Upload
annabelle-warren
View
223
Download
0
Tags:
Embed Size (px)
Citation preview
3.4/7.2 DNA 3.4/7.2 DNA REPLICATIONREPLICATION
Two DNA molecules are Two DNA molecules are constructed from one, constructed from one, therefore each new therefore each new molecule contains one molecule contains one original strand and one original strand and one new strand new strand a semi- a semi-conservative processconservative process
The original strands The original strands serve as a template for serve as a template for the new strand.the new strand.
The parent and the The parent and the daughter molecules are daughter molecules are identical (all made up identical (all made up of the same sequence of the same sequence of nucleotides)of nucleotides)
DNA ReplicationDNA Replication Step 1: An enzyme Step 1: An enzyme
((helicasehelicase) breaks the ) breaks the hydrogen bonds hydrogen bonds between nitrogen bases between nitrogen bases and the double helix and the double helix “unzips”“unzips”
Step 2: Another enzyme Step 2: Another enzyme ((DNADNA polymerasepolymerase) ) moves along each moves along each strand and attaches strand and attaches new bases. This new bases. This enzyme also proofreads enzyme also proofreads the DNA for errors and the DNA for errors and may be able to correct may be able to correct simple errors.simple errors.
http://207.207.4.198/pub/flash/24/menu.swf
DNA Replication Fork
How Nucleotides are Added in DNA Replication
Errors in ReplicationErrors in Replication Mutations are heritable changes in DNA, Mutations are heritable changes in DNA,
which can be passed on to future which can be passed on to future generations. They can occur in any gene generations. They can occur in any gene and randomly.and randomly.
NondisjunctionNondisjunction Any one gene has a one in a million chance Any one gene has a one in a million chance
to be mutated. We have so many genes to be mutated. We have so many genes that mutations are fairly common. Each of that mutations are fairly common. Each of us carries several mutations in our bodies.us carries several mutations in our bodies.
Causes may include radiation and exposure to Causes may include radiation and exposure to chemicals, viruses…chemicals, viruses…
Mutations can be:Mutations can be:1.1. Useful (positive)Useful (positive)2.2. Harmful (negative)Harmful (negative)3.3. No effect (neutral)No effect (neutral)
POINT MUTATIONSPOINT MUTATIONSChanges in one or two basesChanges in one or two bases
Point mutations can be divided into 2 general categories: base-pair substitutions and base-pair insertions or deletions (frameshift mutations)
Base SubstitutionsBase Substitutions: Involves a change : Involves a change in one of the bases. These could be:in one of the bases. These could be:
a)a) SilentSilent: no effect, codes for the same : no effect, codes for the same amino acidamino acid
b)b) MissenseMissense: altered amino acid : altered amino acid sequence, varying severity (sickle-sequence, varying severity (sickle-cell, colourblindness, hemophilia) cell, colourblindness, hemophilia) translations will be terminated translations will be terminated prematurelyprematurely
c)c) Chain Termination/ NonsenseChain Termination/ Nonsense: : produces a stop codon and stops produces a stop codon and stops production of protein production of protein leads to leads to non-functioning proteinsnon-functioning proteinsAnimation Quiz 3 -
Mutation by Base Substitution
Frameshift MutationFrameshift Mutation: Addition or : Addition or deletion of bases; codons are shifted deletion of bases; codons are shifted out of placeout of place
Animation Quiz 4 - Addition and Deletion Mutations
Huntington’s DiseaseHuntington’s Disease: the sequence C-A-: the sequence C-A-G is inserted up to 100 times into a normal G is inserted up to 100 times into a normal gene, messes up the reading of the normal gene, messes up the reading of the normal genetic code, causing abnormal protein genetic code, causing abnormal protein production or a lack of protein production.production or a lack of protein production. Causes nervous system degenerationCauses nervous system degeneration
NeurofibromatosisNeurofibromatosis: :
insertion of DNA sequences insertion of DNA sequences
that do not code for that do not code for
anything right into the anything right into the
middle of the DNA middle of the DNA
sequences that do code sequences that do code
for certain proteins.for certain proteins.
Chromosomal Alterations/mutationsChromosomal Alterations/mutations: : Gross alterations that affect the Gross alterations that affect the structure and/or the number of structure and/or the number of chromosomes. These include:chromosomes. These include:
a)a) TranslocationTranslocation
b)b) Nondisjunction: chromatids Nondisjunction: chromatids fail to split at centromerefail to split at centromere
(Turner’s syndrome)(Turner’s syndrome)
c) Duplicationc) Duplication
d) Inversiond) Inversion
e) Deletione) Deletion
Cystic fibrosisCystic fibrosis: : caused by deletion caused by deletion on chromosome 7. on chromosome 7. Causes the lungs to Causes the lungs to continually fill with continually fill with thick mucus, which thick mucus, which can contain bacteria can contain bacteria and cause and cause pneumonia.pneumonia.
Duchenne Duchenne muscularmuscular dystrophydystrophy: gradual : gradual muscle deteriorationmuscle deterioration
DNA Mutation Problem SetDNA Mutation Problem SetGiven the following sequence, what Given the following sequence, what
would happen if…would happen if…
DNA:DNA:TATATTAGAGGCTCATATTATATTAGAGGCTCATAT11CTTCCTACGCTTCCTACG22TTCTAGATTTCTAGAT33GTGTTCTCTCTC44
ATTATT
mRNA: _______________________________mRNA: _______________________________
a.a.’s: ________________________________a.a.’s: ________________________________
a) Replace T3 with Ab) Replace GT with CAc) Replace G2 with A
d) A inserted after T1
e) Remove C4
Use a separate sheet of paper to solve this problem. Write out the entire mRNA sequence, then the entire sequence of amino acids starting with the start codon. Then replace the bases as indicated and figure out what kind of mutation will occur with each substitution or deletion/insertion.