Embed Size (px)
Citation preview
1
A Novel Hepatointestinal Leukotriene B4 Receptor: Cloning and Functional
Characterization
Suke Wang*, Eric Gustafson, Ling Pang, Xudong Qiao, Jiang Behan, Maureen Maguire,
Marvin Bayne, Thomas Laz
From: Schering-Plough Research Institute
2015 Galloping Hill Road, K15-E119
Kenilworth, NJ 07033
*Tel: 908-740-3949
FAX: 908-740-2383
Email: [email protected]
Running title: Novel LTB4 receptor subtype
Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on September 26, 2000 as Manuscript M004512200 by guest on A
pril 12, 2018http://w
ww
.jbc.org/D
ownloaded from
2
Abstract
Leukotriene B4 (LTB4) is a product of eicosanoid metabolism and acts as an
extremely potent chemotactic mediator for inflammation. LTB4 exerts positive effects on
the immigration and activation of leukocytes. These effects suggest an involvement of
LTB4 in several diseases: inflammatory bowel disease, psoriasis, arthritis and asthma.
LTB4 elicits actions through interaction with one or more cell surface receptors that lead
to chemotaxis and inflammation. One leukotriene B4 receptor has been recently identified
(LTB4-R1). In this report we describe cloning of a cDNA encoding a novel 358-amino
acid receptor (LTB4-R2) that possesses seven membrane-spanning domains, and is
homologous (42%) and genetically linked to LTB4-R1. Expression of LTB4-R2 is broad
but highest in liver, intestine, spleen and kidney. In radioligand binding assays,
membranes prepared from COS-7 cells transfected with LTB4-R2 cDNA displayed high
affinity (KD = 0.17 nM) for 3H-LTB4. Radioligand competition assays revealed high
affinities of the receptor for LTB4 and LTB5, and 20-hydroxy-LTB4, and intermediate
affinities for 15[S]-HETE and 12-oxo-ETE. Three LTB4 receptor antagonists, 14,15-
dehydro-LTB4, LTB4-3-aminopropylamide and U-75302, had high affinity for LTB4-R1
but not for LTB4-R2. No apparent affinity binding for the receptors was detected for the
CysLT1-selective antagonists montelukast and zafirlukast. LTB4 functionally mobilized
intracellular calcium and inhibited forskolin-stimulated cAMP production in 293 cells.
The discovery of this new receptor should aid in further understanding the roles of LTB4
in pathologies in these tissues and may provide a tool in identification of specific
antagonists/agonists for potential therapeutic treatments.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
3
Introduction
Leukotriene B4 (LTB4) is derived as a product of eicosanoid metabolism and is a
pro-inflammatory lipid mediator that potently stimulates neutrophil chemotaxis to sites of
inflammation (1-3). LTB4 is involved in the following events: stimulating immigration of
leukocytes from the blood stream (4,5); neutrophil activation leading to degranualation
and release of noxious mediators, enzymes and superoxides (6); inflammatory pain (7);
host defense against infection (3); and increased interleukin production (8) and
transcription (9). These processes have been implicated in the pathogenesis of a variety of
diseases such as inflammatory bowel disease (IBD), psoriasis, arthritis and asthma
(10,11). Considerable efforts have been devoted in the development of antagonists
targeting the cell surface receptors, by screening compounds with radioligand binding
assays utilizing membrane preparations from cells such as neutrophils. Potential
treatments of various inflammatory conditions with these antagonists have been recently
illustrated in human and animal models (11-15).
Extensive studies of LTB4 and the search for the molecular identity of its
receptors have resulted in the recent cloning of a LTB4 receptor (16) (LTB4-R1). This
protein is a cell surface receptor and belongs to the G protein-coupled receptor super-
family containing seven membrane-spanning domains. The LTB4 receptor binds LTB4
with high affinity, which in turn leads to intracellular signaling and chemotaxis. Among
the major tissues tested, the receptor is expressed abundantly only in peripheral
leukocytes (16). In this report, we describe the identification of a novel LTB4 receptor
(LTB4-R2) that shares homology with LTB4-R1, and the finding that the two receptors
are genetically linked. This novel receptor is highly expressed in several peripheral
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
4
tissues such as liver, spleen and intestine, and binds LTB4 with high affinity. The ligand-
receptor interaction activates the receptor leading to intracellular signal transduction.
Materials and Methods
Materials. 3H-labeled LTB4 (~200 Ci/mmol) was purchased from NEN Life
Science Products. Human marathon-ready cDNAs and RACE kit were from Clontech.
The 293-EBNA cell line was obtained from Invitrogen. Leukotrienes and other ligands
were purchased from Sigma Chemicals and Cayman Chemical Co. 14,15-dehydro-LTB4,
LTB4-3-aminopropylamide and U-75302 were purchased from BIOMOL Research
laboratories, Inc. (Plymouth Meeting, PA). Oligonucleotides were custom-synthesized by
Life Technologies, Inc. Their sequences are: oligo347, 5’-ctaccacgcagtcaaccttctgcag;
oligo348A, 5’-caccggaaggggccttggcgaagct; oligo348B, 5’-tgctctacgtcttcaccgctggaga,
oligo358, 5’-gccgccaccatgtcggtctgctaccgtcc; oligo417, 5’-
gccgccaccatgaacactacatcttctgcagc; oligo418, 5’-gtgcgcctccttccaccaggcctag; MM311, 5’-
ctgacagcaggatgatagcca; 63U, 5’-tttttgttagtttgaggggaag; 480L, 5’-gcagaagggccgcctccattcc;
and oligo359, 5’-gcaggttgtagggtctgctgtca. DNA sequencing was performed using the Big
Dye Terminators sequencing agents (Applied Biosystems).
Cloning and sequencing of the new LTB4 receptor. The amino acid sequences of
known G-protein coupled receptors were used to conduct a BLAST search against EST
databases. The search identified a 397-base sequence as a putative GPCR fragment
(HDPYA90R, Fig. 1A). A phylogenetic analysis (Wisconsin Package, Genetics
Computer Group, Madison, Wisc.) suggested that the sequence was related to a
leukotriene receptor covering transmembrane domains 3 to 6. Further computational
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
5
survey of public databases identified contiguous sequences that resulted in a composite
2451-base sequence that contained a 888-base sequence at the 3’ end which appeared to
be a portion of an open reading frame of a GPCR (Met to TM6, Fig. 1A). A 3’ RACE
was performed to obtain the missing 3’ portion of the putative ORF by PCR using the
Marathon RACE kit for PCR reactions and human liver marathon-ready cDNA
(Clontech) as a template. Primary PCR using oligo347 and AP1 (35 cycles of 94 oC, 30
sec and 68 oC), secondary PCR using primers AP2 and oligo348A (35 cycles of 94 oC, 65
oC, 30 sec, 72 oC, 2min), and tertiary PCR using primers AP2 and oligo348B (35 cycles
of 94 oC, 65 oC, 30 sec, 72 oC, 2 min) resulted in a ~400 basepair (bp) 3’ RACE product
(Fig. 1A). To obtain a full ORF, a 5’ primer (oligo358) containing the ATG codon in the
888-base sequence and a 3’ primer (oligo359) containing the putative stop codon in the 3’
RACE sequence were generated. A PCR with this pair of primers and human liver cDNA
as a template (35 cycles of 94 oC, 65 oC, 30 sec, 72 oC, 2min) yielded a PCR product of
~1.1 kb (SP9030, Fig. 1A).
Isolation of genomic clone. A genomic clone containing both LTB4–R2 (SP9030)
and LTB4-R1 receptors was obtained by PCR-screening a human PAC PCRable DNA
pool (Genome Systems, St. Louis, MO) with primers 63U and 480L. PCR was
performed using PCR Supermix (Life Technologies, Inc) with a thermal cycling of 94 oC,
30 sec; 55 oC, 30 sec; 72 oC, 30 sec (35 cycles). The size of the intron was determined
by PCR using Supermix HiFidelity (Life Technologies) with primers oligo347 and
MM311 and the PAC DNA as a template (94 oC for 30 sec, 55 oC for 30 sec, and 68 oC
for 5 min). The resulting PCR product (~4.0 kb) was gel purified with Qiaex II Gel
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
6
Extraction kit (Qiagen) and partially sequenced (~600 bp) at each of the two ends of
fragment.
Transfection of cells and membrane preparations: COS-7 cells grown in
DMEM/10% FCS at 80-90% confluency were transfected with SuperFect agent (Qiagen)
at 20 µg DNA/150-mm plate. Forty eight hours after transfection, medium was changed
to Opti-MEM or DMEM/Opti-MEM(1:1)/5%FCS. 72 hours after transfection, the cells
were washed with 20 ml PBS without Ca2+/Mg2+ and incubated with 10 ml of 10 mM
Hepes pH 7.4, 0.5 mM PMSF, 20 µg/ml aprotinin at room temperature for 30 min. The
cells were scraped off the plate and vortexed. The cell suspension was then centrifuged at
13,000 g at 4 oC for 15 min. The pellets were re-suspended in 1.8 ml 50 mM Tris-Cl,
pH7.5 and vortexed. The membranes were homogenized with a 23-gauge needle. The
protein concentration of the membrane preparations was determined with the BCA agents
(Pierce).
Radioligand binding assay. For saturation binding, 150 µl binding assay buffer (30
mM Hepes, pH7.4, 10 mM CaCl2, 10 mM MgCl2, 0.05% fatty acid free BSA (w/v), kept
cold on ice) containing 24 µg of membranes were mixed with 50 µl of binding assay buffer
containing 0 or 1 µM leukotriene in 2% (v/v) DMSO. 3H-LTB4 (NEN, 50 nM) was added to
the assays at increasing concentrations. The reactions were incubated for 1 hour at 4 oC with
slow rotation. Binding solutions were filtered through Multiscreen FB filters (Millipore)
pre-soaked with 50 µl of binding assay buffer for 1 hour at room temperature and the filters
were washed twice with 100 µl 50 mM Tris-Cl, pH7.5 (ice cold). Fifty µl microscint fluid
was added to the filters and counted for the bound radioligands. For radioligand competition
assays, 160 µl binding assay buffer containing membranes were mixed with 20 µl of binding
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
7
assay buffer containing various concentrations of competing compounds in 6% DMSO
(v/v). A final 20 µl of binding assay buffer containing 1 µl of 3H-LTB4 (NEN, 50 nM, final
concentration 0.25 nM) in 6% (v/v) DMSO was added to start the binding reaction. Final
concentration of ethanol as the solvent in the stock LTB4 solution was 0.5% (v/v). Binding
data were analyzed with a non-linear regression software (Prism; GraphPad, San diego,
CA).
Intracellular Ca2+ concentration measurement. 293-EBNA cells grown in
DMEM/10% FCS at 80-90% confluency were transfected with the SuperFect agent
(Qiagen). The next day the cells were trypsinized off the plate and washed with PBS without
Ca2+ /Mg2+ . The cells were then seeded at a cell density of 35,000 cells/100 µl medium into
96-well plates pre-coated with poly-D-lysine (Becton Dickinson). On the third day, the
medium was removed and 100 µl Hank’s balanced salt solution (without phenol red)
containing 4 µM of Fluo-3, AM (Molecular Probes), 20 mM Hepes, pH7.4, 0.1% (w/v)
BSA and 250 mM probenecid were added and the cells were incubated at 37 oC, 5% CO2 for
1 hour. The cells were then washed three times with 150 µl buffer containing Hank’s
balanced salt solution, 40 mM Hepes, pH7.4 and 250 mM probenecid. One hundred µl of
the wash buffer was added after the final wash and Ca2+ flux was measured with a FLIPR
(Molecular Device) after addition of 40 µl of the buffer containing appropriate concentration
of ligands.
Cyclic AMP Assay. 293 cells were transfected with plasmid DNA and the SuperFect
agent. Forty-eight hours post-transfection, 100ng/ml pertusis toxin (PTX) was added to the
cells, which were incubated at 37 °C overnight. Immediately prior to assay, the cells were
released from the plate by the cell dissociation buffer (Sigma), and pelleted by centrifuge at
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
8
2000 rpm, 5 min, at 4°C in 10 ml Ficon tube. The cells were re-suspended and seeded at
50,000 cells /50 µl stimulation buffer/per well of FlashPlate. Fresh LTB4 was prepared in
Hank’s-HEPES Buffer (Hanks Salt Solution with 10mM HEPES, pH 7.4 and 0.2 % BSA
(w/v), filtered and stored at 4°C). Fifty µl LTB4 plus or minus 10 µM forskolin were added
to the FlashPlate. Standard cAMP ranging from 0 to 1,000 pmol/ml were arranged in the
same plate. The plate is incubated on a rotating shaker at room temperature for half an hour.
At the end of the incubation, the assay is terminated by addition of 100 µl of the adenylyl
cyclase activation FlashPlate detection mixture (NEN). The FlashPlate is covered and gently
agitated on a shaker for 3-5 hours. After the development, FlashPlate is counted on a 96-
well counter. A standard curve is prepared and the counts were converted to mass (pmol
cAMP/ml). Cyclic AMP production data were analyzed with non-linear regression.
Analyses of Northern blots/dot blots. Hybridization to northern blots and dot blots
(Clontech) was carried out using a PCR-generated 440 bp DNA fragment from the 5’
untranslated region of the open reading frame (ORF) of LTB4-R2. The DNA fragment
was random prime-labeled with 32P-dCTP, and the blots hybridized for 14 h in
ExpressHyb (Clontech) containing ~2 million cpm/ml of radiolabeled probe. The
following day the blots were washed according to the manufacturer’s protocol, and
exposed to Kodak Biomax MS film for six days at –70oC. The films were analyzed for
relative expression levels using the MCID M4 image analysis system (Imaging Research,
Ont., Canada). For the known receptor LTB4-R1, a 425 bp fragment corresponding to nt
49-474 of the published LTB4 open reading frame (16) was generated by PCR. The
northern blot and dot blot analyses were carried out with the random-prime 32P-dCTP
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
9
labeled fragment, hybridized overnight at 65oC with multiple tissue dot blots and
northern blots (Clontech).
Results
Sequence analysis of the 1.1-kb PCR product resulting from multiple RACE
amplification steps identified a putative ORF of 1077-bp (Fig. 1A) that encodes a protein
of 358 amino acids (Fig. 1B). Hydrophobicity analysis of the 358-aa sequence suggested
that there are seven trans-membrane spanning regions. BLAST analysis with the amino
acid sequence against the Genbank database revealed homology of the amino acid
sequence to the human leukocyte LTB4 receptor (LTB4-R1, 42%) (16) (Fig. 1B), the
human CRTH2 (32%) (17), and the human somatostatin receptor SSTR4 (27%) (18,19).
The amino acid sequence of the receptor is only distantly related (~18% homology) to the
recently cloned leukotriene D4 receptor (20,21). The high amino acid sequence homology
to LTB4-R1 and the presence in all seven transmembrane domains of conserved amino
acid motifs indicated that this was a G-protein-coupled receptor. Thus the novel receptor
was tentatively termed as LTB4-R2.
Alignment of the cDNA of LTB4-R2 with the ORF of LTB4-R1 revealed that the
5’ un-translated region (UTRs) of the transcript (Genbank # D89079, (16)) is identical to
the coding region at the 3’ portion and the immediate downstream sequence in the 3’
UTR of the ORF of LTB4-R2. This analysis suggests that portions of both LTB4 receptors
could exist on a single messenger RNA and the two LTB4 receptors are in the same
chomosomal region. A genomic clone containing coding regions of LTB4-R2 and LTB4-
R1 was obtained (PAC clone 159K10) by PCR-screening of a human PAC library using
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
10
primers 63U and 480L in the coding region of LTB4-R2 (Fig. 2A). Direct sequencing of
the PAC clone revealed no intervening sequences in the coding region of either receptor
thus both receptors are encoded by intronless ORFs (Fig. 2A). A second PCR using
primers oligo347 and MM311 revealed a single ~3.6 kb intron 3’ downstream of LTB4-
R2 and 5’ upstream of LTB4-R1 (Fig. 2A). Genbank entry AL096870 is a genomic
sequence from chromosome 14. This fragment contains both the LTB4-R1 and LTB4-R2
genes, as determined by BLAST.
The genomic sequence containing both LTB4-R2 and LTB4-R1 was compared
with several mRNA transcripts of LTB4-R2 and LTB4-R1 (Fig 2B-D). The 3’
untranslated sequence of LTB4-R2 is identical to the 5’ end of the intron, suggesting that
this transcript contains only LTB4-R2 (Fig. 2B). There were three Genbank entries that
contained LTB4-R1 mRNAs: D89078, D89079, and U33448. D89079 (16) contains the
coding sequences of both LTB4-R2 and LTB4-R1, but does not have the 3.6-kb intron
(Fig. 2C). U33448 (22) contains only the coding region of LTB4-R1, and the 5’
untranslated sequence is identical to the 3’ end of the 3.6-kb intron sequence (Fig. 2D).
D89078 also containes only the coding region of LTB4-R1; however, the 5’ untranslated
region is identical to the middle portion of the 3.6-kb intron (Fig. 2E).
Dot blot and Northern blot analyses were performed to determine the expression
of LTB4-R2 mRNA in human tissues. A dot blot containing mRNAs from 56 human
tissues (Clontech) was hybridized to a 440-bp fragment derived from the 5’-UTR of
LTB4-R2 cDNA. Highest expression of LTB4-R2 was detected in liver followed by small
intestine, spleen and fetal liver (20-40% of that of liver, Fig. 3A). Adrenal gland and
pituitary had expression levels between 10-20% of those in the liver. All of the other 49
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
11
tissues expressed LTB4-R2 at 10% of or less than that of the liver level (Fig. 3A),
including peripheral leukocytes in which LTB4-R1 is highly expressed (16). Using the
same fragment as probe to hybridize a Northern blot, a mRNA of approximately 1.6 kb
with high abundance was seen in the liver and a weak band in kidney (Fig. 3B). No
expression was detected in heart, brain, placenta, skeletal muscle and pancreas.
Employing a quantitative PCR method (Taqman, PE Biosystems) with 27 cDNA
preparations generated primarily from human fetal and diseased tissues as templates; the
highest expression of LTB4-R2 was again detected in fetal small intestine, Crohn’s colon,
fetal liver and fetal lung (not shown). As is the case for the novel LTB4 receptor, the
LTB4-R1 mRNA appears to be widely distributed in human tissues based on the results of
the dot blot. LTB4-R1 is most abundant in immune-related tissues, including spleen,
peripheral blood leukocytes, and bone marrow. While there is also low expression of the
LTB4-R1 mRNA in liver, it is not as prominent as that for LTB4-R2. The Dot blot data
for LTB4-R1 are consistent with the Northern blot analysis shown by Yokomizo et al (16)
in which high expression was seen in peripheral leukocytes and low or no mRNA was
detected in other tissues.
Radioligand binding assays were performed to directly test the ability of LTB4-R2
to bind LTB4. The ORF of LTB4-R2 was cloned in expression vector pCR3.1 to form
construct pCR3.1-LTB4-R2. COS-7 cells were transfected with the construct and
membranes were prepared for a 3H-LTB4 binding assay. As shown in Fig.4A, specific
binding was observed with the membranes prepared from cells transfected with pCR3.1-
LTB4-R2; in contrast, no specific binding was seen with membranes prepared from cells
transfected with vector alone. Since serum used in the cell cultures may carry low
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
12
concentrations of LTB4 (23), radioligand binding assays were performed in parallel with
membranes prepared from cells grown for the last 24 h in either serum free (Opti-MEM)
or medium containing 5% (v/v) FCS. No difference in the abilities of the two membrane
preparations to bind [3H]-LTB4 were found (Fig.4A), indicating that the serum used in
the experiments did not affect ligand-receptor interaction through potential effects of
either desensitization or receptor down regulation. Saturation radioligand binding assays
employing membranes from cells cultured in serum yielded a KD of 0.17 ± 0.07 nM and
BMAX of 70 ± 8 fmol/mg membrane protein (n = 3) (Fig. 4B). Similar KD and BMAX were
obtained when membranes prepared from cells cultured in serum free medium: KD = 0.21
± 0.06 nM and BMAX = 64 ± 7 fmol/mg protein (not shown).
The pharmacological profiles of LTB4-R2 and LTB4-R1 were compared in
radioligand competition assays using 3H-LTB4 as the radioligand and a number of
unlabeled leukotrienes, leukotriene analogs, leukotriene receptor antagonists, and 5-
lipoxygenase products as competitiors (Table 1). LTB4, LTB5 and a LTB4 metabolite, 20-
hydroxy-LTB4, have high affinities for both LTB-R2 (Ki < 41 nM and relative affinity
<18) and LTB4-R1 (Ki < 3.7 nM and relative affinity < 5.3) receptors (Table 1, Figure 5).
A 5-lipoxygenase product, 15[S]-HETE, and an arachidonic acid derivative, 12-oxo-ETE,
displayed moderate affinities for LTB4-R2 (relative affinity = 67 – 73) but had low
binding affinities for LTB4-R1 (Ki > 1000 nM) (Table 1, Fig. 5). The affinities of the
three LTB4 receptor antagonists (14,15-dehydro-LTB4 (24), LTB4-3-aminopropylamide
(25,26) and U-75302 (27)) were relatively lower for LTB4-R2 (Ki = 473 – 5434 nM) than
for LTB4-R1 (Ki = 5.1 – 27 nM) (Table 1). Another LTB4 metabolite, 20-carboxy-LTB4,
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
13
bound LTB4-R1 with high affinity (Ki = 20 nM) but bound LTB4-R2 with much lower
affinity (Ki > 1000 nM) (Table 1).
Other test compounds displayed generally low affinities for the LTB4-R2 and LTB4-R1
receptors in the competition assay (Table 1). These compounds include several 5-lipoxygenase
products such as [S]5-HETE, 20-HETE, 8[R]-HETE, and [±]5-HETE (relative affinities > 435,
Table 1), two arachidonic acid derivatives (5-oxo-ETE and 5,6-dehydroarachidonic acid, relative
affinities > 435), and lipoxin-A4 with affinities of ~ 1400 nM (Ki) for the two receptors (Table
1). 6-trans LTB4, a trans stereoisomer of LTB4, also bound the receptors with relatively low
affinity (Table 1). Leukotrienes in the C, D, E and F families and methyl ester of the leukotriene
As, displayed weak or no affinities for LTB4-R2, as well as LTB4-R1 (Table 1). Two CysLT1-
antagonists, monteluskast (Singuliar) and zafirlukast (Accolate) that have high affinities for the
LTD4 receptor (20,21), had affinities at least 4000 times lower than that of LTB4 for LTB4-R2
and LTB4-R1 (Fig. 5, Table 1).
The ability of LTB4-R2 receptor to mediate intracellular signal transduction was
examined by measurements of fluorescence of FLO-3AM as intracellular Ca2+ flux and
by assays of forskolin-induced cAMP production. Interaction of LTB4-R2 expressed in
293-EBNA cells with LTB4 activated cellular Ca2+ release (Fig. 6A), suggesting a
functional coupling of LTB4–R2 with intracellular G-proteins. In contrast, cells that were
mock-transfected with vector alone did not respond to incubation with LTB4 (Fig. 6A).
The ability of the receptor to mediate inhibition of forskolin-stimulated intracellular
cAMP was tested in 293 cells expressing LTB4-R2. LTB4 caused a dose-dependent
inhibition of the cAMP production (Fig. 6B). Non-linear regression analysis of the data
yielded a maximum inhibition of ~60% and EC50 of 58 ± 20 nM (n = 2). Incubation of
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
14
the cells with 100 ng/ml PTX reversed most of the inhibitory activity, indicating that this
is a PTX-sensitive pathway (Fig. 6B).
Discussion
A thorough understanding of the roles of LTB4 requires identification and
characterization of all the LTB4 receptors. We have cloned and characterized a novel
LTB4 receptor that is different from and genetically linked to the previously cloned LTB4
receptor (LTB4-R1). The two receptors vary in primary structures displaying only 42%
homology and in tissue expression patterns, but both are able to bind LTB4 with high
affinity and are functional in stimulating intracellular signaling. In addition, the two
receptors are genetically linked at one locus of the genome.
The cloned LTB4-R2 binds LTB4 with highest affinity among the 31 ligands
tested. The binding affinity is comparable to that of LTB4 for the previously published
LTB4-R1 receptor (Table 1), indicating that the receptor is a LTB4 receptor subtype.
Consistent with this conclusion is the observations that LTB4-R2 shares a high homology
to LTB4-R1 and that the two receptors are genetically co-localized (Figs. 1 and 2). The
ligand affinity of LTB-R2 extends from LTB4 only to LTB5 and 20-hydroxy-LTB4 whose
structures are closely related to LTB4, suggesting a specific ligand recognition (Table 1).
High affinity binding of 20-hydroxy-LTB4 to human PMNs has been observed previously
(28); it is more soluble than and expresses functional activities similarly to LTB4,
suggesting a more important role of 20-hydroxy-LTB4 in inflammation than LTB4 (28).
Except the moderate affinity of 12-oxo-ETE and 15[S]-HETE for LTB4-R2, all the other
ligands tested, including analogs of LTB4 or 5-lipoxygenase products, do not bind the
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
15
receptor with high affinity (Table 1). We note that clinically used LTD4 receptor
antagonists montelukast and zafirlukast have no affinity for the receptor (Fig. 5),
consistent with the finding that the two LTB4 receptors share low homology with the
LTD4 receptor. While LTB4 and LTD4 are derived from a common metabolic pathway,
their receptors are nevertheless phylogenetically distant suggesting the use of a common
pathway in regulations of diverse physiological functions.
The two receptors possess different pharmacological profiles. Like LTB4-R2,
LTB4-R1 binds LTB4, LTB5 and 20-hydroxy-LTB4 with high affinity (Table 1).
However, several compounds, including 14,15-dehydro-LTB4 and LTB4-3-
aminopropylamide and U-75302, and 20-carboxy-LTB4 that do not bind LTB4-R2 tightly,
bind LTB4-R1 with high affinity (Table 1). In contrast, 12-oxo-ETE and 15[S]-HETE
showed preferential binding to LTB4-R2 (Table 1). The trans stereoisomer of LTB4 (6-
trans LTB4) displayed low affinity for either LTB4-R1 or LTB4-R2 (Table 1), suggesting
trans stereo-specificity at C-6 of LTB4 for these receptors (29).
Activation of the LTB4-R2 receptor leads to variable signaling events including
the mobilization of Ca2+ and modulation of intracellular cAMP levels. Activation of the
receptor leads to the interaction of the receptor with two classes of G protein: the Gq
class, which mediates cellular Ca2+ release; or the Gi class, which mediates inhibition of
forskolin-stimulated cAMP production in a PTX-sensitive manner. The activation of
multiple signal transduction pathways suggests different roles for LTB4 through the
interaction with LTB4-R2, depending on the availability of G protein reserves in different
cell types.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
16
LTB4 activities may be regulated by differential expression of the receptors in
different tissues. The new LTB4 receptor is highly expressed in the liver, intestine,
spleen, and to some degree, kidney (Fig. 3), suggesting that this receptor regulates LTB4-
mediated functions in these tissues. This expression pattern is in contrast to that LTB4-
R1, which is expressed only in the peripheral leukocytes (16). The differential expression
patterns ((16), Fig. 3) suggest the functions of the two receptors are tissue-specific, and
may be involved in different inflammatory processes associated with immune or
hepatointestinal systems. The characteristics of LTB4-R2 as an active cell surface
receptor that binds radioliabeled LTB4 saturatably (Fig. 4B) and stimulates intracellular
signaling (Fig. 6) support LTB4 acting as stimulant for cellular functions other than
merely being passively metabolized by liver cells.
Relatively high expression of LTB4-R2 is consistent with existing evidence
implicating functions of LTB4 in these tissues. Hepatic macrophages secreting LTB4
attract neutrophils to the liver in rats with septic liver injury (30). In a hepatic ischemia-
reperfusion injury model, rat liver LTB4 levels were increased to levels 50-fold those in
control liver, accompanied with increase of plasma alanine aminotransferase activities
and PMN accumulation in the liver (31). Only the concentration of LTB4, not LTC4 and
LTE4, in plasma and stimulated peripheral blood leukocyte supernatants of children with
hepatitis A infection was elevated, suggesting that LTB4 may be a critical mediator of
hepatitis A virus-induced hepatocellular injury (32). Use of 5-lipoxygenase inhibitor
significantly lowers blood LTB4 level and promotes liver regeneration after hepatectomy
with obstructive jaundice (33). Liver non-parenchymal cell production of LTB4 was
higher in rats fed corn oil and ethanol (alcoholic liver) than in animals fed saturated fat
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
17
and ethanol (no liver injury) (34). Finally, enhanced production of LTB4 by peripheral
blood mononuclear cells in patients was found with fulminant hepatitis (35).
In spleen, intraperitoneal LTB4 increased the survival rate of mice infected with
methicillin-resistant Staphylococcus aureus (36). Guinea pig spleen membrane
preparations have high affinity for LTB4 and contain moderate number of LTB4 binding
sites (37); this receptor has high affinity for LTB4 and 20-hydroxy-LTB4 but low affinity
for 20-carboxy-LTB4 (37), a profile similar to LTB4-R2 (Table 1). In a rat renal ischemia-
reperfusion injury model, Chinese hamster ovary (CHO) cells expressing a LTB4 receptor
accumulate along with neutrophils in the postischemic kidney; use of LTB4 antagonists
led to the marked decrease in accumulation of CHO cells and neutrophils (38).
Spontaneously hypercholesterolemic rats, characterized by glomerular infiltration of
macrophages, fed a normal diet developed end-stage renal failure in 26 weeks, while
those fed a diet supplemented with a LTB4 antagonist showed normal renal function (39).
In the intestinal system, high LTB4 levels in colonic mucosa in patients with IBD were
detected (10), more than 10-fold chemotactic activity was found in homogenates of IBD
mucosa than in those of normal colonic mucosa, and only lipid extract fraction coeluted
with LTB4 was chemotactically active (40). Furthermore, the response to IBD mucosa
was inhibited by anti-LTB4 antisera, suggesting that LTB4 is an important stimulus to
neutrophil chemotaxis in the disease (40). Given that LTB4-R1 is not found in either
small intestine or colon (16), LTB4–R2 may serve as a more promising therapeutic target
for treatment of IBD.
The close genetic linkage between the two LTB4 receptors (Fig. 2A) are unique to
other GPCR families and may play a role in regulating receptor activation. The genomic
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
18
organization illustrated in Fig. 2A was confirmed by a more recently Genbank entry of a
human genomic fragment, AL096870, which contains both LTB4 receptor genes. Since
the fragment is located on chromosome 14, we mapped the LTB4-R1 and LTB4-R2
receptors to this chromosome. Although we have observed various transcripts that may
contain single receptor of LTB4-R1 or LTB4-R2, or may contain coding regions of both
LTB4-R1 and LTB4-R2, it is not clear about the molecular mechanism that regulate the
formation of those transcripts from the two genes, and the regulatory roles of the
transcripts in specific physiological functions.
Identification of multiple LTB4-receptors with distinct primary structures,
differential pharmacological profiles and expression patterns points to the potential of
differential regulation of LTB4 effects on a variety of inflammatory diseases. Delineation
of pleitropic LTB4 receptor activation is essential for developments of disease- and
receptor subtype-specific antagonists/agonists in various therapeutic areas. It will be
necessary to define the specificity of the previously reported LTB4 antagonists (13-15,41)
toward the two LTB4 receptor subtypes, should these compounds be successfully
developed and safely used in clinic settings. The discovery of the hepatointestinal
receptor and illustration of the cellular mechanisms mediated by this receptor should aid
in design of further studies to understand the roles of LTB4 in functions of the tissues and
identification of receptor subtype-specific antagonists and agonists.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
19
References
1. Samuelsson, B., Dahlen, S. E., Lindgren, J. A., Rouzer, C. A., and Serhan, C. N. (1987)
Science 237(4819), 1171-6
2. Borgeat, P., and Naccache, P. H. (1990) Clin Biochem 23(5), 459-68
3. Chen, X. S., Sheller, J. R., Johnson, E. N., and Funk, C. D. (1994) Nature 372(6502), 179-
82
4. Dahlen, S. E., Bjork, J., Hedqvist, P., Arfors, K. E., Hammarstrom, S., Lindgren, J. A.,
and Samuelsson, B. (1981) Proc Natl Acad Sci U S A 78(6), 3887-91
5. Smith, M. J., Ford-Hutchinson, A. W., and Bray, M. A. (1980) J Pharm Pharmacol 32(7),
517-8
6. Sha'afi, R. I., Naccache, P. H., Molski, T. F., Borgeat, P., and Goetzl, E. J. (1981) J Cell
Physiol 108(3), 401-8
7. Levine, J. D., Lau, W., Kwiat, G., and Goetzl, E. J. (1984) Science 225(4663), 743-5
8. Brach, M. A., de Vos, S., Arnold, C., Gruss, H. J., Mertelsmann, R., and Herrmann, F.
(1992) Eur J Immunol 22(10), 2705-11
9. Stankova, J., and Rola-Pleszczynski, M. (1992) Biochem J 282(Pt 3), 625-9
10. Sharon, P., and Stenson, W. F. (1984) Gastroenterology 86(3), 453-60
11. Jackson, W. T., and Fleisch, J. H. (1996) Prog Drug Res 46, 115-68
12. Weringer, E. J., Perry, B. D., Sawyer, P. S., Gilman, S. C., and Showell, H. J. (1999)
Transplantation 67(6), 808-15
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
20
13. Taylor, B. M., Crittenden, N. J., Bruden, M. N., Wishka, D. G., Morris, J., Richards, I. M.,
and Sun, F. F. (1991) Prostaglandins 42(3), 211-24
14. Kishikawa, K., Tateishi, N., Maruyama, T., Seo, R., Toda, M., and Miyamoto, T. (1992)
Prostaglandins 44(4), 261-75
15. Showell, H. J., Conklyn, M. J., Alpert, R., Hingorani, G. P., Wright, K. F., Smith, M. A.,
Stam, E., Salter, E. D., Scampoli, D. N., Meltzer, S., Reiter, L. A., Koch, K., Piscopio, A.
D., Cortina, S. R., Lopez-Anaya, A., Pettipher, E. R., Milici, A. J., and Griffiths, R. J.
(1998) J Pharmacol Exp Ther 285(3), 946-54
16. Yokomizo, T., Izumi, T., Chang, K., Takuwa, Y., and Shimizu, T. (1997) Nature
387(6633), 620-4
17. Nagata, K., Tanaka, K., Ogawa, K., Kemmotsu, K., Imai, T., Yoshie, O., Abe, H., Tada,
K., Nakamura, M., Sugamura, K., and Takano, S. (1999) J Immunol 162(3), 1278-86
18. Rohrer, L., Raulf, F., Bruns, C., Buettner, R., Hofstaedter, F., and Schule, R. (1993) Proc
Natl Acad Sci U S A 90(9), 4196-200
19. Hein, J. (1990) Methods Enzymol 183, 626-645
20. Lynch, K. R., O'Neill, G. P., Liu, Q., Im, D. S., Sawyer, N., Metters, K. M., Coulombe,
N., Abramovitz, M., Figueroa, D. J., Zeng, Z., Connolly, B. M., Bai, C., Austin, C. P.,
Chateauneuf, A., Stocco, R., Greig, G. M., Kargman, S., Hooks, S. B., Hosfield, E.,
Williams, D. L., Jr., Ford-Hutchinson, A. W., Caskey, C. T., and Evans, J. F. (1999)
Nature 399(6738), 789-93
21. Sarau, H. M., Ames, R. S., Chambers, J., Ellis, C., Elshourbagy, N., Foley, J. J., Schmidt,
D. B., Muccitelli, R. M., Jenkins, O., Murdock, P. R., Herrity, N. C., Halsey, W., Sathe,
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
21
G., Muir, A. I., Nuthulaganti, P., Dytko, G. M., Buckley, P. T., Wilson, S., Bergsma, D. J.,
and Hay, D. W. (1999) Mol Pharmacol 56(3), 657-663
22. Raport, C. J., Schweickart, V. L., Chantry, D., Eddy, R. L., Jr., Shows, T. B., Godiska, R.,
and Gray, P. W. (1996) J Leukoc Biol 59(1), 18-23
23. Seggev, J. S., Wiessner, J. H., Thornton, W. H., Jr., and Edes, T. E. (1995) Ann Allergy
Asthma Immunol 75(4), 365-8
24. Shimazaki, T., Kobayashi, Y., Sato, F., Iwama, T., and Shikada, K. (1990) Prostaglandins
39(4), 459-67
25. Young, R. N., Zamboni, R., and Rokach, J. (1983) Prostaglandins 26(4), 605-13
26. Goldman, D. W., Gifford, L. A., Marotti, T., Koo, C. H., and Goetzl, E. J. (1987) Fed
Proc 46(1), 200-3
27. Lin, A. H., Morris, J., Wishka, D. G., and Gorman, R. R. (1988) Ann N Y Acad Sci 524,
196-200
28. Clancy, R. M., Dahinden, C. A., and Hugli, T. E. (1984) Proc Natl Acad Sci U S A 81(18),
5729-33
29. Dahinden, C. A., Clancy, R. M., and Hugli, T. E. (1984) J Immunol 133(3), 1477-82
30. Doi, F., Goya, T., and Torisu, M. (1993) Hepatology 17(6), 1086-94
31. Hughes, H., Farhood, A., and Jaeschke, H. (1992) Prostaglandins Leukot Essent Fatty
Acids 45(2), 113-9
32. Kasirga, E., Coker, I., Aydogdu, S., Yagci, R. V., Taneli, B., and Gousseinov, A. (1999)
Turk J Pediatr 41(4), 457-65
33. Urade, M., Izumi, R., and Kitagawa, H. (1996) Hepatology 23(3), 544-8
34. Nanji, A. A. (1993) Alcohol 10(6), 443-6
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
22
35. Asano, F., Moriwaki, H., Shiratori, Y., Shimazaki, M., Sakai, T., Koshino, Y., Murakami,
N., Sugihara, J., Ohnishi, H., Saito, K., and et al. (1993) J Gastroenterol Hepatol 8(3),
228-31
36. Yamamoto, S., Adjei, A. A., and Kise, M. (1993) Prostaglandins 45(6), 527-34
37. Cheng, J. B., Cheng, E. I., Kohi, F., and Townley, R. G. (1986) J Pharmacol Exp Ther
236(1), 126-32
38. Noiri, E., Yokomizo, T., Nakao, A., Izumi, T., Fujita, T., Kimura, S., and Shimizu, T.
(2000) Proc Natl Acad Sci U S A 97(2), 823-8
39. Nakao, A., Nosaka, K., Ohishi, N., Noiri, E., Suzuki, T., Taniguchi, S., Seki, G.,
Watanabe, T., Kurokawa, K., Shimizu, T., and Kimura, S. (1997) Kidney Int Suppl 63,
S236-8
40. Lobos, E. A., Sharon, P., and Stenson, W. F. (1987) Dig Dis Sci 32(12), 1380-8
41. Jackson, W. T., Froelich, L. L., Boyd, R. J., Schrementi, J. P., Saussy, D. L., Jr., Schultz,
R. M., Sawyer, J. S., Sofia, M. J., Herron, D. K., Goodson, T., Jr., Snyder, D. W.,
Pechous, P. A., Spaethe, S. M., Roman, C. R., and Fleisch, J. H. (1999) J Pharmacol Exp
Ther 288(1), 286-94
42. Cheng, Y., and Prusoff, W. H. (1973) Biochem. Pharmacol. 22, 3099-3108
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
23
Table 1. Pharmacological profiles of the LTB4-R2 and LTB4-R1 receptors determined with radioligand competition assays
Ligand LTB4-R2 LTB4-R1
Ki (nM) Ki/Ki(LTB4) Ki (nM) Ki/Ki(LTB4)
LTB4 2.3 ± 1.1 1 0.7 ± 0.4 1
LTB5 9.4 ± 4.8 4 3.7 ± 3.0 5.3
20-hydroxy-LTB4 41± 12 18 0.54 ± 21 0.8
15[S]-HETE 173 ± 80 73 >18000 >25714
12-oxo-ETE 155 ± 74 67 >1000 >1429
14,15-dehydro-LTB4 473 ± 201 205 27 ± 3 38
LTB4-3-aminopropylamide 1227 ± 680 533 5.1 ± 0.5 7.3
U-75302 5434 ± 1320 2362 25 ± 4 36
20-carboxy-LTB4 >1000 >435 20 ± 2 29
6-trans LTB4 (trans stereoisomer of LTB4) >1000 >435 336 ± 15 480
5-oxo-ETE >1000 >435 >1000 >1429
[S]5-HETE >3000 >1304 >20000 >28571
[±]5-HETE >1000 >435 >1000 >1429
20-HETE >1000 >435 >10000 >14285
8[R]-HETE >1000 >435 >30000 >42857
5,6-dehydroarachidonic acid >1000 >435 >1000 >1429
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
24
Lipoxin-A4 1400 ± 110 609 1440 ± 190 2057
monteluskast >10000 >4350 >10000 >14285
zafirlukast >10000 >4350 >7124 >10177
LTC3 >4000 >1739 >14000 >20000
LTC4 >9000 >3913 >1900 >2714
LTC5 >3000 >1304 >30000 >42587
LTD3 >1000 >435 >30000 >42587
LTD4 >10000 >4350 >4000 >5714
LTD5 N/A >30000 >42587
LTE3 >4000 >1739 >30000 >42587
LTE4 >6000 >2608 >2370 >3387
LTF4 >6000 >2608 >5700 >8142
LTA3-ME >30000 >13040 >5000 >7142
LTA4-ME >10000 >4350 >30000 >42587
LTA5-ME N/A >30000 >42587
3H-LTB4, at 0.25 nM, was displaced by indicated leukotrienes or compounds from membranes prepared from COS-7 cells
transfected with either pCR3.1-LTB4-R1 or pCR3.1-LTB4-R2. Ki values are calculated for individual compound by using Ki =
EC50/(1 + [3H-LTB4]/Kd) (42), where [3H-LTB4] is the concentration of the radioligand used in the assay, KD is the affinity of the
radioligand for the receptor (0.2 nM) and EC50 is determined by non-linear regression analysis of the binding data. Results are
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
25
represented as mean ± SE from two to four independent experiments performed in duplicate. Ki/Ki(LTB4) denotes relative affinity of
ligands in respect to that of LTB4. The cDNA of LTB4-R1 was generated in a PCR with primers oligo417 and oligo418 with human
spleen cDNA as a template. The thermal cycling profile was 93 oC, 30 sec; 63 oC, 30 sec; 72 oC, 90 sec (35 cycles). The cDNA was
then cloned in expression vector pCR3.1. by guest on A
pril 12, 2018http://w
ww
.jbc.org/D
ownloaded from
26
Figure legends:
Figure 1. Identification of LTB4-R2. (A) Cloning of LTB4-R2. Four steps are indicated to
obtained the full length ORF of LTB4-R2 from partial ORF sequences. The shaded bars
denote individual sequences identified at each step. Arrows indicate the PCR primers
used in the directions as shown. The nucleotide sequence of the ORF obtained at the final
step (~1.1 kb) is shown (accession # here when available). (B) Amino acid sequence
alignment of LTB4-R2 with LTB4-R1 based on the J. Hein method (19). The shaded areas
indicate the residues that match the consensus sequence exactly. Transmembrane
domains are underlined. Potential N-terminal glycosylation site is indicated by “*”. The
two Cys residues that may form a disulfide bond are indicated with “#”.
Figure 2. Genomic organization of the LTB4-R2/LTB4-R1 locus and various mRNAs. (A)
The genomic organization of the LTB4-R2/LTB4-R1 locus. The portion of the genomic
sequence contains both LTB4-R2 and LTB4-R1 receptors, and is identical to AL096870.
The solid bar connecting LTB4-R2 and LTB4-R1 indicates the 3.6-kb intron that is
located at nucleotide 1142 of the LTB4-R2 mRNA. (B) The alignment of the LTB4-R2
transcript with the genomic sequence shown in (A) (AL096870). Relative to the reverse
compliment of AL096870, LTB4-R2 spans from nucleotides 121,344 to 122,255. The
bent dashed line indicates the absence of the intron. (C) The alignment of the transcript
D89079 with the genomic sequence. Relative to the reverse compliment of AL096870,
D89079 spans nucleotides 122,183 to 122,491 and nucleotides 126,318 to
127,630.(16,22). (D) The alignment of U33448 (16,22) with the genomic sequence.
Relative to the reverse complimet of AL096870, U33448 spans nucleotides 125,709 to
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
27
127,808. (E) The alignment of D89078 with genomic sequence. Relative to the reverse
compliment of AL096870, D89078 spans nucleotides 123,995 to 125,702 and nucleotides
126,321 to 127,620.
Figure 3. Human tissue expression of LTB4–R2. (A) Dot blot hybridization. Human
poly(A)+ mRNA on the blot was hybridized with a 32P-labeled 440-bp probe in the 5’
untranslated region of LTB4-R2 ORF (see Fig. 1A). (B) Northern blot analysis of
expression of the LTB4-R2 receptor. The probe used in the hybridization was made from
the same DNA fragment in (A).
Figure 4. Radioligand binding of 3H-LTB4 to LTB4-R2. (A) Specific binding of radioligand
to LTB4-R2 membranes. COS-7 cells were transfected with pCR3.1-LTB4-R2 or pCR3.1
alone (mock transfection). Two days after transfection, the normal growth medium
DMEM/10%FCS was replaced by either Opti-MEM or DMEM-Opti-MEM/5%FCS. The
cells were allow to grow one more day, membranes were prepared and used in binding
assay. Solid bars represent total ligand binding and open bars represent non-specific binding
defined by inclusion of unlabeled LTB4 at 1 µM in the assays. The final concentration of
3H-LTB4 was 0.25 nM. Data are mean ± SD, n = 3. (B) Saturation binding of 3H-LTB4 to
membranes of COS-7 cells transfected with pCR3.1-LTB4-R2. Twenty-five µg of
membranes were incubated with increasing concentrations of the radioligand. Specific
binding (l) was calculated as the difference between total binding (m) and non-specific
binding defined by including 1 µM unlabeled LTB4 (o).
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
28
Figure 5. Radioligand competition assays. COS-7 cells transfected with LTB4-R2 cDNA
were harvested three days after transfection and membrane preparation from the cells were
used for the binding assays. Compounds at increasing concentration was used to compete
with 3H-LTB4 (0.25 nM). m, LTB4; l, LTB5; t, 15[S]-HETE; s, montelukast; o,
zafirlukast.
Figure 6. LTB4-R2 activation leads signal transduction. (A) Ca2+ flux in cells expressing
LTB4-R2. Two days after tranfection with LTB4-R2 cDNA or vector alone (pCR3.1, mock
tranfected), 293-EBNA cells were loaded with Fluo-3, AM and stimulated with 0.2 µM
LTB4. The intracellular Ca2+ flux was measured with a FLIPR instrument. Curves indicate
Ca2+ responses for LTB4-R2 (solid line) and mock (dashed line) transfected cells. (B)
Inhibition of forskolin-stimulated cAMP production by LTB4 in 293 cells expressing LTB4-
R2. Transfected cells were incubated in the presence of 10 µM forskolin alone (control) and
LTB4 at indicated concentrations. The basal and forskolin-stimulated cAMP levels were 8 ±
3 pmol/well (n = 8) and 198 ± 27 pmol/well (n = 8), respectively. Symbols denote
incubation with (m) and without (l) pertusis toxin.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Marvin Bayne and Thomas LazSuke Wang, Eric Gustafson, Ling Pang, Xudong Qiao, Jiang Behan, Maureen Maguire,
CharacterizationA Novel Hepatointestinal Leukotriene B4 Receptor: Cloning and Functional
published online September 26, 2000J. Biol. Chem.
10.1074/jbc.M004512200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
