba K. The Slp homology domainof synaptotagmin-like proteins 1-4 and Slac2 functions as a novelRab27A binding domain. J Biol Chem 2002;277:9212–9218.

66. Tsuboi T, Fukuda M. Rab3A and Rab27A cooperatively regulate thedocking step of dense-core vesicle exocytosis in PC12 cells. J CellSci 2006;119:2196–2203.

67. Itoh T, Satoh M, Kanno E, Fukuda M. Screening for target Rabs ofTBC (Tre-2/Bub2/Cdc16) domain-containing proteins based on theirRab-binding activity. Genes Cells 2006;11:1023–1037.

68. Newton RA, Cook AL, Roberts DW, Leonard JH, Sturm RA. Post-transcriptional regulation of melanin biosynthetic enzymes bycAMP and resveratrol in human melanocytes. J Invest Dermatol2007;127:2216–2227.

69. Abramoff M, Magelhaes P, Ram S. Image processing with ImageJ.Biophotonics Int 2004;11:36–42.

70. McComb T, Cairncross O, Noske AB, Wood DL, Marsh BJ, Ragan MA.Illoura: a software tool for analysis, visualization and semanticquerying of cellular and other spatial biological data. Bioinformatics2009;25:1208–1210.

Traffic 2011; 12: 627–643 643