A Novel Motif Essential for SNARE Interaction with the K+

Channel KC1 and Channel Gating in Arabidopsis W

Christopher Grefen, Zhonghua Chen, Annegret Honsbein, Naomi Donald, Adrian Hills, and Michael R. Blatt1

Laboratory of Plant Physiology and Biophysics, Institute of Molecular, Cellular and Systems Biology-Plant Sciences, University

of Glasgow, Glasgow G12 8QQ, United Kingdom

The SNARE (for soluble N-ethylmaleimide–sensitive factor protein attachment protein receptor) protein SYP121 (=SYR1/

PEN1) of Arabidopsis thaliana facilitates vesicle traffic, delivering ion channels and other cargo to the plasma membrane,

and contributing to plant cell expansion and defense. Recently, we reported that SYP121 also interacts directly with the K+

channel subunit KC1 and forms a tripartite complex with a second K+ channel subunit, AKT1, to control channel gating and

K+ transport. Here, we report isolating a minimal sequence motif of SYP121 prerequisite for its interaction with KC1. We

made use of yeast mating-based split-ubiquitin and in vivo bimolecular fluorescence complementation assays for protein–

protein interaction and of expression and electrophysiological analysis. The results show that interaction of SYP121 with

KC1 is associated with a novel FxRF motif uniquely situated within the first 12 residues of the SNARE sequence, that this

motif is the minimal requirement for SNARE-dependent alterations in K+ channel gating when heterologously expressed,

and that rescue of KC1-associated K+ current of the root epidermis in syp121 mutant Arabidopsis plants depends on

expression of SNARE constructs incorporating this motif. These results establish the FxRF sequence as a previously

unidentified motif required for SNARE–ion channel interactions and lead us to suggest a mechanistic framework for

understanding the coordination of vesicle traffic with transmembrane ion transport.

INTRODUCTION

The superfamily of SNARE (for soluble N-ethylmaleimide–sensi-

tive factor protein attachment protein receptor) proteins, found in

all eukaryotes, is essential in later stages of vesicle targeting and

fusion. They help match vesicles with their target membranes for

delivery of specific membrane proteins and cargo, and they

overcome the dehydration forces associated with lipid bilayer

fusion in an aqueous environment. These processes sustain

cellular homeostasis in yeast (Ungar and Hughson, 2003), they

are essential for synaptic transmission between nerves (Jahn

et al., 2003), and they underpin growth and development in

plants (Campanoni and Blatt, 2007; Grefen and Blatt, 2008).

Complementary SNAREs, located at the vesicle and target

membranes, interact to draw the membrane surfaces together

for fusion. SNAREs comprise theminimal set of proteins required

to accelerate fusion in reconstituted vesicle preparations (Weber

et al., 1998; Parlati et al., 1999; Hu et al., 2003), although other

components, including the N-ethylmaleimide–sensitive factor,

Sec1, Munc18, and their homologs (Burgoyne and Morgan,

2007; Sudhof and Rothman, 2009), affect SNARE conforma-

tions and their interactions (Brunger, 2005; Lipka et al., 2007;

Bassham and Blatt, 2008).

In plants, SNAREs play important roles in vesicle traffic asso-

ciated with defense against fungal pathogens (Collins et al.,

2003; Pajonk et al., 2008) and the response to bacterial elicitors

(Robatzek et al., 2006). In addition, they contribute to events

beyond their canonical roles in membrane targeting and vesicle

fusion (Grefen and Blatt, 2008). The vacuolar SNAREs SYP22

and VTI11, for example, have surfaced as components essential

for gravitopism (Kato et al., 2002; Surpin et al., 2003; Yano et al.,

2003), plausibly linking sensory processing to vacuolar mem-

brane structure or composition (Saito et al., 2005). A fewSNAREs

are known also to interact with ion channels and affect their

regulation. In neuromuscular and neuroendocrine tissues, bind-

ing of the SNARESyntaxin 1A to K+ and Ca2+ channels is thought

to facilitate neurotransmission and hormone secretion (Leung

et al., 2007). In the model plants tobacco (Nicotiana tabacum)

and Arabidopsis thaliana, the SNARE SYP121 (=SYR1/PEN1)

has been implicated in hormonal regulation of Ca2+, Cl2, and K+

channels in guard cells (Leyman et al., 1999; Sokolovski et al.,

2008), in the latter case independent of its role in delivery and

recycling of the ion channel proteins (Sutter et al., 2006, 2007).

Recently, we reported that SYP121 of Arabidopsis, originally

identified with its tobacco homolog in a screen for signaling

elements associated with abscisic acid and drought (Leyman

et al., 1999; Geelen et al., 2002), interacts directly with the

regulatory K+ channel subunit KC1 and forms a tripartite complex

with a second K+ channel subunit, AKT1 (Honsbein et al., 2009).

KC1 interaction proved highly selective for SYP121. We found

the SYP121-KC1-AKT1 complex to be required for the activity

of inward-rectifying K+ currents at the plasma membrane of

root epidermal cells and for K+ nutrient acquisition and growth

when channel-mediated K+ uptake was limiting. These results

1 Address correspondence to m.blatt@bio.gla.ac.uk.The author responsible for distribution of materials integral to thefindings presented in this article in accordance with the policy describedin the Instructions for Authors (www.plantcell.org) is: Michael R. Blatt (m.blatt@bio.gla.ac.uk).WOnline version contains Web-only data.www.plantcell.org/cgi/doi/10.1105/tpc.110.077768

The Plant Cell, Vol. 22: 3076–3092, September 2010, www.plantcell.org ã 2010 American Society of Plant Biologists

demonstrated an unexpected role for the SNARE analogous to

SNARE-ion channel complexes of mammals but unrelated to

signaling or its coupling to vesicle traffic. Thus, they raised

fundamental questions about the mechanics of interaction,

notably about the relationship of K+ channel binding to the

domains required for SNARE core complex assembly that drive

vesicle fusion. We have since identified the minimal sequence

motif harbored by SYP121 and prerequisite for its interaction

with KC1.We report here that themotif is unique to SYP121 and

localized to a region of canonical SNARE structure not previ-

ously associated with ion channel interactions. The results

show that the motif is essential for the interaction of SYP121

with KC1, and it is necessary for the SNARE to facilitate gating

in the K+ channel when expressed heterologously and in the

plant. Significantly, the identity and position of the motif within

the primary SNARE sequence points to a novel mechanism for

mutual control of SYP121-dependent membrane vesicle traffic

and of the K+ channels. Thus, the findings lead us to suggest a

novel framework for understanding the coordination of vesicle

traffic with transmembrane ion transport.

RESULTS

SYP121/SYP122 Chimeras Identify the N Terminus of

SYP121 as Essential for K+ Channel Interaction

We made use of a mating-based split-ubiquitin assay for

interacting proteins (Grefen et al., 2007, 2009) employed previ-

ously to identify SYP121 interaction with KC1 and their formation

of a tripartite complex with AKT1 (Honsbein et al., 2009). The

mating-based assay gives Met-sensitive rescue of yeast growth

on minimal medium. Because the assay relies on reassembly of

the N- and C-terminal halves (Nub and Cub) of the ubiquitin

moiety and cleavage of a LexA-VP16 transactivator, which then

migrates to the nucleus, it permits work with full-length, integral

membrane proteins. Our previous studies showed that KC1

bound selectively with SYP121 and not with SYP122, the closest

homolog to SYP121, with 64% amino acid sequence identity

with which it shares partial functional redundancy in vivo (Assaad

et al., 2004; Zhang et al., 2007; Bassham and Blatt, 2008). To

identify the binding domain responsible for SYP121 interaction,

we therefore made initial use of complementary sets of con-

structs to generate chimeric proteins in which segments of the

chimeric SNAREs corresponded to different combinations of the

SYP121 or SYP122 residue sequences.

Figure 1 shows the yeast mating-based split-ubiquitin assay

and supporting immunoblot data from one of three independent

experiments, each of which yielded equivalent results. Like other

Qa-SNAREs (Lipka et al., 2007; Grefen and Blatt, 2008; Sudhof

and Rothman, 2009), both SYP121 and SYP122 are type-II

integral membrane proteins comprising a C-terminal membrane

anchor, an H3 coiled-coil domain that binds with its cognate

SNARE partners to drive vesicle fusion, and an N-terminal set of

coiled-coil domains (Ha, Hb, and Hc) that folds back on the H3

domain and regulates its accessibility for binding. For purposes

of preliminary analysis, we divided the SNAREs between four

regions: N corresponding to the N-terminal 39–amino acid

Figure 1. SNARE Interaction with the KC1 K+ Channel Depends on the

Presence of the N Terminus of SYP121.

Yeast mating-based split-ubiquitin assay for interaction of the SNARE

chimeras with KC1-Cub as the bait. SNARE chimeras of SYP121 and

SYP122 were constructed by exchange of four domains designated N, H,

Q, and C, indicated above, corresponding to the N-terminal 39–amino acid

residues, the Ha, Hb, and Hc a-helices, the H3 or Qa a-helix, and the

transmembrane a-helix and C-terminal extension, respectively. Segment

alignments (above) for the two SNAREs at the junction points are shown

with arrows indicating the domain breaks. Yeast diploids created with

NubG fusion constructs of each chimera (left) and with SYP121 (in gray

font) and SYP122 (in black font) for reference together with controls

(negative, NubG; positive, wild-type Nub) spotted (left to right) on CSM

medium without Trp, Leu, and uracil (CSMwlu) to verify mating, CSM

without Trp, Leu, uracil, adenine, His, and Met (CSMwluahm) to verify

adenine- and His-independent growth (second panel), and on CSMwluahm

with the addition of 0.2 mM Met to verify interaction at lower KC1-Cub

expression levels (Obrdlik et al., 2004; Grefen et al., 2009). Diploid yeast

was dropped at 1.0 and 0.1 OD600 in each case. Immunoblot analysis

(5 mg total protein/lane) of the haploid yeast used for mating is included

(right) using commercial VP16 antibody for KC1 and both SYP121 and

SYP122 polyclonal antibodies for the SNARE chimeras, the latter showing

association of the principle epitopes with the Ha-Hb-Hc domains of the

SNAREs.

SNARE-K+ Channel Interaction Motif 3077

residues preceeding the Ha a-helix; H corresponding to the Ha,

Hb, andHca-helices (residues 40 to 192); Q (residues 193 to 283)

corresponding to the H3 a-helix terminating with the conserved

Thr residue at position 283; and C corresponding to the remaining

C-terminal sequence (residues 284 to 346) that incorporated the

transmembrane a-helix and an extended stretch of residues that

are predicted to reside outside the cell (Blatt et al., 1999; Leyman

et al., 1999). As before (Honsbein et al., 2009), a readout of

interactionwas evidenced by growth of diploid yeast on selective

media when they expressed both the KC1-Cub and Nub-

SYP121 fusion proteins, and growth was retained in the pres-

ence of 0.2 mMMet to repress transcription of the KC1-Cub bait

construct. Little or no growth was recovered on selective media

and in the presence of Met when yeast carrying KC1-Cub and

Nub-SYP122 were mated. Among the SYP121-SYP122 chi-

meras, growth was recovered in all matings incorporating fusion

constructs with the N domain of SYP121, even when the H, Q,

and C domains were derived from SYP122, and substitution with

the SYP122 N domain virtually eliminated growth when mated

with yeast carrying the KC1-Cub bait. Immunoblot analysis in

every case showed expression of the chimeric SNAREs, al-

though, as expected, the efficacy of the polyclonal antibodies

depended on the relative distribution of epitopes between the

two SNARE sequences in the chimeras. Expression of KC1 was

verified by rescue of diploid yeast growth with the wild-type Nub

and by immunoblots for the VP16 epitope of the fusion protein in

the THY.AP4 yeast prior to mating. Thus, we concluded that the

N-terminal 39 amino acids harbor a motif that is both sufficient

and necessary for SNARE interaction with the KC1 K+ channel.

Alignment of SYP121 and SYP122 shows that the N-terminal

amino acid sequences of the SNAREs diverge principally in three

short segments of 4 to 10 residues each, denoted in the lower-

case suffixes n1, n2, and n3 (Figure 2). We used these segments

as the basis for constructing a second round of chimeras. In the

first instance, we substituted the n1, n2, and n3 segments from

SYP122 into the corresponding positions in the backbone of the

Nub-SYP121 fusion construct. In a second set of experiments,

we used as a backbone the fusion construct comprising the N

domain of SYP121 and the H, Q, and C domains of SYP122 that

retained the capacity to rescue yeast growth in conjunction with

KC1-Cub (Figure 1). Figure 2 shows the readout from experi-

ments using each of these backbones along with supporting

immunoblot analyses. In both cases, an interactionwith KC1was

indicated for constructs that incorporated the n1 segment of

SYP121 by the rescue of yeast growth on selective media and in

the presence of Met, whereas substitutions with the n1 segment

of SYP122 showed a loss of yeast growth. Substitutions with

either the n2 or n3 segment from SYP122 had no appreciable

effect on the rescue of yeast growth. In short, these results

indicated that residues within the N-terminal 20 amino acids

were essential for SYP121 interaction with KC1.

The SYP121 N Terminus Is Essential for K+ Channel Gating

When Heterologously Expressed

KC1 is a so-called silent K+ channel subunit; expressed on its

own, it does not yield measurable K+ currents, but it interacts

with different inward-rectifying K+ channel subunits including

AKT1 (Obrdlik et al., 2004; Duby et al., 2008) to affect the voltage

dependence of channel gating (Geiger et al., 2009). AKT1 and

KC1 preferentially assemble in heteromers (Duby et al., 2008),

and in vivo these assemblies coalesce with SYP121 to yield

functional K+ currents (Honsbein et al., 2009). When expressed

Figure 2. SNARE Interaction with the KC1 K+ Channel Depends on the

Presence of the n1 Segment of the SYP121 N-Terminal Domain,

Corresponding to Amino Acid Residues Ser10-Pro17.

Yeast mating-based split-ubiquitin assay for interaction of the N-terminal

domain chimeras with KC1-Cub as the bait. N-terminal domain chimeras

were constructed by exchange of three segments designated n1, n2, and

n3, each comprising a sequence of 4 to 10 residues of SYP121 and

SYP122. Chimeras were constructed both in SYP121 and in the N1HQC2

domain chimera of SYP121 and SYP122 (see Figure 1). Alignment of the

segments for the two SNAREs within the N-terminal domain is shown

(above) with the segments as indicated. Yeast diploids created with

NubG-fusion constructs of each chimera and with controls (negative,

NubG; positive, wild-type Nub [NubWt]) spotted (left to right) on CSM

medium without Trp, Leu, and uracil (CSMwlu) to verify mating, CSM

without Trp, Leu, uracil, adenine, His, and Met (CSMwluahm) to verify

adenine- and His-independent growth (second panel), and with the

addition of 0.2 mMMet to verify interaction at lower KC1-Cub expression

levels (Obrdlik et al., 2004; Grefen et al., 2009). Diploid yeast was

dropped at 1.0 and 0.1 OD600 in each case. Immunoblot analysis (5 mg

total protein/lane) of the haploid yeast used for mating are included on

the right in each case using commercial VP16 antibody for KC1 (below)

and both SYP121 and SYP122 polyclonal antibodies for the SNARE

chimeras as in Figure 1.

3078 The Plant Cell

heterologously on its own or with KC1, AKT1 does yield an

inward-rectifying K+ current (Gaymard et al., 1996; Duby et al.,

2008). However, the gating of channels assembled as heteromers

of AKT1 and KC1, like that of the homomeric AKT1 channels,

differs fundamentally from that of the K+ channels in vivo, a

difference evident in the midpoint for channel activation (V1/2) and

sensitivity to a change in voltage (the gating charge, d) (Dreyer and

Blatt, 2009), unless coexpressed with SYP121 (Honsbein et al.,

2009).

We used these characteristics to explore the functional con-

sequences of selected SYP121 chimeras identified by the split-

ubiquitin experiments. Electrophysiological recordings were

performed under voltage clamp after coexpressing KC1 and

AKT1 together with the SYP121 mutants in Xenopus laevis

oocytes and verifying expression of the SNAREs. To ensure

activation of AKT1 in the oocytes, all combinations of channel

subunits and SNAREs were coexpressed with the protein kinase

CIPK23 and calcineurin-like activator CBL1 (Li and Luan,

2006; Xu et al., 2006). We extracted the gating charac-

teristics V1/2 and d in each case by jointly fitting the steady state

K+ currents to a Boltzmann function of the form

IK ¼ gmax

�V2EK

�=�1þ edðV2V1=2Þ=RT� ð1Þ

where gmax is the conductance maximum, V is the membrane

voltage, EK is the equilibrium voltage for K+, and R and T have

their usual meanings.

As before (Honsbein et al., 2009), we found that expressed

alone, AKT1 yielded an anomalous K+ current measurable at

voltagesnegative of250mV; expressingAKT1 togetherwithKC1,

with or without (data not shown) the noninteracting SNARE

SYP122, gave a K+ current measurable only at voltages negative

of 2140 mV (Figure 3). To avoid substantial indetermination in

fitted parameters obtained from these data and from subsequent

analyses (see also Figures 11 to 14),we applied standardmethods

of joint fittings with key parameters held in common between data

sets (curves) (Press et al., 1992) and introduced the minimal

assumption of parameters for known (control) data sets consistent

with previous analyses and observations that KC1 coexpression

does not affect significantly the saturation current or gating charge

of the K+ channels, only the value for V1/2 (Duby et al., 2008;

Honsbein et al., 2009). On analysis, these currents werewell-fitted

jointly to the Boltzmann function in every case with a gating

charge, d, near a value of unity andwith onlyV1/2 differing between

the two circumstances (Figures 3 and 4). Fittings of currents

Figure 3. Coexpression with SYP121 Selectively Rescues AKT1-KC1 K+

Current in Xenopus Oocytes.

(A) Current traces and steady state current–voltage curves recorded

under voltage clamp in 96 mM K+ from oocytes expressing KC1 alone

(squares), AKT1 alone (diamonds), AKT1 with KC1 (molar ratio 1:1) alone

(downward-facing open arrowheads), and with the SNAREs and SNARE

chimeras (molar ratio to KC1, 2:1; see Honsbein et al., 2009) SYP121

(upward-facing open arrowheads), N1HQC2 (upward-facing closed ar-

rowheads), N2HQC1 (downward-facing closed arrowheads), and

SYP121n1 incorporating the n1 sequence from SYP122 (circles). Data

for SYP122 omitted for clarity (see Figure 4). Insets: Corresponding

whole-cell currents cross-referenced by symbol. Clamp cycles: holding

voltage, �20 mV; voltage steps, 0 to �190 mV. Scale: 4 mA and 3 s.

Currents from oocytes injected with water and with SYP121 cRNA only

gave results similar to those for KC1 alone. All measurements were

performed in coexpression with CBL1 and CIPK23, which are essential

for AKT1 function in oocytes, using cRNA injections in 1:1:1 molar ratios

with AKT1 (Xu et al.,.2006). Solid curves are the results of joint, nonlinear

least squares fitting of the K+ currents (IK) to the Boltzmann function

(Equation 1) and are summarized in Figure 4. The characteristic voltage

dependence (V1/2) indicates the midpoint of the voltage range for gating,

and the apparent gating charge (d) is a unique property of the gate, its

sensitivity to voltage changes and the associated conformations. Best

fittings were obtained with gmax held in common (gmax for the data

shown, 48 6 9 nS) and with separate, joint values for d between SNARE

chimeras that showed interaction with KC1 and those that did not (see

Figures 1 and 2). Similar results were obtained in each of four indepen-

dent experiments (>24 oocytes for each set of constructs). Both analysis

and visual inspection showed an increase in d and shift in V1/2 on

inclusion of SYP121 and the interacting chimeras with AKT1 and KC1.

(B) Verification of SNARE protein expression. Immunoblot analysis of

total membrane protein (10 mg/lane) extracted from oocytes collected

after electrical recordings and detected with aSYP121 and aSYP122

antibodies (Tyrrell et al., 2007; Honsbein et al., 2009).

SNARE-K+ Channel Interaction Motif 3079

recorded on coexpression of KC1with AKT1 generally yieldedV1/2

values near the limit of clamp voltages achievable in oocytes.

CoexpressingAKT1andKC1withwild-typeSYP121 that interacts

with KC1 (Figure 1; see also Honsbein et al., 2009), by contrast,

yielded a K+ current at voltages negative of 2100 mV that was

well-fitted to the same Boltzmann function, but with values for d

near 2 and V1/2 close to 2150 mV (Figures 3 and 4). These

characteristics were similar to those reported previously on het-

erologous expression in oocytes andSf9 insect cells and compare

favorably with the characteristics of K+ currents obtained in vivo

(Gassmann and Schroeder, 1994; White and Lemtirichlieh, 1995;

Buschmann et al., 2000; Honsbein et al., 2009).

We found a similar and strong divergence of gating character-

istics that paralleled the SNARE–KC1 interactions when compar-

ing the gating parameters of the currents recorded with the

SNARE chimeras (Figures 3 and 4). Coexpressing AKT1 and KC1

with the SYP121-SYP122 chimera N1HQC2 yielded K+ currents

with V1/2 and d values similar to those associated with the wild-

type SYP121, whereas coexpressing AKT1 and KC1 with the

N2HQC1chimera gavecurrent characteristics that aligned closely

with those obtained on coexpressing AKT1 and KC1 alone. Much

the same separation of gating characteristics was observed on

expressing the SYP121 incorporating the n1 segment substitution

fromSYP122. In this case, values for V1/2 and d aligned with those

derived from currents on expressing AKT1 with KC1 alone or with

SYP122. Thus, analysis of channel gating yielded unequivocal

evidence of the functional requirement for the SYP121 N terminus

to affect gating of the K+ channels and paralleled the results of the

yeast mating-based split-ubiquitin screen.

The SYP121 N Terminus Determines SYP121–KC1

Interaction in Vivo

Interactions on heterologous expression in yeast and in Xenopus

oocytes do not rule out the possibility that additional compo-

nents unique to the plant might be important in stabilizing or

directing other domain interactions between SYP121 and KC1.

We therefore made use of a bimolecular fluorescence comple-

mentation (BiFC) assay (Walter et al., 2004) to test these inter-

actions in vivo. Constructs incorporating the open reading

frames for KC1, SYP121, SYP122, and selected SYP121-

SYP122 chimeras fused to the N- and C-terminal halves of

yellow fluorescent protein (YFP) were used to transform Agro-

bacterium tumefaciens and were transiently expressed in Arabi-

dopsis root epidermis by cocultivation (Grefen et al., 2010). We

transformed both the wild type and the syp121 (=pen1-1/

syp121-1) mutant Arabidopsis as a check against possible

interference by higher levels of expression of the native SNARE.

The syp121 mutation introduces a premature stop codon within

the coding sequence of the gene that results in a loss of SNARE

protein expression (Zhang et al., 2007; Pajonk et al., 2008).

Because plant ion channels generally express at levels too low

for detection by fluorescence microscopy, expression was

driven by the constitutive Arabidopsis Ubiquitin-10 gene pro-

moter (Grefen et al., 2010). There is a potential for mistargeting

when a protein is overexpressed. Nonetheless, ion channel dis-

tributions, and that ofmost SNAREs, generally alignwith the native

Figure 4. Coexpression with SYP121-SYP122 Chimeras That Interact

with KC1 Selectively Rescue the Gating Parameters Associated with

SYP121 and the AKT1-KC1 K+ Current in Xenopus Oocytes.

Summary of K+ channel gating parameters of gating charge (A) and V1/2 (B)

recorded from oocytes expressing AKT1 with KC1 in combinations with

SYP121, SYP122, and their chimeras. Data are means6 SE obtained from

joint fittings to Equation 1 of four or more independent data sets in each

case, including the data of Figure 3. Fittings performed by nonlinear least

squares minimization (Marquardt, 1963) with the conductance maximum

gmax held in common within each data set and the apparent gating charge

(d) allowed to vary between SNAREs and chimeras that interact with KC1

and those that do not. Data for SYP121 and the chimera N1HQC2 are

statistically different from the other data sets with P < 0.01.

3080 The Plant Cell

protein in vivo when driven by the constitutive promoter (Uemura

et al., 2004; Sutter et al., 2006, 2007; Grefen et al., 2010).

We used confocal laser scanning microscopy to quantify and

compare fluorescence signals and their distributions obtained

on expressing the KC1-cYFP fusion with different combina-

tions of SNARE fusions. Confocal stacks were used to derive

three-dimensional image projections, and these images were

then analyzed for YFP fluorescence intensity after background

subtraction. As before (Honsbein et al., 2009), we found pro-

nounced YFP fluorescence over background in Arabidopsis

epidermal cells, both in wild-type and syp121 plants, when

transformed with complementary BiFC constructs fused to KC1

and to thewild-type SYP121, but not to SYP122 (Figures 5 and 6;

see Supplemental Movies 1 to 3 online). In each of three,

independent experiments, cotransformations of KC1-nYFP

with the SYP121-SYP122 chimera N1HQC2 fused to cYFP

yielded a fluorescence signal comparable with that of the wild-

type SYP121-cYFP fusion; cotransformations of KC1-nYFP with

cYFP fusions of the N2HQC1 chimera resulted in fluorescence

signals close to background, although expression of the fusion

constructs in these instances was confirmed by immunoblot

analysis (see Figure 10). In principle, BiFC could yield false-

positive interactions as a consequence of overexpression. How-

ever, moderate expression driven by the Ubiquitin-10 promoter

(Grefen et al., 2010) and the absence of an interaction, among

others with the close homolog of SYP121 and the noninteracting

SYP121-SYP122 chimeras, militates against this idea. Addition-

ally, we found the YFP fluorescence was restricted to the cell

periphery and failed to recover after local photobleaching (Figure

7; see Supplemental Movie 4 online), indicating that, like the KC1

complex with wild-type SYP121, interacting assemblies with the

SYP121 mutants were not mobile within the cytosol or within a

circulating endomembrane compartment. Thus, we conclude

that the N terminus of SYP121 is a primary determinant of the

physical interaction between KC1 and SYP121 in vivo.

Figure 6. Analysis of the Interaction of KC1 with SYP121 N Terminus.

Mean fluorescence intensity (arbitrary units) 6 SE for BiFC of KC1 with

SYP121, SYP122, and SYP121-SYP122 chimeras (Figures 1 to 4) ex-

pressed as fusion constructs with N- and C-terminal halves of YFP after

correction for background of (nontransformed) control measurements.

Data from six independent experiments (n > 18 seedlings for each set of

constructs) derived from three-dimensional reconstructions of fluores-

cence image stacks, including those of Figure 5. No appreciable differ-

ence was observed in data from wild-type and syp121 mutant

Arabidopsis, and the results have been pooled. Expressing KC1-nYFP

on its own yielded a fluorescence signal statistically equivalent to the

background and signals from KC1-nYFP coexpressed with SYP122-

cYFP and N2HQC1-cYFP were only marginally higher. Coexpression

with N1HQC2-cYFP gave fluorescence indistinguishable from that

obtained on coexpression with SYP121-cYFP. See Figure 10 for immu-

noblot analysis of cYFP fusion constructs. Data for SYP121 and the

chimera N1HQC2 are statistically different from the other data sets with

P < 0.01.

Figure 5. Interaction of KC1 with SYP121 in Vivo Depends on the N

Terminus of the SNARE.

BiFC of KC1 with SYP121 and the SYP121-SYP122 chimeras N1HQC2

and N2HQC1 expressed in the root epidermis of syp121 mutant

Arabidopsis plants as fusion constructs with the N- and C-terminal

halves of YFP (nYFP and cYFP), respectively. Similar results were

obtained in each of three independent experiments in both mutant and

wild-type Arabidopsis (pooled data summarized in Figure 6). Images for

each combination of constructs are single-plane bright-field ([A], [E], and

[I]), bright-field plus YFP fluorescence ([B], [F], and [J]) and YFP

fluorescence only ([C], [G], and [K]), and three-dimensional projections

from fluorescence image stacks ([D], [H], and [L]). Bar = 50 mm. See also

Supplemental Movies 1 to 3 online.

SNARE-K+ Channel Interaction Motif 3081

The FxRF Residues Define a Minimal Motif for

SYP121–KC1 Interaction

To identify the residues critical for KC1 interaction, we sequen-

tially mutated each of the eight amino acids between Ser-10 and

Pro-17, corresponding to the n1 domain, of the wild-type Nub-

SYP121 fusion to Ala before retransforming yeast with the

site-mutated construct for mating and interaction analysis with

KC1-Cub. Immediately preceding the N terminus of the n1

segment, the Phe at position 9 is highly conserved among Qa-

SNAREs, not only those of Arabidopsis and other plants but also

of yeast and mammals (see Figure 15 and Discussion). There-

fore, we extended the analysis to include the Phe residue at

position 9. Figure 8 summarizes the readouts for KC1–Cub

interaction with these Nub-SYP121 single-site mutants and the

corresponding immunoblot analysis verifying expression of the

SNARE and KC1 fusion proteins. Of the nine SNARE mutants,

yeast growthwas lost following site substitutionswith Ala at Phe-

9, Arg-11, and Phe-12, indicating that substitutions at each of

these residues interfered with the interaction between the

SNARE and KC1. Significantly, an equivalent substitution of

Arg-13 had no effect on yeast growth, nor was growth sup-

pressed following replacements affecting the peptide backbone

angle and negative charge with P17A and E16A, respectively.

To assess the requirement for the FxRFmotif in vivo, we made

use of BiFC as before by transient transformation with A.

tumefaciens. Again, no differences in BiFC signal were observed

in syp121 mutant Arabidopsis compared with the wild type, and

these data were therefore pooled. Fluorescence signals were

quantified by confocal laser scanning microscopy and their

distributions obtained on expressing the KC1-nYFP fusion with

different combinations of SNARE fusions was compared. The

results (Figures 9 and 10) showed a pronounced YFP fluores-

cence over background in Arabidopsis epidermal cells when

transformed with complementary BiFC constructs fused to KC1

and to the wild-type SYP121, but not to SYP122. In each of three

independent experiments, cotransformations of KC1-nYFP with

the SYP121-S10A mutant fused to cYFP yielded a fluorescence

signal comparable with that of the wild-type SYP121-cYFP

fusion, but cotransformations with cYFP fusions of the other

SYP121 site mutants resulted in fluorescence signals that were

statistically indistinguishable from background. Expression of

the fusion constructs in each casewas confirmed by immunoblot

analysis. Thus, we conclude that the FxRF motif of SYP121 is a

primary determinant of the physical interaction betweenKC1 and

SYP121 in vivo.

The FxRF Motif Determines SNARE Control of Channel

Gating and K+ Current Rescue in the Plant

We used the Ala substitutionmutants in each of the four residues

from F9 to F12 of SYP121 to assess their functional impact on K+

channel gating, quantified using the parameters of V1/2 and the

gating charge d. As before, electrophysiological recordings were

performed under voltage clamp after coexpressing KC1 and

AKT1 together with the SYP121 mutants in Xenopus oocytes,

including the protein kinase CIPK23 and calcineurin-like activa-

tor CBL1 (Li and Luan, 2006; Xu et al.,2006), and gating

Figure 7. The Interacting Complex of SYP121-SYP122 Chimera N1HQC2

with the K+Channel KC1 Is Localized to theCell Periphery and IsNonmobile.

Fluorescence recovery after photobleaching in Arabidopsis syp121 mu-

tant root epidermis expressing N1HQC2-cYFP and KC1-nYFP to yield a

BiFC signal.

(A) Bright-field (left column), composite (middle column), and YFP

fluorescence (right column) images taken at time points before and after

local photobleaching (area indicated by dotted rectangle, center row,

left) of the fluorophore. Images collected at times indicated in each frame

relative to the time of photobleach. Bar = 10 mm. See Supplemental

Movie 4 online for the complete time series.

(B) Fluorescence recovery after photobleaching analysis of the fluores-

cence signal taken from the regions indicated (inset) after normalization

and correction for fluorescence decay. Gray bar indicates the period of

photobleaching. Solid curves are the results of nonlinear least squares

fitting of the postbleach fluorescence signals to single exponential

functions yielding an immobile fraction of 0.94. Similar results were

obtained in each of four separate experiments and with BiFC fluores-

cence signals obtained with SYP121n2-cYFP and wild-type SYP121-

cYFP paired with KC1-nYFP (data not shown; see Honsbein et al., 2009)

yielding a mean immobile fraction of 0.92 6 0.04.

3082 The Plant Cell

characteristics were extracted from steady state K+ current–

voltage curves by jointly fitting to a Boltzmann function (Equation

1). As with the SYP121-SYP122 chimeras, we found a strong

divergence in gating characteristics of the SYP121 site mutants

that paralleled their ability to interact with KC1. When expressed

together with AKT1 and KC1, the SYP121-S10Amutant yielded a

K+ current similar to that of the wild-type SNARE, showing an

appreciable steady state current amplitude at voltages negative

of 2100 mV. Fitted to the Boltzmann function, these data gave

values for d near 2 andV1/2 close to2150mV (Figures 11 and 12),

statistically equivalent to those for the wild-type SNARE. By

contrast, coexpressionwith the SYP121 sitemutants F9A, R11A,

and F12A each yielded K+ currents similar to those recorded on

expressing AKT1 and KC1 alone and gave corresponding values

for V1/2 negative of –200 mV and d values close to unity. Analysis

Figure 8. SYP121 Interaction with the KC1 K+ Channel Depends on

Residues Phe-9, Arg-11, and Phe-12.

Yeast mating-based split-ubiquitin assay for interaction between the

KC1-Cub bait and Nub-SYP121 prey carrying substitutions with Ala at

the sites indicated (left) and with controls (negative, NubG; positive,

wild-type Nub [NubWt]) and with wild-type SYP121 and SYP122 for

reference. The N-terminal amino acid sequences of SYP121 and

SYP122 included with the n1 segment indicated (above) for reference.

Diploid yeast spotted (left to right) on CSM medium without Trp, Leu,

and uracil (CSMwlu) to verify crossing, CSM without Trp, Leu, uracil,

adenine, His, and Met (CSMwluahm) to verify adenine- and His-inde-

pendent growth, and with the addition of 0.2 mM Met to verify

interaction on suppressing KC1-Cub expression levels (Obrdlik et al.,

2004; Grefen et al., 2009). Diploid yeast was dropped at 1.0 and 0.1

OD600 in each case. Immunoblot analysis (5 mg total protein/lane) of the

haploid yeast used for mating is included on the right in each case

using commercial VP16 antibody for KC1 and SYP121 polyclonal

antibodies for the SNARE mutants. Note the presence of growth under

Met suppression for the SYP121 site mutants S10A, R13A, S14A,

G15A, E16A, and P17A.

Figure 9. Interaction of KC1 with SYP121 in Vivo Depends on Residues

of the FxRF Motif of SNARE.

BiFC analysis of KC1 association with SYP121 site mutants expressed

in Arabidopsis root epidermis as fusion constructs with the N- and

C-terminal halves of YFP (nYFP and cYFP), respectively. Similar results

obtained in each of four independent experiments (see Figure 10).

Images shown for combinations of KC1-nYFP with the SYP121 site

mutants F9A, S10A, and R11A are single-plane bright-field ([A], [E], and

[I]), bright-field plus YFP fluorescence ([B], [F], and [J]) and YFP

fluorescence only ([C], [G], and [K]), and three-dimensional reconstruc-

tions from fluorescence image stacks ([D], [H], and [L]). Bar = 50 mm.

See also Supplemental Movies 5 to 7 online.

SNARE-K+ Channel Interaction Motif 3083

of channel gating thus showed the functional requirement for the

FxRF motif of SYP121 to alter the gating of the K+ channels.

To validate the impact of the SYP121 FxRF motif on the K+

currents and channel gating in the plant, we made use of voltage

clamp recordings from syp121 mutant Arabidopsis plants. Our

previous studies (Honsbein et al., 2009) showed that the SNARE

mutant, like the null mutants kc1-2 and akt1-1, resulted in a loss

of inward-rectifying K+ current in the root epidermis; the K+

current was recovered in the syp121 mutant background when

complemented with the wild-type transgene under control either

of its own or a constitutive promoter. Therefore, we reasoned that

the K+ current should similarly recover in the syp121 background

when complemented with the SYP121 single-site mutant S10A,

which retained the ability to interact with KC1, but not with the

F9A, R11A, and F12A mutants that failed to interact with KC1.

Measurements were performed using two-electrode voltage

clamp methods on root epidermis of Arabidopsis. We compared

K+ currents from wild-type and syp121 mutant plants, and

syp121 mutant seedlings transformed with the four SYP121

single-site mutants under control of a constitutive promoter. We

also used syp121 mutant seedlings transformed with wild-type

SYP121 and SYP122 as positive and negative controls, respec-

tively. To confirm transformations on a cell-by-cell basis, each of

the SNARE constructs was cloned into a bicistronic binary vector

with two, independent expression cassettes, both localized on

the same T-DNA and each under the control of the Arabidopsis

Ubiquitin-10 gene promoter, one of which was used to drive the

expression of a cytosolic green fluorescent protein (GFP)marker.

Epidermal cells expressing the GFP marker were identified

visually under epifluorescence illumination and were impaled

using multibarrelled microelectrodes for standard two-electrode

voltage clamp recordings (Blatt, 1987; Blatt and Gradmann,

1997). Mature epidermal cells of Arabidopsis roots are not

coupled through plasmodesmata (Duckett et al., 1994), thus

enabling in situ recordings from these single cells. Nonetheless,

root hairs can introduce a substantial and local current sink in

electrical recordings (Meharg et al., 1994). Therefore, to avoid

problems of voltage control associated with nonhomogeneous

current spread, we made use of epidermal cells in files lacking

root hairs. Finally, to check against mistargeting of the mutant

SNAREs, we also performed parallel transformations using

fluorescently tagged constructs.

Figure 13 shows representative measurements fromwild-type

and syp121 mutant plants and from the various complementa-

tions of the syp121mutant line. Similar results were obtained in at

least six independent experiments in every case and are sum-

marized in Figure 14. Wild-type plants showed currents under

voltage clamp typical of the inward-rectifying K+ channels in the

root epidermis (Honsbein et al., 2009). This current, relaxed with

half-times of 300 to 400 ms, was evident principally at voltages

near and negative of 2120 mV and, on analysis, yielded the

characteristic gating parameters for d near 2 and V1/2 close to

2160 mV (Figure 14). The inward-rectifying K+ current was not

evident in recordings from the syp121 mutant nor in syp121

mutant plants transformed with constructs encoding SYP122

(data not shown; seeHonsbein et al., 2009) or the SYP121 single-

site mutations F9A and F12A, except at voltages negative of

2200 mV; a small but persistent current was recorded from

syp121 mutant plants transformed with the R11A mutant of

SYP121 but, again, only when the clamp range was extended to

voltages negative of2200 mV. By contrast, an inward-rectifying

K+ current similar to that of the wild-type plants was observed in

every case in recordings from syp121 mutant plants when

Figure 10. Interaction of KC1 with SYP121 in Vivo Depends on Residues

of the FxRF Motif of SNARE.

(A) Mean fluorescence intensity (arbitrary units)6 SE for BiFC of KC1 with

SYP121, and SYP121 single-site mutations (Figures 8 and 9) expressed as

fusion constructs with N- and C-terminal halves of YFP after correction for

background of (nontransformed) control measurements. Data from three

independent experiments (n > 16 seedlings for each set of constructs)

derived from three-dimensional projections of fluorescence image stacks,

including those of Figure 9. Expressing KC1-nYFP on its own yielded a

fluorescence signal statistically equivalent to the background, and signals

from KC1-nYFP coexpressed with the SYP121 site mutants apart from

S10A-cYFP were similar. Coexpression with S10A-cYFP gave fluores-

cence indistinguishable from that obtained on coexpression with SYP121-

cYFP in the same experiments. Data for SYP121 and the S10A mutant are

statistically different from the other data sets with P < 0.01.

(B) Verification of SNARE protein expression. Immunoblot analysis of

total membrane protein (10 mg/lane) extracted from syp121 mutant

Arabidopsis seedlings expressing the various cYFP fusion constructs

and detected with aSYP121 and aSYP122 antibodies (Tyrrell et al., 2007;

Honsbein et al., 2009). Membrane protein extracted from untransformed

wild-type Arabidopsis seedlings included as a control. The wild-type,

chimera, and single-site mutant fusion proteins run close to the pre-

dicted 47-kD molecular mass. The native SYP121 protein yields a band

consistent with its 38-kD molecular mass.

3084 The Plant Cell

complemented with the construct encoding the S10A mutant of

SYP121. Furthermore, analysis of currents from plants trans-

formed with the S10A mutant showed gating parameters that

aligned closely with those derived from the wild-type plants and

from syp121 mutant plants transformed with the wild-type

SYP121 gene. These recordings also yielded outward-rectifying

K+ currents (data not shown), much as previously described in

mesophyll and guard cells (Very and Sentenac, 2003; Dreyer and

Blatt, 2009) and in Arabidopsis root epidermal cells (Honsbein

et al., 2009), indicating that effects of the experimental manip-

ulations were restricted to the inward-rectifying current. Finally,

parallel transformations using the fluorescently tagged SNARE

mutants (see Supplemental Figure 1 online) showed their local-

ization to the cell periphery, not the cytosol or tonoplast, with an

accumulation around the tip of the root hair much as has been

reported for the wild-type SYP121 (Enami et al., 2009; Grefen

et al., 2010). Thus, we conclude that the FxRF motif is a primary

determinant not only of the physical interaction between KC1

and SYP121 but of the functional expression of K+ current

determined by channel assembly with SYP121 in vivo.

DISCUSSION

Membrane vesicle traffic and the SNARE proteins that drive it are

increasingly recognized as important players in plant cell devel-

opment and growth, as well as signaling and defense. Vesicle

traffic affects the steady state complement of membrane pro-

teins and their tissue distributions during development and at the

cellular level it drives the turnover of ion channels, transporters,

and receptor proteins, contributing to their modulation by hor-

mones and environmental factors (Bassham and Blatt, 2008;

Grefen and Blatt, 2008). These processes play a part in coordi-

nating the ensemble of transport activities at the plasma mem-

brane, although many details are only beginning to come to light.

Additionally, there is now unequivocal evidence of other roles for

SNAREs in the control of ion channels in plants. Our recent

demonstration of a direct and selective interaction of the Arabi-

dopsis SNARE SYP121 with the KC1 K+ channel established a

role for the SNARE in mineral nutrition (Honsbein et al., 2009).

This discovery and its seeming independence from signaling and

vesicle traffic led us to propose its physiological function as a

molecular governor coupling K+ transport with cell surface area

in volume control (Grefen and Blatt, 2008). Thus, the discovery

raised a fundamental question about the identity of the

interacting domain on the SNARE and its relationship to the H3

coiled-coil that assembles in the SNARE core complex and to the

mechanics of vesicle fusion. We have now isolated the KC1

binding site of SYP121, taking advantage of chimeras with the

closely related SNARE SYP122 that does not interact with KC1.

We report here (1) that interaction of SYP121 with KC1, when

expressed in yeast and in situ in the plant, is associated with a

Figure 11. Coexpression with SYP121 and Interacting SYP121 Single-

Site Mutants Selectively Rescues AKT1-KC1 K+ Current in Xenopus

Oocytes.

(A) Current traces and steady state current–voltage curves recorded

under voltage clamp in 96 mM K+ from oocytes expressing KC1 alone

(diamonds), AKT1 alone (circles), AKT1 with KC1 (molar ratio 1:1) alone

(closed squares) and with the SNARE, and SNARE mutants (molar

ratio to KC1, 2:1; see Honsbein et al., 2009) SYP121 (upward-facing

closed arrowheads), SYP121-F9A (downward-facing open arrowheads),

SYP121-S10A (downward-facing closed arrowheads), SYP121-R11A

(open squares), and SYP121-F12A (upward-facing open arrowheads).

Clamp cycles: holding voltage, �20 mV; voltage steps, 0 to �180 mV.

Scale = 3 mA and 4 s. Insets: Corresponding whole-cell currents cross-

referenced by symbol. Currents from oocytes injected with water and

with SYP121 cRNA only gave results similar to those for KC1 alone. All

measurements performed in coexpression with CBL1 and CIPK23,

which are essential for AKT1 function in oocytes, in 1:1:1 molar ratios

with AKT1 (Xu et al., 2006). Solid curves are the results of joint, nonlinear

least squares fitting of the K+ currents (IK) to the Boltzmann function

(Equation 1) and are summarized in Figure 13. Best fittings were obtained

with gmax held in common (gmax for the data shown, 49 6 3 nS) and with

separate, joint values for d between SYP121 and SNARE mutants that

showed interaction with KC1 and those that did not (see also Figures 3

and 4). Similar results were obtained in each of three separate exper-

iments (>12 oocytes for each set of constructs). Both analysis and visual

inspection showed an increase in d and shift in V1/2 on inclusion of

SYP121 and the interacting mutants with AKT1 and KC1.

(B) Verification of SNARE protein expression. Immunoblot analysis of

total membrane protein (10 mg/lane) extracted from oocytes collected

after electrical recordings and detected with aSYP121 antibody (Tyrrell

et al., 2007; Honsbein et al., 2009).

SNARE-K+ Channel Interaction Motif 3085

previously unidentified motif situated within the first 12 residues

of the SNARE sequence, (2) that this same motif is the minimal

requirement for SNARE-dependent alterations in the gating

characteristics of K+ channels assembled with KC1, and (3)

that rescue of the K+ current in syp121 mutant Arabidopsis

depends on complementation with SYP121 that retains this

motif. The KC1 binding site of SYP121 is situated immediately

adjacent Ser residues thought to be phosphorylated in response

to pathogen attack (Pajonk et al., 2008), and, as we note below, it

overlaps with a consensus domain recognized to be important in

regulating vesicle traffic. Thus, the site of KC1 interaction marks

Figure 12. Coexpressionwith SYP121 and Interacting SYP121Single-Site

Mutants Selectively Rescues AKT1-KC1 K+ Current in Xenopus Oocytes.

Summary of K+ channel parameters of gating charge (A) and V1/2 (B)

recorded from oocytes expressing AKT1 with KC1 in combinations with

SYP121, SYP122, and the SYP121 site mutants F9A, S10A, R11A, and

F12A. Data are means 6 SE obtained from joint fittings to Equation 1 of

four or more independent data sets in each case, including the data of

Figure 3. Fittings were performed by nonlinear least squaresminimization

(Marquardt, 1963) with the conductance maximum gmax held in common

within each data set and the apparent gating charge (d) allowed to vary

between SNAREs and chimeras that interact with KC1 and those that do

not. Data for SYP121 and the S10A mutant are statistically different from

the other data sets with P < 0.01.

Figure 13. Coexpression with Interacting SYP121 Single-Site Mutants

Selectively Rescues AKT1-KC1 K+ Current in Vivo.

Current traces and steady state current-voltage curves recorded under

voltage clamp from root epidermal cells of Arabidopsis wild-type plants

(closed circles), syp121 mutant plants (open circles), and syp121 mu-

tant plants expressing the transgenes for SYP121-F9A (upward-facing

open arrowheads), SYP121-S10A (upward-facing closed arrowheads),

SYP121-R11A (downward-facing open arrowheads), and SYP121-F12A

(squares). Data for syp121 plants expressing SYP121 and SYP122 were

omitted for clarity. Clamp cycles: holding voltage,�20mV; voltage steps,

0 to �220 mV. Scale = 2 mA and 1 s. Insets: Corresponding whole-cell

currents cross-referenced by symbol. Solid curves are the results of joint,

nonlinear least squares fitting of the K+ currents (IK) to the Boltzmann

function (Equation 1) and are included in Figure 14. Similar results were

obtained in each of five separate experiments (>12 seedlings for each

construct). Both analysis and visual inspection showed a rescue of the

K+ current with SYP121 and the SYP121-S10A mutant that retains

SNARE-KC1 interaction and functionality in yeast and oocytes.

3086 The Plant Cell

the N terminus of SYP121 as being of special importance: it sug-

gests a close functional overlap between SYP121-dependent

membrane vesicle traffic and control of the K+ channels, and it

discounts a direct competition between SNARE core complex

formation and channel binding. Furthermore, it offers a mecha-

nistic framework from which to explore the coordinate control of

vesicle traffic and transmembrane ion transport.

AMinimal Motif for K+ Channel Interaction and Control

Three observations point to the FxRF motif as an essential and

unique determinant of KC1 binding with SYP121 and to its

functional impact. The first and most important of these derives

fromchimeric substitutionswith domains from the closely related

SNARE SYP122. We found that replacing the N-terminal 39

amino acids of SYP121 with the corresponding sequence from

SYP122 eliminated KC1 interaction in yeast and SNARE action

on K+ channel gating in oocytes; conversely, SNARE–KC1 inter-

action and its impact on channel gating were recovered so long

as this same sequence from SYP121 replaced the N-terminal

domain of SYP122 (Figures 1, 3, and 4 to 6). Second, within this

N-terminal domain a similar pattern of results was obtained on

exchanging eight-residue segments between the two SNAREs

(Figures 2 to 4 and 6), and Ala-scanning mutagenesis within and

adjacent the critical segment identified the core FxRF sequence

determining both KC1 binding and the action of SYP121 on

gating of the K+ channel (Figures 8 to 12). Finally, the same

N-terminal sequence proved essential for functional interaction

of the SNARE with KC1 when expressed in vivo (Figures 13 and

14). These results do not rule out additional sites of interaction

with the K+ channel subunit, but they demonstrate that the

N-terminal FxRF motif is necessary for the physical and func-

tional interaction of SYP121 with KC1.

A key to interpreting the impact of the SYP121 motif can be

drawn from the electrophysiological analyses of SNARE expres-

sion in the syp121 mutant Arabidopsis background that blocks

the inward K+ channel current. We showed previously that

SYP121, through its association with KC1, assembles with a

third protein, the AKT1 K+ channel subunit, and that all three

proteins are essential for functional expression of the inward K+

current in vivo (Honsbein et al., 2009): eliminating SYP121

expression, as in the syp121 mutant (Collins et al., 2003; Zhang

et al., 2007), effectively suppressed the inward K+ current, and

complementing the syp121 mutant with the full-length protein

restored the current, both with SYP121 under control of its own

promoter andwhen constitutively expressed. These effects were

selective for the inward-rectifying K+ current and could be shown

to arise from direct interaction with these channels rather than an

effect mediated through channel protein traffic in vivo (Honsbein

et al., 2009). It follows that SYP121-SYP122 chimeras and

mutant SYP121 constructs that complement the syp121 Arabi-

dopsis plants should retain a capacity to interact functionally with

KC1 in order to affect channel gating. Thus, the parallel between

the readout for interaction based on yeast growth (Figures 1, 2,

and 8) and K+ current rescue (Figures 13 and 14), as well as the

absence of any impact on the outward K+ currents in vivo, argues

strongly that KC1 binding associated with the SYP121 FxRF

motif is a prerequisite for its functional impact on gating.

Figure 14. Coexpression with Interacting SYP121 Single-Site Mutants

Selectively Rescues AKT1-KC1 K+ Current in Vivo.

Summary of K+ current parameters of gating charge (A) and V1/2 (B)

recorded from Arabidopsis expressing AKT1 with KC1 in combinations

with SYP121. Data are means 6 SE obtained from joint fittings of at least

six independent data sets for each construct, in each case with the K+

equilibrium voltage set to �30 mV and the conductance maximum gmax

held in common (Equation 1). Parameter values for noninteracting

constructs were determined assuming a gmax in common with the

mean wild-type K+ current and 0.8 # d # 1.2, consistent with results

from heterologous expression studies (see above and Honsbein et al.,

2009) and should therefore be viewed as estimates only. Data for wild-

type Arabidopsis and for syp121 mutant plants complemented with the

SYP121-S10A mutant are statistically different from the other data sets

(for d, P < 0.01; for V1/2, P < 0.02).

SNARE-K+ Channel Interaction Motif 3087

The same conclusion can be drawn from the heterologous

expression studies in Xenopus oocytes. Furthermore, analysis of

channel gating in this case provides additional detail to the

molecular consequences of the SYP121-KC1 association. As

before (Honsbein et al., 2009), we found coexpression of AKT1

with KC1 only to give a small current near the negative voltage

extreme, whereas coexpression of the channel subunits together

with SYP121 yielded substantial K+ current near and negative of

2100 mVwith values for V1/2 close to2150 mV (Figure 4). Unlike

the situation in the plant, expression of AKT1 alone also yields an

inward K+ current in oocytes, but with anomalous gating char-

acteristics (Duby et al., 2008; Geiger et al., 2009; Honsbein et al.,

2009). Currents obtained with AKT1 alone and with KC1 were

well-fitted to Boltzmann functions with d near unity. By contrast,

coexpression of AKT1 andKC1with SYP121 gave currentswith d

near 2, similar to values returned from analysis of the inward K+

current in the plant (see Figures 3, 4, and 11 to 13; Honsbein

et al., 2009). The K+ currents obtained with the SNARE chimeras

and SYP121 mutants followed this same dichotomous distribu-

tion, the pattern corresponding directly with SNARE–KC1 inter-

action in yeast: chimeras and mutants that failed to rescue yeast

growth also showed currents similar to those recorded from

oocytes expressing AKT1 and KC1 alone or with the noninter-

acting SNARE SYP122; SNARE mutants and chimeras that

rescued yeast growth also gave K+ currents with gating param-

eters that matched closely those on coexpression of AKT1 and

KC1 with the wild-type SYP121. Because the gating parameters

V1/2 and d together encapsulate the intrinsic voltage range and

sensitivity for gating—in short, the capacity for membrane volt-

age to affect channel protein conformations (Dreyer and Blatt,

2009)—this dichotomy in gating characteristics underscores the

functional importance of the FxRF motif in the conformational

changes effected by the SNARE on the K+ channel.

A Unique N-Terminal Domain with Overlapping Functions?

A few examples of SNARE–ion channel interactions are known

and have been associated with other cellular functions. Notably,

themammalianQa-SNARESyntaxin 1Ahasbeen reported tobind

a numberof K+ andCa2+ channels and to subtly affect their gating.

Interactions of Syntaxin 1A with the SUR1-KATP complex of ATP-

sensitive K+ channels and the voltage-gatedKv2.1 K+ channel are

thought to help regulate insulin secretion (Michaelevski et al.,

2003; Cui et al., 2004), and its associations with L- and N-type

Ca2+ channels (Wiser et al., 1996;Bezprozvanny et al., 2000; Arien

et al., 2003) have been suggested similarly to coordinate neuro-

transmission and neuroendocrine secretion (Leunget al., 2007). In

all of these examples, the interacting domains of SNARE appear

to be situated within the C-terminal a-helix that anchors the

protein in the plasma membrane and the adjacent H3 a-helix that

normally assembles as part of the SNARE core complex during

vesicle fusion. The H3 a-helix also binds the CFTR Cl2 channel

(Naren et al., 1997; Ganeshan et al., 2003), although the associ-

ation with vesicle fusion and possible roles for this interaction are

less obvious. One difficulty in each of these examples rests with

the amphipathic properties of the Qa-SNARE H3 a-helix: its

seemingly promiscuouscapacity for protein interaction has raised

concerns about interpreting the physiological significance of

SNARE binding with the channel proteins (Fletcher et al., 2003).

It remains an unprecedented feature of SYP121, therefore, that its

binding with KC1 depends not on the H3 or membrane-spanning

a-helices, but on a previously unidentified motif isolated at the

cytosolic N terminus of the SNARE and unique to SYP121.

Indeed, the FxRF motif appears unique to plants and, among

Arabidopsis Qa-SNAREs, to SYP121 (Figure 15).

KC1 interaction with the SYP121 N terminus now offers a

structural framework to explore its regulation and association

with other physiological phenomena in vivo. There is good

evidence that Ser residues near the N terminus of SYP121 and

its close homolog SYP122 are phosphorylated in response to

pathogen challenge (Nuhse et al., 2003; Heese et al., 2005),

although their significance for any underpinning mechanisms

remains unknown. In SYP121, phosphorylation is thought to

occur at the Ser-7 position, while in SYP122, the adjacent Ser-6

and Ser-8 residues appear the major targets for kinase action

(Benschop et al., 2007). Furthermore, we note that residues

within and adjacent to the FxRF motif of SYP121 are likely to be

important in regulating SNARE core complex formation and

vesicle traffic. The N termini of several Qa-SNAREs, including

mammalian Syntaxin 1A and Syntaxin 5, and the yeast SNAREs

Sed5p, Tlg1p, and Tlg2p, are now recognized to form binding

sites for so-called Sec1/Munc18 (SM) proteins that facilitate

assembly of the SNARE core complex in yeast and mammalian

tissues (Burgoyne and Morgan, 2007; Sudhof and Rothman,

2009). Many details of SM protein binding are still unresolved at

this time. Nonetheless, it is clear that their interaction with the

N-terminal domains of the cognate SNAREs greatly accelerates

fusion, probably by stabilizing protein conformations and vesi-

cle positioning during core complex formation (Sudhof and

Rothman, 2009). At the heart of the binding site on the SNAREs

is a motif comprising highly conserved Asp and Phe residues

separated by four to five amino acids, roughly one a-helical turn,

Figure 15. Conserved Phe Residue Associated with Sec1/Munc18

Protein Binding Overlaps the FxRF Motif of SYP121.

Alignment of representative Qa-SNAREs fromDrosophila,Homo sapiens,

Caenorhabditis elegans, Saccharomyces cereviseae, and Arabidopsis

showing the highly conserved Asp and Phe residues associated with

Sec1/Munc18 protein binding (dark gray), adjacent and largely con-

served residues (light gray), and the overlap with the KC1 interaction

motif of SYP121 (boxed).

3088 The Plant Cell

close to the N terminus of the protein. These residues fit within a

minor groove on the surface of the SM proteins (Bracher and

Weissenhorn, 2002) when the SNARE is in one or more open

(active) conformations, and binding of the SNARE at this site on

the SM proteins is thought to facilitate SM binding with the core

complex (Carpp et al., 2006; Sudhof and Rothman, 2009).

Aligning the corresponding Arabidopsis Qa-SNAREs (Figure 15)

shows that the conserved Asp and Phe residues critical for SM

binding are found in SYP121 and, furthermore, that the Phe

residue is incorporated within the FxRF motif of SYP121, imply-

ing an overlap and, plausibly, competition for binding between

KC1 and one or more Arabidopsis SM proteins. The observation

thus raises entirely new questions that will bear future explora-

tion, notably whether KC1 competes for SYP121 binding with

Arabidopsis SM proteins or KC1 interaction with SYP121 might

substitute in the role of an SM partner and whether KC1 binding

affects SYP121-mediated vesicle traffic to the plasma mem-

brane. Addressing these questions will require knowledge of the

SNARE binding domain of KC1. Regardless of the answers, the

identity of the SYP121 FxRF motif defines a unique site for K+

channel interaction and gating control, and it presents important

and novel perspectives on the concept of the SNARE-K+ channel

association as a molecular governor (Grefen and Blatt, 2008;

Honsbein et al., 2009) to coordinate membrane traffic with

osmotically active solute transport in the plant.

METHODS

Molecular Biology

Open reading frames forAKT1,KC1,SYP121, andSYP122were amplified

with gene-specific primers including Gateway attachment sites (attB1/

attB2). A subsequent BP reaction in pDONR207 (Invitrogen) yielded Entry

clones that were verified via sequencing. The AKT1 and KC1 sequences

were obtained without stop codon to allow C-terminal fusions, whereas

SYP121 and SYP122 were amplified to include their native stop codons

and facilitate correct localization as type-II membrane proteins.

Chimeric cloneswere constructedusing restriction endonucleases, site-

directed mutagenesis, PCR amplification, and DNA ligation. For the

N2HQC1 chimera, SYP121-pDONR207 was cut by sequential digestion

with ApaI and AgeI. The 227-bp fragment incorporating the attL1 site and

the first 39 codons of SYP121 was discarded. A PCR product was

amplified using SYP122-pDONR207 as template to contain the attL1-site

and the first 38 codons of SYP122 with ApaI and AgeI restriction sites and

was inserted at the ApaI and AgeI restriction site. For the NH2QC1

chimera, codon 190 of SYP122 in pDONR207 was mutated to create an

AgeI site through the translationally silent point substitution of ACA with

ACT. Sequences corresponding to theH3 and transmembrane domains of

SYP122 were excised using AgeI and PvuII and replaced with the

corresponding PCR fragment of SYP121 including the same restriction

sites. The NHQ2C1 chimera was constructed by transcriptionally silent,

site-directed mutagenesis at codons 282 and 283 of SYP122 in

pDONR207 to generate a MluI site (mutation of ACACGG to ACGCGT).

Sequences coding for the transmembrane domain of SYP122 were then

excised by digestions with MluI and PvuII, and the corresponding PCR

fragment of SYP121 was inserted. The N1HQC2 chimera was generated

byAgeI andPvuII digestion ofSYP121-pDONR207, and the excised 1035-

bp fragment was discarded and replaced with a corresponding PCR

fragment of SYP122. The NH1QC2 chimera was constructed by mutation

of SYP121-pDONR207 to eliminate an AgeI site at codons 39 to 40.

Thereafter, sequencescorresponding to theN-terminal andHabcdomains

of SYP121 were PCR amplified with primers to add 59 ApaI and 39 AgeI

sites. The PCRproduct was used to replace the corresponding domains in

SYP122-pDONR207. TheNHQ1C2 chimerawas created byApaI andMluI

digestion to excise a fragment containing the attL1 site, N, Habc, and H3

domains of SYP122 from theMluI mutagenized SYP122-pDONR207 (see

above). This site was then replacedby ligationwith the corresponding PCR

product from SYP121. Point mutants were generated by site-directed

mutagenesis as described by Qi and Scholthof (2008) using primer

sequences listed in Supplemental Table 1 online. Finally, Gateway Des-

tination clones were generated using LR Clonase II (Invitrogen) by LR

reaction according to the manufacturer’s instructions. For BiFC and split-

ubiquitin assays, coding sequences for AKT1 and KC1 were cloned in

pMetYC-Dest and pUBC-nYFP, and coding sequences for the SNAREs

SYP121 and SYP122, the chimeras, and point mutants were cloned in

pNX32-Dest and pUBN-cYFP (Grefen et al., 2009, 2010). For electrophys-

iological analysis in oocytes, these constructs were subcloned into pGT-

Dest (see below), and for subcellular localization analysis, single residue

mutants of SYP121 were cloned in pUBN-EOS (Grefen et al., 2010).

The bicistronic vector was prepared by digesting pUB-Dest (Grefen

et al., 2010) using the unique SbfI restriction site, which is situated

between the 35S terminator and the Basta resistance gene. A PCR

reaction was performed with pUBN-GFP-Dest as template to create a

PUBQ10:GFP fragment flanked by SbfI sites using the primers TTCCT-

GCAGGTACCCGACGAGTCAGT (59 to 39) and TTCCTGCAGGTTACTTG-

TACAGCTCGTCCATGC (39 to 59). This product was introduced in the

linearized vector to create the bicistronic vector pUB-Bic-Dest. pUB-

Bic-Dest was maintained and amplified using ccdB survival cells (Invi-

trogen) grown in the presence of the selection markers chloramphenicol

(30 mg/L) and spectinomycin (100 mg/L), and the Gateway Entry and

Destination clones were amplified using Top10 cells (Invitrogen) and the

appropriate antibiotic (gentamycin [20 mg/L] for Entry clones and spec-

tinomycin [100 mg/L] for Destination clones).

Split-Ubiquitin Assays

For yeast mating-based split-ubiquitin assays, the haploid yeast strains

THY.AP4 and THY.AP5 (Obrdlik et al., 2004; Grefen et al., 2007) were

transformed as described previously (Grefen et al., 2009). Pools of 10 to

15 single colonies were selected after 3 d and were inoculated in

selectivemedia for overnight growth. The liquid cultureswere harvested

at OD600 2 to 3 and were resuspended in YPD. Matings were performed

by mixing equal aliquots of cultures containing KC1-Cub in THY.AP4

with the appropriate NubG-SNARE in THY.AP5. Aliquots of 4 mL from

each mixture were dropped on YPD plates and incubated at 308C

overnight. Diploid colonies were selected and inoculated in vector-

selective media lacking Leu, Trp, and uracil (CSMwlu) and were grown to

OD600 of 2 to 3. Thereafter, the yeast was harvested and resuspended in

sterile water. Serial dilutions at OD600 1.0 and 0.1 in water were

dropped, 7 mL per spot, onto plates without and with additions of 200

mM Met on interaction-selective media additionally lacking His, Met,

and adenine (CSMwluham). Growth was monitored at 2, 3, and 4 d, and

images used were taken on the final day. Yeast was also dropped on

CSMwlu media as a control for mating and cell density, and images were

taken after 24 h. To verify expression, yeast was harvested in aliquots

equal to those used for the dilution series and was extracted for protein

gel blot analysis using polyclonal antibodies against SYP121 and

SYP122 as before (Grefen et al., 2009; Honsbein et al., 2009). KC1-

Cub expression was verified in THY.AP4 yeast prior to mating using the

VP16 antibody (Abcam).

Electrophysiology

For electrical recordings using Xenopus laevis oocytes, constructs

with AKT1, KC1, CIPK23, CBL1, SYP121, and SYP122 were used as

SNARE-K+ Channel Interaction Motif 3089

described previously (Honsbein et al., 2009). The SNARE chimeras and

point mutants were cloned in pGT-Dest, which we created using the

oocyte expression vector pBSXG1 (Groves and Tanner, 1992) and

introducing a Gateway cassette with the Gateway conversion kit (Invi-

trogen). Plasmids were linearized and capped cRNA was synthesized in

vitro using T7 mMessage mMachine (Ambion). cRNA quality as a single

band was confirmed by denaturing gel electrophoresis. cRNA was mixed

to ensure equimolar ratios unless otherwise noted. To ensure uniform

injections of AKT1 transcript, mixtures were made up to a standard

volume as necessary with RNase-free water.

Stage V and VI oocytes were isolated from mature Xenopus, and the

follicular cell layer was digested with 2 mg/m collagenase (type 1A;

Sigma-Aldrich) for 1 h. Injected oocytes were incubated in ND96 (96 mM

NaCl, 2 mM KCl, 1 mM MgCl2, 1 mM CaCl2, and 10 mM HEPES-NaOH,

pH 7.4) supplemented with gentamycin (5 mg/mL) at 188C for 3 d before

electrophysiological recordings. Whole-cell currents were recorded un-

der voltage clamp using an Axoclamp 2B two-electrode clamp circuit

(Axon Instruments) as described previously (Leyman et al., 1999; Sutter

et al., 2006). Measurements were performed under continuous perfusion

either with 30 mM KCl and 66 mM NaCl or with 96 mM KCl, in each case

with the addition of 1.8 mM MgCl2, 1.8 mM CaCl2, and 10 mM HEPES-

NaOH, pH 7.2. Oocytes yielding currents were collected and total

membrane protein isolated according to Sottocornola et al. (2006) using

20 mL of extraction buffer per oocyte. Polyclonal antibodies against

SYP121 and SYP122were used at dilutions of 1:5000 in combination with

the ECL Advance Detection Kit (GE Healthcare). Immunoblots were

quantified and normalized to the Ponceau S stain using ImageJ (http://

rsbweb.nih.gov/ij/).

Recordings from Arabidopsis thaliana root epidermal cells were carried

out on wild-type and syp121 mutant seedlings 6 to 8 d postgermination

following transformation by Agrobacterium tumefaciens cocultivation

(Grefen et al., 2010) with the SNAREs and SNARE mutant constructs in

pUB-Bic-Dest. Seedlings were bathed in solutions of 10 and 30 mM KCl

and 5 mM Ca2+-MES, pH 6.1 (adjusted with CaOH, free [Ca2+] = 1 mM)

and voltage clamp records performed using standard, two-electrode

methods (Meharg et al., 1994; Honsbein et al., 2009; Chen et al., 2010).

Measurements were performed on mature epidermal cells in non-root-

hair cell files to avoid electrical coupling and clamp–current dissipation by

root hairs and between cells (Duckett et al., 1994; Meharg et al., 1994). All

recordings were analyzed and leak currents subtracted using standard

methods (Leyman et al., 1999; Sutter et al., 2006) with Henry III software

(Y-Science, University of Glasgow).

Confocal Microscopy

Arabidopsis seedlings were grown in 0.53Murashige and Skoog, pH 7.2,

for 3 to 5 d and transformed by cocultivation with A. tumefaciensGV3101

(Grefen et al., 2010), methods developed from those previously described

for Agrobacterium rhizogenes (Campanoni et al., 2007) and including

0.003% Sylwet (Duchefa) in the cocultivation medium to aid transforma-

tion (Li et al., 2009). Confocal images were obtained as before (Sutter

et al., 2006) on a Zeiss LSM510-UV microscope. GFP fluorescence was

excited with the 458- or 488-nm argon laser lines; YFP fluorescence was

excited with the 514-nm laser line. Emitted light was collected through a

NFT515 dichroic and 505- to 530-nm (GFP) and 535- to 590-nm (YFP)

band-pass filters. Pinholes were set to 1 airy unit. Bright-field images

were collected with a transmitted light detector. Laser intensity, photo-

multiplier gain, and offset were standardized.

Statistics

Statistical analysis of independent experiments is reported as means 6

SE as appropriate with significance determined by Student’s t test or

analysis of variance. Joint nonlinear least squares fittings were performed

using a Marquardt-Levenberg algorithm (Marquardt, 1963) implemented

in SigmaPlot v.11 (SPSS).

Sequences, Vectors, and Maps

Sequences and maps for all vectors described above are available at

www.psrg.org.uk, and vectors are available on request.

Accession Numbers

Sequence data from this article can be found in the Arabidopsis Genome

Initiative or GenBank/EMBL databases under the following accession

numbers: AKT1 (At2g26650), KC1 (At4g32650), SYP121 (At3g11820),

and SYP122 (At3g52400).

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure 1. The Cellular Distribution in Vivo of SYP121 Is

Unaffected by the SYP121-R11A Mutation.

Supplemental Table 1. Oligonucleotides That Were Designed to

Construct the Clones Used in This Study.

Supplemental Movie 1. 3D Projection of Transient Expression in

Arabidopsis Root Epidermis of the BiFC Pair cYFP-SYP121 and KC1-

nYFP.

Supplemental Movie 2. 3D Projection of Transient Expression in

Arabidopsis Root Epidermis of the BiFC Pair cYFP-N1HQC2 and

KC1-nYFP.

Supplemental Movie 3. 3D Projection of Transient Expression in

Arabidopsis Root Epidermis of the BiFC Pair cYFP-N2HQC1 and

KC1-nYFP.

Supplemental Movie 4. FRAP Time Series of Transient Expression in

Arabidopsis Root Epidermis of the BiFC Pair cYFP-N1HQC2 and

KC1-nYFP.

Supplemental Movie 5. 3D Projection of Transient Expression in

syp121 Mutant Arabidopsis Root Epidermis of the BiFC Pair cYFP-

SYP121-F9A and KC1-nYFP.

Supplemental Movie 6. 3D Projection of Transient Expression in

syp121 Mutant Arabidopsis Root Epidermis of the BiFC Pair cYFP-

SYP121-S10A and KC1-nYFP.

Supplemental Movie 7. 3D Projection of Transient Expression in

syp121 Mutant Arabidopsis Root Epidermis of the BiFC Pair cYFP-

SYP121-R11A and KC1-nYFP.

Supplemental Movie Legends.

ACKNOWLEDGMENTS

We thank W.-H. Wu (Beijing) and Hans Thordahl for constructs and

Arabidopsis lines. George Boswell and Amparo Ruiz-Pardo helped with

Xenopus and plant maintenance. This work was supported by grants BB/

H001630/1 and BB/H001673/1 from the UK Biotechnology and Biological

Sciences Research Council and by a Wellcome VIP award to M.R.B.

Received July 3, 2010; revised September 2, 2010; accepted September

13, 2010; published September 30, 2010.

3090 The Plant Cell

REFERENCES

Arien, H., Wiser, O., Arkin, I.T., Leonov, H., and Atlas, D. (2003).

Syntaxin 1A modulates the voltage-gated L-type calcium channel (Ca

(v)1.2) in a cooperative manner. J. Biol. Chem. 278: 29231–29239.

Assaad, F.F., Qiu, J.L., Youngs, H., Ehrhardt, D., Zimmerli, L., Kalde,

M., Wanner, G., Peck, S.C., Edwards, H., Ramonell, K., Somerville,

C.R., and Thordal-Christensen, H. (2004). The PEN1 syntaxin de-

fines a novel cellular compartment upon fungal attack and is required

for the timely assembly of papillae. Mol. Biol. Cell 15: 5118–5129.

Bassham, D.C., and Blatt, M.R. (2008). SNAREs: Cogs and coordina-

tors in signaling and development. Plant Physiol. 147: 1504–1515.

Benschop, J.J., Mohammed, S., O’Flaherty, M., Heck, A.J.R., Slijper,

M., and Menke, F.L.H. (2007). Quantitative phosphoproteomics of

early elicitor signaling in Arabidopsis. Mol. Cell. Proteomics 6: 1198–

1214.

Bezprozvanny, I., Zhong, P.Y., Scheller, R.H., and Tsien, R.W. (2000).

Molecular determinants of the functional interaction between syntaxin

and N-type Ca2+ channel gating. Proc. Natl. Acad. Sci. USA 97:

13943–13948.

Blatt, M.R. (1987). Electrical characteristics of stomatal guard cells: The

contribution of ATP-dependent, “electrogenic” transport revealed by

current-voltage and difference-current-voltage analysis. J. Membr.

Biol. 98: 257–274.

Blatt, M.R., and Gradmann, D. (1997). K(+)-sensitive gating of the K+

outward rectifier in Vicia guard cells. J. Membr. Biol. 158: 241–256.

Blatt, M.R., Leyman, B., and Geelen, D. (1999). Molecular events of

vesicle trafficking and control by SNARE proteins in plants. New

Phytol. 144: 389–418.

Bracher, A., and Weissenhorn, W. (2002). Structural basis for the Golgi

membrane recruitment of Sly1p by Sed5p. EMBO J. 21: 6114–6124.

Brunger, A.T. (2005). Structure and function of SNARE and SNARE-

interacting proteins. Q. Rev. Biophys. 38: 1–47.

Burgoyne, R.D., and Morgan, A. (2007). Membrane trafficking: Three

steps to fusion. Curr. Biol. 17: R255–R258.

Buschmann, P.H., Vaidyanathan, R., Gassmann, W., and Schroeder,

J.I. (2000). Enhancement of Na(+) uptake currents, time-dependent

inward-rectifying K(+) channel currents, and K(+) channel transcripts

by K(+) starvation in wheat root cells. Plant Physiol. 122: 1387–1397.

Campanoni, P., and Blatt, M.R. (2007). Membrane trafficking and polar

growth in root hairs and pollen tubes. J. Exp. Bot. 58: 65–74.

Campanoni, P., Sutter, J.-U., Davis, C.S., Littlejohn, G.R., and Blatt,

M.R. (2007). A generalized method for transfecting root epidermis

uncovers endosomal dynamics in Arabidopsis root hairs. Plant J. 51:

322–330.

Carpp, L.N., Ciufo, L.F., Shanks, S.G., Boyd, A., and Bryant, N.J.

(2006). The Sec1p/Munc18 protein Vps45p binds its cognate SNARE

proteins via two distinct modes. J. Cell Biol. 173: 927–936.

Chen, Z.H., Hills, A., Lim, C.K., and Blatt, M.R. (2010). Dynamic

regulation of guard cell anion channels by cytosolic free Ca2+ con-

centration and protein phosphorylation. Plant J. 61: 816–825.

Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink,

E., Qiu, J.L., Huckelhoven, R., Stein, M., Freialdenhoven, A.,

Somerville, S.C., and Schulze-Lefert, P. (2003). SNARE-protein-

mediated disease resistance at the plant cell wall. Nature 425:

973–977.

Cui, N.G., Kang, Y.H., He, Y., Leung, Y.M., Xie, H.L., Pasyk, E.A.,

Gao, X.D., Sheu, L., Hansen, J.B., Wahl, P., Tsushima, R.G., and

Gaisano, H.Y. (2004). H3 domain of syntaxin 1A inhibits KATP

channels by its actions on the sulfonylurea receptor 1 nucleotide-

binding folds-1 and -2. J. Biol. Chem. 279: 53259–53265.

Dreyer, I., and Blatt, M.R. (2009). What makes a gate? The ins and outs

of Kv-like K+ channels in plants. Trends Plant Sci. 14: 383–390.

Duby, G., Hosy, E., Fizames, C., Alcon, C., Costa, A., Sentenac, H.,

and Thibaud, J.B. (2008). AtKC1, a conditionally targeted Shaker-

type subunit, regulates the activity of plant K+ channels. Plant J. 53:

115–123.

Duckett, C.M., Oparka, K.J., Prior, D.A.M., Dolan, L., and Roberts, K.

(1994). Dye coupling in the root epidermis of arabidopsis is progres-

sively reduced during development. Development 120: 3247–3255.

Enami, K., Ichikawa, M., Uemura, T., Kutsuna, N., Hasezawa, S.,

Nakagawa, T., Nakano, A., and Sato, M.H. (2009). Differential

expression control and polarized distribution of plasma membrane-

resident SYP1 SNAREs in Arabidopsis thaliana. Plant Cell Physiol. 50:

280–289.

Fletcher, S., Bowden, S.E.H., and Marrion, N.V. (2003). False inter-

action of syntaxin 1A with a Ca(2+)-activated K(+) channel revealed

by co-immunoprecipitation and pull-down assays: Implications for

identification of protein-protein interactions. Neuropharmacology 44:

817–827.

Ganeshan, R., Di, A., Nelson, D.J., Quick, M.W., and Kirk, K.L. (2003).

The interaction between syntaxin 1A and cystic fibrosis transmem-

brane conductance regulator Cl- channels is mechanistically distinct

from syntaxin 1A-SNARE interactions. J. Biol. Chem. 278: 2876–2885.

Gassmann, W., and Schroeder, J.I. (1994). Inward-rectifying K+ chan-

nels in root hairs of wheat (a mechanism for aluminum-sensitive low-

affinity K+ uptake and membrane potential control). Plant Physiol. 105:

1399–1408.

Gaymard, F., Cerutti, M., Horeau, C., Lemaillet, G., Urbach, S.,

Ravallec, M., Devauchelle, G., Sentenac, H., and Thibaud, J.B.

(1996). The baculovirus/insect cell system as an alternative to Xen-

opus oocytes. First characterization of the AKT1 K+ channel from

Arabidopsis thaliana. J. Biol. Chem. 271: 22863–22870.

Geelen, D., Leyman, B., Batoko, H., Di Sansebastiano, G.P., Moore,

I., Blatt, M.R., and Di Sansabastiano, G.P. (2002). The abscisic acid-

related SNARE homolog NtSyr1 contributes to secretion and growth:

evidence from competition with its cytosolic domain. Plant Cell 14:

387–406 Erratum Plant Cell 14: 963.

Geiger, D., Becker, D., Vosloh, D., Gambale, F., Palme, K., Rehers,

M., Anschuetz, U., Dreyer, I., Kudla, J., and Hedrich, R. (2009).

Heteromeric AtKC1{middle dot}AKT1 channels in Arabidopsis roots

facilitate growth under K+-limiting conditions. J. Biol. Chem. 284:

21288–21295.

Grefen, C., and Blatt, M.R. (2008). SNAREs—Molecular governors in

signalling and development. Curr. Opin. Plant Biol. 11: 600–609.

Grefen, C., Donald, N., Schumacher, K., and Blatt, M.R. (2010). A

Ubiquitin-10 promoter-based vector set for fluorescent protein tag-

ging facilitates temporal stability and native protein distribution in

transient and stable expression studies. Plant J., in press.

Grefen, C., Lalonde, S., and Obrdlik, P. (2007). Split-ubiquitin system

for identifying protein-protein interactions in membrane and full-length

proteins. Curr. Protoc. Neurosci. 5.27.1–5.27.41.

Grefen, C., Obrdlik, P., and Harter, K. (2009). The determination of

protein-protein interactions by the mating-based split-ubiquitin sys-

tem (mbSUS). Methods Mol. Biol. 479: 217–233.

Groves, J.D., and Tanner, M.J.A. (1992). Glycophorin A facilitates the

expression of human band 3-mediated anion transport in Xenopus

oocytes. J. Biol. Chem. 267: 22163–22170.

Heese, A., Ludwig, A.A., and Jones, J.D.G. (2005). Rapid phosphor-

ylation of a syntaxin during the Avr9/Cf-9-race-specific signaling

pathway. Plant Physiol. 138: 2406–2416.

Honsbein, A., Sokolovski, S., Grefen, C., Campanoni, P., Pratelli, R.,

Paneque, M., Chen, Z., Johansson, I., and Blatt, M.R. (2009). A

tripartite SNARE-K+ channel complex mediates in channel-depen-

dent K+ nutrition in Arabidopsis. Plant Cell 21: 2859–2877.

Hu, C., Ahmed, M., Melia, T.J., Sollner, T.H., Mayer, T., and Rothman,

SNARE-K+ Channel Interaction Motif 3091

J.E. (2003). Fusion of cells by flipped SNAREs. Science 300: 1745–

1749.

Jahn, R., Lang, T., and Sudhof, T.C. (2003). Membrane fusion. Cell

112: 519–533.

Kato, T., Morita, M.T., Fukaki, H., Yamauchi, Y., Uehara, M.,

Niihama, M., and Tasaka, M. (2002). SGR2, a phospholipase-like

protein, and ZIG/SGR4, a SNARE, are involved in the shoot gravi-

tropism of Arabidopsis. Plant Cell 14: 33–46.

Leung, Y.M., Kwan, E.P., Ng, B., Kang, Y., and Gaisano, H.Y. (2007).

SNAREing voltage-gated K+ and ATP-sensitive K+ channels: Tuning

beta-cell excitability with syntaxin-1A and other exocytotic proteins.

Endocr. Rev. 28: 653–663.

Leyman, B., Geelen, D., Quintero, F.J., and Blatt, M.R. (1999). A

tobacco syntaxin with a role in hormonal control of guard cell ion

channels. Science 283: 537–540.

Li, J.F., Park, E., von Arnim, A.G., and Nebenfuhr, A. (2009). The FAST

technique: A simplified Agrobacterium-based transformation method

for transient gene expression analysis in seedlings of Arabidopsis and

other plant species. Plant Methods 5: 6.

Li, L.G., Kim, B.G., Cheong, Y.H., Pandey, G.K., and Luan, S. (2006).

A Ca(2)+ signaling pathway regulates a K(+) channel for low-K re-

sponse in Arabidopsis. Proc. Natl. Acad. Sci. USA 103: 12625–12630.

Lipka, V., Kwon, C., and Panstruga, R. (2007). SNARE-ware: The role

of SNARE-domain proteins in plant biology. Annu. Rev. Cell Dev. Biol.

23: 147–174.

Marquardt, D. (1963). An algorithm for fleast-squaires estimation of

nonlinear parameters. J. Soc. Ind. Appl. Math. 11: 431–441.

Meharg, A.A., Maurousset, L., and Blatt, M.R. (1994). Cable correc-

tion of membrane currents recorded from root hairs of Arabidopsis

thaliana L. J. Exp. Bot. 45: 1–6.

Michaelevski, I., Chikvashvili, D., Tsuk, S., Singer-Lahat, D., Kang,

Y.H., Linial, M., Gaisano, H.Y., Fili, O., and Lotan, I. (2003). Direct

interaction of target SNAREs with the Kv2.1 channel. Modal regulation

of channel activation and inactivation gating. J. Biol. Chem. 278:

34320–34330.

Naren, A.P., Nelson, D.J., Xie, W.W., Jovov, B., Pevsner, J., Bennett,

M.K., Benos, D.J., Quick, M.W., and Kirk, K.L. (1997). Regulation of

CFTR chloride channels by syntaxin and Munc18 isoforms. Nature

390: 302–305.

Nuhse, T.S., Boller, T., and Peck, S.C. (2003). A plasma membrane

syntaxin is phosphorylated in response to the bacterial elicitor flagel-

lin. J. Biol. Chem. 278: 45248–45254.

Obrdlik, P., et al. (2004). K+ channel interactions detected by a genetic

system optimized for systematic studies of membrane protein inter-

actions. Proc. Natl. Acad. Sci. USA 101: 12242–12247.

Pajonk, S., Kwon, C., Clemens, N., Panstruga, R., and Schulze-

Lefert, P. (2008). Activity determinants and functional specialization of

Arabidopsis PEN1 syntaxin in innate immunity. J. Biol. Chem. 283:

26974–26984.

Parlati, F., Weber, T., McNew, J.A., Westermann, B., Sollner, T.H.,

and Rothman, J.E. (1999). Rapid and efficient fusion of phospholipid

vesicles by the alpha-helical core of a SNARE complex in the absence

of an N-terminal regulatory domain. Proc. Natl. Acad. Sci. USA 96:

12565–12570.

Press, W., Flannerly, B., Teukolsky, S., and Vetterling, W. (1992).

Numerical Recipes: The Art of Scientific Computing. (Cambridge, UK:

Cambridge University Press).

Qi, D., and Scholthof, K.B.G. (2008). A one-step PCR-based method

for rapid and efficient site-directed fragment deletion, insertion, and

substitution mutagenesis. J. Virol. Methods 149: 85–90.

Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced

endocytosis of the pattern recognition receptor FLS2 in Arabidopsis.

Genes Dev. 20: 537–542.

Saito, C., Morita, M.T., Kato, T., and Tasaka, M. (2005). Amyloplasts

and vacuolar membrane dynamics in the living graviperceptive cell of

the Arabidopsis inflorescence stem. Plant Cell 17: 548–558.

Sokolovski, S., Hills, A., Gay, R.A., and Blatt, M.R. (2008). Functional

interaction of the SNARE protein NtSyp121 in Ca2+ channel gating,

Ca2+ transients and ABA signalling of stomatal guard cells. Mol. Plant

1: 347–358.

Sottocornola, B., Visconti, S., Orsi, S., Gazzarrini, S., Giacometti, S.,

Olivari, C., Camoni, L., Aducci, P., Marra, M., Abenavoli, A., Thiel,

G., and Moroni, A. (2006). The potassium channel KAT1 is activated by

plant and animal 14-3-3 proteins. J. Biol. Chem. 281: 35735–35741.

Sudhof, T.C., and Rothman, J.E. (2009). Membrane fusion: Grappling

with SNARE and SM proteins. Science 323: 474–477.

Surpin, M., Zheng, H.J., Morita, M.T., Saito, C., Avila, E., Blakeslee,

J.J., Bandyopadhyay, A., Kovaleva, V., Carter, D., Murphy, A.,

Tasaka, M., and Raikhel, N. (2003). The VTI family of SNARE proteins

is necessary for plant viability and mediates different protein transport

pathways. Plant Cell 15: 2885–2899.

Sutter, J.U., Campanoni, P., Tyrrell, M., and Blatt, M.R. (2006). Selec-

tive mobility and sensitivity to SNAREs is exhibited by the Arabidopsis

KAT1 K+ channel at the plasma membrane. Plant Cell 18: 935–954.

Sutter, J.U., Sieben, C., Hartel, A., Eisenach, C., Thiel, G., and Blatt,

M.R. (2007). Abscisic acid triggers the endocytosis of the Arabidopsis

KAT1 K+ channel and its recycling to the plasma membrane. Curr.

Biol. 17: 1396–1402.

Tyrrell, M., Campanoni, P., Sutter, J.-U., Pratelli, R., Paneque, M.,

Sokolovski, S., and Blatt, M.R. (2007). Selective targeting of plasma

membrane and tonoplast traffic by inhibitory (dominant-negative)

SNARE fragments. Plant J. 51: 1099–1115.

Uemura, T., Ueda, T., Ohniwa, R.L., Nakano, A., Takeyasu, K., and

Sato, M.H. (2004). Systematic analysis of SNARE molecules in

Arabidopsis: Dissection of the post-Golgi network in plant cells. Cell

Struct. Funct. 29: 49–65.

Ungar, D., and Hughson, F.M. (2003). SNARE protein structure and

function. Annu. Rev. Cell Dev. Biol. 19: 493–517.

Very, A.A., and Sentenac, H. (2003). Molecular mechanisms and

regulation of K+ transport in higher plants. Annu. Rev. Plant Biol. 54:

575–603.

Walter, M., Chaban, C., Schutze, K., Batistic, O., Weckermann, K.,

Nake, C., Blazevic, D., Grefen, C., Schumacher, K., Oecking, C.,

Harter, K., and Kudla, J. (2004). Visualization of protein interactions

in living plant cells using bimolecular fluorescence complementation.

Plant J. 40: 428–438.

Weber, T., Zemelman, B.V., McNew, J.A., Westermann, B., Gmachl,

M., Parlati, F., Sollner, T.H., and Rothman, J.E. (1998). SNAREpins:

Minimal machinery for membrane fusion. Cell 92: 759–772.

White, P.J., and Lemtiri-Chlieh, F. (1995). Potassium currents across

the plasma membrane of protoplasts derived from rye roots: A patch

clamp study. J. Exp. Bot. 46: 497–511.

Wiser, O., Bennett, M.K., and Atlas, D. (1996). Functional interaction of

syntaxin and SNAP-25 with voltage-sensitive L- and N-type Ca2+

channels. EMBO J. 15: 4100–4110.

Xu, J., Li, H.D., Chen, L.Q., Wang, Y., Liu, L.L., He, L., and Wu, W.H.

(2006). A protein kinase, interacting with two calcineurin B-like proteins,

regulates K+ transporter AKT1 in Arabidopsis. Cell 125: 1347–1360.

Yano, D., Sato, M., Saito, C., Sato, M.H., Morita, M.T., and Tasaka,

M. (2003). A SNARE complex containing SGR3/AtVAM3 and ZIG/

VTI11 in gravity-sensing cells is important for Arabidopsis shoot

gravitropism. Proc. Natl. Acad. Sci. USA 100: 8589–8594.

Zhang, Z.G., Feechan, A., Pedersen, C., Newman, M.A., Qiu, J.L.,

Olesen, K.L., and Thordal-Christensen, H. (2007). A SNARE-protein

has opposing functions in penetration resistance and defence signal-

ling pathways. Plant J. 49: 302–312.

3092 The Plant Cell

DOI 10.1105/tpc.110.077768; originally published online September 30, 2010; 2010;22;3076-3092Plant Cell

BlattChristopher Grefen, Zhonghua Chen, Annegret Honsbein, Naomi Donald, Adrian Hills and Michael R.

Arabidopsis Channel KC1 and Channel Gating in +A Novel Motif Essential for SNARE Interaction with the K

 This information is current as of February 5, 2021

 

Supplemental Data /content/suppl/2010/09/13/tpc.110.077768.DC1.html

References /content/22/9/3076.full.html#ref-list-1

This article cites 69 articles, 34 of which can be accessed free at:

Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists