A specific cytotoxic T-lymphocyte epitope presentation system for antitumor immunity

A specific cytotoxic T-lymphocyte epitope presentation systemfor antitumor immunity

Ying Wu1,2, Changzhen Liu2, Meiyi Sun4, Hexiao Shen2, Deyin Guo1 and Bin Gao2,3

1 State Key Laboratory of Virology and Modern Virology Research Center, College of Life Sciences, Wuhan University, Wuhan, China2 The Center for Molecular Immunology, CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology,

Chinese Academy of Sciences, China3 China-Japan Joint Laboratory for Molecular Immunology and Virology, CAS Key Laboratory of Pathogenic Microbiology and Immunology,

Institute of Microbiology, Chinese Academy of Sciences, China4 Epigen Biotec, Beijing, China

The magnitude of CTL-mediated immunity response is highly dependent on the density of antigenic peptide–MHC I complexes

at the cell surface. In this study, we adopt a novel strategy to promote the surface level of specific peptide–MHC I complexes.

The strategy combines the inhibition of transporter associated with antigen processing (TAP) with the delivery of specific

peptide into endoplasmic reticulum directly without the help of TAP. First, RNA interference (RNAi) technology was used to

inhibit TAP expression for blocking endogenous epitope-assembled MHC class I on cell surface. Second, a peptide epitope of

interest was covalently linked onto human beta-2-microglobulin (b2m). Both TAP-specific siRNA and the peptide-linked b2m

were delivered into antigen-presentation cells sequentially or simultaneously using a retrovirus delivery system. The combined

strategy produces a significant amount of MHC I loaded with specific epitopes on the surface while reducing endogenously

peptide-assembled MHC class I both in vitro and in vivo. The efficacy of induction of specific immune response with the

strategy against tumor cells is demonstrated in both tumor cell lines and a syngenic graft tumor model.

CD8-positive cytotoxic T lymphocytes (CTLs) play a pivotalrole in host defense against tumor and viral infections. Theysample the protein content of cells by recognizing a widerepertoire of self-peptides and foreign peptides associatedwith major histocompatibility complex (MHC) class I mole-cules, which are constitutively expressed on the surface ofvirtually all nucleated cells, and decide whether or not toturn on the killing switch. Most of these peptides are gener-ated from protein degradation in the cytosol by the protea-some complex and transported into the lumen of the endo-plasmic reticulum (ER) by the transporter associated withantigen presentation (TAP).1,2 TAP is a heterodimer com-posed of TAP1 and TAP2 subunits,3 and the defect in eitherof the subunits will lead to a loss of surface expression ofMHC class I molecules despite normal expression of bothheavy chain (HC) and b2m.4,5 A single cell expresses around1–10 � 105 MHC I molecules6 with up to 104 differentpeptides.7 Generally, the concentration on the surface of agiven cell for each individual peptide is very low, and onlyantigen-presentation cells (APC) with increased levels ofpeptide–MHC complex can stimulate an effective T-cellactivation.

Because the magnitude of CTL-mediated immunityresponse is highly dependent on the density of antigenic pep-tide–MHC I complexes at the cell surface,8–11 the strategy toincrease the amount of a specific peptide–MHC class I mole-cules on the surface has significant value in vaccine design andimmunotherapy applications. A common strategy used for thispurpose is the delivery of protein antigens into antigen-

Key words: CTL, MHC class I, TAP, RNAi, peptide-linked b2m

Abbreviations: APCs: antigen-presentation cells; CFSE:

carboxyfluorescein succinimidyl ester; CPRG: chlorophenol red-b-D-

galactopyranoside; DCs: dendritic cells; ER: endoplasmic reticulum;

FACS: fluorescence activated cell sorter; GM-CSF: granulocyte/

macrophage colony-stimulating factor; GVT: graft vs. tumor; GVHD:

graft vs. host disease; GST: glutathione S transferase; hb2m: human beta-

2-microglobulin; HC: heavy chain; HSV-1: type I herpes simplex virus;

mb2m: mouse beta-2-microglobulin; MHC: major histocompatibility

complex; MOI: multiplicity of infection; NFAT: nuclear factor of

activated T-cells; OVA: ovalbumin; PBST: Tween-20 in PBS; RNAi: RNA

interference; r.p.m: round per minute; siRNA: small interfering RNA;

shRNA: short hairpin RNA; SCT: stem cell transplantation; TAP:

transporter associated with antigen processing

Grant sponsor: 973 Scheme of CMST; Grant number:

2006CB504306; Grant sponsor: National Natural Science

Foundation of China; Grant number: 30771953

DOI: 10.1002/ijc.24932

History: Received 18 May 2009; Accepted 14 Sep 2009; Online 6

Oct 2009

Ying Wu and Changzhen Liu contributed equally to this work

Correspondence to: Bin Gao, CAS Key Laboratory of Pathogenic

Microbiology and Immunology, Institute of Microbiology, Chinese

Academy of Sciences, 1, Beichen Xilu Rd, Chaoyang District, Beijing

100101, PR China, Tel and Fax: þ86-10-64807338,

E-mail: [email protected]; or Deyin Guo, Modern Virology

Center, National Key Lab of Virology, College of Life Sciences,

Wuhan University, Wuhan 430072, PR China, Tel:

þ86-27-68752506; Fax: þ86-27-68752897,

E-mail: [email protected]

Tum

orIm

mun

olog

y

Int. J. Cancer: 126, 2373–2386 (2010) VC 2009 UICC

International Journal of Cancer

IJC

processing pathway or pulsing epitope peptides directly ontoAPC to increase the density of peptide–MHC molecules. Previ-ous attempts in this direction also include delivering epitopeencoding mRNA or DNA into antigen-presenting cells or tar-get cells.12–14 However, the enhanced intracellular expressiondid not always correlate with an increased surface display ofspecific peptide–MHC I.15 One creative strategy is to geneti-cally fuse the epitope to its corresponding MHC class I mole-cules. It has been reported that peptides, via a short polypep-tide linker, tethered to the N-terminus of the mouse HC Kb,16

human HC HLA-A2,17 human b2m,18,19b2m-H-chain singlechains20,21 and modified human b2m,22 generated tumor pro-tections in a mouse tumor model.

In this study, we describe a novel strategy to furtherincrease the expression of specific peptide–MHC I moleculeson the cell surface. To minimize the self-peptide–MHC I dis-play, TAP in a given APC was inhibited by RNAi constructtargeting TAP2 gene to block intracellular peptide supply. Atthe same time, to maximize the specific peptide presentation,the generated TAP-deficient APC was provided with specificpeptides independent of TAP by genetically engineered epi-tope–b2m fusion protein. The expression cassette of shRNAor epitope-hb2m was introduced into cells by lentiviral vec-tors. Both the generated TAP2-deficient RMA lymphomapulsed with antigenic peptides and the TAP2-deficient K42fibroblasts or autologous dendritic cells (DCs) engineered toexpress epitope-hb2m fusion proteins were investigated andcompared for their tumor immunoprotection activities invivo, using a mouse lymphoma model.

Material and MethodsAntibodies and peptides

25-D1.16 is a monoclonal antibody specific to the Kb-SIIN-FEKL complex23 and originally provided by Dr. R. Germain.Antibodies BBM1, Y3, 28-14-8 and 25-D1.16 were affinitypurified from respective cell culture supernatants using Pro-tein G columns (ImmunoPure, Pierce, USA). Rabbit polyclo-nal antiserum against human calnexin (CNX), which cross-reacts with mouse CNX, was made using the C-terminal pep-tide of CNX cross-linked to keyhole limpet hemocyanin asimmunogen.24 Rabbit polyclonal antiserum against mouseTAP2 was generated in rabbits immunized with Escherichiacoli expressed inclusion body of mouse TAP2-GST fusionprotein. The ovalbumin (OVA) 257-264 H-2Kb-restrictedpeptide (SIINFEKL) was purchased from Eurogentic (Bel-gium) and resuspended in phosphate-buffered saline (PBS;PH 7.4) to a stock concentration of 5mg/ml.

Mice and cell lines

Female 6- to 8-week-old C57BL/6 mice were purchased fromand kept at Animal Center of Institute of Microbiology, Chi-nese Academy of Sciences. RMA is a Rauscher virus-trans-formed lymphoma cell line of C57 origin and RMA-S is anRMA TAP-2 defecient mutant defective in class I surface

expression. Ia- thymoma cell line EL4 (C57BL/6, H-2b) andchicken OVA-expressing EL4 (EG7)25 were kindly providedby Alain Townsend of Oxford University. B3Z, a T-cell hy-bridoma specific for Kb-SIINFEKL, which expresses theNFAT-LacZ reporter gene on activation, was originally fromthe laboratory of Dr N. Shastri.26 K42, a fibroblast cell linederived from mouse embryos carrying a targeted knockout ofthe CRT gene, was kindly provided by Dr M. Michalak. Celllines expressing antibodies BBM1 (anti-human b2-microglo-bulin), Y3 (anti-H-2Kb) and 28-14-8 (anti-H-2Db) wereobtained from the ATCC. The cell lines described above weregrown in RPMI 1640 supplemented with 10% FBS and L-glu-tamine (Gibco BRL, USA). 293T cells were obtained fromInvitrogen and cultured in Dulbecco’s modified Eagle’s me-dium containing 10% FBS (Gibco BRL, USA).

Generation of bone marrow DCs

To obtain murine DCs, bone marrow cells were isolated byflushing femurs and tibias with RPMI 1640 medium. Afterlysis of the erythrocytes, the bone marrow cells were resus-pended in GM-CSF-containing medium and were cultured aspreviously described27 and collected on day 6.

Plasmid constructs

pLk-siTAP2-88, pLK-siTAP2-89, pLK-siTAP2-90, pLK-siTAP2-91 and pLK-siTAP2-92 are a set of lentivirus transfervectors purchased from Sigma (USA) (MISSIONTM shRNATRCN0000066388 50-CCGGGCTCCC TTTCAATGCC AATATCTCGA GATATTGGCA TTGAAAGGGA GCTTTTTG-30,MISSIONTM shRNA TRCN0000066389 50-CCGGGCTACAAGGATCTCTG GGAAACTCGA GTTTCCCAGA GATCCTTGTA GCTTTTTG-30, MISSIONTM shRNA TRCN0000066390 50-CCGGCGGGTT CTGTCAAGGA CAATACTCGAGTATTGTCCT TGACAGAACC CGTTTTTG-30, MIS-SIONTM shRNA TRCN0000066391 50-CCGGCCAGGA GAACAGAACA CTGATCTCGA GATCAGTGTT CTGTTCTCCTGGTTTTTG-30 and MISSIONTM shRNA TRCN000006639250-CCGGGAGACA TTAATCCCTC GCTATCTCGA GATAGCGAGG GATTAATGTC TCTTTTTG-30), each of whichcontains a hairpin sequence targeting mouse TAP2 (eachshRNA sequence is shown above; Fig. 1a). pLK is the parentalvector that contains no hairpin sequences and used as negativecontrol.

pll3.7-gp100-hb2m (previously constructed by our lab) isa lentivirus transfer vector and contains a gp100 epitope-linked hb2m sequence inserted between the NheI and EcoRIsites. The gp100 epitope-linked b2m has an XhoI site withinthe signal sequence 3 bases upstream of the epitope. OVA257-

264 epitope linked hb2m was generated by a 2-step PCR. Inthe first step, the pll3.7-gp100-hb2m plasmid was amplifiedwith the oligonucleotide primer 50-ATCAACTTTGAAAAACTGGG TGGCGGATCG GGCGGAGGCG G-30,complementary to the last 18 bases of OVA257-264 epitopeand the first 23 bases of the 17-amino acid glycine/serinelinker, and 50-AGAATTCTTA CATGTCTCGA TCCCACTT-

Tum

orIm

mun

olog

y

2374 A specific CTL epitope presentation system


30, encoding an EcoRI site. This PCR product was used asthe template in the second step and amplified witholigonucleotide primer 50-ATTACTCGAG GGCAGTATAATCAACTTTGA AAAACTGGG-30, encoding the OVA257-264

epitope and an XhoI site, and the reverse primer used in thefirst step. pll3.7-OVA-hb2m was obtained by replacing the380-bp XhoI-EcoRI fragment in pll3.7-gp100-hb2m with thesimilarly digested final PCR product. pLK-OVA-hb2m (Fig.1b) or pLK-91-OVA-hb2m was generated by replacing thepuromycin-resistance gene in pLK or pLK-siTAP2-91 with a440-bp BamHI-KpnI fragment encoding OVA257-264 epitope-linked hb2m generated by PCR using pll3.7-OVA-hb2m astemplate with oligonucleotide primers 50-ACTTGGATCCACCACCATGT CTCGCTCCGT-30 and 50-GCTAGGTACCTTACATGTCT CGATCCCAC-30, followed by digestion withBamHI and KpnI. All constructs were verified by sequencing.

Lentivirus production and virus transduction

Lentiviruses were produced by transient transfection into293T cells using the calcium phosphate precipitation methodas previously described.28 A total of 20 lg of plasmid DNAwas used for the transfection of one 100-mm dish of 5 � 106

293T cells: 8 lg of the transfer vector plasmid, 4 lg of enve-lope plasmid pLP/VSVG (Invitrogen, USA), 4 lg of packag-ing plasmid pLP1 (Invitrogen, USA) and 4 lg of packagingplasmid pLP2 (Invitrogen, USA). For fibroblast infection, cellcultures were supplemented with virus supernatant (at anmultiplicity of infection (MOI) of 5) and 8 lg/ml polybrene(Sigma, USA). For lymphoma cell infection, cell cultureswere supplemented with virus supernatant (at an MOI of 10)and 8 lg/ml polybrene and were spun at 1200 rpm for 45min at 30�C. Supernatant was removed 6 h after infectionand replaced with fresh growth medium. For DC infection,DC cultures on day 6 were supplemented with virus superna-tant (at an MOI of 30) and 8 lg/ml polybrene and werespun at 1200 rpm for 30 min at 30�C. Supernatant wasremoved 6 h after infection and replaced with fresh GM-CSF-containing growth medium. Cells transduced by virusescarrying the puromycin-resistance gene were selected by 6lg/ml puromycin (Amresco, USA) 48 h after infection.

Western blots

A total of 2 � 106 cells were lysed on ice in 100 ll PBS (PH7.4) containing 0.5% Nonidet P-40. The lysates were resolvedby 10% SDS-PAGE and transferred onto Hybond Extra-Cmembrane (Amersham, USA). After blocking with 5%skimmed milk (Marvel, UK) in PBS at 4�C overnight, themembrane was incubated with antibodies in 0.05% Tween-20in PBS (PBST) containing 1% skimmed milk for 1 hr atroom temperature. The membrane was washed with PBST 3times and incubated with anti-rabbit or anti-mouse antibodyconjugated with peroxidase (Sigma, USA) in PBST containing1% skimmed milk for 1hr and washed 3 times with PBST.The membrane was visualized with an enhanced chemilumi-nescence detection system according to the manufacture’sinstructions (Pierce, USA).

Figure 1. Blocking endogenous MHC class I expression with

lentiviral delivery of siRNA targeting TAP2. (a) Schematic

representation of LK-siTAP2 lentiviral vectors. Five candidate TAP2

siRNA sequences as mentioned in Materials and methods section

were inserted downstream of human U6 promoter, respectively, as

indicated by the black box. 50LTR, 50long terminal repeat; W, RNA

packaging sequence; RRE, Rev response element; cPPT, central

polypurine tract; hPGK, human phosphoglycerate kinase eukaryotic

promoter; puroR, puromycin-resistance gene; SIN/LTR, 3’self-

inactivating long terminal repeat. (b) Flow cytometry analysis of

MHC class I surface expression in K42 fibroblasts transduced with

virus LK-siTAP2-88 (K42-88),-89 (K42-89), -90 (K42-90), -91 (K42-

91) or -92 (K42-92). K42-88, -89, -90, -91, -92 (black line in each

panel) or non-transduced K42 cells (grey line in each panel) were

incubated with mAbs to H-2Db (28-14-8) and then with FITC-

conjugated goat anti-mouse IgG Abs. Nontransduced K42 cells only

stained by FITC-conjugated goat anti-mouse IgG Abs were used as

negative control (filled area in each panel). (c) Flow cytometry

analysis of MHC class I surface expression in RMA cells transduced

with virus LK-siTAP2-91 (RMA-91). RMA-91 (black line), RMA-S

(doted line) or nontransduced RMA cells (grey line) were incubated

with mAbs to H-2Kb (Y3) and then with FITC-conjugated goat anti-

mouse IgG Abs. Nontransduced RMA cells only stained by FITC-

conjugated goat anti-mouse IgG Abs were used as a negative

control (filled area). In (b) and (c), fluorescence intensity is

presented in logarithmic scale. The percent decrease in expression

as indicated in each graph was determined by subtracting the

negative control from the experimental values against that in

nontransduced cells. The data shown are representative of 3

independent experiments. (d) Western blotting analysis of TAP2

expression in cells transduced with LK-siTAP2-91 virus. Cell lysates

of K42-91, RMA-91 or control cells were subjected to western

blotting. mTAP2 expression was probed by rabbit polyclonal

antiserum against mTAP2. Calnexin (CNX) expression was used as

internal control and probed by rabbit polyclonal antiserum against

human CNX that cross-reacts with mouse CNX.

Tum

orIm

mun

olog

y

Wu et al. 2375


Flow cytometry

A total of 1 � 105 Cells were harvested and resuspended in200 ll FACS buffer (1� PBS, 1% fetal bovine serum, and0.1% sodium azide) containing 2 lg primary antibody andincubated on ice for 30 min. Cells were then washed twicewith FACS buffer and incubated with the secondary antibodyfor 30 min in the dark at 4�C. Cells were washed 3 timesand resuspended in 300 ll fixation buffer (2% paraformalde-hyde in PBS, pH 7.4), and analysis was performed on GuavaEasycyte (Guava Technologies, USA) and analyzed by FlowJo (Tree Star, Ashland, OR).

B3Z activation

Target cells (lentivirus-infected fibroblasts) were harvestedand resuspended in RPMI 1640 medium supplemented with10% FBS at 1 � 106/ml. Hundred-microliter aliquots of prop-erly diluted target cell suspensions were added in wells of a96-well plate to achieve an array of effector to target cellratios. EG7 (endogenously expressing OVA) cells were usedas a positive control. Hndred microliters of 1 � 106/ml B3Zcells were added to each well and cocultured with the targetcells overnight at 37�C with 5% CO2. Cells were washedtwice with PBS (PH 7.4), and the cell pellets were lysed byaddition of 100 ll of Z buffer containing 0.15 mM chloro-phenol red-b-D-galactopyranoside (CPRG) substrate (Calbio-chem, La Jolla, CA), 0.125% NP40 (EMD Sciences, La Jolla,CA), 9 mM MgCl2 (Aldrich, USA) and 100 mM 2-mercapto-ethanol in PBS. After 4 h incubation at 37 �C in dark, 50 llof stop buffer (300 mM glycine and 15 mM EDTA in water)was added to each well. The amount of lacZ enzyme wasquantified by the hydrolysis of CPRG, which produces chlor-ophenol red absorbing at 595 nm. The OD value of each wellwas read on a 96-well plate reader (BioRad Model 3550,USA) at 595 nm with 636 nm as the reference wavelength.29

Mice immunization

For immunization with fibroblast- or lymphoma-based vac-cines, 6- to 8-week-old female C57BL/6 mice (12 for eachgroup) were immunized i.p. with 5 � 106 mytomycin C-treated cells suspended in 500ul sterile PBS (20 lg/ml myto-mycin C for fibrobalsts; 10 lg/ml mytomycin C for peptide-pulsed lymphoma cells) for 3 times at 7-day intervals. Toprepare peptide-pulsed lymphoma cells, cells (5 � 106) werefirst incubated in culture medium at 26 �C for 24 h, washedwith PBS and resuspended in 1 ml RPMI 1640 supplementedwith 50 lg/ml peptide, followed by incubation at 26�C for4 h and then at 37�C for 4 h. For immunization with DC-based vaccines, 6- to 8-week-old female C57BL/6 mice (3 foreach group) were immunized s.c. in the flank with 2 � 106

DCs in 100 ll sterile PBS twice at a 7-day interval. Mice innonimmunized group received sterile PBS only.

Spleen cell-mediated cytotoxicity

Ten days after the last immunization, spleens were removed(2 mice in each group), and splenocytes were obtained andcultured at a density of 2 � 106 cells/ml in the presence of50 lg/ml SIINFEKL for 5 days. Target cells were washedtwice with serum-free medium before staining. The cells werethen incubated for 10 min with Hank’s buffered salt solution(HBSS) supplemented with 2 lM carboxyfluorescein succini-midyl ester (CFSE) at 37�C in the dark. The staining reactionwas quenched by the addition of equal volume of FBS. Thecells were washed twice with growth medium and plated in a96-well U-bottomed plate with each well containing 1 � 104

cells. Effector cells were added to the wells at the indicatedeffector to target cell ratios. After incubation for 6 h at 37�Cwith 5% CO2, the total cell population was harvested fromthe plate, and collected into polystyrene tubes. Immediatelybefore flow cytometric analysis, 10 lg/ml propidium iodide(PI; Sigma-Aldrich, Poole, England) was added to each of thetubes, and all cells were then assessed by FACS analysis.Analysis was on gated CFSE positive cells only. The percent-age of cytotoxic activity was calculated using the followingformula: %specific death ¼ (%total CFSEþPIþ (dead) cells-%spontaneous CFSEþPIþ (dead) cells)/(100%-%spontaneousCFSEþPIþ (dead) cells) � 100%. The percentage of sponta-neous dead cells is measured in the tube containing targetcells only.30

Tetramer staining

After restimulation in vitro for 5 days, the splenocytes weredivided into 2 aliquots. One was used as CTLs in cytotoxicitytest described above and the other was used to determine thefrequency of specific CD8þ T lymphocytes. Splenocytes wereincubated at 37�C for 15 min in staining buffer (PBS with0.1% BSA and 0.1% sodium azide) containing the PE-labeledtetramers (Epigen Biotec (Beijing, China)) and then werewashed once with staining buffer and incubated at roomtemperature in staining buffer containing FITC-labeled rabbitanti-mouse CD8aAbs for 15 min (Epigen Biotec (Beijing,China)). Samples were detected by flow cytometry.

Tumor challenge

Twelve days after the last immunization, mice (10 in eachgroup) were injected with 3 � 106 EG7 tumor cells in 200 llsterile PBS into the right flank skin. Tumors were measuredon 2 perpendicular axes using a vernier caliper. Tumor vol-ume was calculated using the formula V ¼ (A � B2)/2 whereV is volume, A is long diameter, and B is short diameter.31,32

Statistical analysis

Student’s t test was used to determine the statistical differen-ces in cytotoxic activity and tumor sizes. Kaplan-Meier sur-vival platform and log-rank analyses were used to determinethe statistical differences in survival periods. Statistical differ-ences were considered significant if p < 0.05.

Tum

orIm

mun

olog

y



ResultsTargeted disruption of TAP2 with shRNA decreases overall

MHC class I surface expression on transduced cells

TAP2 protein is 1 of the 2 subunits of TAP that is responsi-ble for transportation of peptides generated in the cytosolinto ER, which are required for normal class I antigen proc-essing and presentation.4,33,34 The cells defective in TAP2 ex-hibit decreased surface expression of MHC class I mole-cules.35 To select an efficient shRNA sequence for disruptingTAP2, 5 candidate lentiviruses containing shRNAs driven bya U6 promoter (Fig. 1a) were tested for their effect on MHCclass I surface expression of transduced cells. K42 fibroblastswere infected with the individual shRNA-expressing lentivi-rus, and individual clones were obtained first by drug selec-tion in puromycin and later by limited dilution. The cell sur-face expression of MHC class I was detected by staining withan anti-H-2Db monoclonal antibody. As shown in Figure 1b,surface expression of MHC class I on K42 cell infected withLK-siTAP2-91 (K42-91) and LK-siTAP2-90 (K42-90) viruswas significantly down-regulated compared with that on theparental K42 cell. K42 cells infected with virus LK-siTAP2-88(K42-88), LK-siTAP2-89 (K42-89) and LK-siTAP2-92 (K42-92) showed a moderate reduction of MHC class I. As a con-trol, K42 cells transduced with lentivirus without shRNAsequence (K42-LK) did not show any reduction in MHCclass I expression (data not shown), indicating a specificresponse produced by targeted TAP2 disruption.

The most effective shRNA construct LK-siTAP2-91 wasused to generate a TAP2-defective lymphoma cell line. Amouse lymphoma cell line, RMA, was trasduced by infectionof LK-siTAP2-91 lentivirus (MOI as 1:10), and individualclones were selected by incubation with puromycin (6 lg/ml)and later by limited dilution. MHC class I expression in thetransduced cells (RMA-91) was quantified using anti-H-2Kb

antibody. As shown in Figure 1c, RMA-91 cells exhibited asignificant reduction of MHC class I surface expression.

To test the inhibitory effect of LK-siTAP2-91 on TAP2protein level, K42-91, RMA-91 and control cells were sub-jected to western blotting. As shown in Figure 1d, TAP2expression was considerably suppressed by TAP2-targetingshRNA in cells transduced with LK-siTAP2-91 virus, whereasthe level of calnexin, a control protein, was unaffected. Theseresults indicate that the endogenously produced shRNA canspecifically down-regulate TAP2 expression, leading to a sub-stantial decrease in surface expression of MHC class I.

Expression of OVA epitope-linked hb2m on cell surface

without expression of TAP

To present a specific peptide on an antigen-presentation cellin the absence of TAP, we linked a peptide of interest tob2m that would assemble with MHC HC in the ER andappear on the surface of a cell. For the purpose, SIINFEKL, aH-2Kb-restricted dominant epitope peptide derived fromOVA, was fused to human b2m and built in a lentivirus vec-

tor (Fig. 2a). The vector was used to make LK-OVA-hb2m, avirus expressing SIINFEKL linked human b2m by cotrans-fecting 293FT with lentivirus packaging plasmids.

To test the ability of the virus to express the SIINFEKLpeptide on cell surface without the requirement of TAP,TAP2 knockdown cell line K42-91 along with its parentalK42 cell was infected with LK-OVA-hb2m at a MOI of 5. Asshown in Figure 2b, SIINFEKL-linked b2m was expressedwell in these cell lines comparable with human cell line 293Twhile calnexin was used as a loading control. The surfaceexpression of hb2m on transduced cell population was ana-lyzed by flow cytometry using an anti-human b2-microglobu-lin mAb BBM1 against the background of mouse b2m. Asshown in Figure 2c, a single peak was observed for both celllines transduced with the virus, demonstrating a properexpression of b2-microglobulin on the surface of the cells inthe presence or absence of TAP on high-efficiency transduc-tion. The surface expression of hb2m in K42-91-OVA-hb2mcells was slightly higher than that in K42-OVA- hb2m cells,whereas the total hb2m produced between them was similarto that found in western blotting results (Fig. 2b), suggestingthat the epitope-linked hb2m expressed in K42-OVA-hb2mcells may face the competition from the native mouseb2mand free peptides transported by TAP for the HC. In con-trast, in TAP-deficient cells, a shortage in peptide supplycould substantially decrease the amount of the complex ofmb2m/peptide/HC, which allows efficient assembly of thepeptide-linked hb2m with the H-2Kb HC, a fact clearlydemonstrated by the restoration of MHC class I surfaceexpression in K42-91 cells transduced with LK-OVA-hb2m(Fig. 2d).

Enhanced expression of the specific peptide–MHC I

complexes on cell surface by combination of shRNA

targeted TAP2 disruption with the delivery of an epitope

peptide-linked hb2mTo quantify the specific peptide–MHC I complex on differentcell lines, 25-D1.16, a mAb specific to OVA257-264/K

b com-plex, was used to stain the cells. RMA-S is a Rauscher virus-induced tumor mutant, a well-studied system for antigenprocessing and presentation. Because of its deficiency ofTAP, there are a huge amount of empty MHC I on RMA-Scompared with its wild-type counterpart RMA cells.36 RMAcell line was infected with the virus carrying TAP2-targetingshRNA to make RMA-91, a RMA-S equivalent that expressesdecreased MHC I molecule on the cell surface. It would beexpected that more peptides would bind to both RMA-S andRMA-91 than that to RMA cells when the cells were pulsedwith exogenous peptides at low temperature. RMA, RMA-Sand RMA-91 cells were precultured at 26�C for 24 h ina growth medium and then incubated in 50 lg/ml ofOVA257-264 at 26�C for 4 h. After a further 4 h at 37�C to letempty class I molecules on cell surface fall apart, cells werestained with 25-D1.16 mAb. As shown in Figure 3a,increased OVA257-264/K

b was observed in both RMA-S and

Tum

orIm

mun

olog

y

Wu et al. 2377


RMA-91 cells, although there was a similar level of OVA257-

264/Kb on RMA to that on RMA pulsed with the peptide.

There were more OVA257-264/Kb observed on RMA-S than

that on RMA-91 cells, reflecting incomplete suppression ofTAP2 by RNAi technology. The results demonstrated thatTAP2 knockdown by RNAi provided empty MHC class Imolecules for binding to a specific peptide.

Next, we analyzed the amount of OVA257-264/Kb on cells

with both disrupted TAP2 and delivered SIINFEKL-linkedhb2m. As shown in Figure 3b, the introduction of SIIN-FEKL-linked hb2m increased OVA257-264/K

b on the surfaceof the cells, demonstrating that b2m-associated peptidesbound to MHC class I were well presented on the surface ofcells. In the control experiments, 25-D1.16 hardly picked upany complex even in EG7 cells known to express small num-ber of OVA257-264/K

b on the surface because of antibodys’low affinity for the complex. In contrast to EG7, a significant

amount of OVA257-264/Kb was observed on the surface of

K42-91-OVA-hb2m cells lacking endogenous peptides in theER because of disrupted TAP. The results demonstrated thatthe strategy with combined TAP2 disruption with a peptide-linked hb2m delivery dramatically increased the number ofspecific peptide in the form of MHC complex. The strategywould be useful for efficient epitope presentation, a prerequi-site for stimulation of specific T-cell responses.

The cells with combined TAP2 disruption with a peptide-linked hb2m would be ideal APC for efficient stimulation ofspecific T cell because the number of OVA257-264/K

b on thesecells was greatly increased. K42-91-OVA-hb2m cells alongwith its counterpart cells were tested for their ability to stim-ulate a specific T-cell clone B3Z, a hybridoma that expresseslacZ on its binding to the OVA257-264/K

b complex throughT-cell receptor on the surface.26 Both K42-91-OVA-hb2mand K42-OVA-hb2m cell lines along with a mock-transduced

Figure 2. Expression of OVA257-264-linked hb2m. (a) Schematic representation of LK-OVA-hb2m lentiviral vector. The H-2Kb-restricted OVA

epitope and a 17-amino acid glycine/serine linker were inserted between the hb2m signal sequence and the sequence of mature protein.

The construct was cloned into LK retroviral vector by replacing the puromycin-resistance gene. (b) Western blotting analysis of hb2m

expression in the fibroblasts transduced with LK-OVA-hb2m virus. Cell lysates of K42-OVA-hb2m, K42-91-OVA-hb2m or control cells were

subjected to western blotting. hb2m expression was probed with mAbs to hb2m (BBM1). Calnexin expression was used as internal control

and probed by rabbit polyclonal antiserum against human CNX that cross-reacts with mouse CNX. (c) Flow cytometry analysis of hb2m

expression on the fibroblasts transduced with LK-OVA-hb2m virus. K42, K42-OVA-hb2m or K42-91-OVA-hb2m cells were incubated with

mAbs to hb2m (BBM1) and then with FITC-conjugated goat anti-mouse IgG Abs and analyzed by FACS. (d) Flow cytometry analysis of MHC

class I (H-2Kb) expression on K42-91 cells transduced with LK-OVA-hb2m virus. K42, K42-91 or K42-91-OVA-hb2m cells were incubated

with mAbs to H-2Kb (Y3) and then with FITC-conjugated goat anti-mouse IgG Abs and analyzed by FACS. In (c) and (d), fluorescence

intensity is presented in logarithmic scale, and the data shown are representative of 3 independent experiments.Tum

orIm

mun

olog

y



K42-LK as negative control and EG7 as positive control, werecocultured with B3Z at 37�C overnight. The activation ofB3Z by antigen stimulation was quantified by the hydrolysisof the substrate CPRG by lacZ, and the color change wasread by an ELISA reader. As shown in Figure 3c, both K42-91-OVA-hb2m and K42-OVA-hb2m could effectively acti-vate B3Z, and the responses stimulated by both cells werestronger than that stimulated by OVA-expressing EG7 cells.As expected, the mock virus-transduced cells (K42-LK) didnot show any stimulation of B3Z (open diamond line inFig. 3c).

Induction of OVA257-264 specific CTLs in vivo

In previous experiments, a high concentration of OVA257-264/Kb

on the cell surface could be produced by combined TAPdisruption and peptide-linked b2m delivery. Next, we askedwhether the cells with a high density of OVA257-264/K

b onthe surface could induce a stronger cellular immuneresponse. To answer the question, the stimulation of T cell inmice was tested in response to the immunized cells carrying adifferent density of OVA257-264/K

b on their surface. C57BL/6mice were i.p. immunized 3 times at a weekly interval with aset of cell lines expressing different amount of OVA257-264/K

b,

Figure 3. Augmented specific peptide–MHC I complexes on cell surface of TAP2-deficient cells genetically engineered to express peptide-

linked hb2m or pulsed with exogenous peptides. (a) Flow cytometry analysis of OVA epitope-pulsed lymphoma cells. RMA, RMA-91 or RMA-

S cells were precultured at 26�C for 24 h and incubated with serum free medium containing 50 lg/ml OVA257-264 for 4 h at 26�C and a

further 4 h at 37�C. RMA cells precultured at 26�C for 24h and incubated with serum-free medium for 4 h at 26�C and a further 4h at 37�Cwere used as negative control. Cells were then stained with mAbs (25-D1.16) to Kb-OVA257-264 and then with FITC-conjugated goat anti-

mouse IgG Abs and analyzed by FACS. (b) Flow cytometry analysis of the fibroblasts transduced with LK-OVA-hb2m virus. K42-OVA-hb2m,

K42-91-OVA-hb2m, OVA-expressing EL4 (EG7) or control cells were incubated with mAbs (25-D1.16) to Kb-OVA257-264 complex and then

with FITC-conjugated goat anti-mouse IgG Abs and analyzed by FACS. In (a) and (b), fluorescence intensity is presented in logarithmic scale

and the data shown are representative of 3 independent experiments. (c) Specific activation of the B3Z T cell hybridoma. The indicated

cells were cocultured with the NFAT-LacZ-inducible, SIINFEKL/Kb-specific B3Z T-cell hybridoma overnight at the indicated effector/target (E:T)

ratios. The EG7 cell line expressing endogenous OVA was used as a positive control. The B3Z activation level was evaluated by b-Gal

activity as described. Individual experiments were performed in triplicate, and the data shown are representative of 3 independent

experiments.

Tum

orIm

mun

olog

y

Wu et al. 2379


including OVA257-264-pulsed RMA, OVA257-264-pulsedRMA-91, OVA257-264-pulsed RMA-S, K42-LK, K42-OVA-hb2m and K42-91-OVA-hb2m, as described previously. Themice were sacrificed on day 10 after the last immunization,and the spleen cells from sacrificed mice were tested for theircytotoxic activities against EG7, an endogenous OVA-expressing cell line.

As shown in Figure 4a, K42-91-OVA-hb2m cells inducedthe most potent OVA257-264-specific CTL response, close to,but stronger than that induced by RMA-S cells pulsed withOVA257-264 peptide (E/T ¼ 80, K42-91-OVA-hb2m vs.RMA-SþOVA257-264, p ¼ 0.022). OVA257-264/K

b complex onRMA-S pulsed with an OVA257-264 peptide was claimed to beone of the densest MHC class I molecules ever expressed oncells.36 The cells with combined TAP disruption and peptidelinked b2m delivery were more potent immunogens thanthat with peptide-linked b2m expression only, in correlationto OVA257-264/K

b expressed on their surface (E/T ¼ 80, K42-91-OVA-hb2m vs. K42-OVA-hb2m, p ¼ 0.00011) whileRMA-91þOVA257-264 triggered a stronger T-cell responsethan that by RMA pulsed with the peptide (E/T ¼ 80, RMA-91þOVA257-264 vs. RMAþOVA257-264, p ¼ 0.00045). Simi-larly, OVA257-264-pulsed RMA-S cells stimulated T cells betterthan RMA-91 pulsed with OVA257-264 peptide (E/T ¼ 80,RMA-SþOVA257-264 vs. RMA-91þOVA257-264, p ¼ 0.0309),and a much more weaker cytotoxic response was seen inmice immunized with OVA257-264-pulsed RMA than thatin mice immunized with OVA257-264-pulsed RMA-S cells(E/T ¼ 80, RMA-SþOVA257-264 vs. RMAþOVA257-264, p ¼0.00098). In control groups, spleen cells from mice injectedwith cells transduced with K42-LK mock virus, similar tothat from nonimmunized mice, were not cytotoxic to EG7(E/T ¼ 80, K42-LK vs. nonimmunized, p ¼ 0.125). More-over, the cytotoxicity induced with OVA-presenting cells wasspecific for EG7 cells only, not for EL4 cells (Fig. 4b), exclud-ing the possibility of NK cell-mediated nonspecific killing to-ward tumor cells. These data exhibited a strong correlationbetween the density of specific peptide-associated MHC Imolecules on the cell surface and the level of specific CTLresponse in vivo.

Suppression of tumor growth in immunized mice

We tested the efficacy of the combined strategy of TAPblocking and peptide-b2m delivery for suppressing EG7lymphoma growth in mice. Groups of C57BL/6 mice wereimmunized 3 times by i.p. injection at 7-day intervals withdifferent cell lines: OVA257-264-pulsed RMA, OVA257-264-pulsed RMA-91, OVA257-264-pulsed RMA-S, K42-OVA-hb2m, K42-91-OVA-hb2m or PBS as nonimmunized con-trols. Twelve days after the final immunization, mice wereinoculated intradermally with 3X106 of EG7. The tumorsizes were measured every other day, and the animals thatsurvived were counted every day. As seen in Figure 5, themice vaccinated with K42-91-OVA-hb2m cells showed sig-

nificant tumor protection, and the tumor sizes were thesmallest measured up to day 24. K42-91-OVA-hb2m groupwas the best at suppressing tumor growth with efficacyclose to that of immunization by RMA-SþOVA257-264 (tu-mor sizes measured on day 24, K42-91-OVA-hb2m vs.RMA-SþOVA257-264, p ¼ 0.064). Similarly, the group withthe best survival rate among groups immunized with differ-ent cell lines belongs to K42-91-OVA-hb2m group, followedby RMA-SþOVA257-264 group (survival, K42-91-OVA-hb2mvs. RMA-SþOVA257-264, p ¼ 0.194). Significantly, 2 of 10mice from the group of K42-91-OVA-hb2m were com-pletely tumor-free, demonstrated that combined strategy isefficient to mount T-cell immunity and suppress tumorgrowth.

Figure 4. Spleen cell-mediated antitumoral cytotoxic responses in

C57BL/6 mice immunized either with the lymphomas pulsed with

OVA257-264 peptide or with fibroblasts genetically engineered to

express OVA257-264-hb2m. (a) Groups of mice were immunized i.p.,

respectively, with 5 � 106 mytomycin C-treated cells of each type

every 7 day for 3 times. Nonimmunized mice as control received

sterilized PBS only. Ten days after the last immunization, spleen

cells were harvested and restimulated in vitro for 5 days with

SIINFEKL at 50 lg/ml and subjected to a cytotoxicity assay with

CFSE labeled EG7 tumor cells as target cells at the indicated

effector/target ratios. Columns, mean (n ¼ 3); bars, SD. *p < 0.

05 by Student ’s t test. (b) Control experiments. Spleen cells

described in (a) were subjected to cytotoxicity assay with CFSE-

labeled EL4 tumor cells as target cells at the indicated effector/

target ratio. Columns, mean (n ¼ 3); bars, SD. p > 0.05 for any 2

groups by Student ’s t test.

Tum

orIm

mun

olog

y



Professional APCs modified by the combined strategy of

RNAi-mediated inhibition of TAP and transgenic expression

of epitope–b2m fusion protein induced potent epitope-

specific tumoricidal CTL in vivo

DCs, known as professional APCs, express high levels of cos-timulatory molecules that confer the ability to prime naive Tlymphocytes and thus induce a strong specific cell-mediatedantitumor immune response.37,38 To examine the efficacy of

the combined strategy on professional APCs, autologousbone marrow-derived DCs were infected with either virusLK-91-OVA-hb2m haboring both the most effective TAP2shRNA and OVA257-264 epitope-linked hb2m expression cas-settes, which guarantees simultaneous expression of these 2elements after a single tranduction, or virus LK-OVA-hb2mexpressing OVA257-264 epitope-linked hb2m alone (MOI as30:1). As expected, DCs transduced with LK-91-OVA-hb2mvirus (DC-91-OVA-hb2m) exhibited remarkablely higherlevel of surface expression of hb2m or OVA257-264/K

b thanDCs transduced with LK-OVA-hb2m virus (DC-OVA-hb2m) as stained by BBM1 or 25-D1.16 antibody (Fig. 6a).To determine whether the enhanced epitope presention onTAP deficient DCs could give rise to a more potent specificCTL response, C57BL/6 mice were subcutanously immunizedwith DC-91-OVA-hb2m or DC-OVA-hb2m twice at a 7-dayinterval and sacrificed 10 days after the last immunization.The splenocytes from sacrificed mice were tested for their cy-tolytic activities against EG7 or EL4 tumor cells. As shown inFigure 6b, vaccination with DC-OVA-hb2m elicited a strongcytotoxic response against EG7 tumor cells but still muchweaker than that achieved with DC-91-OVA-hb2m (E/T ¼80, DC-91-OVA-hb2m vs. DC-OVA-hb2m, p¼ 0.00067).Statistically, in both groups of mice immunized with the DC-based vaccines, no distinct cytotoxicity was found againstEL4 tumor cells in support of the OVA257-264 specificity ofthe induced CTLs. Moreover, a higher frequency of OVA257-

264/Kb specific CD8þ T lymphocytes was observed in DC-91-

OVA-hb2m-generated splenocyte population compared withthat of DC-OVA-hb2m-generated splenocyte-population asdetermined by tetramer staining (Fig. 6c), which mightaccount for the higher level of cytotoxicity toward EG7 tu-mor cells raised by DC-91-OVA-hb2m vaccination. Theseresults suggest that bone marrow-derived DCs could be effi-ciently modified by this combined strategy to be potent acti-vators of antigen-specific CTLs in vivo.

DiscussionDiverse strategies have been adopted to increase the densityof specific peptide–MHC I. One of the commonly used meth-ods is to incubate a synthetic peptide at a high concentrationwith cells on which the endogenously processed peptides onMHC complex were stripped by treatment with acid.39 How-ever, it is not suitable for the peptides with low affinity fortheir corresponding MHC I molecules. Alternative methodshave been tried for the delivery of the epitope of interestdirectly into the ER lumen, including fusing the signalsequences to the epitope minigene40 or tethering epitopes to1 component of the MHC I complex.16–21 Recently, animprovement was made to express a high density of MHCclass I molecules by linking membrane-anchored chimericb2m/peptide molecules with the intracellular activation do-main of CD3f-chain.22 It is possible that the peptides led bysignal sequence or the peptide-fused components still facethe competition with their native counterparts within the ER,

Figure 5. Suppression of growth of OVA-expressing tumor in mice

immunized either with the lymphomas pulsed with OVA257-264

peptide or with fibroblasts genetically engineered to express

OVA257-264-hb2m. Groups of mice were immunized i.p.,

respectively, with 5 � 106 mytomycin C-treated cells of each type

every 7 days for 3 times. Nonimmunized mice received sterilized

PBS as control. (a) Inhibition of tumor growth. Twelve days after

the last immunization, mice in each experimental group were

injected intradermally with 3 � 106 EG7 cells. Tumor size was

measured every other day with calipers. The average of tumor size

in the course of 24 days is presented. Points, mean (n ¼ 10);

bars, SD. On day 24, p<0.0001, K42-91-OVA-hb2m vs. K42-OVA-h

b2m; p<0.0001, OVA257-264 pulsed RMA-91 vs. OVA257-264 pulsed

RMA; p ¼ 0.0915, OVA257-264 pulsed RMA-S vs. OVA257-264 pulsed

RMA-91by Student ’s t test. (b) Survival of immunized mice. The

EG7-inoculated mice in each group were monitored at the same

time when tumor size was measured and were sacrificed when

moribund, which corresponded to a tumor size exceeding 25000

mm3. The percentage of survived mice in each group is presented

(n ¼ 10). p < 0.0001, K42-91-OVA-hb2m vs. K42-OVA-h b2m; p <

0.0001, OVA257-264 pulsed RMA-91 vs. OVA257-264 pulsed RMA;

p ¼ 0.1272, OVA257-264 pulsed RMA-S vs. OVA257-264 pulsed

RMA-91 by Kaplan-Meier analysis.

Tum

orIm

mun

olog

y

Wu et al. 2381


which may weaken their potential for profound induction ofCTL response. To minimize surface expression of the self-peptide-loaded MHC-I complex, researches have tried virusproteins to block TAP, such as the ICP47 derived from typeI herpes simplex virus (HSV-1)41,42 and US11 from humancytomegalovirus (CMV).43 However the suppression of MHCI expression by the US11 or ICP47 genes were varied in dif-ferent types of cells and can be blocked by interferon-cexposure.44

In this study, we describe a novel method to increase sur-face expression of specific peptide–MHC I, which was

achieved by combination of TAP inhibition to block intracel-lular peptide supply with provision of specific epitope fusedwith b2m independent of TAP. This has been performedwith lentiviral vectors tailored to express both shRNAs tar-geting TAP2 and peptide-linked hb2m. The novel system hasbeen demonstrated to produce not only a bulk reduction ofendogenously peptide-assembled MHC class I but also a sig-nificant amount of MHC I loaded with specific epitope onthe surface. The results of induction of specific CTLs and tu-mor immunoprotection showed an epitope/MHC I expres-sion dependent manner. OVA257-264-pulsed RMA-S or RMA-

Figure 6. Generation of potent OVA-specific tumoricidal CD8þ effector CTLs in C57BL/6 mice immunized with bone marrow-derived DC

engineered to simultaneously express TAP2 siRNA and OVA257-264-hb2m. (a) Flow cytometry analysis of DC transduced with LK-OVA-hb2m

or LK-91-OVA-hb2m virus. DC, DC-OVA-hb2m or DC-91-OVA-hb2m cells were incubated with mAbs to hb2m (BBM1) or OVA257-264/Kb

complex (25-D1.16) and then with FITC-conjugated goat anti-mouse IgG Abs and analyzed by FACS. Fluorescence intensity is presented in

logarithmic scale and the data shown are representative of 3 independent experiments. (b) Spleen cell-mediated antitumoral cytotoxic

responses in C57BL/6 mice immunized with DC expressing OVA257-264-hb2m. Groups of mice were immunized s.c., respectively, with 2 �106 DC-OVA-hb2m or DC-91-OVA-hb2m cells twice at a 7-day interval. Nonimmunized mice as control received sterilized PBS only. Ten days

after the last immunization, spleen cells were harvested and restimulated in vitro for 5 days with SIINFEKL at 50 lg/ml and subjected to

cytotoxicity assays with CFSE labeled EG7 or EL4 tumor cells as target cells at the indicated effector/target ratios. Columns, mean (n ¼ 3);

bars, SD. *p < 0. 05 by Student’ t test. (c) Frequency of OVA257-264-specific CD8þ T cells induced in C57BL/6 mice immunized with DC

expressing OVA257-264-hb2m. The in vitro restimulated spleen cells as described in (b) were double stained with an FITC-conjugated anti-

mouse CD8 antibody and a PE-conjugated OVA257-264/Kb tetramer and analyzed by FACS. Numbers shown in each graph are percentages of

tetramer-positive cells in total CD8þ T cells. One of 3 tetramer assays is shown.

Tum

orIm

mun

olog

y



91cells were much more efficient to induce a specific T-cellresponse than OVA257-264-pulsed parental cells. K42-91-OVA-hb2m cell vaccination gave rise to more effective CTLsand more significant tumor protection and better survivalrate than K42-OVA-hb2m cell vaccination although both celltypes performed well in vitro activation of specific T cells(Fig. 3c) because of the high sensitivity of B3Z activationassay. A small amount of OVA257-264/K

b complex expressedon the surface of an antigen-presentation cell would beenough to fully stimulate B3Z T cells.45

Several explanations could account for the high efficacy ofthe combined strategy for immunity against tumor. First,K42 cells already have a low background of MHC class Ibecause of a knockout of calreticulin (CRT), an importantcomponent involved in MHC I antigen processing and pre-sentation.46 A further defect in intracellular peptide transpor-tation and simultaneous expression of OVA257-264-linkedhuman b2m that has higher affinity for mouse H-2Kb chainthan mouse b2m47,48 leads to exceedingly high density ofOVA257-264/MHC I complexes. Second, peptide-fused MHC Iis more stable and less susceptible to dissociation than thenatural counterpart49 and thus has longer half-life span.

It has been well established that costimulatory molecules,such as the B7 family, mainly expressed on DCs and acti-vated B cells and macrophages, are necessary for optimalactivation of CTLs.50,51 Fibroblasts are easy to manipulate butdo not express detectable level of costimulatory molecules. Tcells stimulated by fibroblasts will receive only a partial acti-vating signal, which may lead to clonal anergy. Althoughsome immune responses can be generated to tumor cells, theresponse frequently is not sufficient to suppress tumorgrowth. Studies suggested that a high density of specific pep-tide–MHC I complexes could compensate for the absence ofcostimulatory molecules, which in turn decreases the thresh-old of antigenic peptides required for activation of CTLs.52 Ithas been reported that DCs could directly acquire portions ofplasma membrane from antigen-displaying cells and reutilizetransfered surface antigenic peptide–MHC I complexes forpresentation to T cells, and the higher surface density of theantigenic peptide–MHC I complexes on the donor cell couldinduce higher level of CTL response.53 Therefore, it is possi-ble that a large amount of surface OVA257-264/MHC I onK42-91-OVA-hb2m cells on transfered to DCs, providedenough signal for T cell priming. However, as a nonprofes-sional antigen-presentation cell, K42-91-OVA-hb2m itselfwas not powerful enough as an immunogen to eradicateestablished EG7 tumors in mice.

It is anticipated that DCs, known as highly specializedantigen pesentation cells, modified by this strategy, could beuseful to mediate potent antitumor immunity in vivo. Asexpected, immunization with DC expressing more OVA257-

264 epitope generated specific CD8þ CTLs with potent cyto-lytic activity against EG7 tumor cells than that achieved byfibroblast- or lymphoma cell-based vaccines. However, the

established EG7 tumors could not be eradicated in our exper-imental settings (data not shown), indicating complex factorsinvolved in tumor development. Other researchers alsoobserved that effective vaccines against early, microscopictumors were far less successful against established, large tu-mor mass.54 The failure to eliminate tumor burden may bedue to tumor architecture, vasculature and interstitial pres-sure that hamper T-cell penetration into large tumor mass,55

and tumors themselves could also produce inhibitory factorsto suppress DC function, such as IL-10, TGF-b, and prosta-glandins.56–58 Moreover, the CD4þCD25þ T-cell subset(Treg), which is able to impair DC function and T-cell im-munity,59,60 has been detected in the cancer-draining lymphnodes61,62. An increase of Treg population could reduce thesurvival rate in clinical trials.63

Stem cell transplantation (SCT) has been highly recog-nized as a feasible curative anticancer treatment for a varietyof hematologic malignancies and solid tumors.64–67 However,tumor relapse occur often after autologous SCT, largely dueto the remaining tumor cells or tumor-cell contaminants inthe autografts.68 Escalated intensity of regimen, although sig-nificantly reduced the possibility of relapse, increased high-dose related toxicity and hence resulted in higher morbidityand mortality.60,69 Allogeneic SCT provided robust graft vs.tumor (GVT) effect against the minimal residual disease butat the expense of graft vs. host disease (GVHD), anothermajor obstacle still remains to resolve.70 It has been reportedthat the combination of conventional regimen such as chem-otherapy and radiotheray with SCT could dramatically elimi-nate Tregs,71–73 render tumor cells more susceptible to spe-cific CTLs74 and improve the penetration of CTLs into thetumor mass.75 Therefore, a unified strategy with cell-basedvaccines, which in turn would provide long-lasting specificimmunity against tumor relapse, was highly recommended inrecent clinical studies.76–78

The cell-based tumor immunotherapy with naturallyTAP-deficient cell lines would cause allogenetic or xenogenicreactivity, which would limit its application in clinical set-tings. The lentivirus delivery system with RNAi would makesuch personalized cell-based therapy possible for individualpatients. However, the generation of replication-competentlentivirus or partial recombinants of lentiviral vector andaltered phenotype and function of target cells79 need to beaddressed before wide clinical application.

AcknowledgementsThe authors are grateful to Dr. Ronald N. Germain, Lymphocyte Biol-ogy Section, Laboratory of Immunology, US National Institutes ofHealth, Bethesda, Maryland, USA; Dr. Alain Townsend, WeatherallInstitute of Molecular Medicine, University of Oxford, John RadcliffeHospital, Oxford University, Oxford, UK; Dr. Nilabh Shastri, Depart-ment of Molecular and Cell Biology, University of California, Berkeley,CA; and Dr. Marek Michalak, Department of Biochemistry, Universityof Alberta, Edmonton, Alberta, Canada for providing valuable researchmaterial.

Tum

orIm

mun

olog

y

Wu et al. 2383


References

1. Momburg F, Hammerling GJ. Generationand TAP-mediated transport of peptidesfor major histocompatibility complex classI molecules. Adv Immunol 1998;68:191–256.

2. Cresswell P, Lanzavecchia A. Antigenprocessing and recognition. Curr OpinImmunol 2001;13:11–12.

3. Lankat-Buttgereit B, Tampe R. Thetransporter associated with antigenprocessing: function and implications inhuman diseases. Physiol Rev 2002;82:187–204.

4. Powis SJ, Townsend AR, Deverson EV,Bastin J, Butcher GW, Howard JC.Restoration of antigen presentation to themutant cell line RMA-S by an MHC-linkedtransporter. Nature 1991;354:528–31.

5. Norbury CC, Princiotta MF, Bacik I,Brutkiewicz RR, Wood P, Elliott T,Bennink JR, Yewdell JW. Multiple antigen-specific processing pathways for activatingnaive CD8þ T cells in vivo. J Immunol2001;166:4355–62.

6. Trucco M, de Petris S, Garotta G,Ceppellini R. Quantitative analysis of cellsurface HLA structures by means ofmonoclonal antibodies. Hum Immunol1980;1:233–43.

7. Cox AL, Skipper J, Chen Y, HendersonRA, Darrow TL, Shabanowitz J, EngelhardVH, Hunt DF, Slingluff CL Jr.Identification of a peptide recognized byfive melanoma-specific human cytotoxic Tcell lines. Science 1994;264:716–19.

8. Engelhard VH. Structure of peptidesassociated with class I and class II MHCmolecules. Annu Rev Immunol 1994;12:181–207.

9. Tsomides TJ, Aldovini A, Johnson RP,Walker BD, Young RA, Eisen HN.Naturally processed viral peptidesrecognized by cytotoxic T lymphocytes oncells chronically infected by humanimmunodeficiency virus type 1. J Exp Med1994;180:1283–93.

10. Gervois N, Guilloux Y, Diez E, Jotereau F.Suboptimal activation of melanomainfiltrating lymphocytes (TIL) due to lowavidity of TCR/MHC-tumor peptideinteractions. J Exp Med 1996;183:2403–7.

11. Levitsky V, Zhang QJ, Levitskaya J,Masucci MG. The life span of majorhistocompatibility complex-peptidecomplexes influences the efficiency ofpresentation and immunogenicity of twoclass I-restricted cytotoxic T lymphocyteepitopes in the Epstein-Barr virus nuclearantigen 4. J Exp Med 1996;183:915–26.

12. Porgador A, Irvine KR, Iwasaki A, BarberBH, Restifo NP, Germain RN.Predominant role for directly transfected

dendritic cells in antigen presentation toCD8þ T cells after gene gunimmunization. J Exp Med 1998;188:1075–82.

13. Akbari O, Panjwani N, Garcia S, Tascon R,Lowrie D, Stockinger B. DNA vaccination:transfection and activation of dendriticcells as key events for immunity. J ExpMed 1999;189:169–78.

14. Gilboa E, Vieweg J. Cancerimmunotherapy with mRNA-transfecteddendritic cells. Immunol Rev 2004;199:251–63.

15. Weidanz JA, Nguyen T, Woodburn T,Neethling FA, Chiriva-Internati M,Hildebrand WH, Lustgarten J. Levels ofspecific peptide-HLA class I complexpredicts tumor cell susceptibility to CTLkilling. J Immunol 2006;177:5088–97.

16. Mottez E, Langlade-Demoyen P, GournierH, Martinon F, Maryanski J, Kourilsky P,Abastado JP. Cells expressing a majorhistocompatibility complex class I moleculewith a single covalently bound peptide arehighly immunogenic. J Exp Med 1995;181:493–502.

17. Kang X, Robbins PF, Fitzgerald EB, WangR, Rosenberg SA, Kawakami Y. Inductionof melanoma reactive T cells by stimulatorcells expressing melanoma epitope-majorhistocompatibility complex class I fusionproteins. Cancer Res 1997;57:202–5.

18. Uger RA, Barber BH. Creating CTL targetswith epitope-linked beta 2-microglobulinconstructs. J Immunol 1998;160:1598–605.

19. Tafuro S, Meier UC, Dunbar PR, Jones EY,Layton GT, Hunter MG, Bell JI,McMichael AJ. Reconstitution of antigenpresentation in HLA class I-negative cancercells with peptide-beta2m fusion molecules.Eur J Immunol 2001;31:440–9.

20. Yu YY, Netuschil N, Lybarger L, ConnollyJM, Hansen TH. Cutting edge: single-chaintrimers of MHC class I molecules formstable structures that potently stimulateantigen-specific T cells and B cells.J Immunol 2002;168:3145–9.

21. Lybarger L, Yu YY, Miley MJ, FremontDH, Myers N, Primeau T, Truscott SM,Connolly JM, Hansen TH. Enhancedimmune presentation of a single-chainmajor histocompatibility complex class Imolecule engineered to optimize linkage ofa C-terminally extended peptide. J BiolChem 2003;278:27105–11.

22. Margalit A, Sheikhet HM, Carmi Y, BerkoD, Tzehoval E, Eisenbach L, Gross G.Induction of antitumor immunity by CTLepitopes genetically linked to membrane-anchored beta2-microglobulin. J Immunol2006;176:217–24.

23. Porgador A, Yewdell JW, Deng Y, BenninkJR, Germain RN. Localization, quantitation,and in situ detection of specific peptide-MHC class I complexes using amonoclonal antibody. Immunity 1997;6:715–26.

24. Lewis JW, Sewell A, Price D, Elliott T.HLA-A*0201 presents TAP-dependentpeptide epitopes to cytotoxic Tlymphocytes in the absence of tapasin. EurJ Immunol 1998;28:3214–20.

25. Moore MW, Carbone FR, Bevan MJ.Introduction of soluble protein into theclass I pathway of antigen processing andpresentation. Cell 1988;54:777–85.

26. Karttunen J, Sanderson S, Shastri N.Detection of rare antigen-presenting cellsby the lacZ T-cell activation assay suggestsan expression cloning strategy for T-cellantigens. Proc Natl Acad Sci U S A. 1992;89:6020–4.

27. Inaba K, Inaba M, Romani N, Aya H,Deguchi M, Ikehara S, Muramatsu S,Steinman RM. Generation of largenumbers of dendritic cells from mousebone marrow cultures supplemented withgranulocyte/macrophage colony-stimulatingfactor. J Exp Med 1992;176:1693–702.

28. Sena-Esteves M, Tebbets JC, Steffens S,Crombleholme T, Flake AW. Optimizedlarge-scale production of high titerlentivirus vector pseudotypes. J VirolMethods 2004;122:131–39.

29. Sanderson S, Shastri N. LacZ inducible,antigen/MHC-specific T cell hybrids. IntImmunol 1994;6:369–76.

30. Kim GG, Donnenberg VS, DonnenbergAD, Gooding W, Whiteside TL. A novelmultiparametric flow cytometry-basedcytotoxicity assay simultaneouslyimmunophenotypes effector cells:comparisons to a 4 h 51Cr-release assay.J Immunol Methods 2007;325:51–66.

31. Kumar R, Yoneda J, Fidler IJ, Dong Z.GM-CSF-transduced B16 melanoma cellsare highly susceptible to lysis by normalmurine macrophages and poorlytumorigenic in immune-compromisedmice. J Leukoc Biol 1999;65:102–8.

32. Rosenberg S, Lotze M, Muul L, Leitman S,Chang A, Ettinghausen S, Matory Y,Skibber J, Shiloni E, Vetto J. Observationson the systemic administration ofautologous lymphokine-activated killer cellsand recombinant interleukin-2 to patientswith metastatic cancer. N Engl J Med 1985;313:1485–92.

33. Anderson K, Cresswell P, Gammon M,Hermes J, Williamson A, Zweerink H.Endogenously synthesized peptide with anendoplasmic reticulum signal sequencesensitizes antigen processing mutant cells

Tum

orIm

mun

olog

y



to class I-restricted cell-mediated lysis.J Exp Med 1991;174:489–92.

34. Salter RD, Cresswell P. Impaired assemblyand transport of HLA-A and -B antigensin a mutant TxB cell hybrid. EMBO J1986;5:943–9.

35. Karre K, Ljunggren HG, Piontek G,Kiessling R. Selective rejection of H-2-deficient lymphoma variants suggestsalternative immune defence strategy.Nature 1986;319:675–78.

36. De Bruijn ML, Schumacher TN, NielandJD, Ploegh HL, Kast WM, Melief CJ.Peptide loading of empty majorhistocompatibility complex molecules onRMA-S cells allows the induction ofprimary cytotoxic T lymphocyteresponses. Eur J Immunol 1991;21:2963–70.

37. Steinman RM. The dendritic cell systemand its role in immunogenicity. Annu RevImmunol 1991;9:271–96.

38. Caux C, Vanbervliet B, Massacrier C,Azuma M, Okumura K, Lanier LL,Banchereau J. B70/B7–2 is identical toCD86 and is the major functional ligandfor CD28 expressed on human dendriticcells. J Exp Med 1994;180:1841–7.

39. Langiade-Demoyen P, Levraud J-P,Kourilsky P, Abastado J-P. Primarycytotoxic T lymphocyte induction usingpeptide-stripped autologous cells. IntImmunol 1994;6:1759–66.

40. Leifert JA, Rodriguez-Carreno MP,Rodriguez F, Whitton JL. Targetingplasmid-encoded proteins to the antigenpresentation pathways. Immunol Rev 2004;199:40–53.

41. Hill A, Jugovic P, York I, Russ G, BenninkJ, Yewdell J, Ploegh H, Johnson D. Herpessimplex virus turns off the TAP to evadehost immunity. Nature 1995;375:411–5.

42. Fruh K, Ahn K, Djaballah H, Sempe P, vanEndert PM, Tampe R, Peterson PA, YangY. A viral inhibitor of peptide transportersfor antigen presentation. Nature 1995;375:415–18.

43. Hengel H, Flohr T, Hammerling GJ,Koszinowski UH, Momburg F. Humancytomegalovirus inhibits peptidetranslocation into the endoplasmicreticulum for MHC Class I assembly. J GenVirol 1996;77:2287–96.

44. Radosevich TJ, Seregina T, Link CJ.Effective suppression of class I majorhistocompatibility complex expression bythe US11 or ICP47 genes can be limited bycell type or interferon-gamma exposure.Hum Gene Ther 2003;14:1765–75.

45. Berko D, Carmi Y, Cafri G, Ben-Zaken S,Sheikhet HM, Tzehoval E, Eisenbach L,Margalit A, Gross G. Membrane-anchoredbeta 2-microglobulin stabilizes a highlyreceptive state of MHC class I molecules.J Immunol 2005;174:2116–23.

46. Nakamura K, Zuppini A, Arnaudeau S,Lynch J, Ahsan I, Krause R, Papp S, DeSmedt H, Parys JB, Muller-Esterl W, LewDP, Krause K-H, et al. Functionalspecialization of calreticulin domains. J CellBiol 2001;154:961–72.

47. Shields MJ, Moffat LE, Ribaudo RK.Functional comparison of bovine, murine,and human [beta]2-microglobulin:interactions with murine MHC Imolecules. Mol Immunol 1998;35:919–28.

48. Pedersen LO, Stryhn A, Holter TL,Etzerodt M, Gerwien J, Nissen MH,Thogersen HC, Buus S. The interaction ofbeta 2-microglobulin (beta 2m) with mouseclass I major histocompatibility antigensand its ability to support peptide binding.A comparison of human and mouse beta2m. Eur J Immunol 1995;25:1609–16.

49. Gakamsky DM, Bjorkman PJ, Pecht I.Peptide interaction with a class I majorhistocompatibility complex-encodedmolecule: allosteric control of the ternarycomplex stability. Biochemistry 1996;35:14841–8.

50. Sigal LJ, Reiser H, Rock KL. The role ofB7–1 and B7–2 costimulation for thegeneration of CTL responses in vivo.J Immunol 1998;161:2740–5.

51. Azuma M, Lanier LL. The role of CD28costimulation in the generation ofcytotoxic T lymphocytes. Curr TopMicrobiol Immunol 1995;198:59–74.

52. Motta I, Lone YC, Kourilsky P. In vitroinduction of naive cytotoxic T lymphocyteswith complexes of peptide andrecombinant MHC class I molecules coatedonto beads: role of TCR/ligand density.Eur J Immunol 1998;28:3685–95.

53. Zhang QJ, Li XL, Wang D, Huang XC,Mathis JM, Duan WM, Knight D, Shi R,Glass J, Zhang DQ, Eisenbach L, JefferiesWA Trogocytosis of MHC-I/peptidecomplexes derived from tumors andinfected cells enhances dendritic cell cross-priming and promotes adaptive T cellresponses. PLoS One 2008;3:e3097.

54. Nicholl M, Lodge A, Brown I, Sugg SL,Shilyansky J Restored immune response toan MHC-II-Restricted antigen in tumor-bearing hosts after elimination ofregulatory T cells. J Pediatr Surg 2004;39:941–6; discussion: 41–6.

55. Jain RK. Vascular and interstitial barriersto delivery of therapeutic agents in tumors.Cancer Metastasis Rev 1990;9:253–66.

56. Bueler H, Mulligan RC. Induction ofantigen-specific tumor immunity by geneticand cellular vaccines against MAGE:enhanced tumor protection bycoexpression of granulocyte-macrophagecolony-stimulating factor and B7–1. MolMed 1996;2:545–55.

57. Gajewski TF, Meng Y, Harlin H. Immunesuppression in the tumor

microenvironment. J Immunother 2006;29:233–40.

58. Wang D, Dubois RN. Prostaglandins andcancer. Gut 2006;55:115–22.

59. Mukherji B, Guha A, Chakraborty NG,Sivanandham M, Nashed AL, Sporn JR,Ergin MT. Clonal analysis of cytotoxic andregulatory T cell responses against humanmelanoma. J Exp Med 1989;169:1961–76.

60. Chakraborty NG, Twardzik DR,Sivanandham M, Ergin MT, Hellstrom KE,Mukherji B. Autologous melanoma-induced activation of regulatory T cellsthat suppress cytotoxic response.J Immunol 1990;145:2359–64.

61. Rosenberg SA, Dudley ME. Cancerregression in patients with metastaticmelanoma after the transfer of autologousantitumor lymphocytes. Proc Natl Acad SciU S A 2004;101:14639–45.

62. Viguier M, Lemaitre F, Verola O, Cho MS,Gorochov G, Dubertret L, Bachelez H,Kourilsky P, Ferradini L. Foxp3 expressingCD4þCD25(high) regulatory T cells areoverrepresented in human metastaticmelanoma lymph nodes and inhibit thefunction of infiltrating T cells. J Immunol2004;173:1444–53.

63. Curiel TJ, Coukos G, Zou L, Alvarez X,Cheng P, Mottram P, Evdemon-Hogan M,Conejo-Garcia JR, Zhang L, Burow M, ZhuY, Wei S, et al. Specific recruitment ofregulatory T cells in ovarian carcinomafosters immune privilege and predictsreduced survival. Nat Med 2004;10:942–9.

64. Barrett AJ, Horowitz MM, Gale RP, BiggsJC, Camitta BM, Dicke KA, Gluckman E,Good RA, Herzig RH, Lee MB. Marrowtransplantation for acute lymphoblasticleukemia: factors affecting relapse andsurvival. Blood 1989;74:862–71.

65. Eibl B, Schwaighofer H, Nachbaur D,Marth C, Gachter A, Knapp R, Bock G,Gassner C, Schiller L, Petersen F,Niederwieser D. Evidence for a graft-versus-tumor effect in a patient treatedwith marrow ablative chemotherapy andallogeneic bone marrow transplantation forbreast cancer. Blood 1996;88:1501–8.

66. Kanold J, Paillard C, Tchirkov A, Merlin E,Marabelle A, Lutz P, Rousseau R,Baldomero H, Demeocq F. Allogeneic orhaploidentical HSCT for refractory orrelapsed solid tumors in children: toward aneuroblastoma model. Bone MarrowTransplant 2008;42 Suppl 2:S25–S30.

67. Kurtzberg J, Prasad VK, Carter SL, WagnerJE, Baxter-Lowe LA, Wall D, Kapoor N,Guinan EC, Feig SA, Wagner EL, KernanNA. Results of the Cord BloodTransplantation Study (COBLT): clinicaloutcomes of unrelated donor umbilicalcord blood transplantation in pediatricpatients with hematologic malignancies.Blood 2008;112:4318–27.

Tum

orIm

mun

olog

y

Wu et al. 2385


68. Deisseroth AB, Zu Z, Claxton D, HananiaEG, Fu S, Ellerson D, Goldberg L, ThomasM, Janicek K, Anderson WF. Geneticmarking shows that Phþ cells present inautologous transplants of chronicmyelogenous leukemia (CML) contributeto relapse after autologous bone marrow inCML. Blood 1994;83:3068–76.

69. Passweg JR, Rowlings PA, Armitage JO,Gale RP, Pelz CJ, Sobocinski KA, Klein JP,Zhang MJ, Horowitz MM. Report from theInternational Bone Marrow TransplantrRegistry and Autologous Blood andMarrow Transplant Registry—NorthAmerica. Clin Transpl 1995:117–27.

70. Slavin S, Morecki S, Weiss L, Or R.Immunotherapy of hematologicmalignancies and metastatic solid tumorsin experimental animals and man. Crit RevOncol Hematol 2003;46:139–63.

71. North RJ. Radiation-induced,immunologically mediated regression of anestablished tumor as an example ofsuccessful therapeuticimmunomanipulation. Preferentialelimination of suppressor T cells allows

sustained production of effector of T cells.J Exp Med 1986;164:1652–66.

72. Awwad M, North RJ. Cyclophosphamide-induced immunologically mediatedregression of a cyclophosphamide-resistantmurine tumor: a consequence ofeliminating precursor L3T4þ suppressorT-cells. Cancer Res 1989;49:1649–54.

73. Ercolini AM, Ladle BH, Manning EA,Pfannenstiel LW, Armstrong TD, MachielsJP, Bieler JG, Emens LA, Reilly RT, JaffeeEM. Recruitment of latent pools of high-avidity CD8(þ) T cells to the antitumorimmune response. J Exp Med 2005;201:1591–602.

74. Chakraborty M, Abrams SI, Coleman CN,Camphausen K, Schlom J, Hodge JW.External beam radiation of tumors altersphenotype of tumor cells to render themsusceptible to vaccine-mediated T-cellkilling. Cancer Res 2004;64:4328–37.

75. Coral S, Sigalotti L, Altomonte M,Engelsberg A, Colizzi F, Cattarossi I,Maraskovsky E, Jager E, Seliger B, Maio M.5-aza-20-deoxycytidine-induced expressionof functional cancer testis antigens in

human renal cell carcinoma:immunotherapeutic implications. ClinCancer Res 2002;8:2690–5.

76. Liu G, Black KL, Yu JS. Sensitization ofmalignant glioma to chemotherapy throughdendritic cell vaccination. Expert RevVaccines 2006;5:233–47.

77. Gabrilovich DI. Combination ofchemotherapy and immunotherapy forcancer: a paradigm revisited. Lancet Oncol2007;8:2–3.

78. Kitawaki T, Kadowaki N, Kondo T,Ishikawa T, Ichinohe T, Teramukai S,Fukushima M, Kasai Y, Maekawa T,Uchiyama T. Potential of dendritic-cellimmunotherapy for relapse after allogeneichematopoietic stem cell transplantation,shown by WT1 peptide- and keyhole-limpet-hemocyanin-pulsed, donor-deriveddendritic-cell vaccine for acute myeloidleukemia. Am J Hematol 2008;83:315–17.

79. Dullaers M, Thielemans K. From pathogento medicine: HIV-1-derived lentiviralvectors as vehicles for dendritic cell basedcancer immunotherapy. J Gene Med 2006;8:3–17.

Tum

orIm

mun

olog

y



Documents

A specific cytotoxic T-lymphocyte epitope presentation system for antitumor immunity