Embed Size (px)
DESCRIPTION
A B C D E F. DNA Sample Key. A: DNA from crime scene with Enzyme 1 B: DNA from crime scene with Enzyme 2 C: DNA from suspect 1 with Enzyme 1 D: DNA from suspect 1 with Enzyme 2 E:DNA from suspect 2 with Enzyme 1 F: DNA from suspect 2 with Enzyme 2. Restriction Enzymes. - PowerPoint PPT Presentation
Citation preview
ABC
DEF
DNA Sample Key
• A: DNA from crime scene with Enzyme 1• B: DNA from crime scene with Enzyme 2• C: DNA from suspect 1 with Enzyme 1• D: DNA from suspect 1 with Enzyme 2• E:DNA from suspect 2 with Enzyme 1• F: DNA from suspect 2 with Enzyme 2
Restriction Enzymes• Cut DNA in at specific location based on base
sequences called restriction sites
Bam HI
ATGCGTGGCCGTACTACCCATGGATCCGGGTATATAGTACGCACCGGCATGATGGGTACCTAGGCCCATATATC
5’-GGATCC-3’3’-CCTAGG-5’
↓
↑
↓
↑
Restriction Enzyme II: HaeIII
ATGCGTGGCCGTACTACCCATGGATCCGGGTATATAGTACGCACCGGCATGATGGGTACCTAGGCCCATATATC
5’-GGCC-3’3’-CCGG-5’
↓
↑
↓
↑
![v e ] d b f r Z ] h f · 2016. 10. 21. · k l h e b d Z f b b k d Z f _ c d Z f b. < _ a ^ _ q b k l h l Z, ] Z j f h g b y, k i h d h c k l \ b _. I h ^ g y \ r b k v d](https://img.pdfslide.net/doc/110x75/6058d4447a979752a235ecc2/v-e-d-b-f-r-z-h-f-2016-10-21-k-l-h-e-b-d-z-f-b-b-k-d-z-f-c-d-z-f-b-.jpg)
