THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1991 by The American Society for Bioehemistry and Molecular Biology, Inc

Vol. 266, No. 12, Issue of April 25. pp. 7864-7869.1991 Printed in (I.S.A.

A Barbiturate-regulated Protein Binding to a Common Sequence in the Cytochrome P450 Genes of Rodents and Bacteria*

(Received for publication, August 30,1990)

Jian-Sen He and Armand J. FulcoS From the Department of Biological Chemistry and Laboratory of Biomedical and Environmental Sciences, School of Medicine, University of California at L o s Angeles, California 90024-1737

Analyses of the 5’ regulatory sequences of genes encoding barbiturate-inducible cytochromes P450BM-1 and P45OBMS3 from Bacillus megaterium and of the 5’ sequences of genes for barbiturate-inducible P450b and P45Oe of the rat revealed a string of 17 base pairs in each of the genes that shared a high degree of se- quence identity. Labeled oligonucleotide probes of each of these four sequences were tested in gel retardation assays with protein obtained from B. megaterium grown either in the presence or absence of barbiturates or with protein from nuclear extracts from livers of rats left untreated or injected with phenobarbital. Each of the four 17-mers bound strongly to a single protein from bacteria grown in the absence of barbiturates, but this binding was dramatically reduced with protein from pentobarbital- or phenobarbital-grown cells. Conversely, the probes complexed weakly to one pro- tein band from nuclear extracts from untreated rats but much more strongly with protein from phenobar- bital-treated rats. Similar effects could be obtained by prolonged incubation with phenobarbital of either sol- uble protein from the bacteria grown in the absence of barbiturates or nuclear extract protein from untreated rats. Deletion analysis of the 5”flanking region of the P 4 5 0 ~ ~ . ~ gene of B. megaterium revealed a putative repressor binding site located within a 24-base pair DNA segment that included the 17-base pair sequence involved in barbiturate-regulated protein binding.

The induction of specific cytochrome P450s in mammalian liver by barbiturates is a well established phenomenon (1, 2). In rat liver, the two major barbiturate-inducible forms, cyto- chromes P450b (P450IIBl) and P450e (P450IIB2), are coor- dinately induced by phenobalbital in a process that involves a dramatic increase in the rate of synthesis of their specific mRNAs and an apparent increase in the rate of transcription initiation (2-6). Although the causative processes remain obscure, the cloning of these two P450 genes along with major portions of their 5“flanking sequences (7-9), enhance the possibility of elucidating the induction mechanism at the molecular level. Indeed, recent in uitro studies of these 5’-

*The research was supported by National Institutes of Health Research Grant GM23913 and by Contract DE-FC03-ER06015 from the Director of the Office of Energy Research, Office of Health and Environmental Research. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$To whom reprint requests or inquiries should he addressed University of California, Laboratory of Biomedical and Environmen- tal Sciences, 900 Veteran Ave., Los Angeles, CA 90024-1786. Tel.: 213-825-8570.

flanking regions suggest that barbiturate-mediated binding of one or more proteins may be involved in the transcriptional activation of the P450b and P450e genes (10).

We have described three distinct cytochrome P450s (P450BM.1, P450BM.z, and P450BM.3) from the bacterium Bacil- lus megaterium that are also induced by barbiturates (11-13). One of these, P450BM.3 incorporates both a P450 and an NADPH:P450 reductase in proteolytically separable domains of a single soluble 119-kDa polypeptide and functions as a fatty acid monooxygenase independently of any other protein (14, 15). P450BM.3 resembles the liver microsomal systems, in organization and sequence identity, more than it does the mitochondrial or other bacterial P450s (17). Its gene has been cloned and sequenced (including the complete 5”regulatory region encompassing more than 1 kb’) and a detailed study of the mechanism of its barbiturate-mediated induction has been initiated (16-18).

Although we have focused on P450BM.3, the cloning, se- quencing, and expression of the gene for a second barbiturate- inducible but structurally unrelated P450 from B. megaterium (P450BM.1) gave us another system for comparative studies (19). The expression of P45oBM.i in Escherichia coli trans- formed by a 1.9-kb insert of B. megaterium DNA in a pUC19 vector was directed solely by a promoter within the B. mega- terium DNA (19). Since this insert contained a functional promoter and more than 0.5 kb 5’ to the start of the structural gene, we reasoned that a comparison of the 5’-flanking regions of the two B. megaterium genes might reveal common barbi- turate-responsive elements. Computer-assisted comparisons of the 5”flanking region of P450BM.1 with the regulatory sequences of P450BM.3 and the 5”flanking regions of the rat P450b and P450e genes revealed a string of 17 bases among the four genes that shared a high degree of sequence identity and were located within 300 bp of the translation start sites (Table I). On the basis of this parallelism, we prepared labeled oligonucleotide probes of each of the four sequences shown in Table I and tested them in gel retardation assays with protein preparations obtained from B. megaterium grown either in the presence or absence of barbiturates and with nuclear extract protein from the livers of control or phenobarbital- injected rats. We also examined various deletion derivatives of the regulatory region of the P450BM.1 gene and tested their effectiveness in regulating the expression, in B. megaterium, of a reporter gene. The results, reported here, provide evidence that barbiturate-mediated induction of cytochrome P450s in bacteria and in mammals may be mechanistically related.

EXPERIMENTAL PROCEDURES

Oligonucleotides and Enzymes-The doubled-stranded 17-bp DNA oligonucleotides used as labeled probes in the gel retardation assays

The abbreviations used are: kh, kilobase pair(s); bp, base pair(s); CAT, chloramphenicol acetyltransferase.

7864

A Barbiturate-regulated Protein in P450 Genes TABLE I

Homologous 5’-flankin~ seuuences in B. mepaterium and rat

7865

Gene Organism 17-base sequence“ 5’ locationb 17-bp nrohe‘

P45oBM.l B. megaterium CCATAAAAAGCTGGTCC -318 to -302 - “_

1 7 ~ ~ ~ 1 P 4 5 0 ~ ~ . : , B. megaterium ATATCAAAAGCTGGTGG -243 to -227 ~ ~ B M - R - ”_

P450b Rat - ATAGCTAAAGCAGGAEG ” -119 to -103 17b

P450e Rat - ATAGCCAAAGCAGGAGG -116 to -100 17e - ”_

- “_

Bases with double underlining are identical in all four sequences; bases with single underlining are identical in the P450BM.3 sequence and in both rat sequences.

In each case, location is determined by counting backwards from the translation start site (+1) of the gene to facilitate comparisons with the complete published sequences for the B. megaterium genes (see refs. 17 and 19). For the two rat genes, the transcription start sites are identical and are 30 bp upstream from the ATG translation start codon (see ref. 8); the putative transcription start site for the P450BM I gene is 145 bp upstream (see Fig. 7).

Designation for the double-stranded ”P-labeled probe used in the gel-shift assays.

and the 23- and 24-bp DNA oligonucleotides tested as competitors in several of these assays were purchased from Oligos etc., Inc. (Guilford, CT). Four double-stranded 22-mer oligonucleotides (SP1, NFl/CTF, AP,, and APs) and one 26-mer (AP,) that consisted of consensus sequences of previously characterized sites for protein binding (20- 24) were purchased from Stratagene (La Jolla, CA). Larger segments of DNA, utilized as competitors, were restriction fragments obtained from either a pUC13 plasmid with a 5-kb insert containing the complete P450BM.3 gene (17) or a pUC19 plasmid with a 1.9-kb insert containing the complete P450BM.I gene (19). Poly(d1-dC) .poly(dI- dC), used in the DNA-protein binding assays, was purchased from Pharmacia LKB Biotechnology, Inc. Oligonucleotide probes were 5’- end-labeled with [r-”P]ATP as described previously (16,251, and 0.1 pg of probe DNA (2 X lo5 dpm) was used in each assay. All restriction enzymes and other enzymes used in molecular cloning and other procedures involving nucleotides were obtained from New England Biolabs.

Protein Preparations-Growth of B. megaterium ATCC 14581 in the presence or absence of barbiturates and the preparation of soluble protein by sonication from early stationary phase cells has been described in detail previously (11, 15, 26). For use in most of the assays a fraction (designated “partially purified protein”) was used. To prepare this, the sonicate was centrifuged at 40,000 X g and the supernatant was treated with polyethylenimine to remove DNA and then fractionated by (NH4),S04 treatment. Protein precipitating be- tween 30 and 65% (NH4),S04 saturation was collected, dialyzed, and eluted from a DEAE-cellulose column with a NaCl gradient. Protein fractions eluting between 0.28 and 0.30 M NaCl (fractions 24-32) were combined for use in the assays. In one set of assays (see Fig. 1) individual fractions were tested against each probe. To prepare solu- ble nuclear extract protein from rat liver, white Wistar rats (320-375 g) were given intraperitoneal injections of either saline (designated as untreated) or phenobarbital (100 mg/kg body weight) and then killed 16 h later by exsanguination. The livers were removed at once and nuclear extract protein was prepared by the procedure described by Andersen et al. (27). Nuclear extract protein from mouse hepatoma cell line Hepa-1 (28,29) was kindly provided by Dr. Oliver Hankinson of UCLA.

Construction of Plasmids and Preparation of Deletion Deriuatiues- Plasmid PUBCAT, an E. coli-B. megaterium shuttle vector containing a promoterless CAT gene, was utilized in the analysis of the regulatory region of cytochrome P ~ ~ O B M . ~ ; a detailed description of its construc- tion and use has already been published (18). Plasmid PUC19BM.1, consisting of pUC19 containing a 1.9-kb insert of B. megaterium DNA that expressed cytochrome P 4 5 0 ~ ~ ~ ~ in transformed E. coli (19), was used as the starting material for our deletion derivatives. The insert incorporated an open reading frame encoding the complete amino sequence of P 4 5 0 ~ ~ . ~ and also included 504 bp 5’ to the start of the structural gene (19). Plasmid pUC19BM.1 was doubly digested with SphI and BamHI at polylinker sites and then treated with exonuclease 111 for various times. Digested fragments were blunt-ended with S1 nuclease and Klenow plus dNTP and finally treated with T4 ligase to generate a series of 5’-3‘ deletions of the insert in pUC19. After isolation from transformed E. coli, the deletion derivatives were identified by restriction mapping and the exact sites of deletion determined by double-stranded DNA sequencing (30, 31). Selected derivatives were opened at a polylinker site with HindIII, blunt-ended with Klenow plus dNTP, and then cut with SacI at a polylinker site

to remove the insert. To restore restriction sites in the polylinker region, the gel-purified fragments were than ligated to a fresh stock of pUC19 previously cut with SacI and SmaI. Each insert was then removed by cutting at a 5’ polylinker site with Sal1 and at the 3’ end with XmnI (after base +14 in the structural gene; see Fig. 10). After gel purification, each fragment was ligated into PUBCAT that had previously been prepared by cutting in a polylinker region with HindIII, blunt-ending with Klenow plus dNTP, and then restricting with SaZI. The resulting shuttle-vector constructs were used to trans- form B. megaterium, and CAT assays were carried out for the trans- formants as described in detail previously (18).

Other Procedures-Gel retardation assays and visualization by autoradiography were performed essentially as described in the man- ual edited by Ausubel et al. (32) except that 10% polyacrylamide gels were used. The standard conditions for the binding reaction of DNA with protein involved a 20-30-min incubation at room temperature before gel loading. A more vigorous binding reaction (60 min at 37 “C) gave identical results and was used only as a control reaction for the third procedure, below. When the in vitro effects of barbiturates were to be tested four different procedures were used. In the first, the binding reaction was carried under standard conditions, and the barbiturate was added just before gel loading; in the second procedure, the binding reaction was carried under standard conditions but in the presence of the barbiturate; in the third procedure, the binding reaction was carried out for 60 min at 37 “C in the presence of the barbiturate; in the fourth procedure, protein alone was incubated with barbiturate a t 37 “C for 60 min and then dialyzed overnight in the cold to remove barbiturate. Probe was then added and the standard binding reaction carried out. In all cases, appropriate controls (no barbiturate added) were carried through the same procedures. Results with the first method were essentially identical to those obtained without the addition of barbiturates while the second procedure gave a relatively weak but detectable barbiturate effect. The third and fourth procedures gave the maximum and essentially the same ob- served barbiturate effects.

RESULTS AND DISCUSSION

Binding of a B. megateriurn Protein with the 17-bp Oligo- nucleotide Probes-In initial gel retardation assays (data not shown) we found that each of the oligonucleotide probes (Table I) bound with what appeared to be a single protein in cell-free sonicates from B. megaterium cells grown in the absence of barbiturates; this binding was not observed, how- ever, with protein from cells grown in 4 mM pentobarbital. Essentially the same effect could be obtained by growing the cells in 8 mM phenobarbital (data not shown). To ascertain whether the same protein was involved in each case, we fractionated the sonicates (see “Experimental Procedures”) and tested individual fractions in sequence, again with each probe. As Fig. 1 shows, each of the four probes was shifted to the same degree by binding to a protein that was concentrated in fractions 28-30 from the cells grown in the absence of barbiturates; binding was abolished or significantly reduced in the same protein fractions from barbiturate-grown cells.

7866 A Barbiturate-regulated Protein in P450 Genes A 1 2 3 4 5 6 7 8 9 1011 121314151617181920 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4 1 5 1 6 1 7 1 8 1 ~ ~

~ ~- E 1 2 3 4 5 6 7 8 9 1011 1213 14151617181920

” -

0 1 2 3 4 5 6 7 8 9 10 11 1213 141516 1718 19 70

E .1 2 3 4 5 6 7 8 9 1011121314151617181920

FIG. 1. DNA-protein binding assays using four labeled 17- bp DNA probes and B. meguterium protein. The probes (see Table I ) were 17BM-1 ( A and E ) , 17BM-3 ( R ) , 17b (C), and 17e (D). Lanes I and 20, probe only; lanes 2-10, probe plus 2 pg per lane of DEAE-cellulose protein fractions 24 to 32, respectively, from B. megaterium grown in the absence of barbiturates; lanes 11-19, probe plus 2 pg per lane of DEAE-cellulose protein fractions 24 to 32, respectively, from B. megaterium grown in the presence of 4 mM pentobarbital. In E, after the binding incubations, all samples were heated at 100 “C for 5 min before gel electrophoresis.

The relative affinity of each probe for this protein can be estimated both by the intensity of binding and by the degree of binding on either side of fractions 28-30. By these criteria, the binding affinity order was 17b > 17BM-1> 17e > 17BM- 3. When very high levels (30 pg) of protein obtained from B. megaterium, grown in the presence of either 4 mM pentobar- bital or 8 mM phenobarbital, were used, all of the probes showed significant binding to the same protein, especially 17BM-1 and 17b (data not shown).

Binding of Liver Nuclear Protein with the 17-bp Oligonucle- otide Probes-Once we found that both the rat and bacterial 17-bp oligonucleotides could bind to the same B. megaterium protein, we carried out a similar experiment using rat liver nuclear protein from untreated or phenobarbital-injected rats (Fig. 2). Surprisingly, the results obtained with B. megaterium protein were inverted. With the possible exception of 17b, none of the probes showed detectable binding with 5 pg of protein from untreated rats. On the other hand, when 1 pg of protein from barbiturate-injected rats was used, all of the probes showed strong to moderate binding in the order: 17BM-1> 17b > 17e > 17BM-3.

Competition Experiments Using Unlabeled Probes or Por- tions of the Bacterid P450 Genes-As expected, the unlabeled 17-bp probes competed, in the predicted order of efficiency, to reduce or eliminate binding of any one of the 32P-labeled probes to the bacterial or rat protein, while nonspecific DNA

FIG. 2. DNA-protein binding assays using the labeled 17- bp DNA probes and either protein-C.., from nuclear extracts from liver of untreated rats or protein-P.., from nuclear extracts from liver of rats treated with phenobarbital. Lane I, 17b only; lane 2, 17b plus 0.5 pg of protein.C,,,; lane 3, l7b plus 5 pg of protein. lane 4, 17b plus 0.5 pg of protein. P,aI; lane 5, 17b plus 1 pg of protein. PraI; lane 6, 17e only; lane 7, 17e plus 0.5 pg of protein. C,,,; lane 8, 17e plus 5 pg of protein.C,,,; lane 9, 17e plus 0.5 pg of protein.P,,,; lane 10, 17e plus 1 pg of protein-P,& lane 11, 17BM-1 only; lane 12, 17BM-1 plus 0.5 pg of protein.C,,,; lane 13, 17BM-1 plus 5 pg of protein.C,,,; lane 14, 17BM-1 plus 0.5 pg of protein.P,,,; lane 15, 17BM-1 plus 1 pg of protein.P,,; lane IS, 17BM-3; lane 17, 17BM-3 plus 0.5 pg of protein.C,,; lane 18, 17BM-3 plus 5 pg of protein.CraI; lane 19, 17BM-3 plus 0.5 pg of protein.P,.,; lane 20, 17BM-3 plus 1 pg of protein.

1 2 3 4 5 6 7 8 9 1011121314

FIG. 3. Effects of competitor DNA in the DNA-protein bind- ing assays using labeled 17b (in all lunes) with 2 pg of partially purified protein-C,,, from B. meguterium grown in the ab- sence of barbiturates. In all cases, both probes and competitors consisted of double-stranded DNA. Lune I, probe only; lane 2, plus protein; lane 3, plus protein and 100-fold DNA by weight of the 0.5- kb regulatory region of P ~ ~ ~ B M . I ; lane 4, plus protein and 100-fold DNA by weight of the 1.6-kb regulatory region of P450~~.3; lane 5, plus protein and 100-fold DNA by weight of the 1.3-kb structural gene encoding P 4 5 0 ~ ~ . ~ ; lane 6, same as lane 5 except 150-fold competing DNA by weight; lane 7, plus protein and 100-fold DNA by weight of a Hind111 digest of the 3.4-kb structural gene encoding P450RM.3; lune 8, same as lane 7 except 150-fold competing DNA by weight; lane 9, plus protein and 5-fold oligo 1 DNA (23 bp from -301 to -279 inclusive of the P ~ ~ O B M . ~ gene, 5’ + 3’, with the sequence GTATGCCCTAAAATATCTAGCTG); lanes 10 and 11, as for lane 9 except 50- and 100-fold, respectively, of competing DNA by weight; lane 12, plus protein and 5-fold oligo 2 DNA (24 bp from -159 to

TATACTATTAGTACATTTTTATAC); lanes 13 and 14, as for lane -136 inclusive of the P450~~ . , gene, 5’ + 3’, with the sequence

9 except 50- and 100-fold, respectively, of competing DNA by weight.

such as pUC19, tested at 150-fold levels, had no detectable effect (data not shown). We also tested as competitors in gel- shift assays various portions of the P450BM.1 and P450BM.3 genes against each of the probes in combination with various protein preparations. Several of these experiments, utilizing 17b and 17BM-1 as the labeled probes, are shown in Figs. 3 and 4. As expected, the regulatory regions of the P ~ ~ O B M . ~ and P ~ ~ O B M . ~ genes, but not the DNA encoding the proteins, competed with probes 17b and 17BM-1. What was surprising was the unexpected efficiency of this competition, especially with the 100-fold by weight of the regulatory region of P450BM.3, the equivalent of less than 1.1-fold of the 17BM-3 sequence contained in this region. Addition of this 1.6-kb segment resulted in the complete elimination of detectable binding by 17b and 17BM-1 (see lanes 4 in Figs. 3 and 4) despite the fact that 50-fold 17BM-3 could not completely accomplish this (Fig. 4, lune 13). These and the similar results with the regulatory region of P450RM.1 indicate that there are other elements in these DNA segments that individually, or

A Barbiturate-regulated Protein in P450 Genes 7867

1 2 3 4 5 6 7 8 9 1011 12 13141516

”

FIG. 4. Effects of competitor DNA in the DNA-protein bind- ing assays using labeled 17BM-1 (in all lanes) with 2 pg of partially purified protein from B. rneguteriurn grown in the absence of barbiturates (protein-C,.,) unless otherwise indi- cated. In all cases, both probes and competitors consisted of double- stranded DNA. Lane I, probe only; lane 2, plus protein.C,,,; lane 3, protein.C,,, and 100-fold DNA by weight of the 0.5-kb regulatory region of P 4 5 0 ~ ~ . , ; lane 4, plus protein.C,,, and 100-fold DNA by weight of the 1.6-kb regulatory region of P450~~.3; lane 5, plus protein.C,,, and 100-fold DNA by weight of the 1.3-kb structural gene encoding P 4 5 0 ~ ~ . ~ ; lane 6, same as lane 5 except 150-fold competing DNA by weight; lane 7, plus protein.C,,, and 100-fold DNA by weight of a Hind111 digest of the 3.4-kb structural gene encoding P 4 5 0 ~ ~ . ~ ; lane 8, same as lane 7 except 150-fold competing DNA by weight; lane 9, plus protein. C,,, and 50-fold oligo 1 DNA by weight (see Fig. 3); lane IO, plus protein. C,,, and 50-fold oligo 2 DNA by weight (see Fig. 3); lane I I, plus protein. C,,, and 50-fold 17b DNA by weight; lane 12, plus protein. C,,, and 50-fold 17e DNA by weight; lane 13, plus protein. C,,, and 50-fold 17BM-3 DNA by weight; lanes 14-16, as for lane 2 except that 1,2, and 3 pg, respectively, of protein. Pt,,, from E. megaterium grown in the presence of 4 mM pentobar- bital replaced protein. C,,,.

in combination, complex strongly with the 17-bp binding protein of B. megaterium. Indeed, in preliminary experiments, we tested various restriction digests of the P450BM.1 regulatory region with B. megaterium protein preparations and located a t least two additional elements, oligo 1 and oligo 2 (see lanes 9-14 in Fig. 3; lanes 9 and 10 in Fig. 4), that complex strongly with protein Cmev When rat liver nuclear extract protein. P,, was tested in similar experiments (data not shown), 100-fold by weight of either the P 4 5 0 ~ ~ . ~ or P450BM.3 regulatory regions also completely eliminated binding with probe 17b but, in contrast to the results with the B. megaterium protein, neither oligo 1 nor oligo 2 were competitors, even at 150-fold concen- trations by weight.

In Vitro Effects of Barbiturates-In preliminary experi- ments (data not shown) we found that the in vivo effects of barbiturates could be duplicated, or at least mimicked, by incubating protein from untreated rats or bacteria with phe- nobarbital. Thus, low levels of protein e C,, did not give a gel- shift band with labeled 17b. However, when the binding reaction with protein.C,,, was carried out in the presence of barbiturates for 1 h a t 37 “C before the gel-shift assay, a labeled band appeared in the same position on gels as that seen with protein. Prat. The B. megaterium protein was also responsive to in vitro treatment with barbiturates; thus, the strong binding of protein. Cmeg to 17b was significantly re- duced by including phenobarbital in the binding reaction. The data in Fig. 5 provide a direct comparison between the effects of in vivo and in vitro treatment with barbiturates. With the rat liver nuclear extracts, protein. P,, is a t about 50 times more effective in binding 17b than protein - C,, (compare lanes 4 and 5 of Fig. 5). However, the treatment of protein C,, with 4 mM phenobarbital reduces this advantage to roughly 2-fold (compare lanes 5, 8, and 10 of Fig. 5, for example). Incubation of protein.P,, with barbiturate had no discernible effect (lanes 8 and 9, Fig. 5). In similar comparisons using B. megaterium protein, in vitro treatment with phenobarbital was even more effective. Thus, protein-C,,, a t 0.5 or 1 pg gives intense gel bands with 17b (lanes 12 and 13). These bands are very much attenuated when protein a P,,, is used

1 2 3 4 5 6 7 8 9 10111213141516171819 20

FIG. 5. Effect of in vitro treatment with barbiturates of rat or bacterial protein on probe binding. DNA-protein binding assays were performed using labeled 17b (in all lanes) and either protein.C,a, from nuclear extracts from liver of untreated rats, pro- tein.P,, from nuclear extracts from liver of rats treated with phe- nobarbital, partially purified protein .C,., from B. megaterium grown in the absence of barbiturates, or protein.P,., from bacteria grown in the presence of 8 mM phenobarbital. In all cases the binding reaction was carried out for 1 h at 37 “C before the gel-shift assay. Lane I , probe only; lanes 2-4, plus 1, 2, and 50 pg, respectively, of protein-C,.,; lanes 5, 6, and 7, plus 1, 2, and 5 pg, respectively, of protein. Pra,; lanes 8 and 9, 1 or 2 pg, respectively, of protein. P,, incubated with both probe and 4 mM phenobarbital before assay; lanes I O and I I, 1 or 2 pg, respectively, of protein. C,, incubated with both probe and 4 mM phenobarbital before assay; lanes 12 and 13, plus 0.5 or 1 pg, respectively, of protein.C,.,; lanes 14 and 15, plus 0.5 or 1 pg, respectively, of protein-P,.,; lanes 16 and 17, 0.5 or 1 pg, respectively, of protein.P,,, incubated with both probe and 4 mM phenobarbital before assay; lanes 18 and 19, 0.5 or 1 pg, respectively, of protein-C,., incubated with both probe and 4 mM phenobarbital before assay; lane 20, probe only.

(lanes 14 and 15) and barely detectable when either protein. Pme, or protein. C,,, is first treated with phenobarbital before assay (lanes 16-19). That these effects were brought about by a barbiturate-mediated change in the protein rather than an effect on the binding reaction was demonstrated by obtaining essentially the same results (data not shown) using protein. P,,, or protein. C,,, that had been incubated with phenobar- bital in the absence of probe and then freed of barbiturate by overnight dialysis before carrying out the binding reaction (see “Experimental Procedures”). We also carried out the same experiments with nuclear extracts from mouse hepa-1 cells which apparently do not contain barbiturate-inducible equivalents of rat P450b and P450e (33) and could not detect binding to the probes, even when using 30 pg of barbiturate- treated protein.

Competition Experiments Using Characterized Protein- binding Oligonucleotides-To determine whether nonspecific effects were significantly involved in any of the observed barbiturate-responsive DNA-protein interactions, we con- ducted a series of gel-shift assay competition experiments using various commercially available oligonucleotides (see “Experimental Procedures”), each containing a consensus sequence to previously characterized sites for protein binding. Fig. 6 shows gel-shift assays using either rat or bacterial protein extracts with labeled SP1 consensus sequence oligo- nucleotide. I t can be seen that rat nuclear extract contains at least one protein (Fig. 6, lanes 2 and 3) that binds with this probe, but the binding is not barbiturate-responsive. There is no indication of significant binding of SP1 oligonucleotide to any protein from B. megaterium grown in the presence or absence of barbiturates (Fig. 6, lanes 4 and 5).’ Essentially identical experiments with similar results (data not shown) to those presented in Fig. 6 for SP1 were carried out using as labeled probes NFl/CTF, AP,, AP2, or AP3. None of these probes bound significantly to bacterial protein, while, in all

* The weak band just visible in lane 4 (containing protein.C,,) is apparently caused by leakage of rat protein from lane 3 since, when protein.C,,, is run alone with labeled SP1 (data not shown), no band can be detected.

7868 A Barbiturate-regulated Protein in P450 Genes

’ ?- -3 .4 5 -504

FIG. 6. Binding of SP1 consensus sequence oleonucleotide to rat or bacterial protein. DNA-protein binding assays were performed using labeled SP1 double-stranded DNA (in all lanes) and either protein. C,el from nuclear extracts from liver of untreated rats (lane 2 ) , protein.P,, from nuclear extracts from livers of rats treated with phenobarbital (lane 3), partially purified protein. C,,, from B. megaterium grown in the absence of barbiturates (lane 4 ) , or protein. P,,, from bacteria grown in the presence of 8 mM phenobarbital (lane Fj). In all cases 2 pg of protein were used in the the binding reactions.

cases, some binding to one or more rat proteins was observed although never to a component matching the 17-bp binding component of protein. P,,,. Furthermore, no difference in probe binding was observed between protein. C,, and protein. Pra,. In competition experiments (data not shown) we found that neither SP1 nor NFl/CTF oligonucleotides, in 100-fold excess by weight, could attenuate the binding of labeled 17b with a component of protein. Pret even though equivalent amounts by weight of 17e or the 0.5-kb fragment containing the regulatory region of P450BM.1 abolished 17b binding. Con- versely, labeled SP1 oligonucleotide bound to a rat protein significantly larger than the 17-bp binding component of protein P,,, and this binding was not significantly affected by barbiturate treatment in uiuo or in vitro or by 100-fold excesses by weight of 17b, 17e, or the regulatory regions of the bacterial P450 genes.

Effect of Deletion Deriuatiues of the Regulatory Region of P 4 5 0 ~ ~ . , on Expression-Fig. 7 delineates the structures of various 5’ -+ 3‘ deletion derivatives of the 5”flanking region of the P 4 5 0 ~ ~ . , gene that were inserted in front of the pro- moterless CAT gene in the multicopy shuttle vector pUBcA~ (18); Table I1 shows the expression of CAT activity in B. megaterium transformed by these constructs. Constructs 1 and 2, containing 504 and 345 5”flanking bp, respectively, gave essentially identical results, an indication that the inter- vening bases play little or no role in regulation. In both instances, 4 mM pentobarbital induced more than a 4-fold increase in CAT activity over the basal level. The removal of the remaining 27 bp upstream from the 17-bp barbiturate- responsive element (construct 3) had little effect on the basal level of expression but significantly reduced (although it did not eliminate) the response to pentobarbital, a result consist- ent with the partial loss of a positive regulatory site. The effect of the removal of the next 24 bases (construct 4) was more dramatic. Not only was the pentobarbital response completely eliminated, but the basal level of CAT expression was increased 9-fold (i.e. to a specific activity of more than twice that of the observed maximum inducible level). This result is consistent with the elimination of a negative regula- tory site resulting in the complete derepression of expression. Finally, as expected, the removal of the promoter region (construct 5) completely eradicates CAT expression. Analo- gous experiments were not carried out with the regulatory

-501 TCTGATTATCCCCTCTATATTCAATGACTACTTTTTCTCTTTGTAGAATA

-451 AGTGATTCTTGCAGAGACGAAAGTAATGAGATAAGCAGTTCGCTTTTAGA

-401 TGAGAAATATTTATAAAATGTTCCTTTTGAAATCCCGCTTCTTTCTAATA (2) + (3) -)

(4) + -3 5 1 TATCTTGTACCGAAGTGTCTACGTATCCTTTTT~$ATAAAAAGCTGGT~

-301 GTATGCC~TAAAATATCTAGCTGTTTTTGATTCATTGCTGTTACTCCTCT

-251 GTTTACAATTTACTTTTTATTTAGTATAGCTTATCTGCCTTTTCCTACGT -35 -10

-201 GAATTTTATCCTTTTTCCTTGATAACCAAGTAAAAATAATTAWUCZAT mRNA start i. (5) +

-151 TAGTACATTTTTATAC~AATTGTAT~TGTACTAATAGTATAGGTTA

-101 TTCGACAAAGTAACTATTTATCTAGCAAGTGACAACTACTGAGCGCTATG

-51 TAGCTAGTAAATTCCAAATCTATACCTATTCTGAAGGAGGAATAAGATCA Xmn I restrimion site

- 1 CATCRACAAACAACTJ

FIG. 7. Deletion derivatives of the 504-bp 5”flanking re- gion of the P450BM.1 gene. A series of five 5’ + 3’ deletion derivatives originally obtained from plasmid PUC19BM.I were inserted into the shuttle vector PUBCAT and used to transform B. megaterium (see “Experimental Procedures”). CAT expression directed by these constructs is shown in Table 11. As shown, each insert tested is designated by a number (in brackets); the 5’ end of each insert is indicated by a superscript base, while the 3’ end of each insert is identical, terminating a t an XmnI restriction site at base +14 of the cytochrome P450BM.1 open reading frame. Also indicated are the -35 and -10 sequences (underlined), the mRNA start site (f, base under- lined), and the 17-bp homologous sequence (doubled underlined). In the sequence above, numbering is from the translation start site rather than from the more conventionally used transcription start site. This was done for two reasons. First, the sequences for both the P450BM.1 and P 4 5 0 ~ ~ . ~ genes were published utilizing numbering from the translation start site (17, 19), and retention of this arrangement eliminates a source of potential confusion and allows direct compar- ison of the constructs above with the more complete sequences published previously. Second, we now have evidence (G.-C. Shaw and A. J. Fulco, unpublished experiments) that there may be multiple transcription start sites involved in the expression of cytochrome P450R~.R, and thus, at present, the use of the invariant translation start site for numbering the P450RM.1 sequence permits unambiguous comparisons.

TABLE I1 CAT expression in B. megaterium directed by PUBC,IT constructs B. megaterium transformed by PUBCAT constructs containing in-

serts of various deletion derivatives of the P450RM.1 gene 5’-flanking region (see Fig. 7) were grown in the presence or absence of 4 mM pentobarbital and then assayed for chloramphenicol acetyltransferase activitv (18). Each value is the average of four seDarate assays.

Insert in the PUBCAT Chloramphenicol acetyltransferase activity transforming plasmid

(construct number) +Pentobarbital -Pentobarbital p e ~ ~ ~ r & a l

cpmlhlpg of soluble protein (No insert) 27 29 0.93

1 3867 898 2 3597 842

4.31 +. 0.14

3 4.29 k 0.16

1586 833 4 6649” 6742

1.90 f 0.22 0.99 k 0.01

5 37 58 0.64 f 0.13 a Cells grown in 3 mM pentobarbitak growth in 4 mM pentobarbital

was severely inhibited.

A Barbiturate-regulated Protein in P450 Genes 7869

region of the P450BM.3 gene, since previously published results (18) demonstrate that the removal of a segment of this region approximately 1 kb 5' to the translation start site does not support expression of CAT when inserted into the P U B ~ T shuttle vector.

Conclusions-The results reported here show that the 5' regulatory sequences of genes encoding barbiturate-inducible cytochromes P450BM., and P450BM.3 from B. megaterium and the 5"flanking sequences of genes for barbiturate-inducible P450b and P450e of the rat each contain a sequence of 17 bp that share a high degree of identity and bind to a barbiturate- regulated protein. Protein from either the bacterium or the rat interacted with the four 17-bp probes corresponding to these sequences but was affected differently by barbiturates. In gel-shift assays using nuclear extracts from the livers of untreated rats, a single protein band showed weak affinities for the probes, but this binding was strongly enhanced when preparations from barbiturate-injected rats were used. On the other hand, probe-binding was far stronger with a protein from B. megaterium grown in the absence of barbiturates than it was with protein from phenobarbital-grown cells. Similar effects were obtained by prolonged incubation with pheno- barbital of either soluble protein from the bacteria grown in the absence of barbiturates or nuclear extract protein from untreated rats; such treatment resulted in decreased binding by the B. megaterium protein and increased binding by the rat protein to the same four oligonucleotide probes. This result suggests that de novo protein synthesis is not necessarily involved in the observed in vivo effect and that we are observ- ing a different phenomenon than that reported by Rangarajan and Padmanaban (10). They showed that the binding of a putative transcription factor from rat nuclear extracts to a 5"flanking region of the P450b and P450e gene was signifi- cantly increased by pretreatment of the animals with pheno- barbital and that, in DNase footprint studies, a protein from phenobarbital-treated rats protected a 32-bp region that be- gan with the 17-bp homologous sequence from P450e (see Table I). Nevertheless, these effects were blocked by cyclo- heximide, indicating the necessity of protein synthesis. Their evidence also implicated an 85-kDa protein in both effects. The rat and bacterial oligonucleotide-binding proteins in our system appear to be identical in size to each other but much smaller than 85 kDa. It must be emphasized, however, that the rat and bacterial proteins, regardless of their apparently equivalent size, must be essentially dissimilar since they re- spond differently to barbiturates, in vivo and in vitro. Fur- thermore, oligos l and 2 (see Fig. 3) compete effectively with the 17-bp probes for the bacterial protein but are not compet- itors for the rat protein. Preliminary experiments (data not shown) also show that the binding of the rat protein to labeled 17-bp probes is abolished more readily by heat denaturation than is binding by B. megaterium protein. We are currently attempting to isolate and characterize these proteins and to identify other sequences in the bacterial and rat regulatory regions that also exhibit barbiturate-mediated interaction with them.

Finally, the results of the deletion analysis of the 5'-flank- ing region of the P 4 5 0 ~ ~ . 1 gene (see Fig. 7 and Table 11)

indicate that, in B. megaterium, a negative regulatory element is involved in barbiturate-mediated regulation of cytochrome P450BM.1, and, although the data is less convincing on this point, a positive regulatory sequence may also be implicated. Both elements are located within a 51-bp region that includes the 17-bp barbiturate-responsive element. More precisely, a segment of the putitive positive regulatory region of the P450BM.1 gene appears to be located in the 27-bp segment just 5' to the 17-bp element, while a repressor binding site appears to reside in a 24-bp region starting at the first base of this element. As noted above, the homologous 17-bp element of the rat P450e gene appears at the beginning of the 32-bp DNA fragment protected in a footprinting experiment by a phenobarbital-induced protein (10).

Acknowledgments-We thank Dr. Eric Svensson of UCLA for providing us with the rat liver nuclear extract used in our preliminary experiments, Dr. Robert Anderson of UCLA for teaching us his procedure for preparing rat liver nuclear extracts, and Dr. Harvey Herschman, also of UCLA, for many helpful discussions during the course of the research.

REFERENCES 1. Okey, A. B. (1990) Pharmacol. Ther. 45,241-298 2. Whitlock, J. P., Jr. (1986) Annu. Reu. Phrmacol. Toxicol. 26,333-369 3. Adesnik, M., Bar-Nun, S., Maschio, F., Zunich, M., Lippman, A., and Bard,

4. Adesnik, M., and Atchison, M. (1986) CRC Crit. Reu. Biochem. 1 9 , 247- E. (1981) J. B~ol. Chem. 256,10340-10345

5. Hardwick, J. P., Gonzalez, F. J., and Kasper, C. B. (1983) J. Biol. Chem.

6. Omiecinski, C. J., Walz, F. G., Jr., and Vlasuk, G. P. (1985) J. Biol. Chem.

7. Mizukami, Y., Sogawa, K., Suwa, Y., Muramatsu, M., and Fujii-Kuriyama,

8. Suwa, Y., Mlzukami, Y., Sogawa, K., and Fujii-Kuriyama, Y. (1985) J. Biol.

9. Jaiswal, A. K., Rivkin, E., and Adesnik, M. (1987) Nucleic Acids Res. 15,

305

258,8081-8085

260,3247-3250

Y. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 3958-3962

Chem. 260,7980-7984

G7.55 10. Rayiaiajan, P. N., and Padmanaban, G. (1989) Proc. Natl. Acad. Sci. U. S.

11. Narhi, L. O., and Fulco, A. J. (1982) J. Biol. Chem. 257, 2147-2150 12. Schwalb. H.. Narhi, L. 0.. and Fulco, A. J. (1985) Biochim. BioDhvs. Acta

A. 86,3963-2967

"_, "_ "- 13. Fulco A. J. and Ruettinger, R. T. (1987) Life Sci. 40, 1769-1775 14. Narhi, L. O:, and Fulco, A. J. (1986) J. Biol. Chem. 261,7160-7169 15. Narhi, L. 0. and Fulco, A. J. (1987) J. Biol Chem. 262,6683-6690 16. Wen, L.-P., bnd Fulco, A. 3. (1987) J. Biol. Chem. 262,6676-6682 17. Ruettineer. R. T.. Wen. L.-P.. and Fulco. A. J. (1989) J . Biol. Chem. 264.

18.

19.

20. 21.

22.

23. 24.

25.

26.

27.

28.

10987Y-ioG95 ' ~' ' ,~ I

Wen, L.-P., Ruettinger, R. T., and Fulco, A. J. (1989) J. Biol. Chem. 264,

He, J.-S., Ruettinger, R. T., Liu, H.-M., and Fulco, A. J. (1989) Biochim.

Dynan, W. S., and T'ian, R. (1985) Nature 36, 774-778 Chodosh. L. A.. Baldwin. A. S.. Carthew. R. W.. and Sham. P. A. (1988)

10996-11003

Biophys. Acta 1009, 301-303

Cell 5 3 , 11-24

5889-5893

. .

Kadonaga, J. T., and Tjian, R. (1986) Proc. NatZ. Acad. Sei. U. S. A. 83,

Serfling, E., Jasin, E., and Schaffner, W. (1985) Trends Genet. 1, 224-230 Kadonaga, J. T., Jones, K. A,, and Tjian, R. (1986) Trends. Biochem. Sci.

11,20-23 Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A

Laboratory Manual, pp. 122-124, Cold Spring Harbor Laboratory, Cold

Ruettinger, R. T., Kim, B.-H., and Fulco, A. J. (1984) Biochim. Biophys. Spring Harbor, NY

Andersen, R. D., Tapliz, S. J., Oberbauer, A. M., Calame, K. L., and Acta 801,372-380

Bernhard, H. P., Darlm&on, G. J., and Ruddle, F. H. (1973) Deu. Bid. 3 5 , Herschman, H. R. (J990) Nucleic Acids Res. 18, 6049-6055

83-96 29. Hankinson 0. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 373-376 30. Chen, E. J.: and Seeburg, P. H. (1985) DNA (N. Y.) 4,165-170 31. Haltiner, M., Kempe, T., and Tjian, R. (1985) Nucleic Acids Res. 13,1015-

32. Ausubel, F. M.. Brent, R.. Kingston. R. E., Moore. D. D.. Seidman. J. G.. 1026

Smith, J. A.,'and Struhi, K. i;eds) .(1989).Currek Protocols in Molecular Biology, Vol. 2, Section 12.1, John Wiley & Sons, New York

33. Owens, I. S., and Nebert. D. W. (1975) Mol. Pharmacol. 11,94-104