There is more to tomato fruit colour than candidate carotenoid genes

Plant Biotechnology Journal (2003) 1, pp. 195–207

© 2003 Blackwell Publishing Ltd 195

Blackwell Publishing Ltd.

There is more to tomato fruit colour than candidate carotenoid genesYong-Sheng Liu1, Amit Gur1, Gil Ronen1,2, Mathilde Causse3, René Damidaux3, Michel Buret4, Joseph Hirschberg2 and Dani Zamir1,*1Department of Field and Vegetable Crops and The Otto Warburg Center for Biotechnology, Faculty of Agriculture, The Hebrew University of Jerusalem, PO Box

12, Rehovot 76100, Israel 2Department of Genetics, The Hebrew University of Jerusalem, Givat-Ram, Jerusalem 91904, Israel 3Station de Génétique et Amelioration des Fruits et Légumes, INRA, BP 94-84143 Montfavet-Cedex, France 4UMR Sécurité et Qualité des Produits d’Origine Végétale, INRA, Domaine St Paul, 84914 Avignon, Cedex 9, France

SummaryDetermining gene sequences responsible for complex phenotypes has remained a major

objective in modern biology. The candidate gene approach is attempting to link, through

mapping analysis, sequences that have a known functional role in the measured phenotype

with quantitative trait loci (QTL) that are responsible for the studied variation. To explore the

potential of the candidate approach for complex traits we conducted a mapping analysis of

QTL for the intensity of the red colour of the tomato fruit (mainly lycopene) and for probes

associated with the well-characterized carotenoid biosynthesis pathway. Seventy-five

tomato introgression lines (ILs), each containing a single homozygous RFLP-defined

chromosome segment from the green-fruited species Lycopersicon pennellii delimited 107

marker-defined mapping bins. Three of the bins resolved known qualitative colour

mutations for yellow (r) and orange (B and Del ) fruits resulting from variation in specific

carotenoid biosynthesis genes. Based on trials in different environments, 16 QTL that

modified the intensity of the red colour of ripe fruit were assigned to bins. Candidate

sequences associated with the carotenoid biosynthesis pathway were mapped to 23 loci.

Only five of the QTL co-segregated with the same bins that contained candidate genes – a

number that is expected by chance alone. Furthermore, similar map location of a QTL and

a candidate is far from a direct causative relationship between a gene and a phenotype. This

study highlights the wealth and complexity of the variation present in the genus

Lycopersicon that could be employed for basic research and genetic improvement of fruit

colour in tomato.

Received 28 January 2003;

revised 28 January 2003;

accepted 29 January 2003.

*Correspondence: Faculty of Agriculture, The

Hebrew University of Jerusalem, PO Box 12,

Rehovot 76100, Israel (fax +972 8 9468265;

e-mail [email protected])

Keywords: bin mapping, candidate

genes, carotenoid biosynthesis,

introgression lines (ILs), tomato, QTL.

Introduction

Genetic variation in nature usually takes the form of a

continuous phenotypic range rather than discrete classes. The

genetic variation underlying quantitative traits results from

the segregation of numerous interacting quantitative trait loci

(QTL) whose expression is modified by the environment.

Tomato has been the model system for the analysis of

complex genetic traits due to the development of a wide

range of introgressions of wild-species chromosome

segments in cultivated genetic background (Eshed and Zamir,

1995; Monforte and Tanksley, 2000). These interspecific

nearly isogenic or congenic populations offered a tool for

the identification of quantitative trait loci (QTL) that improve

yield (Eshed and Zamir, 1994) and for the map-based cloning

of two wild species QTL. Brix9-2-5 is a QTL that originates from

Lycopersicon pennellii and increases the glucose and fructose

content of the fruit. Brix9-2-5 was genetically delimited to

the third exon and intron of the tomato apoplastic invertase

gene, Lin5 (Fridman et al., 2000). This finding is consistent

196 Yong-Sheng Liu et al.

© Blackwell Publishing Ltd, Plant Biotechnology Journal (2003), 1, 195–207

with the sucrose cleaving function of the invertase enzyme –

and makes a good ‘candidate gene’ sense. On the other hand,

the QTL Fw2.2 that modifies fruit size turned out to be a

gene of unknown function that shares some motive similarity

with the human oncogene RAS (Frary et al., 2000). This gene

could not be identified through the candidate approach.

For genomes that have not yet been targeted for complete

sequence analysis, such as tomato, the framework for

associating gene sequences and phenotypes is a genetic

linkage-map. Our QTL mapping framework is based on an

introgression line (IL; Eshed and Zamir, 1995) population

composed of 75 L. esculentum (cv. M82) lines, each containing

a single RFLP-defined chromosome segment introgression

from the wild green-fruited species L. pennellii (LA 716)

(Pan et al., 2000). Each of the ILs is nearly isogenic to the

cultivated tomato variety and together the lines provide a

complete coverage of the tomato genome. The ILs partition

the tomato genome into 107 discrete marker defined mapping

bins with unique composition (average size 12 cM). The ILs

constitute a permanent seed and information resource for

associating complex phenotypes with specific bins that can

be tested in different environments and locations.

Carotenoids are one of the largest classes of pigments in

nature that play indispensable roles in photosynthesis as

accessory pigments for light-harvesting, and in preventing

photo-oxidative damage. Another important role of caroten-

oids in plants is the distinct pigmentation they provide to

flowers and fruits, which attract animals for pollination and

for seed dispersal. Most of the orange, yellow and red colours

found in the flowers, fruits and some other organs of many

higher plant species are due to the accumulation of caroten-

oids in the chromoplasts. The carotenoid biosynthesis path-

way was postulated over three decades ago by standard

biochemical analyses using labelled precursors, specific

inhibitors and mutant characterization. In recent years, genes

encoding nearly all of the enzymes in the carotenoid biosyn-

thesis pathway have been cloned from bacteria, fungi and

plants (reviewed in Hirschberg, 2001). The tomato fruit,

which mainly contains the red pigment lycopene, has been

a favourite model system for carotenoid research due to its

dramatic colour changes during ripening and the availability

of a range of colour mutants. The concentration of lycopene

in tomato fruit is an important feature for the processing and

fresh market industry; increasing lycopene content is there-

fore a main objective in tomato breeding. In this study, bin

map positions of QTL for internal fruit colour and carotenoid-

associated candidate sequences were compared, indicating

that a diverse network of processes control the intensity of

tomato fruit colour.

Results

Genetic variation for fruit colour phenotypes

The objective of this study was to identify genomic regions

that modify the intensity of the red colour of tomato fruits.

The L. pennellii IL population is an efficient resource for the

identification of fruit colour QTL for the following reasons:

(1) The donor wild species is green-fruited and therefore the

population is expected to carry a wide range of exotic genes

that modify fruit colour; (2) the genetic structure of the pop-

ulation ensures that each line is nearly isogenic to the original

L. esculentum variety (M82), and therefore a phenotypic

difference between an IL and M82 are associated with the

introgressed chromosome segment; (3) L. pennellii has an

exceptional drought tolerance allowing the evaluation of

fruit colour of ILs grown under normal and non-irrigated

conditions. We hypothesized that if certain colour QTL are

consistently identified under such extremely different environ-

ments they must represent genomic regions with a solid effect

on the measured phenotype.

The internal fruit colour of the 75 ILs was evaluated under

the irrigated and non-irrigated treatments, with a high

correlation between the two field environments (r = 0.81).

The frequency distribution of the mean internal colour rating

from the two irrigation regimes was continuous, except for

bins 3C, 6E and 12C, which were previously characterized

as harbouring the single gene mutations that alter carote-

noid composition: yellow-flesh (r; Fray and Grierson, 1993),

high Beta (B; Ronen et al. 2000) and high Delta (Del; Ronen

et al. 1999), respectively (Figure 1). The internal colour

frequency distribution clearly differentiated between the

three qualitative variants and the rest of the lines located in

the continuous distribution for quantitative differences in red

colour intensity. Fruit lycopene content was assayed on the

population grown in a third environment in France and

was continuous except for IL3-2 and IL12-2 (IL6-2 and IL6-3

harbouring B were not evaluated). Trait distributions for

carotene content and for the chromameter measurements

L*, a* and b* also indicated that the lines containing the

single gene mutations r and Del were outside the range of the

normal curve.

We detected significant genetic correlations among the 10

colour phenotypes analysed on the ILs, as detailed in Table 1.

External and internal colours were highly correlated both in

the wet and dry environments and so were the internal colour

ratings in the two irrigation treatments. The strong colour

rating correlations between the dry and wet treatments

prompted us to calculate the mean internal colour rating and

Tomato colour QTL and candidate genes 197


Figure 1 Frequency distribution for fruit colour traits measured on the L. pennellii ILs. The %-value on the x-axis represents the value of the common control, M82, and the population means are indicated by black arrows.

Table 1 Significant (P < 0.001) correlations between colour related traits in the L. pennellii IL populations. The sign of the correlation coefficient indicates the direction of the correlation

EC-D EC-W IC-D IC-W IC-M lycopene carotene L* a* b*

EC-W 0.84

IC-D 0.81 0.74

IC-W 0.72 0.87 0.81

IC-M 0.80 0.85 0.94 0.96

lycopene 0.56 0.60 0.67 0.63 0.69

carotene −0.34 −0.31 −0.33 N.S. −0.31 N.S.

L* −0.68 −0.76 −0.64 −0.73 −0.73 −0.72 N.S.

a* 0.44 0.46 0.44 0.42 0.46 0.69 N.S. −0.74

b* −0.50 −0.61 −0.55 −0.62 −0.62 −0.57 N.S. 0.77 −0.48

EC = external colour, IC = internal colour, D = non-irrigated, W = irrigated, M = mean effect.



compare it to the fruit colour parameters measured for the

same lines, independently grown in France. The mean inten-

sity of the internal red colour of the fruits was highly positively

correlated to lycopene content (0.69) and showed a strong

negative correlation with L* (−0.73). These results also dem-

onstrate that the L. pennellii ILs provide a rich permanent

resource that permits a reproducible scoring of the colour

phenotypes in different locations.

Mapping of fruit colour QTL

Nineteen genomic regions were associated with modifica-

tions in the intensity of the red internal colour (Table 2). IL2-

1 and IL2-2, that had a lower colour rating than M82, defined

the QTL ic-2C (Figure 2). IL2-1 had a mean rating that was

27% lower than M82 in the wet treatment and 14% lower

(not significant) than the control in the dry treatment. The

IC %m82

Limits

(in cM)Locus ILs Dry Wet Mean QTL value

ic-2C IL2-1 −14 −27** −21** −22 3

IL2-2 −20** −24** −22**

ic-2K IL2-5 38** 5 21** 21 21

IL2-6 31** 27** 30**

ic-2L IL2-6-5 22** 14 19** 19 3

r (ic-3C ) IL3-2 −71** −75** −73** −73 28

ic-4F IL4-3-2 −18** −15* −16** −16 5

IL4-3 −12 9 1

ic-4H IL4-4 43** 16* 29** 29 20

ic-6A IL6-1 17* 11 15** 15 22

B (ic-6E) IL6-2 −28* −26** −27** −35 8

IL6-3 −59** −58** −42**

ic-7B IL7-4 −19* −28** −23** −23 7

IL7-4-1 −24** −33** −28**

IL7-5 −8 −35** −22**

IL7-5-5 N.T. −19* −19*

ic-7F IL7-2 0 23** 13** 13 19

IL7-3 8 16** 13**

ic-8C IL8-1 27** 25** 26** 26 2

ic-8E IL8-2-1 −16 −18** −17** −17 18

IL8-2 −9 0 −3

ic-8F IL8-3 8 22** 16** 16 20

ic-9G IL9-2 8 22** 16** 18 7

IL9-2-6 15 22** 19**

ic-10B IL10-1 29** 27** 28** 28 24

ic-10E IL10-2 −35** −32** −33** −34 19

IL10-2-2 −33** −36** −34**

ic-11B IL11-1 29** 7 18** 20 11

IL11-2 31** 11 21**

Del (ic-12C ) IL12-2 −65** −64** −65** −65 9

ic-12H IL12-4 −21** −31** −26** −26 6

Significant at *P < 0.05 level; significant at **P < 0.01 level.

Table 2 Fruit internal colour (IC) QTL identified in non-irrigated and irrigated fields (as percentage of M82). Mean QTL effect derived from the two enviromnents and QTL value (– indicates lower than M82) are delimited to their corresponding bin sizes

Figure 2 The L. pennellii IL bin map composed of 75 lines and 107 bins. The chromosomes are drawn as open bars and the L. pennellii introgressed segments appear as solid bars to the left of the chromosomes. The boundary markers of each introgressed segment and bins definition are detailed in the Solanaceae Genome Network <http://www.sgn.cornell.edu/>. All ILs are homozygous for the introgressed segment, except for part of IL8-1 (dashed line). The bins for each chromosome are designated by capital letters and indicate a unique area of IL overlap and singularity. The bin locations of the sequences associated with carotenoid biosynthesis (Table 3) are indicated (underlined) to the left of the chromosomes as well as cloned single-gene fruit colour mutations (in parenthesis). The bin location of the fruit colour QTL is indicated to the right of the chromosomes. QTL designations are: ic – internal colour, ly – lycopene, car – carotene, L* – lightness, a* – chromaticity and b* – chromaticity. QTL names include their chromosome bin position and the number in parentheses that follows the QTL indicates the percentage difference from the common control (M82) where a (+) designates a QTL that improves the colour phenotype.

http://www.sgn.cornell.edu/





Figure 2 Continued.



observation that IL2-2 had significantly lower ratings than the

control in both environments delimited the QTL to an approx-

imately 3 cM region overlapping between the two lines,

designated to bin-2C. A combined colour analysis in the two

environments showed a similar reduced rating for IL2-1 and

IL2-2, whose mean defined the phenotypic value of the QTL

ic-2C (22% lower than M82). The QTL ic-2K and ic-2L both

improved fruit colour relative to the control and were defined

by IL2-5, IL2-6 and IL2-6-5. IL2-6 had the largest effect in

improving fruit colour in both environments while IL2-5 and

IL2-6-5 only showed a significant increase in the dry treat-

ment. IL2-5 and IL2-6-5 have no overlapping introgression

and based on this result we assigned two QTL to the long arm

of chromosome 2. IL3-2, carrying the mutation yellow flesh

(r), defined a genomic region that dramatically reduced the

colour rating in the dry and wet fields. IL4-3-2 had signifi-

cantly lower colour under the two irrigation regimes and IL4-

4 showed the highest colour improvement in the population.

However, IL4-3, which partially overlaps the above two lines,

was neutral in its effect on colour. These results suggest that

at least two QTL reside on IL4-3, ic-4F with a negative effect

and ic-4H that improves colour. The next QTL mapped to the

short arm of chromosome 6 (ic-6A) where its effects were

only highly significant in the combined analysis. The reduc-

tion in the internal colour observed in IL6-2 and IL6-3 was due

to the gene Beta (B) that increases β-carotene in the fruit at

the expense of lycopene (Ronen et al., 2000). Four overlap-

ping lines defined the ic-7B that reduced colour, while ic-7F

was only effective in the wet environment. Three QTL were

defined to chromosome 8: ic-8C mapped to a small genetic

segment (2 cM) that can only be maintained in a hetero-

zygous condition in IL8-1. A resolution of the two linked QTL,

ic-8E and ic-8F, was based on a similar rationale as for the

linked loci on the long arm of chromosome 4. ic-9G had its

strongest effects in the wet environment, and on chromo-

some 10 two major QTL were defined; ic-10B improving

colour and ic-10E is the QTL with the largest reducing effect

on internal colour in the population. Ic-11B was mostly effec-

tive under dry conditions, while ic-12C (the mutation Delta;

Ronen et al. 1999) and ic-12H were detected under both

environments.

In summary, of the 19 genomic regions that affected fruit

colour, three were attributed to known single gene muta-

tions while the other 16 regions were defined as QTL that

affect the intensity of the red colour of the fruit. Of these QTL,

10 showed transgressive segregation where alleles from the

green-fruited species improved the intensity of the red colour

of the fruits (Figure 2). For six QTL we detected significant

effects on colour, both in the dry and wet treatments, while

nine additional QTL (ic-2C, ic-2K, ic-2L, ic-6A, ic-7B, ic-8E,

ic-8F, ic-9G, ic-11B) exhibited similar trends in the direction

of the QTL effect, although significance was only detected for

a single environment. One QTL, ic-7F, only seemed to affect

colour in one of the environments. For the colour parameters

measured in France, we identified five QTL that modified

lycopene content, two of which landed in the same bin as the

internal colour QTL. One QTL was mapped for β-carotene

content and located in a bin that modified internal fruit

colour. Six QTL were detected for L*, out of which four were

located to bins that affected internal colour. In accordance

with the negative relationship calculated for internal colour

and L* (Table 1), QTL that were found to improve the intensity

of the red colour were associated with reduced L* readings,

and vice versa. Ten QTL were mapped for a*, out of which seven

corresponded to loci that affected internal colour. Overall,

the internal colour scores of the ILs were consistent in the dry

and wet field environments and generally with the colour

measurements that were obtained in France. These results

provide a strong credibility to the subjective internal colour

scores and the QTL that modulate this phenotype.

Mapping the candidate carotenoid sequences

Genes associated with the carotenoid biosynthetic pathway

are obvious candidates for QTL that modify the intensity of

the red colour and lycopene content of the fruit. The carote-

noid biosynthesis pathway is presented in Figure 3 (reviewed

by Hirschberg, 2001) and the genes that encode the carote-

noid associated enzymes that were used as RFLP probes

are summarized in Table 3. Plant carotenoids are 40-carbon

isoprenoids that are built from the 5-carbon compound

isopentenyl diphosphate (IPP). IPP is produced in the ‘DOXP

pathway’ from pyruvate and glyceraldehyde-3-phosphate.

In plants, carotenoids are synthesized within the plastids by

enzymes that are nuclear encoded. The first part of the

isoprenoid pathway up to GGPP serves the biosynthesis of

numerous essential compounds. Three different enzymes

utilize DMAPP and IPP to produce geranyl diphosphate (GPP),

farnesyl diphosphate (FPP) and geranylgeranyl diphosphate

(GGPP), which is the substrate for carotenoids. Two phytoene

synthase enzymes, which carry out the first committed step

in carotenoid biosynthesis, exist in tomato, PSY2 is expressed

in green tissues and PSY1 is highly expressed exclusively in

flowers and fruits. The 40 carbon phytoene undergoes dehy-

drogenation by two enzymes, PDS and ZDS, to give lycopene,

which is the red carotenoid that accumulates in fruits. These

reactions involve an electron transfer that requires the plastid

terminal oxydase (PTOX). β-carotene and δ-carotene are



formed by cyclization reactions at the ends of the lycopene

molecules and the hydroxylation and epoxidation that follow

produce the various xanthophylls (Figure 3).

In an attempt to resolve as many loci as possible, we used

low stringency hybridization conditions as well as ortholo-

gous probes from Arabidopsis and pepper. For GGPS, ZDS,

ZEP and CCS (which is the orthologue of CYC-B) the probes

originating from pepper and Arabidopsis generated identical

results to the tomato clones. In addition to the carotenoid

biosynthesis pathway genes, four additional candidates were

mapped that may be associated with colour development:

(1) Farnesyl diphosphate synthase (FPS) operates early in the

isoprenoid pathway by catalysing the sequential condensation

of two molecules of IPP with one molecule of DMAPP to pro-

duce C15 farnesyl diphosphate. (2) Geranylgeranyl diphosphate

reductase (GGPR) converts GGPP to phytyl diphosphate in the

tocopherols biosynthesis pathway and may affect carotenoid

biosynthesis through competition with PSY for GGPP. (3) Plastid

Figure 3 The carotenoid biosynthesis pathway in tomato. Abbreviations of intermediates and enzymes: CCS, capsanthin-capsorubin synthase; CRTISO, carotenoid isomerase; CRTR-B, β-ring hydroxylase, CRTR-E, ε-ring hydroxylase; CYC-B, chromoplast-specific lycopene βcyclase; DMAPP, dimethylallyl diphosphate; FPP, farnesyl diphosphate; FPS, farnesyl diphosphate synthase; GA3P, Glyceraldehyde-3-phosphate; GPP, geranyl diphosphate; GGPP, geranylgeranyl diphosphate; GGPR, geranylgeranyl diphosphate reductase; GGPS, GGPP synthase; GPS, geranyl diphosphate synthase; IPI, IPP isomerase; IPP, isopentenyl diphosphate; LCY-B, lycopene β-cyclase; LCY-E, lycopene ε-cyclase; NXS, neoxanthin synthase; PDS, phytoene desaturase; PPP, phytyl diphosphate; PQ, plastoquinone; PSY, phytoene synthase; PTOX, plastid terminal oxydase; VDE, violaxanthin de-epoxidase; VNCED, 9-cis-epoxycarotenoid dioxygenase; ZDS, ζ-carotene desaturase; ZEP, zeaxanthin epoxidase. Mutations in tomato that alter carotenoid biosynthesis are indicated in parentheses: B, Beta; Del, Delta; og, old-gold; gh, ghost; r, yellow-flesh; t, tangerine; Y, yellow-fruit (in pepper).

Table 3 Mapped carotenoid associated cDNAs, their accession numbers and bin-map positions

Probed

gene Encoded enzyme

Accession

number

Bin location

and size (cM) Reference

CRTISO Carotenoid isomerase AF416727 10E (19) Issacson et al. (2002)

CRTR-B β-carotene hydroxylase Y14810 2A (2), 3C (28), 6A (22) Ronen et al. (in prep.)

CYC-B Lycopene β-cyclase, B (in chromoplasts) AF254793 6E (8) Ronen et al. (2000)

FPS Farnesyl diphosphate synthase AI485064 10A (12) Gaffe et al. (2000)

GGPR Geranylgeranyl diphosphate reductase AI484190 3F (32) van der Hoeven et al. (2002)

GGPS Geranylgeranyl diphosphate synthase BE432698 4H (20) van der Hoeven et al. (2002)

IPI Isopentenyl diphosphate isomerase AI488740 4E (15), 11D (15) van der Hoeven et al. (2002)

LCY-B Lycopene β-cyclase X86452 4E (15), 10E (19) Pecker et al. (1996)

LCY-E Lycopene ε-cyclase Y14387 12C (9) Ronen et al. (1999)

PAP Plastid-lipid-associated protein Y15490 2A (2), 2H (2) Pozueta-Romero et al. (1997)

PDS Phytoene desaturase X59948 3G (3) Pecker et al. (1992)

PSY Phytoene synthase Y00521 3C (28), 2H (2) Ray et al. (1992)

tDET-1 Phytochrome signalling pathway AJ222798 1D (48) Mustilli et al. (1999)

VDE Violaxanthin de-epoxidase AI483033 4E (15) van der Hoeven et al. (2002)

VNCED Xanthophyll cleavage enzyme Z97215 7F (19) Burbidge et al. (1999)

ZDS ζ-carotene desaturase AF195507 1G (24) Bramley, unpublished

ZEP Zeaxanthin epoxidase Z83835 2K (21) Burbidge et al. (1997)



lipid-associated protein (PAP) is involved in carotenoid packaging

in the chromoplast and may play a role in colour development

in the fruit. (4) Tomato de-etiolated-1 (tDET1) functions in the

phytochrome signal transduction pathway and is responsible

for the high lycopene accumulating mutant high-pigment-2

(Mustilli et al., 1999).

Co-segregation of internal colour QTL and candidate

genes

To evaluate whole genome associations of QTL that modify

the intensity of the red colour and candidate genes we tested

the co-occurrence of the two groups in map intervals defined

by the 107 mapping bins (average size 12 cM). Qualitative

variation for internal fruit colour is evident from the frequency

distribution (Figure 1), where bins 3C, 6E and 12C carried

carotenoid biosynthesis genes that modified the carotenoid

composition of the fruit. These bins and the candidate loci

that map to them were excluded from the analysis since they

represent non-red phenotypes, while our focus has been

those QTL that modify the intensity of the red colour of

the fruit. The bin position of 16 QTL cover a total length of

208 cM, while the whole genome covers 104 bins that span

1155 cM of the 1200 cM of the tomato genetic map (r, B and

Del were excluded; Table 2; Figure 2). Nineteen candidate

carotenoid-associated loci were mapped to 14 independent

bins, of which five contained QTL for the intensity of the

red colour of the fruit (2K, 4H, 6A, 7F and 10E). Assuming

that the candidate genes are randomly distributed along the

tomato genome we would expect to find 0.016 candidates

per cM (19/1155) and for the 208 cM, to which the QTL were

mapped, the expectation is 3.4 candidates (208 × 0.016).

This number is very close to the observed value of five

co-segregating QTL and candidate genes (χ2 = 0.43, 1 d.f., P = 0.5)

indicating that the potential of the candidate genes to explain

the QTL variation is no more than would be expected by

chance alone.

Discussion

Fruit colour mutations in tomato

Ripe tomato fruits of the M82 variety are composed of

approximately 75% lycopene and the rest is mainly β-carotene

and phytoene (Fraser et al., 1994; Isaacson et al., 2002).

The recessive allele yellow flesh (r; bin 3C ) results from a loss-

of-function mutation in the phytoene synthase gene (PSY-1),

which catalyses the first committed step in carotenoid synthe-

sis, and as a result the fruits do not accumulate lycopene (Fray

and Grierson, 1993). The orange colour of the partially dom-

inant alleles of Del (high δ-carotene; bin 12C ) and B (high β-

carotene; bin 6E ) result from higher expression during fruit

ripening of the wild species alleles for lycopene ε-cyclase

(LCY-E) and lycopene β-cyclase (LCY-B) (Ronen et al., 1999,

2000). The distinctness of r, B and Del is evident from the

frequency distribution plots (Figure 1) where the appropriate

lines are located outside the normal distributions. The amino

acid sequence of the lycopene β-cyclase encoded by B (CYC-

B) is similar to the capsanthin-capsorubin synthase (CCS) in

pepper, which produces the red xanthophylls in the wild-type

fruits (Hugueney et al., 1995; Thorup et al., 2000). A reces-

sive mutation (y) in the CCS of pepper is responsible for the

yellow fruit phenotype (Lefebvre et al., 1998). These results

from tomato and pepper are consistent with the observation

that CCS, when expressed in E. coli, exhibits some activity of

lycopene β-cyclase (Hugueney et al., 1995). Cloning of the

tomato mutation tangerine, which accumulates the orange

pigment poly-cis lycopene (prolycopene), revealed a caroten-

oid isomerase essential for the production of β-carotene and

xanthophylls (Isaacson et al., 2002). The strong interaction of

carotenoid biosynthesis genes with fruit colour variation in the

tomato is further indicated by the transgenic over-expression

of enzymes in the pathway (Dharmapuri et al., 2002; Fraser

et al., 2002; Ronen et al., 2000; Rosati et al., 2000). The above

results support the strong candidate position of carotenoid

genes for qualitative variation in fruit colour phenotypes.

It is important to note that other genes, not directly

involved in the carotenoid pathway, can dramatically modify

the carotenoid content of the tomato fruit. Tomato de-

etiolated 1 (tDET-1; bin 1D) is the tomato homologue of Det1

from Arabidopsis, a gene that functions in the phytochrome

signal transduction pathway which regulates various

developmental processes, including those affecting plastids

(Mustilli et al., 1999). A mutation in tDet-1 is responsible for

the phenotype of high lycopene accumulation in the fruits of

high-pigment-2 (hp-2), probably due to an increase in the

number of plastids and their capacity to synthesize and store

carotenoids. Furthermore, fruit-localized phytochromes regulate

light-induced lycopene accumulation independently of

ethylene biosynthesis (Alba et al., 2000). Fruit ripening pro-

cesses can influence carotenoid content, as exemplified by the

ripening-inhibitor (rin) mutation in a MADS-box transcription

factor that regulates fruit maturation (Vrebalov et al., 2002).

Plants homozygous for the recessive mutation rin develop

very little of the red pigment lycopene. Other ripening related

mutations and transgenic plants were also shown to affect

colour development (Reviewed by Giovannoni, 2001). This

short list of genes that affect fruit colour in tomato establish



the links of the carotenoid pathway to a network of develop-

mental processes in the fruit.

Transgressive segregation of fruit colour QTL

Wild germplasm provides a rich resource for both qualitative

and quantitative variation in many important plant traits.

Marker and phenotypic analyses of segregating populations

involving crosses of the cultivated tomato with its wild

relatives revealed numerous QTL that modify fruit colour.

The small red-fruited species L. pimpinellifolium is rich in

lycopene, with values five-fold higher than in the cultivated

tomato. Eight QTL that modify lycopene content in the fruit,

including a major QTL accounting for 12% of the total phe-

notypic variation, were identified in a segregating population

involving L. pimpinellifolium (Chen et al., 1999). Advanced

backcross analysis involving a different accession of L.

pimpinellifolium identified five QTL that modify fruit colour

intensity (Tanksley et al., 1996). Of the 13 QTL identified in

the red-fruited species crosses, 10 had a significant effect on

improving colour. In a population derived from a cross with

a L. esculentum var. cerasiforme, Saliba-Colombani et al.

(2001) mapped three QTL for L*, a* and b* colour parame-

ters, two QTL for lycopene and three for carotene content.

The cherry tomato alleles improved the traits in all the cases.

Advanced backcross populations involving crosses with three

green-fruited species were scored for different fruit colour

parameters. In an L. hirsutum population (Bernacchi et al.,

1998), 15 QTL were identified, of which eight were associ-

ated with improved colour. In an L. peruvianum cross, 15 fruit

colour QTL were detected, three of which improved fruit

colour (Fulton et al., 1997). An L. parviflorum cross was analysed

for a range of fruit colour phenotypes and of the 42 QTL

identified, 18 improved the red pigmentation of the fruit

(Fulton et al., 2000). In summary, in the three crosses involving

tomato species that do not develop red fruits, QTL originated

in the wild parent were associated with improved colour.

These studies and the results presented in this paper highlight

the transgressive variation in wild germplasm and its potential

for tomato breeding and in basic research of fruit colour

development. The tomato IL ‘exotic library’ should encourage the

construction of similar populations for other crop plants as a

source of naturally selected phenotypic variations (Zamir, 2001).

Candidate genes and pleiotropic effects on fruit

colour QTL

In this study we employed IL bin-mapping to explore the rela-

tionship between genes involved in carotenoid biosynthesis

and QTL that regulate fruit colour. Based on the mapping

intervals, 19 genomic regions that affect the intensity of the

red colour of the fruit and 23 carotenoid-associated loci were

identified. After eliminating the three qualitative colour

mutants and their corresponding bins and candidates from

the analysis, we assayed for independence of segregation of

the 16 QTL that were within the range of the continuous

distribution presented for internal colour (Figure 1). The QTL

and candidates were largely independent, since the simultaneous

occurrence of the two in the same genetic interval does not

occur more often than is expected by chance. Furthermore,

11 QTL were located in bins with no mapped carotenoid-

related sequences. However in five intervals there was an

overlap for genomic segments that carry hundreds of genes

(Van der Hoeven et al., 2002) many of which may affect fruit

colour, either directly or indirectly. The QTL ic-4H is conserved

in nearly isogenic lines (NILs) derived from a number of

tomato wild species crosses (Monforte et al., 2001). The

chromosome 4 segment was associated with a range of

agronomic traits including yield, total soluble solids content

(Brix), fruit weight and epidermis reticulation (Eshed and Zamir,

1995). Fine mapping of the QTL using L. hirsutum NILs

delimited the internal colour effect to 2–3 cM interval (additive

effect a = 30%; Monforte et al., 2001). Substitution mapping

assisted in resolving the issue of linkage vs. pleiotropy by

separating the QTL in the region to single independent locus.

Ic-4H could represent a regulatory gene of the carotenoid

pathway or a potential variant in geranylgeranyl diphosphate

synthase (GGPS; bin 4H). This enzyme is a member of a closely

related family of prenyl transferases. It catalyses the sequen-

tial condensation of three molecules of IPP with one molecule

of DMADP to produce the C20 molecule geranylgeranyl

diphosphate (GGPP), which is the backbone of the caroten-

oid molecule. The 20% colour improvement associated with

ic-2K could result from a pleiotropic effect exerted by the fruit

weight allele of L. pennellii (fw2.2) that reduced fruit weight

in 20% (Frary et al., 2000). The strong negative correlation

observed between fruit weight and lycopene content (r =

−0.46, P < 0.01, data not shown; Chen et al., 1999; Saliba-

Colombani et al., 2001) suggests that the colour variation

could be partly due to the pleiotropic effects of fruit weight

QTL. Smaller fruits may produce the same amount of lyco-

pene as normal fruits, and as a result increase the parameter

of lycopene/fresh fruit weight (reflected by ly.2K; Figure 2).

The other candidate for ic-2k is ZEP, however, this enzyme

operates a few steps after lycopene production and is not

likely to control the amount of lycopene in fruits.

The candidate gene approach has been efficient for the

identification of sequences that regulate major fruit colour



loci, but not for the quantitative variation of red colour and

the regulation of pigment accumulation. This paper presents

a genetic framework for further elucidation of fruit colour

development through physiological studies, map based

cloning and validation by genetic transformation. The results

of this and other studies (Byrne et al., 1996; Kliebenstein et al.,

2001; Pflieger et al., 2001) are consistent with the concept

that network relationships are an appropriate perspective

to approach the complex reality of QTL biology.

Experimental procedures

Plant material

The IL population is composed of 75 lines, each containing a

single introgression from L. pennellii (LA 716) in the genetic

background of the processing tomato variety M82 (Pan et al.,

2000; http://www.sgn.cornell.edu/ ). For colour analysis the

lines were planted in the field in Akko, Israel (2000), in a com-

pletely randomised design under two irrigation treatments.

Seven plants of each homozygous IL and 100 plants of M82

were transplanted under each irrigation treatment. IL8-1 is

the only line that could not be maintained in a homozygous

condition, and therefore plants heterozygous for the intro-

gression IL8-1 were selected using the RFLP marker TG16.

Seedlings (35 days old) were transplanted in the field with

50 cm between plants and 2 m between rows (1 m2 per plant).

All the plants were sprinkler-irrigated at the transplanting

day with 30 m3 of water for 1000 m2 of field area. For the

rest of the growing period, the wet treatment was drip-

irrigated with 250 m3 of water for 1000 m2, while no

water was applied to the dry treatment.

The IL population was planted in Sonito, Avignon (France)

during summer 2000, in a three-block trial under irrigated

conditions. Each block contained the 70 lines (6 plants per

plot) and four plots of M82 as a control (lines IL1-1-3, IL3-3,

IL6-2, IL6-2-2 and IL6-3 were not planted). Fully ripe fruits

were harvested and a total of 21 fruits per plot were used for

the colour analyses.

Colour phenotyping

In the Israeli trial, at the time of harvest, 10 ripe fruits from

each replicated genotype were randomly sampled. Five fruits

were sliced open transversely and another five longitudinally.

Internal fruit colour was visually evaluated using a scale of

one to five (1 = yellow, 2 = orange, 3 = light red, 4 = red, 5

= dark red). Higher scores indicate a more intense red colour.

In the French trial, external colour was measured by a

Minolta chromameter which resulted in three parameters:

lightness (L*), and the chromaticity coordinates a*, a green-

to-red scale, and b*, a blue to yellow scale (Arias et al.,

2000; Saliba-Colombani et al., 2001). The fruits were then cut,

frozen and powdered in liquid nitrogen, and lycopene and

carotene were extracted in acetone and petroleum benzene.

The amounts were then evaluated spectrophotometrically

according to Lime et al. (1957).

cDNA clones used for mapping

The tomato cDNA clones and their accession numbers are

listed in Table 3. For genes identified based on homology in

the tomato EST database <http://www.sgn.cornell.edu/> and

for which we did not have the corresponding cDNAs, we

designed primers for amplification of cDNA fragments by RT-

PCR (Ronen et al., 1999).

The primer sequences were: for FPS: CAAAAGGT-

TGGGATGATTGC (f) and CTCTGGGTCAGCAAAGCAG (r),

amplifying a 393 bp fragment; for GGPR: GGCCAACATA-

CAAGGTGCTT (f) and CATGAAATTCGATAAAAGGCATA

(r), amplifying a 326 bp fragment; for IPI: CTGGTGGATGA-

GAATGACCA (forward) and CCTCAGCAACTTCATCTGGA

(reverse), amplifying a 448 bp fragment; for PAP: CGAA-

GAACCCTAATCCAGCA (f ) and GTACCTGCAGTGTTCCAGCA

(r), amplifying a 604 bp fragment; for tDET-1: CCATTCA-

TTTCGCAAGTTCA (f ) and TTGTGGAAAACCCTTTCGTC

(r), amplifying 399 bp fragment; for VDE: AATTGAATAA-

TGGCGCTTGC (f) and TCAGCCTTTGAAGCAACTGA (r),

amplifying a 407 bp fragment; for VNCED: TCAATGCC-

ATCATCAAAGGA (f ) and TTGGGTATTTTTCCGGTGAC (r),

amplifying a 403 bp fragment; for ZEP: TTATTCGGACCCAG-

TGAAGC (f) and CATCAGAGGCATTCCCAAGT (r), amplifying

a 703 bp fragment.

Restriction fragment length polymorphism (RFLP)

analysis

The IL map was connected to the high-resolution F2 map

composed of 1500 markers (Tanksley et al., 1992) by probing

all of the specific chromosome lines with the RFLP markers

from the framework F2 map. A total of 614 markers were

probed, and the ends of the introgressions were mapped

with the resolution of the F2 map. The entire IL population

was probed with carotenoid genes and PCR products

(Table 3). Genomic DNA extraction, digestion and hybridiza-

tion were as previously described (Eshed and Zamir, 1995).

Low and high-stringency analysis was performed for all probes

according to the methods of Zamir and Tanksley (1988).





Statistical analyses and QTL mapping

Statistical analyses were performed using the JMP V.4

software package for Macintosh (SAS Institute, 2000). Mean

values for the parameters measured for the tested genotypes

were compared to the common control (M82) using the ‘Fit

Y by X’ function and ‘Compare with control’ with an α-level

of 0.05 (Dunnet). All calculations were performed with

the phenotypic values, while the results are presented as a

percentage difference from M82. The basic pre-requisite for

mapping a QTL to a specific bin was that all the ILs that

included this bin had a significant effect on the phenotype in

the same direction relative to the control.

Acknowledgements

Many thanks to R. Matthieu and M. Lensel for their technical

support, and to SONITO for the field trial in France. This work

was supported in part by The French–Israeli Association for

Scientific and Technological Research (AFIRST).

References

Alba, R., Cordonnier-Pratt, M.M. and Pratt, L.H. (2000) Fruit-localizedphytochromes regulate lycopene accumulation independently ofethylene production in tomato. Plant Physiol. 123, 363–370.

Arias, R., Tung-Ching, L., Logendra, L. and Janes, H. (2000) Corre-lation of lycopene measured by HPLC with the L*, a*, b* colourreadings of a hydroponic tomato and the relationship of maturitywith colour and lycopene content. J. Agric. Food Chem. 48,1697–1702.

Bernacchi, D., Beck-Bunn, T., Eshed, Y., Lopez, J., Petiard, V., Uhlig, J.,Zamir, D. and Tanksley, S. (1998) Advanced backcross QTLanalysis in tomato. I. Identification of QTL for traits of agronomicimportance from Lycopersicon hirsutum. Theor. Appl. Genet. 97,381–397.

Burbidge, A., Grieve, T.M., Jackson, A., Thompson, A., McCarty, D.R.and Taylor, I.B. (1999) Characterization of the ABA-deficienttomato mutant notabilis and its relationship with maize Vp14.Plant J. 17, 427–431.

Burbidge, A., Grieve, T., Terry, C., Corlett, J., Thompson, A. andTaylor, I. (1997) Structure and expression of a cDNA encodingzeaxanthin epoxidase, isolated from a wilt-related tomato (Lyco-persicon esculentum Mill.) library. J. Exp. Bot. 48, 1749–1750.

Byrne, P.F., McMullen, M.D., Snook, M.E., Musket, T.A., Theuri, J.M.,Widstrom, N.W., Wiseman, B.R. and Coe, E.H. (1996) Quantita-tive trait loci and metabolic pathways: genetic control of theconcentration of maysin, a corn earworm resistance factor, inmaize silks. Proc. Natl Acad. Sci. USA, 93, 8820–8825.

Chen, F.Q., Foolad, M.R., Hyman, J., St. Clair, D.A. and Beelaman, R.B.(1999) Mapping of QTLs for lycopene and other fruit traits ina Lycopersicon esculentum × L. pimpinellifolium cross andcomparison of QTLs across tomato species. Mol. Breed, 5, 283–299.

Dharmapuri, S., Rosati, C., Pallara, P., Aquilani, R., Bouvier, F.,Camara, B. and Giuliano, G. (2002) Metabolic engineering ofxanthophyll content in tomato fruits. FEBS Lett. 519, 30–34.

Eshed, Y. and Zamir, D. (1994) Introgressions from Lycopersiconpennellii can improve the soluble-solids yield of tomato hybrids.Theor. Appl. Genet. 88, 891–897.

Eshed, Y. and Zamir, D. (1995) An introgression line populationof Lycopersicon pennellii in the cultivated tomato enables theidentification and fine mapping of yield-associated QTL. Genetics,141, 1147–1162.

Frary, A., Nesbitt, T.C., Grandillo, S., van der Knaap, E., Cong, B.,Liu, J., Meller, J., Elber, R., Alpert, K. and Tanksley, S.D. (2000)Cloning and transgenic expression of fw2.2: a quantitativetrait locus key to the evolution of tomato fruit. Science, 289,85–87.

Fraser, P.D., Romer, S., Shipton, C.A., Mills, P.B., Kiano, J.W.,Misawa, N., Drake, R.G., Schuch, W. and Bramley, P.M. (2002)Evaluation of transgenic tomato plants expressing an additionalphytoene synthase in a fruit-specific manner. Proc. Natl Acad. Sci.USA, 99, 1092–1097.

Fraser, P.D., Truesdale, M.R., Bird, C.R., Schuch, W. and Bramley, P.M.(1994) Carotenoid biosynthesis during tomato fruit development.Plant Physiol. 105, 405–413.

Fray, R.G. and Grierson, D. (1993) Identification and genetic-analysisof normal and mutant phytoene synthase genes of tomato bysequencing, complementation and co-suppression. Plant Mol.Biol. 22, 589–602.

Fridman, E., Pleban, T. and Zamir, D. (2000) A recombinationhotspot delimits a wild species QTL for tomato sugar content to484-bp within an invertase gene. Proc. Natl Acad. Sci. USA, 97,4718–4723.

Fulton, T.M., Beck-Bunn, T., Emmatty, D., Eshed, Y., Lopez, J.,Uhlig, J., Zamir, D. and Tanksley, S.D. (1997) QTL analysis of anadvanced backcross of Lycopersicon peruvianum to the cultivatedtomato and comparison of QTLs found in other wild species.Theor. Appl. Genet. 95, 881–894.

Fulton, T.M., Grandillo, S., Beck-Bunn, T., Fridman, E., Frampton, A.,Lopez, J., Petiard, V., Uhlig, J., Zamir, D. and Tanksley, S.D. (2000)Advanced backcross analysis of Lycopersicon esculentum × L.parviflorum cross. Theor. Appl. Genet. 100, 1025–1042.

Gaffe, J., Bru, J.P., Causse, M., Vidal, A., Stamitti-Bert, L., Carde, J.P.and Gallusci., P. (2000) LeFPS1, a tomato farnesyl pyrophos-phatase gene highly expressed during early fruit development.Plant Physiol. 123, 1351–1362.

Giovannoni, J. (2001) Molecular biology of fruit maturation andripening. Annu. Rev. Plant. Physiol. Plant. Mol. Biol. 52, 725–749.

Hirschberg, J. (2001) Carotenoid biosynthesis in flowering plants.Curr. Opin. Plant Biol. 4, 210–218.

Hugueney, P., Badillo, A., Chen, H.C., Klein, A., Hirschberg, J.,Camara, B. and Kuntz, M. (1995) Metabolism of cyclic caroten-oids – a model for the alteration of this biosynthetic-pathway inCapsicum-annuum chromoplasts. Plant J. 8, 417–424.

Isaacson, T., Ronen, G., Zamir, D. and Hirschberg, J. (2002) Cloningof tangerine from tomato reveals a carotenoid isomerase essentialfor production of carotene and xanthophylls in plants. Plant Cell,14, 333–342.

Kliebenstein, D.J., Gershenzon, J. and Mitchell-Olds, T. (2001) Com-parative quantitative trait loci mapping of aliphatic, indolic andbenzylic glucosinolate production in Arabidopsis thaliana leavesand seeds. Genetics, 159, 359–370.



Lefebvre, V., Kuntz, M., Camara, B. and Palloix, A. (1998) Thecapsanthin-capsorubin synthase gene: a candidate gene for the ylocus controlling the red fruit colour in pepper. Plant Mol. Biol. 36,785–789.

Lime, B.J., Griffiths, F.P., O’Connor, R.T., Heinzelman, D.C. andMcCall, E.R. (1957) Spectrophotometric methods for determiningpigmentation – Beta-carotene and lycopene. Ruby red grapefruit.J. Agri. Food Chem. 5, 941–944.

Monforte, A.J., Friedman, E., Zamir, D. and Tanksley, S.D. (2001)Comparison of a set of allelic QTL-NILs for chromosome 4 oftomato: Deductions about natural variation and implications forgermplasm utilization. Theor. Appl. Genet. 102, 572–590.

Monforte, A.J. and Tanksley, S.D. (2000) Development of a set ofnear isogenic and backcross recombinant inbred lines containingmost of the Lycopersicon hirsutum genome in a L. esculentumgenetic background: a tool for gene mapping and gene discovery.Genome, 43, 803–813.

Mustilli, A.C., Fenzi, F., Ciliento, R., Alfano, F. and Bowler, C. (1999)Phenotype of the tomato high pigment-2 mutant is caused by amutation in the tomato homolog of DEETIOLATED1. Plant Cell,11, 145–157.

Pan, Q., Liu, Y.S., Budai-Hadrian, O., Sela, M., Carmel-Goren, L.,Zamir, D. and Fluhr, R. (2000) Comparative genetics of NBS-LRRresistance gene homologues in the genomes of two dicotyledons:tomato and Arabidopsis. Genetics, 155, 309–322.

Pecker, I., Chamovitz, D., Linden, H., Sandmann, G. and Hirschberg, J.(1992) A single polypeptide catalyzing the conversion of phy-toene to zeta-carotene is transcriptionally regulated duringtomato fruit ripening. Proc. Natl Acad. Sci. USA, 89, 4962–4966.

Pecker, I., Gabbay, R., Cunningham, F.X. and Hirschberg, J. (1996)Cloning and characterization of the cDNA for lycopene beta-cyclase from tomato reveals decrease in its expression during fruitripening. Plant Mol. Biol. 30, 807–819.

Pflieger, S., Lefebvre, V. and Causse, M. (2001) The candidate geneapproach in plant genetics: a review. Mol. Breed, 7, 275–291.

Pozueta-Romero, J., Rafia, F., Houlne, G., Cheniclet, C., Carde, J.P.,Schantz, M.L. and Schantz, R. (1997) A ubiquitous plant house-keeping gene, PAP, encodes a major protein component of bellpepper chromoplasts. Plant Physiol. 115, 1185–1194.

Ray, J., Moureau, P., Bird, C., Bird, A., Grierson, D., Maunders, M.,Truesdale, M., Bramley, P. and Schuch, W. (1992) Cloning andcharacterization of a gene involved in phytoene synthesis fromtomato. Plant Mol. Biol. 19, 401–404.

Ronen, G., Carmel-Goren, L., Zamir, D. and Hirschberg, J. (2000) Analternative pathway to β-carotene formation in plant chromo-plasts discovered by map-based cloning of Beta (B) and old-gold

(og) colour mutations in tomato. Proc. Natl Acad. Sci. USA, 97,11102–11107.

Ronen, G., Cohen, M., Zamir, D. and Hirschberg, J. (1999) Regula-tion of carotenoid biosynthesis during tomato fruit development:Expression of the gene for lycopene epsilon- cyclase is down-reg-ulated during ripening and is elevated in the mutant Delta. PlantJ. 17, 341–351.

Rosati, C., Aquilani, R., Dharmapuri, S., Pallara, P., Marusic, C.,Tavazza, R., Bouvier, F., Camara, B. and Giuliano, G. (2000) Met-abolic engineering of beta-carotene and lycopene content intomato fruit. Plant J. 24, 413–420.

Saliba-Colombani, V., Causse, M., Langlois, D., Philouze, J. andBuret, M. (2001) Genetic analysis of organoleptic quality in freshmarket tomato. 1. Mapping QTLs for physical and chemical traits.Theor. Appl. Genet. 102, 259–272.

SAS Institute (2000) JMP Statistics and Graphics Guide: version 4.Cary, NC: SAS Institute, Inc.

Tanksley, S.D., Ganal, M.W., Prince, J.P., Devicente, M.C.,Bonierbale, M.W., Broun, P., Fulton, T.M., Giovannoni, J.J.,Grandillo, S., Martin, G.B., Messeguer, R., Miller, J.C., Miller, L.,Paterson, A.H., Pineda, O., Roder, M.S., Wing, R.A., Wu, W. andYoung, N.D. (1992) High-density molecular linkage maps of thetomato and potato genomes. Genetics, 132, 1141–1160.

Tanksley, S.D., Grandillo, S., Fulton, T.M., Zamir, D., Eshed, Y.,Petiard, V., Lopez, J. and BeckBunn, T. (1996) Advanced back-cross QTL analysis in a cross between an elite processing line oftomato and its wild relative L. pimpinellifolium. Theor. Appl.Genet. 92, 213–224.

Thorup, T.A., Tanyolac, B., Livingstone, K.D., Popovsky, S., Paran, I.and Jahn, M. (2000) Candidate gene analysis of organ pigmenta-tion loci in the Solanaceae. Proc. Natl Acad. Sci. USA, 97,11192–11197.

Van der Hoeven, R., Ronning, C., Giovannoni, J., Martin, G. andTanksley, S. (2002) Deductions about the number, organization,and evolution of genes in the tomato genome based on analysisof a large expressed sequence tag collection and selectivegenomic sequencing. Plant Cell, 14, 1441–1456.

Vrebalov, J., Ruezinsky, D., Padmanabhan, V., White, R., Medrano, D.,Drake, R., Schuch, W. and Giovannoni, J. (2002) A MADS-boxgene necessary for fruit ripening at the tomato ripening-inhibitor(rin) locus. Science, 12, 343–346.

Zamir, D. (2001) Improving plant breeding with exotic geneticlibraries. Nature Rev. Genet, 2, 983–989.

Zamir, D. and Tanksley, S.D. (1988) Tomato genome is comprisedlargely of fast evolving, low copy number sequences. Mol. Gen.Genet. 213, 254–261.

Documents

There is more to tomato fruit colour than candidate carotenoid genes