Cellular Signalling 30 (2017) 30–40

Contents lists available at ScienceDirect

Cellular Signalling

j ourna l homepage: www.e lsev ie r .com/ locate /ce l l s ig

A Sonic hedgehog coreceptor, BOC regulates neuronal differentiation andneurite outgrowth via interaction with ABL and JNK activation

Tuan Anh Vuong a, Young-Eun Leem a, Bok-Geon Kim a, Hana Cho b, Sang-Jin Lee c,Gyu-Un Bae c, Jong-Sun Kang a,⁎a Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, Samsung Biomedical Research Institute, Suwon 16419, Republic of Koreab Department of Physiology, Sungkyunkwan University School of Medicine, Samsung Biomedical Research Institute, Suwon 16419, Republic of Koreac Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women's University, Seoul 04310, Republic of Korea

Abbreviations: Shh, Sonic hedgehog; BOC, Brothemolecular downregulated by ocogenes; JNK, Jun N-tecarcinoma cell; NPC, neural progenitor cell; DCC, deletroundabout; GLI, glioma-associated oncogene; JLP, Jprotein; MAPK, mitogen activated protein kinase; SH2, Srhomology domain 3; DCX, doublecortin; MAP2, microturetinoic acid; ITS, insulin/transferrin/selenite; Ngn1, Neurgrowth factor; EGF, epidermal growth factor; CM, conditi⁎ Corresponding author at: Department of Molecula

University School of Medicine, 2066, Seobu-Ro, Jangan-Republic of Korea.

E-mail address: kangj01@skku.edu (J.-S. Kang).

http://dx.doi.org/10.1016/j.cellsig.2016.11.0130898-6568/© 2016 Published by Elsevier Inc.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 14 November 2016Accepted 17 November 2016Available online 18 November 2016

Neurite outgrowth is a critical step for neurogenesis and remodeling synaptic circuitry during neuronal develop-ment and regeneration. An immunoglobulin superfamily member, BOC functions as Sonic hedgehog (Shh)coreceptor in canonical and noncanonical Shh signaling in neuronal development and axon outgrowth/guidance.However signaling mechanisms responsible for BOC action during these processes remain unknown. In our pre-vious studies, a multiprotein complex containing BOC and a closely related protein CDO promotes myogenic dif-ferentiation through activation of multiple signaling pathways, including non-receptor tyrosine kinase ABL.Given that ABL and Jun. N-terminal kinase (JNK) are implicated in actin cytoskeletal dynamics required forneurogenesis, we investigated the relationship between BOC, ABL and JNK during neuronal differentiation.Here, we demonstrate that BOC and ABL are induced in P19 embryonal carcinoma (EC) cells and cortical neuralprogenitor cells (NPCs) during neuronal differentiation. BOC-depleted EC cells or Boc−/− NPCs exhibit impairedneuronal differentiationwith shorter neurite formation. BOC interacts with ABL through its putative SH2 bindingdomain and seems to be phosphorylated in an ABL activity-dependent manner. Unlike wildtype BOC, ABL-binding defective BOC mutants exhibit impaired JNK activation and neuronal differentiation. Finally, Shh treat-ment enhances JNK activation which is diminished by BOC depletion. These data suggest that BOC interactswith ABL and activates JNK thereby promoting neuronal differentiation and neurite outgrowth.

© 2016 Published by Elsevier Inc.

Keywords:BOCShh coreceptorABLJNKNeuronal differentiationNeurite outgrowth

1. Introduction

Neurite outgrowth is a critical step for neurogenesis and neuronalcircuitry formation during neuronal development and regeneration[1]. Axon guidance molecules, such as netrin, slit or Sonic hedgehog(Shh) play important roles in axonal growth and navigation of growthcones to innervate targetswhich involve remodeling and reorganizationof the cytoskeleton [2]. The guidance receptors such as the netrin recep-tor Frazzled/DCC, the slit receptor ROBO or the Shh receptor BOC

r of CDO; CDO, cell adhesionrminal kinase; EC, embryonaled in colorectal cancer; ROBO,NK-interacting protein 1-likec homology domain 2; SH3, Srcbule-associating protein2; RA,ogenin 1; bFGF, basic fibroblastoned medium; KD, kinase dead.r Cell Biology, Sungkyunkwangu, Suwon, Gyunggi-do 16419,

mediate signals to modulate cytoskeletal remodeling [3–5]. Non-recep-tor tyrosine kinase ABL plays a critical role in nervous system develop-ment [6] and regulates the cytoskeletal rearrangement involved in theNetrin/Frazzled/DCC and Slit/ROBO-mediated axon guidance [7–9].ABL interacts with these receptors and also phosphorylates ROBO tomodulate its function in axon guidance [10–12]. Multiple downstreampathways, such as the Rho family small GTPases and c-Jun. NH2-terminal kinases (JNKs) have been implicated in ABL-mediated axonguidance [7,13,14]. ABL is shown to interact with and phosphorylateJNK-interacting protein 1 (JIP1), which in turn might activate JNK topromote axon outgrowth [15]. JNKs are also involved indiverse process-es of neuronal development, including neuronal differentiation, axonformation/outgrowth, and injury-mediated neuronal degradation [16].JNK is shown to regulate neuronal differentiation and neurite out-growth induced by nerve growth factor [17–19] and the inhibition ofJNK blocks neuronal differentiation of P19 embryonal carcinoma (EC)cells [19,20]. Furthermore, JNK is also implicated in axon guidance me-diated by a netrin receptor DCC/DSCAM complex in the developing ner-vous system [21].

BOC belongs to an immunoglobulin/fibronectin type III (Ig/FNIII)subfamily of cell surface proteins and together with a closely related

Table 1List of primers used to generate expression vectors of this study.

Vectors Primer Sequence

pcDNA3.1/flag-hBOCP899A

Forward 5′ tcgaagtgcccttccagcatcctgcccgtatactat 3′Reverse 5′ atagtatacgggcaggatgctggaagggcacttcga 3′

pcDNA3.1/flag-hBOCY1001F

Forward 5′ gagggctctttcttattcacactgcccgacgac 3′Reverse 5′ gtcgtcgggcagtgtgaataagaaagagccctc 3′

pEBG-2T/GST-hBOC878-962

F-SpeI-ihBOC1 5′ aatg act agt tggagggcctggtctaagcaa 3′R-ClaI-ihBOC1 5′ catt atc gat ctactgctgaagctcgcctgggca 3′

pEBG-2T/GST-hBOC936-1037

F-SpeI-ihBOC2 5′ aatg act agt cagagtgacaccagcagcctg 3′R-ClaI-ihBOC2 5′ catt atc gat ctagggggctctcctcacccctga 3′

pEBG-2T/GST-hBOC1038-1114

F-SpeI-ihBOC3 5′ aatg act agt gacagtcctgtcctggaagca 3′R-ClaI-ihBOC3 5′ catt atc gat ctaaattgtgagaggtggtgtttc 3′

pEBG-2T/GST-hBOC878-1037

F-SpeI-ihBOC1 5′ aatg act agt tggagggcctggtctaagcaa 3′R-ClaI-ihBOC2 5′ catt atc gat ctagggggctctcctcacccctga 3′

pEBG-2T/GST-hBOC936-1114

F-SpeI-ihBOC2 5′ aatg act agt cagagtgacaccagcagcctg 3′R-ClaI-ihBOC3 5′ catt atc gat ctaaattgtgagaggtggtgtttc 3′

pEBG-2T/GST-hBOC878-1114

F-SpeI-ihBOC1 5′ aatg act agt tggagggcctggtctaagcaa 3′R-ClaI-ihBOC3 5′ catt atc gat ctaaattgtgagaggtggtgtttc 3′

31T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

protein, called CDO, functions as Shh coreceptor to activate gene expres-sion through glioma-associated oncogene (GLI) transcription factors[22–25].Mice lackingBOCor/and CDOdisplay defects in central nervoussystem development associated with reduced Shh signaling activitieslike holoprosencephaly [26,27] or defects in the patterning of ventralneuronal fates [28]. Unlike CDO, BOC has been reported to function asa guidance receptor for Shh. In spinal cord development, BOC is requiredfor proper guidance of commissural neurons in response to Shh [4]. BOCdepletion in the forebrain of zebrafish causes defects in axon guidance[29,30]. In addition, BOC is involved in the formation of synapses to gen-erate the cortical microcircuitry [31]. However, intracellular signalingpathways of BOC regulation of axon guidance and synapse formationare currently unclear.

In skeletalmuscle differentiation, BOC forms amultiprotein complexwith closely related CDO [22,32] and the netrin receptor Neogenin acti-vatingmultiple signalingpathways, includingABL to promotemyogenicdifferentiation [33–35]. CDO interacts with the SH3 domain of ABL viaits PXXP motif in the intracellular region and the interaction seems tobe necessary for the promyogenic activity [36]. ABL also binds to JIP-like Protein (JLP) and activates p38 MAPK during myoblast differentia-tion [36]. Although human BOC protein contains a putative SH3 bindingPXXP motif and a putative SH2 binding YXXP motif in its intracellularregion (see Fig. 3a), it is currently unclear whether BOC regulates ABLin myoblast differentiation or Shh-mediated axon guidance. In thisstudy,we assessedwhether ABL and BOC interact and regulate neuronaldifferentiation and neurite outgrowth. BOC and ABL are induced uponneuronal induction in P19 EC cells and cortical neural progenitor cells(NPCs). BOC-depleted P19 EC cells or BOC-deficient cortical NPCs exhib-it impaired neuronal differentiationwith shorter neurite formation. BOCinteracts with the SH2 domain of ABL through the region containingYXXP motif in its intracellular region in a phosphorylation-dependentmanner. BOC depletion or deficiency reduces the level of activated JNKduring neuronal differentiation. JNK activation increases concomitantlywith the increase of BOC proteins in 293T cells and the ABL-binding de-ficient BOC mutation exhibit impaired JNK activation. In addition, ABLelevates JNK activation when co-expressed with BOC while the ki-nase-dead form of ABL (ABL KD) failed to do so. In BOC-depleted P19cells, neuronal differentiation was restored by re-expressing wildtypeBOC but not the ABL-binding deficient BOC protein. Furthermore, Shhtreatment enhances the level of p-JNK and DCX protein levels in P19EC cells which are abrogated by BOC depletion. Taken together, thesedata suggest that BOC regulates neuronal differentiation and neuriteformation through ABL interaction and JNK activation.

2. Materials and methods

2.1. Expression constructs

The expression vectors for pSuper/shBOC, pcDNA3.1/ABL,pcDNA3.1/ABLΔSH2, pcDNA3.1/ABLΔSH3, pcDNA3.1/flag-hBOC wereas previously described [22,36,37]. To generate the point mutations ofthe proline residue to alanine at 899 (P899A) and the tyrosine residueto phenylalanine at 1001 (Y1001F), PCR amplification was performedwith pcDNA3.1/flag-hBOC vector as a template and the primers as indi-cated in Table 1. To generate the GST-fusion protein containing thehuman BOC-intracellular region, PCR product of human BOC intracellu-lar region was subcloned into pEBG-2T expression vector.

2.2. Cell cultures and immunocytochemistry

P19 EC cells, C17.2 neuronal progenitor and 293T cellswere culturedas previously described [37]. Briefly, P19 EC cellswere cultured in alpha-minimum essential medium (MEM) supplemented with 10% fetal bo-vine serum (FBS, Invitrogen) which was referred as growing condition(G) in this study. To generate aggregates, 3.5 × 105 cells/100 mm2

were seeded onto poly-L-lysine (PLL)-coated petri dishes and 24 h

later, treated with 0.5 μM all-trans-retinoic acid (RA, Sigma-Aldrich) inDMEM/F12 medium supplemented with insulin-transferrin-selenium(ITS, Invitrogen) for 2 days followed by switching into DMEM/F12/ITSin the absence of RA with fresh medium replacement every 2 dayswhen needed. Transient transfection of P19 EC cells were performedby using lipofectamine 2000 (Invitrogen) as previously described [37].The transfection efficiency for P19 cells was generally about 90%.

Isolation and culture of neural progenitor cells (NPCs) were per-formed similarly as previously described [37]. In this study, mouse cor-tices of E13 embryos from the time-mating of the Boc+/− mice wereutilized and isolated cells were cultured as neurospheres in N2B27 me-dium (Invitrogen) supplemented with 10 ng/ml of EGF and bFGF(N2B27-EGF/bFGF, Invitrogen) for 5 days. To induce differentiation ofNPCs, neurospheres were dissociated as single cells with versene(Invitrogen) and cultured in suspension culture in N2B27-bFGF for 3or 5 days (I3 or I5). To examine the effect of axon outgrowth, singlecells were plated on PLL and laminin coated chamber slides in N2B27-bFGF medium for 3 days and fixed with 4% PFA. Immunostaining ofP19 cells and NPCs was carried out as previously described [37]. Briefly,fixed cells were permeabilized with 0.5% triton X-100 (Sigma) for15min at room temperature, incubated with primary antibodies suchas anti-MAP2 (Millipore-MAB-3418) and anti-β-tubulin III (Sigma-Al-drich) for 1 h at room temperature and secondary antibody followedby confocal microscopy. The length of neurites was measured by usingNeuronJ program [38]. Secondary florescence antibodies used in thisstudy were Alexa Fluor 488 goat anti-mouse antibody and Alexa Fluor594 goat anti-rabbit antibody (Invitrogen). Fluorescence microscopywas performed with Nikon ECLIPS TE-2000U and NIS-Elements F soft-ware (Nikon). Confocal microscopy was performed at SungkyunkwanUniversity School of Medicine Microscopy Shared Resource Facilitywith Zeiss LSM-510 or LSM-710 Meta confocal microscope.

Control or Shh-AP conditioned media were generated as previouslydescribed [24]. For coculture of P19 cells with 293T aggregates express-ing control or Shh, 293T transfectedwith pcDNAor Shh-APwere seededonto bacterial culture petri dishes for 2 days to generate aggregates. Atthe same time, P19 cells were induced to undergo neurogenesis byneurosphere cultures in alpha-MEM/10% FBS plus 0.5 μM RA for2 days. Neurospheres were seeded onto one side of PLL-coated petridishes in DMEM/F12/ITS medium, followed by seeding on 293T aggre-gates expressing control of Shh-AP and culturing for 2 days.

2.3. Protein analysis

Western blot analyses were carried out as described previously [36,39]. Briefly, cells were lysed in extraction buffer (50 mM Tris pH 7.4,

32 T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

150mMNaCl, 1.2mMMgCl2, 1mMEGTA, 1% Triton X-100, 10mMNaF,1 mM Na3VO4 and complete protease inhibitor cocktail) and then SDS-PAGE was performed followed by immunoblotting. Primary antibodiesused in this study were as following; BOC (R&D system), c-ABL (BDTransduction Laboratories), p-JNK, JNK, Neurogenin 1, NeuroD, Neuro-filament-M (Santa Cruz), β-tubulin III (Aves labs), MAP2 (Millipore),Doublecortin (Abcam), β-tubulin, Flag (Sigma). For co-immunoprecipi-tation (co-IP), 293T cells were transfected by using lipofectamine 2000and 36 h later cells were lysed. One milligram of total cell lysates wereimmunoprecipitated with 1 μg primary antibody overnight at 4 °Cfollowed by incubation with 20 μl of protein A/G agarose bead (Roche)for 2 h at 4 °C. For GST-pull down assay, lysate-antibody mixtureswere incubated with 20 μl of the Glutathione Sepharose 4B agarosebeads (GE Healthcare) overnight at 4 °C.

2.4. Statistical analysis

Statistical analysis of the results is expressed as mean S.E.M. of atleast three independent experiments. For comparison between twogroups, statistical significance was tested by student t-test using Excelsoftware (Microsoft). The limit of statistical significance was set at a p-value b0.05.

3. Results

3.1. BOC depletion impaired neuronal differentiation

To investigate the molecular mechanism of BOC in neuronal differ-entiation, we have utilized in vitro differentiation systems of pluripo-tent P19 EC cells [40] and cortical neural progenitor cells (NPCs)isolated frommouse embryos at embryonic day 13.5. P19 cells were in-duced to differentiate into neurons by retinoic acid (RA) treatment for2 days (RA2) followed by culturing in insulin/transferrin/selenite differ-entiation medium without RA (ITS) for additional 2 days. Neuronal dif-ferentiation was assessed by expression of neuronal markers, β-tubulinIII,Microtubule Associating Protein 2 (MAP2), Neurogenin 1 (Ngn1) andNeurofilament M (NFM). BOC expression was induced upon neuronalinduction by RA treatment and further increased at the later stage ofneuronal differentiation when neuronal marker genes are expressedand neurites are formed (Fig. 1a). ABL expression was also greatly en-hanced upon RA treatment and persisted during neuronal differentia-tion (Fig. 1a). Immunostaining and confocal microscopy of P19 cellsdifferentiated for one day in ITS medium (ITS1) showed that BOC andABL were colocalized with phallodin in developing neurites (Fig. 1b).Next, P19 cells were transfected with control or BOC-shRNA (shBOC)expression vectors and induced to differentiate. BOC-depleted P19cells showed reduced levels of BOC and neuronal markers, β-tubulinIII and Ngn1, while the expression of NeuroD was unaffected in thesecells, compared to control cells (Fig. 1c). P19/pSuper and P19/shBOCcells at 2 days in ITS medium (ITS2) stage were immunostained forthe expression of β-tubulin III (Fig. 1d). BOC-depleted cells were differ-entiated less well with shorter β-tubulin III-positive neurites, relative tothat of control cells (Fig. 1e).

To further investigate BOC's role in neurite outgrowth, cortical NPCsfromwildtype embryos at embryonic day 13.5 were isolated and grownas neurospheres in N2/B27medium supplementedwith basic fibroblastgrowth factor (bFGF) and epidermal growth factor (EGF; G). To inducedifferentiation of NPCs, cells were plated on poly-L-lysine coated platesand induced to differentiate by the removal of growth factors for 5 days(D5). The expression of BOC and ABL was enhanced in differentiatingneurons (Fig. 1f). Boc+/+ and Boc−/− NPCs at D5 were immunostainedwith anti-β-tubulin III antibodies (Fig. 1g). The quantification of theneurite length revealed that BOC-deficient NPCs had more β-tubulinIII-positive neurons with shorter neurites (b50 μm), while fewerBoc−/− NPCs had neurites longer than 100 μm, compared to wildtypeNPCs (Fig. 1h). Taken together, these data suggest that BOC expression

is stimulated during neuronal differentiation and plays a critical rolein neuronal differentiation and neurite outgrowth.

3.2. BOC and ABL interacted through the YXXP motif of BOC's intracellularregion and the SH2 domain of ABL

Immunostaining of P19 cells at ITS1 revealed that BOC and ABLcolocalized in growing neurites (Fig. 2a). Thus, we have determinedwhether BOC and ABL physically interact. 293T cells were transfectedwith control or flag-tagged human BOC (BOC-flag) expression vectorsand subjected to immunoprecipitation with anti-flag antibodies follow-ed by immunoblotting. Endogenous ABL proteins were coprecipitatedwith BOC proteins (Fig. 2b). Conversely, endogenous BOC proteinswere coimmunoprecipitated with ABL in P19 cells at ITS1 and ITS2(Fig. 2c). To define the interacting domain of BOC, we havecotransfected ABL with the GST-fusion vectors containing various re-gions of human BOC's intracellular domain as indicated (BOC-ICD; Fig.2d, e), followed by GST-pulldown assays. The ICD/full-length (ICD/878-114) exhibited the strongest interaction with ABL, while GST-fu-sion proteins harboring YXXP motifs (ICD/963-1037, ICD/878-1037and ICD/963-1114) precipitated relatively well with ABL. In addition,ICD/878-962 containing the PXXP motif showed a weak interactionwhile ICD/1038-1114 failed to interact with ABL. Thus, it appears thatthe ICD/963-1037 of BOC containing the YXXP motif is primarily re-sponsible for ABL interaction.

Next, we determined the domain of the ABL protein responsible forBOC interaction. To do so, we have cotransfected hBOC-ICD/full-lengthconstructs with wildtype ABL or ABL mutations with the deletion of ei-ther SH2 (ΔSH2) or SH3 (ΔSH3) domain assessing the interaction abilityby GST-pulldown assays. ABL-ΔSH2 displayed reproducibly diminishedinteraction with BOC, while the SH3 deletion mutation and full-lengthof ABL showed a comparable binding strength (Fig. 2f, g). These datasuggest that the efficient interaction of BOC and ABL is mediatedthrough the YXXP motif in the BOC-ICD and the SH2 domain of ABL.

3.3. BOC was phosphorylated at the tyrosine of the YXXP motif during neu-ronal differentiation

Next, we have generated humanBOCproteins harboring a pointmu-tation to alanine for the first proline of the PXXP motif (P899A, referredas PA; Fig. 3a) and the tyrosine residue of YXXP to phenylalanine(Y1001F, referred as YF; Fig. 3a) in BOC-ICD, followed by immunopre-cipitation. Both mutant proteins exhibited declined binding capacitiesto ABL, suggesting that both residues are required for the efficient bind-ing of human BOC to ABL (Fig. 3b–d). However, YF mutation generallyexhibited less ABL binding capacities than the PA mutation (Fig. 3c).Since the phosphorylated YXXP motifs bind to SH2 domains of variousproteins [41,42], we examinedwhether BOC proteins are tyrosine phos-phorylated by immunoprecipitation with control mouse IgG or anti-phosphor-tyrosine antibody (αpY). Lysates of P19 EC cells at proliferat-ing or differentiating conditions (G, ITS1 or ITS2)were precipitatedwithαpY (Fig. 3e). BOC was precipitated with αpY in P19 cells at both ITS1and ITS2, although it was higher in cells at ITS2 correlating withhigher BOC levels (Fig. 3e). In addition, wildtype or the two BOCmutant-containing constructs were transfected into 293T cells andimmunoprecipitated with control mouse IgG or αpY antibodies. BOCproteins were immunoprecipitated with αpY. While wildtype and thePA mutation were precipitated at similar levels, the BOC YF mutationwas precipitated to a lesser degree (Fig. 3f).When 293T cells transfectedwith wildtype BOC were treated with an ABL inhibitor Nilotinib, thelevel of BOC proteins precipitated with αpY was less than that of theDMSO-treated cells (Fig. 3g). These data suggest that BOC can be tyro-sine phosphorylated, and ABL might be critical for the tyrosine phos-phorylation of BOC.

Fig. 1. BOC depletion impaired neuronal differentiation and neurite formation. (a) P19 embryonal carcinoma (EC) cells were induced to differentiate into neurons by treatmentwith 0.5 μM retinoic acid (RA) for 2 days, followed by incubation for further 2 days in medium containing insulin-transferrin-selenium without RA (ITS). ITS1, one day in ITSmedium; ITS2, 2 days in ITS medium. Proliferating P19 cells were used as control and designated as G. Immunoblot analysis for markers of neuronal differentiation in P19cells. (b) Immunostaining of P19 cells at ITS1 for BOC (green), ABL (green) and actin staining with phalloidin (red). Size bar = 10 μm. (c) Immunoblot analysis for neuronaldifferentiation of control pSuper or BOC shRNA expressing P19 cells at ITS1 and ITS2. This experiment was repeated at least three times with similar results. (d)Immunostaining of the control pSuper or BOC shRNA expressing P19 cells at ITS1 with anti-β-tubulin III antibodies followed by DAPI staining to visualize nuclei. Neuritetrace of the longest neurite was assessed by using NeuronJ program. Size bar = 50 μm. (e) Quantification of neurite length shown in panel d by using NeuronJ program. Cellswith neurites per field were quantified and values represented as percentile. N = 10. *p b 0.05, ***p b 0.001. (f) Immunoblot analysis for BOC, ABL and β-tubulin III proteinsin Boc+/+ and Boc−/− cortical neural stem cells (NSCs) induced to differentiate for 3 (D3) or 5 days (D5). (g) Immunostaining of Boc+/+ and Boc−/− NSCs at D5 with anti-β-tubulin III antibodies followed by DAPI staining to visualize nuclei. Size bar = 100 μm. (h) Quantification of cells, shown in panel g, with indicated neurite length per fieldand values are depicted as percentile. N = 5. *p b 0.05, ***p b 0.001.

33T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

Fig. 2. Intracellular region of BOC interactedwith the SH2 domain of ABL via its YXXPmotif. (a) Immunostaining of P19 cells at ITS1 for BOC (green) and ABL (red). The neurite areamarkedis enlarged in the inset. Size bar = 20 μm. (b) Immunoprecipitation analysis of 293T cells transfected with flag-tagged human BOC expression vector (BOC). Lysates wereimmunoprecipitated with anti-flag antibodies and immunoblotted with anti-ABL, or anti-BOC antibodies. (c) P19 cell lysates from G, ITS1 and ITS2 were immunoprecipitated withanti-ABL antibodies or mouse IgG as a control, and immunoblotted with anti-ABL, or anti-BOC antibodies. (d) GST-pulldown analysis of GST-human BOC fusion constructs (BOC-ICD)expressing various intracellular domains with ABL proteins. PD, pulldown. (e) A schematic representation of BOC-ICD containing PXXP motif starting at aa 899 (a putative SH3-bindingdomain) and YXXP motif starting at aa 1001 (a putative SH2-binding domain). Summary of the ABL binding strength of GST fused with various BOC intracellular regions (BOC-ICD)from 3 independent pulldown analyses. (f) GST-pulldown analysis of BOC-ICD with ABL, ABL-SH2 deletion (ΔSH2) or ABL-SH3 deletion (ΔSH3) proteins. (g) Quantification of ABLlevels pulled down with BOC-ICD shown in panel f. N = 3. **p b 0.01. ns= not significant.

34 T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

3.4. BOC deficiency caused decreased JNK activation, and BOC mutationsdefective for ABL-interaction impaired JNK activation

In previous studies, ABL has been shown to regulate JNK in neuriteoutgrowth and inhibition of JNK causes impaired neuronal differentia-tion of P19 cells [20,43]. Thus, we assessed the involvement of JNK inBOC/ABL-mediated neuronal differentiation and neurite outgrowth.Similarly to BOC andABL (Fig. 1a), the level of the active phosphorylatedJNK (p-JNK) was increased upon RA treatment and progressively in-creased during neuronal differentiation, while the total JNK levels didnot alter (Fig. 4a). The immunostaining of P19 cells at ITS1 or ITS2 forBOC and p-JNK revealed that BOC and p-JNK proteins colocalized ingrowing neurites (Fig. 4b). Interestingly, the level of p-JNKwas substan-tially decreased in BOC-depleted P19 cells at ITS1 and ITS2, compared tothe control P19 cells (Fig. 4c). Furthermore, ABL expression seemed to

be slightly decreased in BOC-depleted P19 cells, relative to the controlcells (Fig. 4c). To confirm this, Boc+/+ and Boc−/− NPCs were inducedto differentiate by removing EGF and bFGF for 3 or 5 days and assessedby immunoblotting (Fig. 4d). The levels of p-JNK and ABL were de-creased in Boc−/−NPCs, compared to thewildtype cells. These data sug-gest that BOC depletion causes impaired JNK activation during neuronaldifferentiation.

To further examine the effect of BOC on JNK activation, 293T cellswere transfected with increasing amounts of BOC, followed by immu-noblotting. The increasing BOC levels were correlated with graduallyenhanced JNK activation, while ABL levels did not specifically alter(Fig. 4e). The quantification from replica experiments of Fig. 4e for therelative signal intensities of BOC and p-JNK, which were normalized tothe loading control β-tubulin and total JNK, respectively, showed a con-comitant increase of p-JNK levels with BOC levels (Fig. 4f). We further

Fig. 3. The tyrosine residue of the YXXP motif was phosphorylated by ABL during neuronal differentiation. (a) Scheme of the human BOC structure, highlighting the PXXP and YXXPmotives in the intracellular region. Ig repeats, immunoglobulin repeats: FN repeats, fibronectin type III repeats; TM, transmembrane domain. (b) Immunoprecipitation of flag from293T cells expressing flag-tagged human BOC wildtype or point mutation proteins, and ABL. The proline residue at 899 in human BOC was changed to alanine (P899A), while thetyrosine residue at 1001 was switched to phenylalanine (Y1001F). (c) Quantification of multiple experiments, shown in panel b, revealed that Y1001F mutation showed consistentlydiminished interaction, while P899A mutation had variable interaction ability with ABL. N = 3. **p b 0.01, ***p b 0.001. (d) Immunoprecipitation of ABL from 293T cells expressing ABLand BOC proteins. Note that both human BOC point mutations showed reduced interaction with ABL. (e) Immunoprecipitation analysis of P19 cells at G, ITS1 and ITS2 with anti-phosphor-tyrosine antibody (αpY), followed by immunoblotting against BOC. (f) Immunoprecipitation analysis of αpY from 293T cells transfected with control, P899A, Y1001F or WTBOC expression vectors, followed by immunoblotting against BOC. (g) 293T transfected BOC were treated with an ABL inhibitor, Nilotinib (10 μM) for one day followed byimmunoprecipitation analysis with αpY. Lysates were immunoblotted with antibodies to BOC, ABL, phosphorylated ABL at tyrosine245 and GAPDH.

35T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

examined the effect of wildtype or BOC mutant constructs on JNK acti-vation in 293T cells. Overexpression of wildtype BOC enhanced stronglyp-JNK levels, while the expression of either one of the BOC mutationsled to significantly decreased JNK activation (Fig. 4g, h). These data sug-gest that BOC expression is critical for JNK activation during neuronaldifferentiation and the interacting ability of BOC with ABL is importantfor JNK activation.

To determine whether BOC and ABL regulate JNK, 293T cells weretransfected with control or BOC expression vectors in combinationwith wildtype ABL or the kinase activity-deficient ABL (ABL-KD) andassessed for JNK activation. The expression of wildtype ABL or BOCalone enhanced p-JNK levels to 2.1 or 2.7 fold, respectively (Fig. 4i). Incontrast, the expression of ABL-KD had no effect on p-JNK levels.Coexpression of BOC and wildtype ABL enhanced p-JNK levels to 7.3

fold, while BOC and ABL-KD cotransfection resulted in only 3.6 fold in-crease of p-JNK levels. These data suggest that BOC and ABL can syner-gistically activate JNK, and the kinase activity of ABL is important forBOC-mediated JNK activation.

3.5. ABL-binding defective BOC proteins failed to restore JNK activation andneuronal differentiation in BOC-depleted P19 cells

To determine the function of BOC binding to ABL in neuronal differ-entiation, wildtype BOC (WT) or BOC mutants (PA or YF) werereintroduced into BOC-depleted P19 cells (Fig. 5a). These cells werethen immunostained for β-tubulin III and MAP2 expression, followedby quantification of the relative signal intensity and the neurite length(Fig. 5b–d). BOC-depleted P19 cells formed fewer β-tubulin III and

Fig. 4. The ABL-binding defective BOC mutations exhibited impaired JNK activation.(a) Immunoblot analysis of P19 cell lysates during neuronal differentiation for expression of thephosphorylated form of JNK (p-JNK) and total JNK. (b) Immunostaining of P19 cells at ITS1 and ITS2 for BOC (green) and pJNK (red). Note the colocalization of BOC and p-JNK indifferentiating cells and growing neurites in the enlarged inset. Size bar = 20 μm. (c) Immunoblot analysis of control or BOC-knockdown P19 cells at ITS1 and ITS2 for ABL, p-JNK andJNK expression. β-tubulin serves as a loading control. (d) Immunoblot analysis of Boc+/+ and Boc−/− NSCs at D3 and D5 for ABL, p-JNK and JNK expression. (e) Immunoblot analysis of293T cells transfected with increasing amounts of BOC for ABL, p-JNK and JNK expression. (f) Quantification of the relative protein levels of p-JNK/JNK and BOC/β-tubulin, shown inpanel e. The value of control cells was set to 1.0. n = 3. *p b 0.05, **p b 0.01, ***p b 0.001. (g) Immunoblot analysis of 293T cells transfected with control, P899A, Y1001F or WT hBOCexpression vectors for p-JNK, JNK, BOC and β-tubulin as a loading control. (h) Quantification of the relative signal intensity of pJNK levels, shown in panel g. The signal in the controlcells was set to 1.0. n = 3. *p b 0.05, **p b 0.01, ***p b 0.001. (i) Immunoblot analysis of 293T cells transfected with BOC and ABL or ABL deficient kinase activity (ABL-KD). The relativep-JNK signalswere quantified and the values are indicated under each lane. The signal intensity of the control cellswas set to 1.0. This experimentwas repeated 3 timeswith similar results.

36 T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

MAP2-positive cells with shorter neurites, relative to the control P19cells. Thewildtype BOC restoredneuronal differentiation of BOC-deplet-ed P19 cells to control levels, while BOCmutant proteins failed to do so.In agreement with the immunocytochemistry data, wildtype BOC re-stored levels of β-tubulin III, MAP2 and Doublecortin (DCX) proteinsin BOC-depleted P19 cells, to the level of control P19 cells (Fig. 5e). In

contrast, BOC mutant protein failed to restore the expression levels ofβ-tubulin III, MAP2 and DCX. Next, we have assessed the effect of BOCmutations on JNK activation. In agreement with the previous results,the level of p-JNK relative to JNKwas significantly decreased in BOC-de-pleted P19 cells, which was recovered by wildtype BOC (Fig. 5f, g). Theexpression of the YF mutation failed to induce JNK activation. However,

37T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

the PA mutation showed some degree of rescue for JNK activation, al-though the level varied somewhat. These data suggest that BOC regu-lates neuronal differentiation and neurite outgrowth throughinteraction with ABL and the activation of JNK.

3.6. BOC depletion inhibited Shh-induced JNK activation

P19 cell aggregates were cocultured with 293T cell aggregates ex-pressing control or Shh in ITS medium for 2 days and immunostainedwith anti-β-tubulin III antibodies (Fig. 6a). The quantification of neuritelength revealed that P19 cells, which were cocultured with Shh-

Fig. 5.ABL-binding defective BOCmutations failed to restore neuronal differentiation in BOC-deP899A or Y1001F BOC expression vectors for BOC and β-tubulin as a loading control. (b) Immunor MAP2 (red) followed by DAPI staining to visualize nuclei. Size bar = 50 μm. (c) Quantificatisignal intensity was normalized to that of DAPI signal intensity. n = 10. (d) Quantification ofpercentile. n = 10. ***p b 0.001. ns = not significant. (e) Immunoblot analysis of P19/shBOC cmarkers β-tubulin III, DCX, MAP2 and β-tubulin as a loading control. (f) Immunoblot analyvectors for p-JNK and JNK. (g) Quantification of relative levels of p-JNK/JNK in P19 cells, show*p b 0.05, **p b 0.01. ns= not significant.

secreting 293T cells formed longer neurites (Fig. 6b). In addition, P19cells treatedwith Shh conditionmedium (CM) for 48h exhibited elevat-ed levels of β-tubulin III, DCX and p-JNK, relative to cells treated withcontrol CM, while total JNK levels did not alter (Fig. 6c). Furthermore,control or BOC-depleted P19 cells were treated with control CM orShh-CM for 48 h in ITS medium and subjected to immunoblotting.Shh-CM treatment elevated DCX levels in both control and BOC-knock-down cells (Fig. 6d). Consistently, Shh treatment enhanced p-JNK levelsin control cells and restored in BOC-knockdown cells to the controllevels without Shh treatment (Fig. 6e, f). In addition, P19 cells treatedwith a Shh inhibitor, SANT-1 for 48 h had no significant effect on JNK

pleted P19 cells. (a) Immunoblot analysis of P19/shBOC cells transfectedwith control,WT,ostaining of P19 cells transfectedwith indicated expression vectors forβ-tubulin III (green)on of relative signal intensities of β-tubulin III and MAP2, shown in panel b. Each value ofcells bearing neurites with indicated length, shown in panel b. The values are depicted asells transfected with control, WT, P899A or Y1001F BOC expression vectors for neuronalsis of P19/shBOC cells transfected with control, WT, P899A or Y1001F BOC expressionn in panel f. The relative signal intensity of control transfected cells was set to 1.0. n = 3.

38 T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

activation (Fig. 6g, h). Taken together, these data suggest that BOC inter-acts with ABL and activates JNK to promote neurite outgrowth in re-sponse to Shh.

4. Discussion

Here, we demonstrate that BOC promotes neuronal differentiationand neurite outgrowth by interaction with ABL and activation of JNK.The results shown in this study are consistentwith previously proposedroles of ABL and JNK in the control of cytoskeletal dynamics essential forneurite outgrowth and axon guidance [7,9,13,14,21,44]. Our study sug-gests that the tyrosine residue of the YXXP motif in BOC's intracellularregion is a critical site for interactionwith ABL, and the YFmutation con-sistently exhibits reduced interaction with ABL. The lack of the kinaseactivities of the guidance receptors like BOC requires nonreceptor tyro-sine kinases, such as Src family kinases (SFKs), FAK or ABL to activatethese receptors to regulate their function and to transmit the signal tocontrol cytoskeletal dynamics. BOC is precipitated with antibodiesagainst the phosphor-tyrosine in 293T cells and P19 cells and its levelis increased in differentiating neurons, suggesting that BOC might be

Fig. 6. BOC depletion reduced Shh-induced JNK activation. (a) P19 aggregates were coculturimmunostained for β-tubulin III (green). (b) Quantification of neurite length of P19 cells cocua. Neurite length is quantified by using NeuronJ program. (c) Immunoblot analysis of P19 ce(Con-CM) or Shh-AP (Shh-CM). (d) Immunoblot analysis of DCX from control or BOC-depleteor BOC-depleted P19 treated with Con-CM or Shh-CM for 48 h in ITS medium for p-JNK andsignal in the control cells was set to 1.0. n = 3. **p b 0.01. ns = not significant. (g) ImmunoQuantification of the relative p-JNK/JNK signal intensity shown in panel g. The signal from the

tyrosine-phosphorylated. The identity and exact mechanism of the ki-nase responsible for BOC phosphorylation is currently unknown. Sincethe treatment with an ABL inhibitor, Nilotinib decreases tyrosine-phos-phorylated BOC levels, it is likely that ABLmight interact and phosphor-ylate BOC. Previously, SFKs have been implicated in the Shh-mediatedguidance of commissural axons. Interestingly, SFK activation is depen-dent on Smoothened, but not for induction of Gli transcriptional activi-ties [45,46]. Since BOC is the primary receptor for Shh-mediatedguidance of commissural axons and BOC's action at the signal receivingsteps prior to Smoothened activation, SFKsmay not be phosphorylatingBOC. However, the crosstalk between SFKs and ABL has been demon-strated in various systems [47]. Thus, SFKs might be involved in activat-ing ABL further when the signaling is in action thereby furtherstabilizing the interaction between BOC and ABL. It is possible thatBOC interacts first with ABL-SH3 through its PXXP sequence and this in-teraction in turn activates ABL by opening its autoinhibitory configura-tion [48,49], leading to phosphorylation of BOC at tyrosine 1001. Thephosphorylated tyrosine residue of BOC now interacts with ABL-SH2domainwhichmight stabilize the interaction between ABL and BOC. Al-though the effects of the PA mutation seem to be weaker and variable,

ed with control or Shh-AP expressing 293T cell aggregates for 48 h in ITS medium andltured either control- (n = 118) or Shh- (n = 67) expressing 293T cells, shown in panellls treated with conditioned medium of 293T cells, which were transfected with controld P19 cells treated with Con-CM or Shh-CM for 48 h. (e) Immunoblot analysis of controlJNK. (f) Quantification of the relative p-JNK/JNK signal intensity, shown in panel e. Theblot analysis of P19 cells treated with SANT-1 (20 μM) for 48 h, for p-JNK and JNK. (h)control cells was set to 1.0. n = 3. ns = not significant.

39T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

the PXXP motif in human BOC appears to be important for its function.However, the PXXP motif is only found in human and primates. Thus,the primary interactionmight bemediated by YXXP of BOC and SH2 do-main of ABL. Considering that CDO interacts with ABL and CDO is alsocoexpressed with BOC in differentiating neurons [36,40], it is possiblethat CDO interacts with BOC and ABL which in turn phosphorylatesBOC at tyrosine 1001 thereby stabilizing the interaction with BOC. Ourprevious study has shown that CDO plays a critical role in the early neu-rogenic induction of P19 cells and C17.2 NPCs through activation of neu-ral bHLH transcription factors [40]. Thus, it is tempting to speculate thatCDO plays a key role in early neuronal induction, while BOC might bemore important for neurite outgrowth.

Ig superfamily members of axon guidance, such as Frazzled/DCC,ROBO and BOC signal through ABL and JNK to regulate neurite out-growth [5,11,21,50]. Considering the high homology shared by BOCwith DCC and ROBO [22,51,52] and the importance of cytoskeletal re-modeling as an underlying mechanism for neurite formation and axonguidance, it is not surprising that the similar mechanism involves ABLand JNK. However, the similarities between these receptors are limitedto the structural organization and the sequence homology in their ex-tracellular region andhow the different intracellular regions utilize sim-ilar downstream regulators to modulate cytoskeletal remodeling inaxon guidance is currently unclear. The conserved interacting se-quences for SH2 and SH3 domains in the receptor proteins play a criticalrole in mediating the interaction with downstream effectors, such asABL, which can connect to cytoskeletal remodeling in neurite formationand axon guidance [53].

Previously, JNKs were implicated in neural development, neuriteoutgrowth and axonal regeneration [15,54–56]. Our study reveals thatJNK activation depends on BOC andABL during neuronal differentiation.BOC depletion caused reduced JNK activation during neuronal differen-tiation. Consistently, JNK activation was observed concomitantly withinduction of BOC expression during neuronal differentiation. BOCmuta-tions deficient for ABL binding displayed diminished JNK activation andthe ABL-KD mutation failed to activate JNK to the level of the wildtype,suggesting that the interaction of BOC with ABL is required for JNK acti-vation during neuronal differentiation and neurite formation. BOC de-pletion reduced the expression of DCX and MAP2 along with JNKactivation in neuronal differentiation that was restored by the re-ex-pression of wildtype BOC, but not by BOC mutant proteins deficientfor ABL binding. Interestingly, the treatmentwith Shh induced JNK acti-vation and this activation was abrogated by BOC depletion in neuronaldifferentiation of P19 cells. These data suggest that Shh/BOC signalingactivates JNK promoting neuronal differentiation and neurite formation.Thus, it is likely that Shh binding to BOC might activate ABL/JNK path-way to induce neuronal differentiation and cytoskeletal remodeling re-quired for neurite outgrowth.

5. Conclusions

Taken together, our data demonstrate the positive role of BOC inneuronal differentiation of P19 EC cells and cortical NPCs, and BOC inter-actswith ABL, resulting in JNK activation and promotion of neuronal dif-ferentiation. Our current study therefore provides new insight howShh/BOC signaling regulates actin cytoskeleton remodeling triggered by ABLand JNK signaling cascades to promote neurite formation and extension.

Conflict of interest

The authors declare no conflict of interest.

Author contributions

TAV, YEL, BGK, SJL designed andperformed experiments, interpretedresults and analyzed statistics. GUB, HC and JSK designed experiments,interpreted results and wrote the manuscript.

Acknowledgments

Authors thank Dr. Ruth Simon for critical discussion and reading ofthe manuscript. This research was supported by Basic Science ResearchProgram through the National Research Foundation of Korea (NRF)funded by the Ministry of Science, ICT and Future Planning (NRF-2015R1A2A1A15051998) (NRF-2016R1A2B2007179).

References

[1] L. Luo, Actin cytoskeleton regulation in neuronal morphogenesis and structural plas-ticity, Annu. Rev. Cell Dev. Biol. 18 (2002) 601–635.

[2] B.J. Dickson, Y. Zou, Navigating intermediate targets: the nervous system midline,Cold Spring Harb. Perspect. Biol. 2 (2010) a002055.

[3] H. Thompson, W. Andrews, J.G. Parnavelas, L. Erskine, Robo2 is required for Slit-me-diated intraretinal axon guidance, Dev. Biol. 335 (2009) 418–426.

[4] A. Okada, F. Charron, S. Morin, D.S. Shin, K. Wong, P.J. Fabre, M. Tessier-Lavigne, S.K.McConnell, Boc is a receptor for sonic hedgehog in the guidance of commissuralaxons, Nature 444 (2006) 369–373.

[5] C. Qu, T. Dwyer, Q. Shao, T. Yang, H. Huang, G. Liu, Direct binding of TUBB3with DCCcouples netrin-1 signaling to intracellular microtubule dynamics in axon outgrowthand guidance, J. Cell Sci. 126 (2013) 3070–3081.

[6] A.J. Koleske, A.M. Gifford, M.L. Scott, M. Nee, R.T. Bronson, K.A. Miczek, D. Baltimore,Essential roles for the Abl and Arg tyrosine kinases in neurulation, Neuron 21 (1998)1259–1272.

[7] L.M. Lanier, F.B. Gertler, From Abl to actin: Abl tyrosine kinase and associated pro-teins in growth cone motility, Curr. Opin. Neurobiol. 10 (2000) 80–87.

[8] L.R. Zukerberg, G.N. Patrick, M. Nikolic, S. Humbert, C.L. Wu, L.M. Lanier, F.B. Gertler,M. Vidal, R.A. Van Etten, L.H. Tsai, Cables links Cdk5 and c-Abl and facilitates Cdk5tyrosine phosphorylation, kinase upregulation, and neurite outgrowth, Neuron 26(2000) 633–646.

[9] P.J. Woodring, E.D. Litwack, D.D. O'Leary, G.R. Lucero, J.Y. Wang, T. Hunter, Modula-tion of the F-actin cytoskeleton by c-Abl tyrosine kinase in cell spreading andneurite extension, J. Cell Biol. 156 (2002) 879–892.

[10] G.J. Bashaw, T. Kidd, D. Murray, T. Pawson, C.S. Goodman, Repulsive axon guidance:Abelson and enabled play opposing roles downstream of the roundabout receptor,Cell 101 (2000) 703–715.

[11] D.J. Forsthoefel, E.C. Liebl, P.A. Kolodziej, M.A. Seeger, The Abelson tyrosine kinase,the Trio GEF and Enabled interact with the Netrin receptor Frazzled in Drosophila,Development 132 (2005) 1983–1994.

[12] X.R. Ren, Y. Hong, Z. Feng, H.M. Yang, L. Mei, W.C. Xiong, Tyrosine phosphorylationof netrin receptors in netrin-1 signaling, Neurosignals 16 (2008) 235–245.

[13] R.A. Van Etten, Cycling, stressed-out and nervous: cellular functions of c-Abl, TrendsCell Biol. 9 (1999) 179–186.

[14] E.C. Liebl, D.J. Forsthoefel, L.S. Franco, S.H. Sample, J.E. Hess, J.A. Cowger, M.P.Chandler, A.M. Shupert, M.A. Seeger, Dosage-sensitive, reciprocal genetic interac-tions between the Abl tyrosine kinase and the putative GEF trio reveal trio's rolein axon pathfinding, Neuron 26 (2000) 107–118.

[15] F. Dajas-Bailador, E.V. Jones, A.J. Whitmarsh, The JIP1 scaffold protein regulates axo-nal development in cortical neurons, Curr. Biol. 18 (2008) 221–226.

[16] E.T. Coffey, Nuclear and cytosolic JNK signalling in neurons, Nat. Rev. Neurosci. 15(2014) 285–299.

[17] E. Zentrich, S.Y. Han, L. Pessoa-Brandao, L. Butterfield, L.E. Heasley, Collaboration ofJNKs and ERKs in nerve growth factor regulation of the neurofilament light chainpromoter in PC12 cells, J. Biol. Chem. 277 (2002) 4110–4118.

[18] L. Marek, V. Levresse, C. Amura, E. Zentrich, V. Van Putten, R.A. Nemenoff, L.E.Heasley,Multiple signaling conduits regulate global differentiation-specific gene ex-pression in PC12 cells, J. Cell. Physiol. 201 (2004) 459–469.

[19] C.R. Amura, L. Marek, R.A. Winn, L.E. Heasley, Inhibited neurogenesis in JNK1-defi-cient embryonic stem cells, Mol. Cell. Biol. 25 (2005) 10791–10802.

[20] H. Wang, S. Ikeda, S. Kanno, L.M. Guang, M. Ohnishi, M. Sasaki, T. Kobayashi, S.Tamura, Activation of c-Jun amino-terminal kinase is required for retinoic acid-in-duced neural differentiation of P19 embryonal carcinoma cells, FEBS Lett. 503(2001) 91–96.

[21] C. Qu, W. Li, Q. Shao, T. Dwyer, H. Huang, T. Yang, G. Liu, c-Jun N-terminal kinase 1(JNK1) is required for coordination of netrin signaling in axon guidance, J. Biol.Chem. 288 (2013) 1883–1895.

[22] J.S. Kang, P.J. Mulieri, Y. Hu, L. Taliana, R.S. Krauss, BOC, an Ig superfamily member,associates with CDO to positively regulate myogenic differentiation, EMBO J. 21(2002) 114–124.

[23] W. Zhang, J.S. Kang, F. Cole, M.J. Yi, R.S. Krauss, Cdo functions at multiple points inthe Sonic Hedgehog pathway, and Cdo-deficient mice accurately model humanholoprosencephaly, Dev. Cell 10 (2006) 657–665.

[24] T. Tenzen, B.L. Allen, F. Cole, J.S. Kang, R.S. Krauss, A.P. McMahon, The cell surfacemembrane proteins Cdo and Boc are components and targets of the Hedgehog sig-naling pathway and feedback network in mice, Dev. Cell 10 (2006) 647–656.

[25] B.L. Allen, J.Y. Song, L. Izzi, I.W. Althaus, J.S. Kang, F. Charron, R.S. Krauss, A.P.McMahon, Overlapping roles and collective requirement for the coreceptors GAS1,CDO, and BOC in SHH pathway function, Dev. Cell 20 (2011) 775–787.

[26] G.U. Bae, S. Domene, E. Roessler, K. Schachter, J.S. Kang, M. Muenke, R.S. Krauss, Mu-tations in CDON, encoding a hedgehog receptor, result in holoprosencephaly anddefective interactions with other hedgehog receptors, Am. J. Hum. Genet. 89(2011) 231–240.

40 T.A. Vuong et al. / Cellular Signalling 30 (2017) 30–40

[27] W. Zhang, M. Hong, G.U. Bae, J.S. Kang, R.S. Krauss, Boc modifies theholoprosencephaly spectrum of Cdo mutant mice, Dis. Model. Mech. 4 (2011)368–380.

[28] M. Seppala, G.M. Xavier, C.M. Fan, M.T. Cobourne, Boc modifies the spectrum ofholoprosencephaly in the absence of Gas1 function, Biology open 3 (2014) 728–740.

[29] S.A. Bergeron, O.V. Tyurina, E. Miller, A. Bagas, R.O. Karlstrom, Brother of cdo(umleitung) is cell-autonomously required for Hedgehog-mediated ventral CNSpatterning in the zebrafish, Development 138 (2011) 75–85.

[30] J.A.S. John, S. Scott, K.Y. Chua, C. Claxton, B. Key, Growth cone dynamics in thezebrafish embryonic forebrain are regulated by Brother of Cdo, Neurosci. Lett. 545(2013) 11–16.

[31] C.C. Harwell, P.R. Parker, S.M. Gee, A. Okada, S.K. McConnell, A.C. Kreitzer, A.R.Kriegstein, Sonic hedgehog expression in corticofugal projection neurons directscortical microcircuit formation, Neuron 73 (2012) 1116–1126.

[32] R.S. Krauss, F. Cole, U. Gaio, G. Takaesu, W. Zhang, J.S. Kang, Close encounters: regu-lation of vertebrate skeletal myogenesis by cell-cell contact, J. Cell Sci. 118 (2005)2355–2362.

[33] J.S. Kang, M.J. Yi, W. Zhang, J.L. Feinleib, F. Cole, R.S. Krauss, Netrins and neogeninpromote myotube formation, J. Cell Biol. 167 (2004) 493–504.

[34] G. Takaesu, J.S. Kang, G.U. Bae, M.J. Yi, C.M. Lee, E.P. Reddy, R.S. Krauss, Activation ofp38alpha/beta MAPK inmyogenesis via binding of the scaffold protein JLP to the cellsurface protein Cdo, J. Cell Biol. 175 (2006) 383–388.

[35] J.S. Kang, G.U. Bae, M.J. Yi, Y.J. Yang, J.E. Oh, G. Takaesu, Y.T. Zhou, B.C. Low, R.S.Krauss, A Cdo-Bnip-2-Cdc42 signaling pathway regulates p38alpha/beta MAPK ac-tivity and myogenic differentiation, J. Cell Biol. 182 (2008) 497–507.

[36] G.U. Bae, B.G. Kim, H.J. Lee, J.E. Oh, S.J. Lee, W. Zhang, R.S. Krauss, J.S. Kang, Cdo bindsAbl to promote p38alpha/beta mitogen-activated protein kinase activity and myo-genic differentiation, Mol. Cell. Biol. 29 (2009) 4130–4143.

[37] M.H. Jeong, S.M. Ho, T.A. Vuong, S.B. Jo, G. Liu, S.A. Aaronson, Y.E. Leem, J.S. Kang, Cdosuppresses canonical Wnt signalling via interaction with Lrp6 thereby promotingneuronal differentiation, Nat. Commun. 5 (2014) 5455.

[38] E. Meijering, M. Jacob, J.C. Sarria, P. Steiner, H. Hirling, M. Unser, Design and valida-tion of a tool for neurite tracing and analysis in fluorescence microscopy images, Cy-tometry. Part A: the Journal of the International Society for Analytical Cytology 58(2004) 167–176.

[39] P. Tran, S.M. Ho, B.G. Kim, T.A. Vuong, Y.E. Leem, G.U. Bae, J.S. Kang, TGF-beta-acti-vated kinase 1 (TAK1) and apoptosis signal-regulating kinase 1 (ASK1) interactwith the promyogenic receptor Cdo to promote myogenic differentiation via activa-tion of p38MAPK pathway, J. Biol. Chem. 287 (2012) 11602–11615.

[40] J.E. Oh, G.U. Bae, Y.J. Yang, M.J. Yi, H.J. Lee, B.G. Kim, R.S. Krauss, J.S. Kang, Cdo pro-motes neuronal differentiation via activation of the p38 mitogen-activated proteinkinase pathway, FASEB J.: official publication of the Federation of American Societiesfor Experimental Biology 23 (2009) 2088–2099.

[41] C.E. Andoniou, C.B. Thien, W.Y. Langdon, The two major sites of cbl tyrosine phos-phorylation in abl-transformed cells select the crkL SH2 domain, Oncogene 12(1996) 1981–1989.

[42] S.M. Feller, Crk family adaptors-signalling complex formation and biological roles,Oncogene 20 (2001) 6348–6371.

[43] M. Leyssen, D. Ayaz, S.S. Hebert, S. Reeve, B. De Strooper, B.A. Hassan, Amyloid pre-cursor protein promotes post-developmental neurite arborization in the Drosophilabrain, EMBO J. 24 (2005) 2944–2955.

[44] E.M. Moresco, S. Donaldson, A. Williamson, A.J. Koleske, Integrin-mediated dendritebranch maintenance requires Abelson (Abl) family kinases, J. Neurosci. Off. J. Soc.Neurosci. 25 (2005) 6105–6118.

[45] P.T. Yam, S.D. Langlois, S. Morin, F. Charron, Sonic hedgehog guides axons through anoncanonical, Src-family-kinase-dependent signaling pathway, Neuron 62 (2009)349–362.

[46] T.F. Sloan, M.A. Qasaimeh, D. Juncker, P.T. Yam, F. Charron, Integration of shallowgradients of Shh and Netrin-1 guides commissural axons, PLoS Biol. 13 (2015),e1002119.

[47] L. Rubbi, B. Titz, L. Brown, E. Galvan, E. Komisopoulou, S.S. Chen, T. Low, M.Tahmasian, B. Skaggs, M. Muschen, M. Pellegrini, T.G. Graeber, Globalphosphoproteomics reveals crosstalk between Bcr-Abl and negative feedbackmechanisms controlling Src signaling, Sci. Signal. 4 (2011), ra18.

[48] O. Hantschel, G. Superti-Furga, Regulation of the c-Abl and Bcr-Abl tyrosine kinases,Nat. Rev. Mol. Cell Biol. 5 (2004) 33–44.

[49] J. Colicelli, ABL tyrosine kinases: evolution of function, regulation, and specificity,Sci. Signal. 3 (2010), re6.

[50] M.P. O'Donnell, G.J. Bashaw, Distinct functional domains of the Abelson tyrosine ki-nase control axon guidance responses to Netrin and Slit to regulate the assembly ofneural circuits, Development 140 (2013) 2724–2733.

[51] I. Dudanova, R. Klein, Integration of guidance cues: parallel signaling and crosstalk,Trends Neurosci. 36 (2013) 295–304.

[52] R.M. Connor, C.L. Allen, C.A. Devine, C. Claxton, B. Key, BOC, brother of CDO, is a dor-soventral axon-guidance molecule in the embryonic vertebrate brain, J. Comp.Neurol. 485 (2005) 32–42.

[53] L.K. Harbott, C.D. Nobes, A key role for Abl family kinases in EphA receptor-mediatedgrowth cone collapse, Mol. Cell. Neurosci. 30 (2005) 1–11.

[54] V. Waetzig, Y. Zhao, T. Herdegen, The bright side of JNKs-multitalented mediators inneuronal sprouting, brain development and nerve fiber regeneration, Prog.Neurobiol. 80 (2006) 84–97.

[55] A.A. Oliva Jr., C.M. Atkins, L. Copenagle, G.A. Banker, Activated c-Jun N-terminal kinaseis required for axon formation, J. Neurosci. Off. J. Soc. Neurosci. 26 (2006) 9462–9470.

[56] C. Lindwall, L. Dahlin, G. Lundborg, M. Kanje, Inhibition of c-Jun phosphorylation re-duces axonal outgrowth of adult rat nodose ganglia and dorsal root ganglia sensoryneurons, Mol. Cell. Neurosci. 27 (2004) 267–279.