www.elsevier.com/locate/vetmic

Veterinary Microbiology 107 (2005) 139–144

Short communication

A real-time PCR assay to detect the Panton Valentine

Leukocidin toxin in staphylococci: screening Staphylococcus

schleiferi subspecies coagulans strains from companion animals

Scott Roberts a, Kathleen O’Shea b, Daniel Morris c, Andrew Robb d,Donald Morrison e, Shelley Rankin c,*

a University of Pennsylvania School of Veterinary Medicine, 3850 Spruce Street, Philadelphia, PA 19104, USAb University of Pennsylvania, New Bolton Center, 382 West Street Road, Kennett Square, PA 19148, USA

c Mathew J. Ryan Veterinary Hospital, University of Pennsylvania, 3900 Delancey Street, Philadelphia, PA 19104, USAd Vale of Leven Hospital, Main Street, Alexandria G83 0UA, Scotland, UK

e Scottish MRSA Reference Laboratory, Stobhill Hospital, Glasgow G21 3UW, Scotland, UK

Received 29 October 2004; received in revised form 4 January 2005; accepted 14 January 2005

Abstract

Recent reports suggest that methicillin-resistant strains of Staphylococcus schleiferi subspecies coagulans are now

commonly isolated from dogs. Given the association of a potentially mobile SCCmec type IV element with lysogenic

phage-encoded Panton Valentine Leukocidin (PVL) toxin genes in community-acquired methicillin-resistant Staphylococcus

aureus strains we hypothesized that methicillin-resistant S. schleiferi ssp. coagulans strains may also encode PVL toxin genes.

Forty S. schleiferi ssp. coagulans strains isolated from companion animals were studied. Susceptibility to oxacillin was

determined by broth microdilution and all isolates were screened by PCR for the presence of the mecA gene. SCCmec typing was

performed on 14 isolates. A real-time PCR assay was developed for the detection of the PVL genes using a SmartCyclerTM.

Pulsed-field gel electrophoresis (PFGE) was performed to determine whether S. schleiferi ssp. coagulans strains were

homogeneous. Twenty-eight of the 40 isolates (70%) were resistant to oxacillin and 26/28 possessed the mecA gene by

PCR. SCCmec IV was identified in seven strains; the other seven isolates were not typable by this technique. All 40 strains were

negative for the PVL toxin gene. PFGE showed a heterogeneous population and 13 different profiles were determined. In

conclusion, this study showed that PVL toxin genes were not detected in a heterogeneous population of methicillin-resistant S.

schleiferi ssp. coagulans strains isolated from companion animals.

# 2005 Elsevier B.V. All rights reserved.

Keywords: Staphylococcus schleiferi; Panton Valentine Leukocidin (PVL); Methicillin-resistant Staphylococcus aureus (MRSA); Real-time

polymerase chain reaction

* Corresponding author. Tel.: +1 215 573 1189; fax: +1 215 898 0503.

E-mail address: srankin@vet.upenn.edu (S. Rankin).

0378-1135/$ – see front matter # 2005 Elsevier B.V. All rights reserved.

doi:10.1016/j.vetmic.2005.01.002

S. Roberts et al. / Veterinary Microbiology 107 (2005) 139–144140

1. Introduction

In 1990, Igimi et al. identified Staphylococcus

schleiferi subspecies coagulans (S. schleiferi ssp.

coagulans) from the external auditory meatus of dogs

with external otitis. S. schleiferi ssp. coagulans is

differentiated from S. schleiferi ssp. schleiferi in that it is

tube coagulase positive and urease positive. S. schleiferi

ssp. coagulans has been shown to be a pathogen of dogs,

in which it causes dermatological and ear infections

(Igimi et al., 1990; Frank et al., 2003). Methicillin-

resistance has recently been described in S. schleiferi

ssp. coagulans and has been shown to be due to the

presence of a mecA gene (Frank et al., 2003; Kania et al.,

2004). Since its first description only a few studies have

been published on the pathogenicity of S. schleiferi and

little is known about virulence factors that it may

possess although a fibronectin binding protein (Peacock

et al., 1999) and a b-like toxin (Linehan et al., 2003)

have been described.

Methicillin-resistant Staphylococcus aureus (MR-

SA) is a highly pathogenic multiple-drug resistant

(MDR) microorganism that has recently become more

prevalent in the community and molecular analyses

have shown these community-acquired MRSA (CA-

MRSA) strains to be genetically distinct from the

healthcare associated MRSA strains (Saiid-Salim

et al., 2003). Methicillin resistance is associated with

a mobile genetic element termed the staphylococcus

cassette chromosome mec (SCCmec) and four

SCCmec elements have been described. The type

IV element has been shown to be associated with CA-

MRSA strains (Okuma et al., 2002; Vandenesch et al.,

2003). SCCmec type IV is unique due to its small size

and the presence of two functional recombinase genes.

These factors may allow this element to move between

different Staphylococcus species (Prevost et al.,

1995a).

Community-acquired MRSA strains that carry the

SCCmec type IV element have also been shown to

encode genes for the Panton Valentine Leukocidin

(PVL) toxin located on a lysogenic phage (Vande-

nesch et al., 2003). The PVL toxin is responsible for

many of the clinical symptoms of infection with CA-

MRSA strains, such as furunculosis, severe necrotiz-

ing pneumonia, and necrotic lesions of the skin and

soft tissues (Lina et al., 1999; Dufour et al., 2002;

Vandenesch et al., 2003).

Given the association of a potentially mobile

SCCmec type IV element with lysogenic phage-

encoded PVL toxin genes in CA-MRSA strains we

hypothesize that S. schleiferi ssp. coagulans strains

that possess a mecA gene may also possess PVL toxin

genes. The aim of this study was to determine whether

methicillin-resistant S. schleiferi ssp. coagulans

strains also encode a PVL toxin.

2. Experimental methods

2.1. Bacterial strains

Forty S. schleiferi ssp. coagulans strains identified

by the Clinical Microbiology Laboratory at the

Matthew J. Ryan Veterinary Hospital of the University

of Pennsylvania were stored at �70 8C in Microbank

tubes (ProLab Diagnostics, Austin, TX). The majority

of isolates were from canine sources; however, three

isolates were available from feline sources. A

MicroScan Walkaway 40 (Dade Behring, Sacramento,

CA) PC20 Gram Positive combo-panel was used to

identify isolates as S. schleiferi. Antimicrobial

susceptibility to 23 antibiotics was determined using

the same panel (results not shown).

The production of coagulase was determined by a

tube coagulase test using rabbit plasma with EDTA

(Remel Inc., Lenexa, KS) to characterize isolates as

either S. schleiferi ssp. schleiferi or S. schleiferi ssp.

coagulans.

S. aureus strain ATCC 49775 was used as a positive

control for the mecA and PVL toxin gene PCR assays.

S. schleiferi ssp. coagulans ATCC 49545 was also

included as a control strain.

2.2. DNA extraction

DNA was extracted from all Staphylococcus strains

using a MasterPure DNA Extraction Kit (Epicentre

Technologies, Madison, WI) and used as a template

for PCR amplification.

2.3. Detection of the mecA gene by PCR

The presence of the mecA gene was determined by

PCR using primers and conditions as described

previously (Sakoulas et al., 2001).

S. Roberts et al. / Veterinary Microbiology 107 (2005) 139–144 141

2.4. SCCmec typing

SCCmec typing was performed on 14 S. schleiferi

ssp. coagulans at the Scottish MRSA Reference

Laboratory as described by Oliveira and de Lencastre

(2002). Briefly, a multiplex PCR assay that rapidly

identifies structural types and variants of the mec

element in S. aureus was used to type the 14 strains of

S. schleiferi submitted for screening.

2.5. Real-time PCR detection of the PVL toxin genes

Oligonucleotide primers to detect the PVL toxin

genes (lukS-PV, lukF-PV) were designed from a

conserved region of a previously published sequence

(GenBank accession number, X72700 as described

by Lina et al., 1999). The primers were designed

with LightCycler Probe Design Software Version

1.0 (Idaho Technology Inc., 2001) and amplify a

258 bp region across the lukS/lukF gene junction.

Primers, PVLSC-F, GCTCAGGAGATACAAG and

PVLSC-R, GGATAGCAAAAGCAATG were

synthesized at the University of Pennsylvania,

DNA Sequencing Center. Amplification and detec-

tion was carried out on a SmartCyclerTM (Cepheid,

Sunnyvale, CA) using a LightCycler1 FastStart

DNA Master SYBR Green I kit (Roche Applied

Bioscience, Indianapolis, IN). The cycling condi-

tions were as follows: after an initial denaturation

step of 98 8C for 5 min, samples completed 30

cycles of amplification (15 s of denaturation at

95 8C, 5 s of annealing at 55 8C and 10 s of

extension at 72 8C). Since SYBR Green binds to

any double stranded DNA, it was essential to

perform a melt curve analysis directly following

amplification (5 s at 95 8C, 15 s at 65 8C, then ramp

from 65 to 95 8C at 0.1 8C/s). All 40 strains were

tested by real-time PCR.

DNA from all 40 S. schleiferi ssp. coagulans

strains were also amplified using a conventional PCR

protocol that was a modification of that described by

Lina et al. (1999). Using primers, ATCATTAGG-

TAAAATGTCTGGACATGATCCA for luk-PV-1,

and GCATCAASTGTATTGGATAGCAAAAGC for

luk-PV-2, DNA was amplified in a Px2 Thermal

Cycler (Thermo Electron Corp., MA) using the

FailSafe PCR System (Epicentre Technologies,

Madison, WI).

2.6. Pulsed-field gel electrophoresis (PFGE)

PFGE was performed on 28 methicillin-resistant

isolates as described previously (McDougal et al.,

2003). Gels were photographed with the Kodak EDAS

290 system (Eastman Kodak Co., New Haven, CT)

and saved as a TIFF file for analysis with BioNumerics

software Version 3.0 (Applied Maths, Kortrijk,

Belgium). S. aureus NCTC 8325 was used as the

reference standard. Percent similarities were identified

on a dendrogram derived from the unweighted pair

group method using arithmetic averages and based on

Dice coefficients. Band position tolerance and

optimization were set at 1.25 and 0.5%, respectively.

A similarity coefficient of 80% was selected to define

pulsed-field profile (PFP) clusters as described for S.

aureus (McDougal et al., 2003).

3. Results

3.1. Phenotypic determination of S. schleiferi ssp.

coagulans

A tube coagulase test was positive for all 40 isolates

and thus confirmed these strains as S. schleiferi ssp.

coagulans. Thirty-nine of the forty isolates in this study

had the biotype code 317371 assigned by the MicroScan

Walkaway 40. Previously, four of the isolates in this

study that showed this biotype were submitted to the

Centers for Disease Control and Prevention, Division of

Healthcare Quality Promotion and were confirmed to be

S. schleiferi ssp. coagulans. All 40 isolates in this study

were pyrrolidonase (PYR) positive and 38/40 isolates

were urease positive. One isolate was shown to be

trehalose (TRE) positive which is a very rare biotype for

this species. Both urease negative isolates were

considered to be S. schleiferi ssp. coagulans based on

a positive reaction in a tube coagulase test; both of these

strains were susceptible to oxacillin.

3.2. mecA PCR

Twenty-eight isolates determined to be oxacillin

resistant by the MicroScan Walkaway system

(MIC > 2 mg/ml) were tested for the presence of

the mecA gene by PCR and 26 of 28 (93%) strains

tested positive.

S. Roberts et al. / Veterinary Microbiology 107 (2005) 139–144142

Fig

.1.

PF

GE

pat

ter n

sof

the

28

met

hic

illi

n-r

esis

tant

S.

schle

i fer

ist

rai n

suse

din

this

study .

Thir

teen

PF

GE

pat

tern

sw

ere

obse

rved

inth

e28

isola

tes.

S. Roberts et al. / Veterinary Microbiology 107 (2005) 139–144 143

3.3. SCCmec typing

Fourteen of the 28 oxacillin resistant isolates were

submitted to the Scottish MRSA Reference Lab for

SCCmec typing. SCCmec IV was identified in seven of

these strains and the additional seven isolates were not

typable by this technique.

3.4. Detection of PVL toxin genes

All 40 isolates were tested for the presence of the

PVL toxin genes by conventional and real-time PCR.

The oxacillin susceptible isolates were also included

in this analysis as it may have been the case that all S.

schleiferi ssp. coagulans strains were positive for PVL

toxin regardless of whether or not the isolate was

methicillin resistant. However, all 40 isolates were

negative for the PVL genes.

3.5. PFGE

As previous studies have suggested that S.

schleiferi strains are highly clonal, PFGE was

performed on all 28 oxacillin resistant S. schleiferi

ssp. coagulans isolates to determine genetic related-

ness (Kluytmans et al., 1998). Our results indicated a

heterogeneous population and 13 different pulsed-

field profiles were observed as shown in Fig. 1.

4. Discussion

S. schleiferi ssp. coagulans isolates from dogs with

recurrent pyoderma are frequently resistant to

methicillin (Frank et al., 2003; Kania et al., 2004)

and the clinical presentations of infection due to S.

schleiferi ssp. coagulans in companion animals are

notably similar to those observed with S. schleiferi

infection in humans which has been shown to cause

endocarditis, brain empyema, soft tissue and surgical

site infections, otitis externa, sepsis and infections of

implanted prosthetic (Kluytmans et al., 1998; Leung

et al., 1999; Hernandez et al., 2001). The pathogenic

mechanisms by which S. schleiferi of both subspecies

cause such diseases are unknown, but there appears to

be a degree of similarity between the spectrum of

infections caused by S. schleiferi and those associated

with S. aureus (Peacock et al., 1999). It is plausible

therefore that the two species share one or more

virulence determinants.

The mecA gene encodes the low-affinity penicillin-

binding protein PBP 2A carried on the SCCmec

element. It is widely accepted that the SCCmec

element is disseminated among staphylococci via

horizontal transfer (Daum et al., 2002). Our study

showed that 26/28 oxacillin resistant isolates were

positive for the mecA gene by PCR. Seven of these

isolates possessed the SCCmec type IV element and

this is the first report of this element in S. schleiferi ssp.

coagulans. A further seven isolates were not typable

by the method used in this study and this may indicate

that there are a variety of uncharacterized SCCmec

elements in staphylococcal species other than S.

aureus. The phenotypic expression of resistance in the

absence of a mecA gene in two strains could have been

due to hyperproduction of b-lactamase as described

for S. aureus (Nicola et al., 2000). One of these

isolates (4689) had a unique pulsed-field profile; the

other (6040) was part of a small cluster of five

temporally unrelated isolates that had no known

epidemiological association.

In conclusion, this study has shown that the PVL

toxin genes are not present in S. schleiferi ssp.

coagulans. However, this does not infer that leukocidin

genes are not present in this species. S. intermedius has

been shown to carry leukocidin genes, LukF-I and

LukS-I, and the amino acid sequences showed only 73

and 67% identity with the LukF and LukS genes

respectively of S. aureus (Prevost et al., 1995b). It is

therefore possible that S. schleiferi harbors specific

leukocidin genes that are as yet unrecognized. In S.

aureus strains the PVL toxin genes have been shown to

be encoded on a bacteriophage. In 2001, Narita et al.

demonstrated the difficulty in converting PVL-negative

S. aureus strains and showed that there are at least two

temperate phages in S. aureus which harbor PVL toxin

genes. Additionally, they identified seven distinct

phages that contain PVL toxin genes from different

Staphylococcus species of human origin. Narita et al.

(2001) have speculated that the low number of

staphylococcal strains capable of bacteriophage infec-

tion is due to immunity conferred by lysogenic phages.

This may be the case for S. schleiferi and future research

should be directed at the capability of other Staphy-

lococcus species, including S. schleiferi, to obtain these

highly virulent genes.

S. Roberts et al. / Veterinary Microbiology 107 (2005) 139–144144

Acknowledgements

Scott Roberts was supported by the Merck/NIH

summer research program under NIH training grant

RR07065 and a grant from the Merck Foundation.

Special thanks to Donna Maloney and Marianne

Lorenzo for technical assistance.

References

Daum, R.S., Ito, T., Hiramatsu, K., Hussain, F., Mongkolrattanothai,

K., Jamklang, M., Boyle-Vavra, S., 2002. A novel methicillin-

resistance cassette in community-acquired methicillin-resistant

Staphylococcus aureus isolates of diverse genetic backgrounds.

J. Infect. Dis. 186, 1344–1347.

Dufour, P., Gillet, Y., Bes, M., Lina, G., Vandenesch, F., Floret, D.,

Etienne, J., Richet, H., 2002. Community-acquired methicillin-

resistant Staphylococcus aureus infections in France: emergence

of a single clone that produces Panton-Valentine Leukocidin.

Clin. Infect. Dis. 35, 819–824.

Frank, L.A., Kania, S.A., Hnilica, K.A., Wilkes, R.P., Bemis, D.A.,

2003. Isolation of Staphylococcus schleiferi from dogs with

pyoderma. J. Am. Vet. Med. Assoc. 222, 451–454.

Hernandez, J.L., Calvo, J., Sota, R., Aguero, J., Garcia-Palomo, J.D.,

Farinas, M.C., 2001. Clinical and microbiological characteris-

tics of 28 patients with Staphylococcus schleiferi infection. Eur.

J. Clin. Mictobio. Infect. Dis. 20, 153–158.

Igimi, S., Takahashi, E., Mitsuoka, T., 1990. Staphylococcus schlei-

feri subsp. coagulans subsp. nov., isolated from the external

auditory meatus of dogs with external ear otitis. Int. J. Syst.

Bacteriol. 40, 409–411.

Kania, S.H., Williamson, N.H., Frank, L.A., Wilkes, R.P., Jones,

R.D., Bemis, D.A., 2004. Methicillin resistance in staphylococci

isolated from the skin of dogs with pyoderma. Am. J. Vet. Res.

65, 1265–1268.

Kluytmans, J., Berg, H., Steegh, P., Vandenesch, F., Etienne, J., Van

Belkum, A., 1998. Outbreak of Staphylococcus schleiferi wound

infections: strain characterization by randomly amplified poly-

morphic DNA analysis, PCR ribotyping, conventional ribotyp-

ing, and pulsed-field gel electrophoresis. J. Clin. Microbiol. 36,

2214–2219.

Lina, G., Piemont, Y., Godail-Gamot, F., Bes, M., Peter, M.-O.,

Gauduchon, V., Vandenesch, F., Eteinne, J., 1999. Involvement

of Panton-Valentine Leukocidin-producing Staphylococcus aur-

eus in primary skin infection and pneumonia. Clin. Infect. Dis.

29, 1128–1132.

Linehan, D., Etienne, J., Sheehan, D., 2003. Relationship between

haemolytic and sphingomyelinase activities in a partially pur-

ified b-like toxin from Staphylococcus schleiferi. FEMS Immu-

nol. Med. Microbiol. 36, 95–102.

Leung, M.J., Nuttall, N., Mazur, M., Taddei, T.L., McComish, M.,

Pearman, J.W., 1999. Case of Staphylococcus schleiferi endo-

carditis and a simple scheme to identify clumping factor positive

staphylococci. J. Clin. Microbiol. 37, 3353–3356.

McDougal, L.A., Steward, C.D., Killgore, G.E., Chaitram, J.M.,

McAllister, S.K., Tenover, F.C., 2003. Pulsed-field gel electro-

phoresis typing of oxacillin-resistant Staphylococcus aureus

isolates from the United States: establishing a national database.

J. Clin. Microbiol. 41, 5113–5120.

Narita, S., Kaneko, J., Chiba, J., Peimont, Y., Jarraud, S., Etienne, J.,

Kamio, Y., 2001. Phage conversion of Panton-Valentine Leu-

kocidin in Staphylococcus aureus: molecular analysis of a PVL-

containing phage, FSLT. Gene 268, 195–206.

Nicola, F., Banter, C., Caniga, L.F., Relloso, S., Bianchini, H.,

Smayevesky, J., 2000. Comparison of several methods to deter-

mine methicillin-resistance in Staphylococcus aureus with focus

on borderline strains. Diag. Microbiol. Infect. Dis. 36, 91–93.

Okuma, K., Iwakawa, K., Turnidge, J.D., Grubb, W., Bell, J.,

O’Brien, F., Coombs, W., Pearman, J., Tenover, F., Kapi, M.,

Tiensasitorn, C., Ito, T., Hiramatsu, K., 2002. Dissemination of

new methicillin-resistent Staphylococcus aureus clones in the

community. J. Clin. Microbiol. 40, 4289–4294.

Oliveira, D.C., de Lencastre, H., 2002. Multiplex PCR strategy for

rapid identification of structural types and variants of the mec

element in methicillin-resistant Staphylococcus aureus. Anti-

microb. Agents Chemother. 46, 2155–2161.

Peacock, S.J., Lina, G., Etienne, J., Foster, T.J., 1999. Staphylo-

coccus scheiferi expresses a fibronectin-binding protein. Infect.

Immun. 67, 4272–4275.

Prevost, G., Couppie, P., Prevost, P., Gayet, S., Petiau, P., Cribier, B.,

Monteil, H., Piemont, Y., 1995a. Epidemiological data on

Staphylococcus aureus strains producing synergohymentropic

toxins. J. Med. Microbiol. 42, 237–245.

Prevost, G., Bouakham, T., Piemont, Y., Monteil, H., 1995b. Char-

acterization of a synergohymenotrophic toxin produced by

Staphylococcus intermedius. FEBS Lett. 376, 135–140.

Saiid-Salim, B., Mathema, B., Kreiswirth, B., 2003. Community-

acquired methicillin-resistant Staphylococus aureus: an emer-

ging pathogen. Infect. Control. Hosp. Epidemiol. 21, 451–455.

Sakoulas, G., Gold, H.S., Venkataraman, L., Degirolami, P.C.,

Eliopoulos, G.M., Qian, Q., 2001. Methicillin-resistant Staphy-

lococcus aureus: comparison of susceptibility testing methods

and analysis of mecA-positive susceptible strains. J. Clin.

Microbiol. 39, 3946–3951.

Vandenesch, F., Naimi, T., Enright, M.C., Lina, G., Nimmo, G.R.,

Heffernan, H., Liassine, N., Bes, M., Greenland, T., Reverdy,

M.-E., Etienne, J., 2003. Community-acquired methicillin-resis-

tant Staphylococcus aureus carrying Panton-Valentine Leuko-

cidin genes: worldwide emergence. Emerg. Infect. Dis. 9, 978–

984.