View
218
Download
0
Tags:
Embed Size (px)
Citation preview
Activities of RNA Polymerase
•sequence specific DNA binding
-promoters
•melts DNA to reveal the template strand
•selects ribonucleotide (not deoxynucleotides) that anneals to template strand
•polymerizes RNA strand
•translocates on DNA template, during which it must:
-unwind DNA in front of polymerase
-unwinds RNA:DNA hybrid
-rewinds DNA behind polymerase
•recognize termination signals in the nascent transcript (or on the DNA template)
•In addition, the polymerase must be processive (have a high probability of reaching the end of the gene)
Modular Organization of Regulatory Information via Multiple Enhancers
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
stripes of ftz and eve expression in a Drosophila embryo
fragments of eve regulatory were inserted upstream of a -Gal reporter and inserted into flies. different regulatory elements gave distinct patterns of -Gal (dark staining) expression. Normal eve expression is shown in red.
1
Open complex formation
Abortive initiation
Promoter clearance
Promoter binding
Elongation
Stages of Transcription
[closed complex]
[open complex]
Keys to Successful Protein Purification
-an abundant source of material
-a quantitative assay-must be able determine yield and purity
-a strategy for separation-charge-size-hydrophobicity-stability-affinity reagents
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Roeder’s Assay, Incorporation of 32P-labeled UTP into RNA
note that the phosphate is incorporated into the RNA
he could measure the amount of radioactivity incorporated into RNA (vs that that remained associated with the UTP)
32
Three Different RNA Polymerases in Eukaryotes(Roeder and Rutter, 1969)
DEAE-SephadexQuickTime™ and a
TIFF (LZW) decompressorare needed to see this picture.
protein(measured by UV light absorbance in a spectrophotometer)
polymerase activity(32P incorporation into RNA)
[salt](50mM KCl-400 mM)
functional group on column:
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
-Amanitin (g/ml)
% M
axim
um
act
ivit
yRNA Polymerases I, II, and III Exhibit Different
Sensitivities towards -Amanitin
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Amanita phalloides
Enzyme location relative -amanitinactivity sensitivity
Pol I nucleolus 50-70% not inhibited
Pol II nucleoplasm 20-40% inhibited
Pol III nucleoplasm ≈10% species-specific
All three polymerase classes....
weigh >500,000 D
contain 12-16 subunits- some conserved across evolution
’ - like (~200,000 D)- like (~140,000 D)- like (~40,000 D)
- some shared among all 3 polymerases - some unique
Eukaryotic Nuclear RNA Polymerases
Three Classes of Transcription in Eukaryotes
RNA polymerase I (pol I)
ribosomal RNAs (5.8S, 18S, 28S rRNA)
RNA polymerase II (pol II)
mRNAs some small nuclear RNAs (snRNAs)non-coding RNAs (mostly of unknown function)
RNA polymerase III (pol III)
tRNAs 5S RNA some snRNAs small cytoplasmic RNAs (scRNAs)
RNA Polymerase II Underlies the Central
Dogma of Molecular Biology
Pol I
Pol II
Pol III
45S rRNA
tRNA5S rRNA
RibosomeDNA mRNA Protein
this explains our emphasis on the mechanisms of Pol II transcription
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Roger Kornberg (1947)
(With wife and sons, Stockholm Dec. 2006)
Important things to know about Pol II
• The general architecture of the polymerase, including the arrangement of nucleic acids in the active site
• That nucleotides likely enter through the “funnel”
• That the polymerase is a catalyst that specifically accelerates the rate at which the correctly paired ribonucleotide is added to a growing RNA chain (the exact details of the proposed reaction mechanism are not important to know)
– Review, but don’t feel obligated to memorize the exact details of the role of the trigger loop in facilitating catalysis and substrate (I.e. nucleotide) selection
• That the polymerase must be able to translocate on the DNA template after it has added a nucleotide to the RNA
QuickTime™ and aYUV420 codec decompressor
are needed to see this picture.
Crystal Structure of Yeast RNA Polymerase II at 2.8 Å Resolution (Cramer et al, 2001)
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
RNAP (T. aquaticus) RNA Pol II (S. cerevisiae)
’
Rpb2
Rpb1
What is Required for Promoter Function?
cis (DNA sequences) vs trans (proteins)
identify cis elements by, conservation, mutagenesis and assays of transcription
identify trans factors by biochemical (mainly) and genetic (occasionally) approaches
Assays of Promoter Activity
in vitro- use a specific promoter- mix with NTPs and extract or purified factors- measure RNA (directly, with 32P-labeled NTPs or indirect assays, see Weaver pp 106-111)
in vivo- introduce gene of interest into cells
transformation (yeast and bacteria)transfection (cultured cells)
- fuse promoter to a reporter gene that can be differentiated from normal genes in the recipient cells
“reporter gene”- can collect and measure RNA from cells- can measure activity of reporter gene
beta-Gal, selectable markers
• Deletion mutations
• Linker scanning
• Point mutations
Identifying Promoter Elements
+
+
-
+
-
p o i n t m u t a t i o n s
+
-
-
+
-
l i n k e r i n s e r t i o n m u t a g e n e s i s
X
X
X
X
t x n
+
-
-
+
-
s c a n n i n g d e l e t i o n m u t a g e n e s i s
+
+
+
-
d e l e t i o n m u t a g e n e s i s t x n
Class II PromotersSeveral parts:– Core promoter– Upstream promoter
elements– Enhancers, may be
far from core promoters
sequence elements found in many core promoters
gene specific
Core Promoter Elements• In addition to TATA box, core promoters are:
– TFIIB recognition element (BRE)– Initiator (Inr)– Downstream promoter element (DPE)– note: the important thing to remember is the TATA box
• At least one of the four core elements is missing in most promoters• TATA-less promoters tend to have DPEs• Promoters for highly specialized genes tend to have TATA boxes • Promoters for housekeeping genes tend to lack them
Upstream Elements
• Upstream promoter elements are usually found upstream of class II core promoters
• Differ from core promoters in binding to relatively gene-specific transcription factors.examples:– GC boxes bind transcription factor Sp1– CCAAT boxes bind CTF (CCAAT-binding transcription
factor)
• Enhancers, function in a position and orientation independent manner. (sometimes enhancers are considered to be a distinct type of element)
-2000 -1500 -1000 -200 -150 -100 -50 +1 50 100
core promoterupstreamelements
enhancers
CAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACCTT-30-20-10 +1
TATA-box Inr
CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCAC -100 -90 -80 -70
CAAT-boxGC-box
CCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCT
AP4 AP1 AP3 AP2
A Typical RNA Pol II Promoter
Identifying the General Transcription Machinery
• establish robust in vitro assay with a strong core promoter – AdML adenovirus major late promoter
• purify proteins required for transcription• goal is to identify a minimal set of purified proteins
with which to reconstitute transcription
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Fork loop 2
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
What is Required for Promoter Function?
Observation: RNA polymerase alone is not capable of accurately initiated, gene-specific transcription.
cis (DNA sequences) vs trans (proteins)
identify cis elements by, conservation, mutagenesis and assays of transcription
-core promoter (esp. TATA box)-upstream elements-enhancers
identify trans factors by biochemical (mainly) and genetic (occasionally) approaches
-general transcription factors (GTFs)-accessory factors required at all genes transcribed by a polymerase
Identifying the General Transcription Machinery
• establish robust in vitro assay with a strong core promoter – AdML adenovirus major late promoter
• purify proteins required for transcription• goal is to identify a minimal set of purified proteins
with which to reconstitute transcription
RNA Polymerase II Requires Additional Factors for Accurate Transcription Initiation at Promoters(Matsui et al, 1980)
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Phosphocellulose chromatography
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Further Fractionation of S-100 Extract (Matsui et al, 1980)
Pol II 12
GTFs TFIID
TFIIB 1 TFIIE 2 TFIIH 9 TFIIF 2 TFIIA 3
Mediator 22
RNA polymerase II Transcription MachineryNumber of subunits
TBP 1TAFs 12*
*
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Proposed Pathway of Initiation
helicases in TFIIH catalyze open complex formation
Pol II-TFIIF recruited by DNA-D/A/B complex
initiation and escape
Factor Role
TBP
TFIIB
TFIIE
TFIIF
TFIIH
Promoter recognition; configures DNA to the pol II surface
Promoter recognition; pol II recruitment; directs DNA path, stabilizes early transcribing complex; coupling of RNA synthesis to promoter clearance
Recognizes closed complex, recruits TFIIH
Captures nontemplate strand upon melting
Untwisting of promoter DNA (helicase), CTD phosphorylation
(kinase)
Mechanism of Initiationof RNA Polymerase IITranscription
H
Pol
TBPBC
H
Pol
TBP
BC
F BN
Transcription Elongation
...is slow compared to DNA replication
20-40 nucleotides / second
Typical 1° transcript is ≈20,000 nts., corresponds to ≈10 minutes / transcript. Long transcripts can take hours to complete
… is regulated
TFIIF suppresses pausingTFIIS rescues arrested complexesothers
…. polymerases stalled at the 5’ ends of genes appear to be common
...may involve proof-reading (observed in vitro)
...is coupled to DNA repair
Activating domains can be replaced by randomly selected sequences (Ma and Ptashne, 1986)
activator -gal +gal
Gal4 111 1895
Gal4DBD <1 <1
none <1 <1
B17 415 794
B42 542 756
B6 429 588
B9 21 9.3
B15 90 73
beta-gal activity
Q. what are the essential features of activation domains?
Approach: random e. coli sequences cloned downstream of Gal4 DBD and expressed in yeast containing a -gal reporter with Gal4 sites in its promoter
16
Activating domains can be replaced by randomly selected sequences (Ma and Ptashne, 1986)
1. random e. coli sequences cloned downstream of the Gal4 DBD and expressed in a yeast strain containing a -gal reporter with Gal4 sites in its promoter
2. ~1% of all the clones activated transcription
3. activating sequences did not resemble known proteins, no catalytic domains etc.
-activation domains unlikely to have enzymatic activity
4. negatively charged residues common
17
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Overexpression of Gal4 from the strong ADH promoter
inhibits promoters that lack Gal4 binding sites(Gill and Ptashne, 1988)
core
HIS3+1
UASH/core
+12
-Gal
UASG= GAL enhancer (binds Gal4)UASH= HIS3 enhancerUASC= CYC1 enhancer
decreased expression of reporter genes lacking Gal4 binding sites when Gal4 levels are high
18
1. Eukaryotic activators do not bind to RNA pol II polymerase and therefore do not directly recruit polymerase to promoters.
2. Activators may, however, indirectly recruit RNA polymerase by recruiting factors (often called co-activators) that serve as a physical bridge between activator and polymerase.
‘TFIID hypothesis’
‘Holoenzyme hypothesis’
What is the Limiting Target of Activators?
21
ChIP (Chromatin Immunoprecipitation)
Formaldehyde crosslink
Shear chromatin by sonication
Immunoprecipitation
Reverse crosslinks, PCR
TBP
TBP
TBP
TBP
input control: reverse crosslinks and analyze sample prior to IP
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
22
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
Extent of TBP binding correlates with promoter activity(Li et al, 1999)
TBP crosslinks to active promoters
23
Pol II 12
GTFs TFIID
TFIIB 1 TFIIE 2 TFIIH 9 TFIIF 2 TFIIA 3
Mediator 22
RNA Polymerase II Transcription MachineryNumber of subunits
TBP 1TAFs 12*
*
24
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
The ‘TFIID Hypothesis’
in vitro assays suggest specific activator-TAF contacts
predictions?
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (LZW) decompressor
are needed to see this picture.
1. TAFs provide surfaces for the interaction
of TFIID with activators. 2. TFIID recruits polymerase
25
Activated Transcription in the Absence of TAFIIs
western blot demonstrating depletion of TAFIIs
see p97 of Weaver or p769 of Watson for a description of the Western blot technique
in vitro transcription shows that - transcription is abolished in the TFIID depleted extract- TBP is sufficient to restore activated transction- 4 different activators were tested
Oelgeschlager et al., 1998
no transcription after depletion of TFIID and TAFs 26