AFAB Volume 3 Issue 3

Volume 3, Issue 32013

ISSN: 2159-8967www.AFABjournal.com

172 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 3 - 2013

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 3, Issue 3 - 2013 173

Sooyoun Ahn University of Florida, USA

Walid Q. AlaliUniversity of Georgia, USA

Kenneth M. Bischoff NCAUR, USDA-ARS, USA

Debabrata BiswasUniversity of Maryland, USA

Claudia S. Dunkley University of Georgia, USA

Lawrence GoodridgeColorado State University, USA

Leluo GuanUniversity of Alberta, Canada

Joshua GurtlerERRC, USDA-ARS, USA

Yong D. HangCornell University, USA

Divya JaroniOklahoma State University, USA

Weihong Jiang Shanghai Institute for Biol. Sciences, P.R. China

Michael JohnsonUniversity of Arkansas, USA

Timothy KellyEast Carolina University, USA

William R. KenealyMascoma Corporation, USA

Hae-Yeong Kim Kyung Hee University, South Korea

W.K. KimUniversity of Georgia, USA

M.B. KirkhamKansas State University, USA

Todd KostmanUniversity of Wisconsin, Oshkosh, USA

Y.M. Kwon University of Arkansas, USA

Maria Luz Sanz MuriasInstituto de Quimica Organic General, Spain

Melanie R. MormileMissouri University of Science and Tech., USA

Rama NannapaneniMississippi State University, USA

Jack A. Neal, Jr.University of Houston, USA

Benedict OkekeAuburn University at Montgomery, USA

John PattersonPurdue University, USA

Toni Poole FFSRU, USDA-ARS, USA

Marcos RostagnoLBRU, USDA-ARS, USA

Roni ShapiraHebrew University of Jerusalem, Israel

Kalidas ShettyNorth Dakota State University, USA

EDITORIAL BOARD


EDITOR-IN-CHIEFSteven C. RickeUniversity of Arkansas, USA

EDITORSTodd R. CallawayFFSRU, USADA-ARS, USA

Cesar CompadreUniversity of Arkansas for Medical Sciences, USA

Philip G. CrandallUniversity of Arkansas, USA

MANAGING and LAYOUT EDITOREllen J. Van LooGhent, Belgium

TECHNICAL EDITORJessica C. ShabaturaFayetteville, USA

ONLINE EDITION EDITORC.S. ShabaturaFayetteville, USA

ABOUT THIS PUBLICATION

Agriculture, Food & Analytical Bacteriology (ISSN

2159-8967) is published quarterly, beginning with

this inaugural issue.

Instructions for Authors may be obtained at the

back of this issue, or online via our website at

www.afabjournal.com

Manuscripts: All correspondence regarding pend-

ing manuscripts should be addressed Ellen Van Loo,

Managing Editor, Agriculture, Food & Analytical

Bacteriology: [email protected]

Information for Potential Editors: If you are interested

in becoming a part of our editorial board, please con-

tact Editor-in-chef, Steven Ricke, Agriculture, Food &

Analytical Bacteriology: [email protected]

Advertising: If you are interested in advertising with

our journal, please contact us at advertising@afab-

journal.com for a media kit and current rates.

Reprint Permission: Correspondence regarding re-

prints should be addressed Ellen Van Loo, Managing

Editor, Agriculture, Food & Analytical Bacteriology

[email protected]

Ordering Print Copies: print editions of this journal

may be purchased and shipped internationally from

our website order form at www.afabjournal.com

Subscription Rates: Subscriptions are not available

at this time. To be advised when subscriptions plans

are made available, please join our newsletter at

www.afabjournal.com

Mailing Address: 2138 Revere Place . Fayetteville, AR . 72701 Website: www.AFABjournal.com

EDITORIAL STAFF


Antimicrobial Activity of Red Clover (Trifolium pratense L.) Extract on Caprine Hyper-Am-monia-Producing Bacteria M. D. Flythe, B. Harrison, I. A. Kagan, J. L. Klotz, G. L. Gellin, B. M. Goff, G. E. Aiken

176

Suitability of Various Prepeptides and Prepropeptides for the Production and Secretion of Heterologous Proteins by Bacillus megaterium or Bacillus licheniformis

S. Saengkerdsub, R. Liyanage, J. O. Lay Jr.

230

Utility of Egg Yolk Antibodies for Detection and Control of Foodborne SalmonellaP. Herrera, M. Aydin, S. H. Park, A. Khatiwara and S. Ahn

195

ARTICLES

Vibrio Densities in the Intestinal Contents of Finfish from Coastal Alabama J.L. Jones, R.A. Benner Jr., A. DePaola, and Y. Hara-Kudo

186

BRIEF COMMUNICATIONS

Instructions for Authors252

Introduction to Authors

The publishers do not warrant the accuracy of the articles in this journal, nor any views or opinions by their authors.

Potential for Dry Thermal Treatments to Eliminate Foodborne Pathogens on Sprout SeedsT. Hagger and R. Morawicki

218

TABLE OF CONTENTS

REVIEW


www.afabjournal.comCopyright © 2013

Agriculture, Food and Analytical Bacteriology

ABSTRACT

One of the inefficiencies in rumen fermentation is the catabolism of feed amino acids and peptides by

hyper ammonia-producing bacteria (HAB). The HAB can be controlled through selective inhibition with

antimicrobials. In vitro ammonia production by mixed goat rumen bacteria was inhibited by red clover (Tri-

folium pratense L.) phenolic extract. One component of the extract was the isoflavone, biochanin A. When

the biochanin A concentration was 30 ppm, amino acid fermentation and ammonia production decreased.

The effect of biochanin A was tested on a cultured caprine HAB isolate (Peptostreptococcus spp.). The

growth of the HAB was not inhibited by biochanin A alone, even if the concentration was as much as 200

ppm. However, the addition of sterile rumen fluid (5%) caused growth inhibition at 2 ppm biochanin A. To

determine what component in the rumen fluid acted synergistically with biochanin A, the growth experi-

ment was repeated with either a mixture of volatile fatty acids (VFA) or the supernatant of the bacteriocin-

producing Streptococcus bovis HC5 (5% v/v) in place of the rumen fluid. The combination of biochanin A

and S. bovis supernatant caused growth inhibition, but VFA had no effect. These results are consistent with

the hypothesis that biochanin A potentiates the activity of other heat-stable antibacterial compounds that

are present in the rumen environment, and that the spectrum of activity could depend on the inhibitors

present. Red clover extract and its components represent plant-based feed additives that could be used to

control ammonia production in goats and other ruminants.

Keywords: Ammonia, feed efficiency, ionophores, plant secondary metabolite, rumen

Correspondence: Michael D. Flythe, [email protected] Tel: +1 -859- 421-5699

Antimicrobial Activity of Red Clover (Trifolium pratense L.) Extract on Caprine Hyper Ammonia-Producing Bacteria

M. D. Flythe1,2, B. Harrison1, I. A. Kagan1,3 J. L. Klotz1,2, G. L. Gellin1, B. M. Goff3, G. E. Aiken1,3

1USDA, Agricultural Research Service, Forage-Animal Production Research Unit; Lexington, Kentucky 40546 2University of Kentucky, Department of Animal and Food Sciences, Lexington, Kentucky 40546 3University of Kentucky, Department of Plant and Soil Sciences, Lexington, Kentucky 40546

Proprietary or brand names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of the name by the USDA implies no approval of the product, nor

exclusion of others that may be suitable.

Agric. Food Anal. Bacteriol. 3: 176-185, 2013


INTRODUCTION

Most of the nitrogen in plants is incorporated into

protein. However, non-protein nitrogen (NPN) is also

present, and must be considered when the nutrition-

al value of a feed is assessed. All animals can utilize

amino acids, but ruminants are especially suited to

utilize NPN, such as ammonia and urea, because

the rumen flora can assimilate them into microbial

protein (Polan, 1988). Unfortunately, rumen micro-

organisms also depolymerize feed protein, catabo-

lize peptides, and deaminate amino acids. In many

cases, the rate and extent of ruminal deamination

exceeds assimilation, and the animal cannot absorb

all excess NPN. This problem is both a nutritional

inefficiency and a source of environmental pollution

(Tedeschi et al., 2003).

Many rumen bacteria are proteolytic, but the pro-

teolytic bacteria are not necessarily responsible for

amino acid deamination (Rychlik and Russell, 2000).

The hyper ammonia-producing bacteria (HAB) are

a phylogenetically diverse group of species, which

are characterized by the ability to rapidly deaminate

amino acids and produce ammonia. HAB species

were first discovered in the rumen of dairy cattle

in the 1980’s (Russell et al. 1988, Chen and Russell

1989). Since that time, they have been isolated from

deer (Atwood et al. 1998), sheep (Atwood et al.,

1998; Eschenlauer et al., 2002; Wallace et al., 2003),

and goats (Flythe and Andries, 2009).

The rumen is both an organ and a complex eco-

logical habitat (Hungate, 1960). However, it is also a

natural fermentation, and to a certain degree, it can

be manipulated as if it were an industrial fermenta-

tion (Russell and Rychlik, 2001). Antimicrobials can

be added to ruminant diets to alter rumen fermen-

tation via selective inhibition of the microorganisms

that promote ammonia production, methanogen-

esis, and other wasteful processes (Van Nevel and

Demeyer, 1977; Tedeschi et al., 2003). Many of the

antimicrobial compounds used as feed additives are

synthesized by microorganisms. For example, the

ionophore monensin is produced by the soil bacte-

rium, Streptomyces cinnamonensis (Van Nevel and

Demeyer, 1977). However, numerous antimicrobial

compounds are also produced by plants, some con-

stitutively (Osbourn, 2006) and some in response to

biotic (Hammerschmidt, 1999) or abiotic stresses (Sa-

viranta et al., 2009). Botanical antimicrobials shown to

decrease rumen ammonia include pure compounds

such as cinnamaldehyde and eugenol (Busquet et

al., 2005; Cardozo et al., 2006), as well as mixtures

of essential oils (McIntosh et al., 2003; Benchaar et

al., 2008), and other types of plant extracts. This lat-

ter category includes a phenolic extract of red clover

(Trifolium pratense), which inhibited the growth and

ammonia production of the bovine HAB, Clostridi-

um sticklandii (Flythe and Kagan, 2010).

The primary components of the red clover extract-

ed by Flythe and Kagan (2010) were isoflavones, one

of which (biochanin A) was active against C. sticklan-

dii. Other phenolic compounds have been found to

decrease ammonia production by mixed rumen mi-

croorganisms in vitro (Getachew et al., 2009). These

results indicate that phenolic compounds from le-

gumes might be used to control ammonia produc-

tion in the rumen. However, because the previous

studies employed bacteria of bovine origin, the

relevance to goat production is uncertain. Khan

and colleagues (2011) showed that Egyptian clover

(Trifolium alexandrinum) extracts exhibited a broad

spectrum of activity against phylogenetically diverse

human bacteria. The broad spectrum of activity sug-

gests that clover extract might inhibit amino acid

degradation by the diverse rumen microbial com-

munity. The experiments described here were initiat-

ed to determine: 1) the effects of red clover phenolic

extract and biochanin A on in vitro ammonia produc-

tion by mixed rumen bacteria from goats, and 2) that

biochanin A is one of the inhibitory compounds by

assessing its effect on a pure caprine HAB.

MATERIALS AND METHODS

Animals and diet

The University of Kentucky Institutional Animal

Care and Use Committee approved all animal proce-

dures (protocol number 2009-0520). Kiko goat weth-


ers (n=8, 2 y, 40 to 50 kg) were maintained at the Uni-

versity of Kentucky’s Research Farm. Mixed rumen

microorganisms were obtained from non-fistulated

goats, as described below. Rumen fluid for sterile

additions to media was obtained from a rumen-

fistulated goat in the same herd. Access to pasture

was unrestricted. The botanical composition of the

pasture was estimated at the beginning of the study

by observing the predominant species at 1 m inter-

vals along 37 m transects. A total of 6 transects were

used and were spaced approximately 11 m apart.

The predominant species were: tall fescue (Lolium

arundinaceum (Schreb.) Darbysh., 44.4%), orchard-

grass (Dactylis glomerata L., 14.9%), white clover

(Trifolium repens L., 14.9%), Kentucky bluegrass (Poa

pratensis L., 8.9%), red clover (Trifolium pratense L.,

3.3%), bermudagrass (Cynodon dactylon (L.) Pers.,

1.4%) and broad-leaf weeds (12.6%). The goats were

supplemented with 1.0 kg head-1d-1 orchardgrass/

alfalfa hay (18% crude protein, as fed), and 0.25 kg

head-1d-1 supplement (16% crude protein; Kalmbach

Feeds, Upper Sandusky, OH). Water and a mineral

mixture (Southern States Cooperative, Richmond,

VA) were provided free choice. The composition of

the mineral mixture, as reported by the manufactur-

er, was (crude protein 1.75%, calcium 22.0%, phos-

phorus 5.0%, NaCl 21.0%, magnesium 3.0%, sulfur

0.25%, iodine 40 ppm, copper 400 ppm, cobalt 15

ppm, selenium 32 ppm, zinc 3000 ppm, manganese

2000 ppm, vitamin A 300000 IU/lb., vitamin D 25000

IU/lb., vitamin E 200 IU/lb). The supplements were

non-medicated. The herd had never received iono-

phores or antibiotic feed supplements.

Bacterial strains and media composition

The isolation and characterization of the caprine

HAB culture (Peptostreptococcus spp. BG1) used

in these experiments were reported previously (Fly-

the and Andries 2009). Briefly, BG1 is most closely

related to Peptostreptococcus anaerobius. It grows

with amino acids as the sole energy source and pro-

duces ammonia and VFA as products. The HAB

medium contained (per liter): 240 mg K2HPO4, 240

mg KH2PO4, 480 mg NaCl, 480 mg Na2SO4, 64 mg

CaCl2·2H2O, 100 mg MgSO4·7H2O, 600 mg cysteine

hydrochloride, trace minerals and vitamins as previ-

ously described (Russell et al., 1988). An initial pH

of 6.5 was obtained by adding NaOH. The broth

was autoclaved (121˚C, 103 kPa, 20 min) to remove

O2 and cooled under O2-free CO2. The buffer (4.0

g Na2CO3) was added before dispensing and auto-

claving again for sterility. The amino acid substrate,

Casamino acids (Fisher BioReagents, Fair Lawn, NJ),

was prepared separately and added aseptically (15

mg mL-1 final concentration). Streptococcus bovis

HC5 was obtained from the culture collection of

James B. Russell, Cornell University, Ithaca, NY. It is a

bacteriocin-producing strain that was isolated from

the bovine rumen (Mantovani and Russell, 2002).

The Streptococcus bovis medium was based on

previously described media (Mantovani and Russell,

2002), and contained (per liter): 240 mg K2HPO4, 240

mg KH2PO4, 480 mg NaCl, 480 mg (NH4)2SO4, 64 mg

CaCl2·2H2O, 100 mg MgSO4·7H2O, 600 mg cysteine

hydrochloride, 0.5 g yeast extract, 1.0 g Trypticase

(Fisher BioReagents, Fair Lawn, NJ). Glucose was

prepared as an anaerobic stock and added asepti-

cally (4.0 mg mL-1 final concentration).

In vitro ammonia production with red clover extract or biochanin A

Three goats (described above) were sampled

for each experiment. The rumen samples were

obtained by gastric intubation. Briefly, a speculum

was inserted into the mouth, and a sterilized tube

(0.25 inch O.D., Tygon®, U.S. Plastics, Lima, OH) was

inserted through the speculum. A sample (5-8 ml)

of rumen fluid was aspirated into the tube with a

handheld pump (Drummond, Broomall, PA) that was

connected to the distal end of the tube. The tube

was removed and the sample was immediately ex-

pressed into a Hungate tube, sealed, sparged with

CO2, and transported to the laboratory under a CO2

headspace. The microorganisms in the rumen sam-

ples were harvested by centrifugation (25600 x g, 10

min, 27˚C), then washed and re-suspended in HAB


medium. This suspension was diluted to an optical

density (OD, absorbance 600 nm) of 1.0, using a Bio-

wave II spectrophotometer (Biochrom, Cambridge,

UK). The suspension was used to inoculate (10%) en-

richment tubes containing HAB medium with Casa-

mino Acids (15 mg mL-1). The enrichment tubes were

amended with either red clover extract (obtained

from plants allowed to wilt 24 h, described by Flythe

and Kagan 2010) or biochanin A (Indofine, Hillsbor-

ough, NJ), as indicated. Biochanin A concentrations

in the red clover extracts were calculated from the

concentrations determined by high-performance

liquid chromatography for extracts from the same

tissue (Flythe and Kagan, 2010). Controls for each

treatment were included. The enrichment tubes

were incubated (39˚C, 48 h), and sampled at 0 and

48 h. Supernatant samples were clarified by centrifu-

gation and frozen (-20˚C). The supernatant samples

were later thawed and the ammonia concentrations

were determined by the phenolic acid/hypochlorite

method (Chaney and Marbach, 1962).

Pure culture growth experiments

The HAB medium was amended with Casamino

acids (15 mg mL-1). Overnight Peptostreptococcus

spp. BG1 culture was used as the inoculum (10%). All

incubations were conducted in a shaking incubator

(150 rpm, 39˚C). Growth was determined by OD (ab-

sorbance 600 nm) at 16, 24 and 48 h. The treatments

included biochanin A with or without: sterile rumen

fluid, VFA, or the supernatant of a bacteriocin-pro-

ducing Streptococcus bovis.

Biochanin A was dissolved in acetone and added

with a Hamilton syringe to achieve the concentra-

tions indicated (200 to 0.2 ppm). The acetone carrier

was not inhibitory when less than 200 µL was added

to 10 mL media (data not shown).

Sterile rumen fluid was added to the tubes when

indicated (10% v/v). The rumen fluid (750 mL) was

obtained from a rumen-fistulated goat that was

maintained in the same herd as the goats sampled

for mixed rumen microorganisms. Atmospheric oxy-

gen was excluded by endogenous gas production

during transport to the laboratory. The feed parti-

cles and microorganisms were removed by centrif-

ugation (25600 x g, 5 min, 27˚C). The supernatant

was transferred to a serum bottle and sparged with

O2-free CO2 until the serum bottle was stoppered,

sealed and autoclaved (121˚C, 103 kPa, 20 min). The

sterile rumen fluid was not inhibitory to the HAB in

the absence of biochanin A (data not shown).

VFA were added to the HAB medium to emulate

the concentrations used in typical nonselective ru-

men fluid media (Caldwell and Bryant, 1966). It con-

tained (per liter): acetic acid (1.26 mL), propionic acid

(0.45 mL), butyric acid (0.22 mL valeric acid (0.07 mL),

isovaleric acid (0.07 mL), isobutyric acid (0.07 mL),

2-methylbutyric acid (0.07 mL). The initial pH was

adjusted to 6.5 by addition of NaOH. The VFA ad-

ditions were not inhibitory to the caprine HAB at this

pH value (data not shown).

Streptococcus bovis HC5 was grown (16 h) in

Streptococcus bovis medium as previously de-

scribed (Mantovani et al., 2001). The supernatants

were clarified by centrifugation, and added to HAB

medium with a tuberculin syringe at 1, 2.5, 5, 7.5, and

10% volume to volume (v/v). S. bovis did not grow in

the HAB medium because there was no fermentable

carbohydrate. The 5% v/v amendment was used to

test synergy with biochanin A because it was sub-

inhibitory to all of the caprine HAB strains (data not

shown).

Replication and statistical analysis

The in vitro ammonia production experiments

with mixed rumen microorganisms were performed

in triplicate with rumen fluid obtained from three

different goats. The means are reported. Statistical

differences from the controls (the same mixed ru-

men microorganism suspensions with no biochanin

A or clover extract) were determined with paired

Student’s t-tests. P values less than 0.05 were con-

sidered significant, and indicated with asterisks on

the figures. Pure culture growth experiments were

performed in triplicate, and there was no variation in

the results that are reported.


RESULTS

Effects of red clover extract and bio-chanin A on ammonia production by mixed rumen microorganisms

When mixed rumen microorganisms from goats

were used to inoculate media rich in free amino ac-

ids (Casamino acids, 15 mg mL-1), but lacking red

clover extract, the average ammonia concentration

was 39 mM after 48 h (Figure 1). The addition of

red clover phenolic extract decreased the ammonia

concentrations in tubes inoculated with the same

mixed rumen microorganisms. However, the ammo-

nia concentration was not significantly less than the

control until enough extract was added to achieve a

biochanin A concentration of 20 ppm (70 µM). At 20

ppm biochanin A, the mean ammonia concentration

was 17 mM in the amino acid enrichments, and these

concentrations were significantly less than the con-

trols (P < 0.05). The experiment was repeated with

mixed rumen microorganisms from the same goats,

but the media were amended with pure biochanin A

rather than red clover extract (Figure 2). The mean

ammonia concentration in the controls after 48 h was

39 mM. When ≤ 15 ppm biochanin A was added,

the ammonia concentration was not different from

the controls. When 30 ppm biochanin A was added

the mean ammonia concentration was 20 mM. These

concentrations were significantly less than those of

the controls (P < 0.05).

Figure 1. Effect of red clover (Trifolium pratense) phenolic extract on ammonia production by mixed microorganisms from the rumen of a goat (n=3). The 48 h enrichments were performed (39°C) in HAB medium with Casamino acids (15 mg mL-1) as the substrate. Clover extract was added at 0 h to achieve the biochanin A concentration indicated on the horizontal axis. The dif-ference between initial ammonia concentrations and the 48 h ammonia concentrations are shown on the vertical axis. Means of triplicate experiments are shown. Differences from the control (no addition) were determined by Student’s t-tests, and the asterisk indicates P < 0.05.

0

10

20

30

40

50

-10 0 10 20

Am

mo

nia

pro

duc

tio

n (m

M)

Clover extract (ppm Biochanin A)

0 0

*


Growth inhibition of a caprine HAB cul-ture by biochanin A, sterile rumen fluid, VFA, and the supernatant of a bacterio-cin-producer

When the caprine ruminal HAB, BG1, was grown

in HAB media with amino acids (Casamino acids, 15

mg mL-1) as a substrate, the cultures reached station-

ary phase in less than 48 h, as determined by OD

(data not shown). The addition of biochanin A (0.2,

2.0, 20, or 200 ppm) had no effect on viable cell num-

ber at 48 h when no rumen fluid was included (Fig-

ure 3). The addition of sterile rumen fluid (10% v/v)

from a rumen-fistulated goat did not prevent growth

when no biochanin A was present. However, the

growth of BG1 was inhibited by the combination of

sterile rumen fluid and 2, 20, or 200 ppm biochanin

A. To elucidate the antimicrobial agent in the rumen

fluid, a VFA mixture and a bacteriocin were tested.

Neither the VFA mixture nor the addition of Strepto-

coccus bovis HC5 supernatant (5% v/v) inhibited the

growth in the absence of biochanin A. The addition

of the VFA mixture to culture tubes did not change

the inhibitory concentration of biochanin A. How-

ever, BG1 did not grow in the presence of S. bovis

HC5 supernatant when the biochanin A concentra-

tion was 2 ppm or greater. The S. bovis HC5 super-

natant inhibited the culture when it was included at

greater than 10% v/v (data not shown). The pure cul-

ture experiments were performed three times with

identical results.

Figure 2. Effect of biochanin A on ammonia production by mixed microorganisms from the rumen of a goat (n=3). The 48 h enrichments were performed (39°C) in HAB medium with casamino acids (15 mg mL-1) as the substrate. Biochanin A was added at 0 h to achieve the concentration indicated on the horizontal axis. The difference between initial ammonia concentrations and the 48 h ammonia concentrations are shown on the vertical axis. Means of triplicate experiments are shown. Differences from the control (no biochanin A added) were determined by Student’s t-tests, and the asterisk indicates P < 0.05.

0

10

20

30

40

50

-10 0 10 20 30

Am

mo

nia

pro

duc

tio

n (m

M)

Biochanin A (ppm)

0 0

*


DISCUSSION

Previous work showed that red clover extract, as

well as biochanin A, a major component of red clover

extract, inhibited the growth and ammonia produc-

tion of Clostridium sticklandii SR (Flythe and Kagan,

2010). Strain SR is the most commonly used model

for HAB (Chen and Russell, 1989; Van Kessel and

Russell, 1992; Krause and Russell, 1996; Rychlik and

Russell, 2002; Attwood et al., 2006, Xavier and Rus-

sell, 2009; Flythe, 2009). HAB is a functional category,

or guild, rather than a taxon, and includes phyloge-

netically diverse members. C. sticklandii is a mem-

ber of Phylum Firmicutes, and has a typical Gram-

positive cell envelope (Paster et al.,1993). However,

Gram-negative bacteria (e.g. Fusobacteria) can also

occupy amino acid-fermenting niches (Attwood et

al., 1998; Russell, 2005). Structural differences be-

tween these taxa cause differences in susceptibility

to antimicrobials, which raised the concern that red

clover phenolic extract might have a spectrum of ac-

tivity too narrow to control ammonia production in

the rumen.

In the current study, mixed rumen microorganisms

produced approximately 40 mM ammonia from free

amino acids. Clover extract or pure biochanin A re-

duced the final ammonia concentration by half. This

indicates that red clover phenolic extract was effec-

tive against the HAB that were present in the goats

at the time of sampling. Biochanin A did not inhibit

Figure 3. Effect of biochanin A on the growth of the hyper ammonia-producing bacterium, Peptostreptococcus spp. BG1. The culture was grown in HAB medium with Casamino acids (15 mg mL-1) as the substrate. Biochanin A was added to achieve the concentration indicated on the horizontal axis. The medium was supplemented with no addition (orange bars), rumen fluid (green bars), a volatile fatty acid mixture (hatched bars) or the supernatant of a bacteriocin-pro-ducing Streptococcus bovis (blue bars). The stationary phase optical density was taken after 24 h incubation (39°C). The experiment was repeated three times with identical results.

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0 2 20 200

Op

tica

l D

ensi

ty (

600

nm)

Biochanin A conc. (ppm)


the growth of the caprine HAB in defined media, but

isolate BG1 was inhibited by biochanin A concentra-

tions ≥ 2 ppm when the broth was amended with

sterile rumen fluid. These results suggest that bio-

chanin A potentiated, or acted synergistically with,

one or more heat-stable, antimicrobial compounds

present in the rumen fluid.

Others have reported synergistic interactions be-

tween biochanin A and other compounds. Morel

and colleagues (2003) showed that biochanin A and

other isoflavones, although not active against Staph-

ylococcus aureus, potentiated the antibacterial ac-

tivity of other compounds. The minimum inhibitory

concentration (MIC) of berberine against S. aureus

decreased 94% in the presence of the isoflavones.

Subsequent work revealed that biochanin A was the

most effective of nine phenolic compounds at inhib-

iting ethidium bromide efflux from Mycobacterium

smegmatis cells (Lechner et al., 2008), thus decreas-

ing the MIC of ethidium bromide. Biochanin A also

has been found to have a synergistic effect on the ac-

tivity of the antibiotic ciprofloxacin (Liu et al., 2011).

A variety of antimicrobial compounds are pres-

ent in the rumen. Some of these compounds, like

phenolics, are present in feed, but the rumen micro-

organisms produce other antimicrobial compounds.

This latter category includes fermentation acids,

which are sometimes called short chain fatty acids

or VFA. Acetic acid and other VFA are common

bacterial products, and they are known to have an-

timicrobial activity in fermented foods (Sengun and

Karabiyikli 2011), feeds (Flythe and Russell, 2006; Van

Immerseel et al., 2006), and industrial fermentations

(Dharmagadda et al., 2010). The mechanism of ac-

tion is intracellular accumulation of the anion, which

has been shown to disrupt osmotic homeostasis in

amino acid-fermenting bacteria (Flythe and Russell,

2006).

The rumen also contains bacteriocins, which are

small, ribosome-synthesized peptides. Streptococ-

cus bovis (Mantovani et al., 2001), Butyrivibrio fibri-

solvens (Rychlik and Russell, 2002) and Ruminococ-

cus albus (Chen et al., 2004) are among the rumen

bacteria that produce bacteriocins. It has been

estimated that the presence of bacteriocins in vivo

impacts the number and activity of HAB (Rychlik and

Russell, 2000). The caprine HAB was not inhibited by

biochanin A, even when a mixture of VFA was add-

ed to the media. However, one of the HAB strains

was inhibited by a combination of biochanin A and

a small amount of culture supernatant from a bac-

teriocin-producing Streptococcus bovis. It is pos-

sible that the inhibition of ammonia production by

mixed rumen microorganisms was due to a synergy

between the isoflavone and native bacteriocins. Fur-

thermore, bacteriocins are membrane-associated,

and can be transmitted from both producing cells

and sensitive cells, to other sensitive cells (Xavier

and Russell, 2009). We propose that a sub-inhibitory

concentration of bacteriocin was retained on the

mixed microorganisms that were separated from the

rumen digesta. Then the antimicrobial activity of the

bacteriocin was potentiated by the addition of bio-

chanin A.

CONCLUSIONS

The host is the most important factor that deter-

mines the composition of gastrointestinal microbial

community of a goat (Shi et al., 2007). Our results

demonstrate that red clover phenolic extract and

one of its major components, biochanin A, inhib-

ited ammonia production by uncultivated, mixed

goat rumen microorganisms. Furthermore, a hyper

ammonia-producing bacterium of caprine origin was

inhibited by biochanin A. The mechanism of action

appeared to be a synergistic interaction between

biochanin A and heat-stable rumen components.

Therefore, the spectrum of activity and minimum in-

hibitory concentrations are likely to be dependent

on compounds present in the rumen environment.

ACKNOWLEDGEMENTS

The Agricultural Research Service, USDA, sup-

ported this work. The authors thank Adam Barnes

and Tracy Hamilton for technical assistance.


REFERENCES

Attwood, G.T., A.V. Klieve, D. Ouwerkerk, and B.K.C.

Patel. 1998. Ammonia-hyperproducing bacteria

from New Zealand ruminants. Appl. Environ. Mi-

crobiol. 64:1796-1804.

Attwood, G., D. Li, D. Pacheco, and M. Tavendale.

2006. Production of indolic compounds by rumen

bacteria isolated from grazing ruminants. J. Appl.

Microbiol. 100:1261-1271.

Benchaar, C., S. Calsamiglia, A.V. Chaves, G.R. Fraser,

D. Colombatto, T.A. McAllister, and K.A. Beauche-

min. 2008. A review of plant-derived essential oils

in ruminant nutrition and production. Anim. Feed

Sci. Technol. 145:209-228.

Busquet, M., S. Calsamiglia, A. Ferret, P.W. Cardozo,

and C. Kamel. 2005. Effects of cinnamaldehyde and

garlic oil on rumen microbial fermentation in a dual

flow continuous culture. J. Dairy Sci. 88:2508-2516.

Caldwell, D.R., and M.P. Bryant. 1966. Medium with-

out rumen fluid for non-selective enumeration

and isolation of rumen bacteria. Appl. Microbiol.

14:794-801.

Cardozo, P., S. Calsamiglia, A. Ferret, and C. Kamel.

2006. Effects of alfalfa extract, anise, capsicum,

and a mixture of cinnamaldehyde and eugenol on

ruminal fermentation and protein degradation in

beef heifers fed a high-concentrate diet. J. Anim.

Sci. 84:2801-2808.

Chaney, A.L., and E.P. Marbach. 1962. Modified re-

agents for determination of urea and ammonia.

Clin. Chem. 8:130-132.

Chen, G.J., and J.B. Russell. 1989. More monensin-

sensitive, ammonia-producing bacteria from the

rumen. Appl. Environ. Microbiol. 55:1052-1057.

Chen, J., D.M. Stevenson, and P.J. Weimer. 2004. Al-

busin B, a bacteriocin from the ruminal bacterium

Ruminococcus albus 7 that inhibits growth of Ru-

minococcus flavefaciens. Appl. Environ. Microbiol.

70:3167-3170.

Dharmagadda, V. S. S., S. E. Nokes, H. J. Strobel, and

M. D. Flythe. 2010. Investigation of the metabolic

inhibition observed in solid-substrate cultivation

of Clostridium thermocellum on cellulose. Biore-

source Technol. 101:6039-6044.

Eschenlauer, S.C., N. McKain, N.D. Walker, N.R.

McEwan, C.J. Newbold, and R.J. Wallace. 2002.

Ammonia production by ruminal microorganisms

and enumeration, isolation, and characterization

of bacteria capable of growth on peptides and

amino acids from the sheep rumen. Appl. Environ.

Microbiol. 68:4925-4931.

Flythe, M.D., and J.B. Russell. 2006. Fermentation

acids inhibit amino acid deamination by Clostridi-

um sporogenes MD1 via a mechanism involving a

decline in intracellular glutamate rather than pro-

tonmotive force. Microbiology 152:2619-2624.

Flythe, M.D. 2009. The antimicrobial effects of hops

(Humulus lupulus L.) on ruminal hyper ammonia-pro-

ducing bacteria. Lett. Appl. Microbiol. 118:242-248.

Flythe, M., and K. Andries. 2009. The effects of mo-

nensin on amino acid catabolizing bacteria iso-

lated from the Boer goat rumen. Small Rum. Res.

81:178–181.

Flythe, M., and I. Kagan. 2010. Antimicrobial effect of

red clover (Trifolium pratense) phenolic extract on

the ruminal hyper ammonia-producing bacterium,

Clostridium sticklandii. Curr. Microbiol. 61:125-131.

Getachew, G., A.M. Dandekar, W. Pittroff, E.J.

DePeters, D.H. Putnam, S. Goyal, L. Teuber, and

S. Uratsu. 2009. Impacts of polyphenol oxidase

enzyme expression in transgenic alfalfa on in vitro

gas production and ruminal degradation of pro-

tein, and nitrogen release during ensiling. Anim.

Feed Sci. Technol. 151:44-54.

Hammerschmidt, R. 1999. Phytoalexins: What have

we learned after 60 years? Ann. Rev. Phytopathol.

37:285-306.

Hungate, R.E. 1960. Symposium: selected topics in

microbial ecology. I. Microbial ecology of the ru-

men. Bacteriol. Rev. 24:353-364.

Khan, A.V., Q.U. Ahmed, I. Shukla, and A.A. Khan.

2012. Antibacterial activity of Trifolium alexandri-

num Linn. leaves extracts against pathogenic bac-

teria causing tropical diseases. Asian Pac. J. Trop.

Biomed. 2:189-194.

Krause, D.O., and J.B Russell. 1996. An rRNA ap-

proach for assessing the role of obligate amino

acid-fermenting bacteria in ruminal amino acid

deamination. Appl. Environ. Microbiol. 62:815-821.


Lechner, D., S. Gibbons, and F. Bucar. 2008. Plant

phenolic compounds as ethidium bromide efflux

inhibitors in Mycobacterium smegmatis. J. Antimi-

crob. Chemother. 62:345-348.

Liu, G., J.C. Liang, X.L. Wang, Z.H. Li, W. Wang, N.

Guo, X.P. Wu, F.G. Shen, M.X. Xing, L.H. Liu, L. Li,

M.Y. Liu, and L. Yu. 2011. In vitro synergy of bio-

chanin A and ciprofloxacin against clinical isolates

of Staphylococcus aureus. Molecules 16:6656-6666.

Mantovani, H.C., D.K. Kam, J.K. Ha, and J.B. Russell.

2001. The antibacterial activity and sensitivity of

Streptococcus bovis strains isolated from the ru-

men of cattle. FEMS Microbiol. Ecol. 37:223-229.

Mantovani, H.C., and J.B. Russell. 2002. Bovicin

HC5, a bacteriocin from Streptococcus bovis HC5.

Microbiology 148:3347-3352.

McIntosh, F., P. Williams, R. Losa, R.J. Wallace, D.

Beever, and C. Newbold. 2003. Effects of essential

oils on ruminal microorganisms and their protein

metabolism. Appl. Environ. Microbiol. 69:5011-5014.

Morel, C., F.R. Stermitz, G. Tegos, and K. Lewis. 2003.

Isoflavones as potentiators of antibacterial activity.

J. Agric. Food Chem. 51:5677-5679.

Osbourn, A.E. 1996. Preformed antimicrobial com-

pounds and plant defense against fungal attack.

Plant Cell 8:1821-1831.

Paster, B.J., J.B. Russell, C.M. Yang, J.M. Chow, C.R.

Woese, and R. Tanner. 1993. Phylogeny of the

ammonia-producing ruminal bacteria Peptostrep-

tococcus anaerobius, Clostridium sticklandii, and

Clostridium aminophilum sp. nov. Int. J. Syst. Bac-

teriol. 43:107-110.

Polan, C. 1988. Update: dietary protein and micro-

bial protein contribution. J. Nutr. 118:242-248.

Russell, J.B. 2005. Enrichment of fusobacteria from

the rumen that can utilize lysine as an energy

source for growth. Anaerobe 11:177-184.

Russell, J.B., H.J. Strobel, and G.J. Chen. 1988. En-

richment and isolation of a ruminal bacterium with

a very high specific activity of ammonia produc-

tion. Appl. Environ. Microbiol. 54:872-877.

Russell, J.B., and J.L. Rychlik. 2001. Factors that alter

rumen microbial ecology. Science 11:1119-1122.

Rychlik, J.L., and J.B. Russell. 2000. Mathematical

estimations of hyper-ammonia producing ruminal

bacteria and evidence for bacterial antagonism

that decreases ruminal ammonia production.

FEMS Microbiol. Ecol. 32:121-128.

Rychlik, J.B., and J.B. Russell. 2002. Bacteriocin-like

activity of Butyrivibrio fibrisolvens JL5 and its effect

on other ruminal bacteria and ammonia produc-

tion. Appl. Environ. Microbiol. 86:1040-1046.

Saviranta, N.M.M., R. Julkunen-Tiitto, E. Oksanen,

and R. O. Karjalainen. 2010. Red clover (Trifolium

pratense L.) isoflavones: root phenolic compounds

affected by biotic and abiotic stress factors. J. Sci.

Food. Agric. 90:418-423.

Sengun, I. Y., and S. Karabiyikli. 2011. Importance of

acetic acid bacteria in food industry. Food Control

22:647-656.

Shi, P.J., K. Meng, Z.G. Zhou, Y.R. Wang, Q.Y. Diao,

and B. Yao. 2007. The host species affects the mi-

crobial community in the goat rumen. Lett. Appl.

Microbiol. 46:132-135.

Tedeschi, L.O., D.G. Fox, and T. P. Tylutki. 2003. Po-

tential environmental benefits of ionophores in ru-

minant diets. J. Environ. Qual. 32:1591-1602.

Van Immerseel F, J.B. Russell, M.D. Flythe, I. Gan-

tois, L. Timbermont, F. Pasmans , F. Haesebrouck,

and R. Ducatelle. 2006. The use of organic acids to

combat Salmonella in poultry: A mechanistic ex-

planation of the efficacy. Avian Pathol. 35: 182-188.

Van Kessel, J.S., and J.B. Russell. 1992. Energetics of argi-

nine and lysine transport by whole cells and membrane

vesicles of strain SR, a monensin-sensitive ruminal bac-

terium. Appl. Environ. Microbiol. 58:969-975.

Van Nevel, C.J., and D.I. Demeyer. 1977. Effect of

monensin on rumen metabolism in vitro. Appl. En-

viron. Microbiol. 34:251-257.

Wallace, R.J., N. McKain, N.R. McEwan, E. Miyagawa,

L.C. Chaudhary, T.P. King, N.D. Walker, J.H.A. Apa-

jalahti, and C.J. Newbold. 2003. Eubacterium py-

ruvativorans sp. nov., a novel non-saccharolytic an-

aerobe from the rumen that ferments pyruvate and

amino acids, forms caproate and utilizes acetate and

propionate. Int. J. Syst. Evol. Microbiol. 53:965-970.

Xavier, B., and J.B. Russell. 2009. The ability of non-

bacteriocin producing Streptococcus bovis strains

to bind and transfer bovicin HC5 to other sensitive

bacteria. Anaerobe 15:168-172.




ABSTRACT

Vibrio vulnificus, Vibrio parahaemolyticus and Vibrio cholerae, are human pathogens ubiquitous in the

marine and estuarine environments. Correlation between abundance of these pathogens and increased

water temperature is well established, but little is known about their environmental persistence. Previous

studies have identified finfish intestines as a potential reservoir of V. vulnificus; however, the data for other

pathogenic Vibrios is sparse. The objective of this study was to simultaneously enumerate the three Vibrio

spp. of greatest human health concern in finfish intestines collected from the Gulf of Mexico and estuarine

sites in Mobile Bay, Alabama. V. vulnificus, V. parahaemolyticus, and V. cholerae levels in fish intestines

were enumerated using a microtiter plate most probable number (MPN)-real-time polymerase chain reac-

tion (Rti-PCR) method. Of the 21 finfish samples examined, 62%, 76%, and 19% had detectable levels (≥3

MPN/g) of V. vulnificus, V. parahaemolyticus and V. cholerae, respectively. The highest levels of V. vulnificus

(7.63 log MPN/g), V. parahaemolyticus (7.97 log MPN/g), and V. cholerae (4.58 log MPN/g) were found in

sheepshead (Archosargus probatocephalus) collected from estuarine sites. There was a greater detection

frequency of all three organisms in the estuarine samples, compared to the Gulf of Mexico samples; V.

cholerae was only detected in the estuarine samples. Additionally, the levels of V. vulnificus and V. para-

haemolyticus were significantly higher in the estuarine samples. This is the first report for simultaneous

enumeration of V. vulnificus, V. parahaemolyticus, and V. cholerae in their environmental reservoir of finfish

intestines.

Keywords: Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio cholerae, real-time PCR, MPN, CPC+, finfish, Alabama, intestinal contents

Correspondence: Jessica L. Jones, [email protected] Tel: +1 -251-406-8136

BRIEF COMMUNICATION

Vibrio Densities in the Intestinal Contents of Finfish from Coastal Alabama

J.L. Jones1*, R.A. Benner Jr.1, A. DePaola1, and Y. Hara-Kudo2

1FDA, Division of Seafood Science and Technology, Gulf Coast Seafood Laboratory, Dauphin Island, AL2National Institute of Health Sciences, Division of Microbiology, Setagayaku, Tokyo 158 8501, Japan



INTRODUCTION

Vibrio spp. are ubiquitous in the marine and es-

tuarine environments (Chakraborty et al., 1997).

Some of these species, predominately V. vulnificus,

V. parahaemolyticus and V. cholerae, are pathogen-

ic to humans (Scallan et al., 2011). The main vec-

tor of seafood-related Vibriosis in the United States

is the consumption of shellfish, particularly oysters

(Iwamoto et al., 2010). Levels of pathogenic Vibrio

spp. have been frequently measured in oysters and

the environment (Baross and Liston, 1970; Colwell et

al., 1977; DePaola et al., 2003; Johnson et al., 2010;

Motes et al., 1998). However, when environmental

conditions are unfavorable for Vibrio spp. to be de-

tected in oysters, the question of how they persist

arises. One theory is that the Vibrios survive in a res-

ervoir such as sediment or finfish intestines.

While many studies have been conducted on

the microbiota of fish intestines, they have largely

focused on aquacultured fish of commercial or re-

search importance (Cantas et al., 2012; Ringo and

Olsen, 1999; Silva et al., 2011). The limited avail-

able studies conducted on wild fish populations

are mainly focused on the microbial diversity within

the fish gut (Aiso et al., 1968; Smriga et al., 2010).

In some of these studies, Vibrio spp. were identified

among the dominant flora (Aiso et al., 1968; Silva et

al., 2011; Smriga et al., 2010). A few previous studies

have specifically examined finfish intestines for oc-

currence and/or densities of human pathogenic Vib-

rios, specifically V. parahaemolyticus, V. alginolyticus,

and V. cholerae (Baross and Liston, 1970; DePaola et

al., 1994; Jaksic et al., 2002; Senderovich et al., 2010;

Sudha et al., 2012); however, only a few studies have

enumerated V. vulnificus and V. parahaemolyticus

(DePaola et al., 1994; Noorlis et al., 2011). The find-

ings of these previous studies and personal observa-

tions (Jones et al., 2012) support the theory that fish

guts may be a reservoir for pathogenic Vibrios, but

no study has simultaneously enumerated the three

Vibrio species of greatest human health concern.

Previous studies have clearly identified finfish in-

testine as a potential reservoir of V. vulnificus (De-

Paola et al., 1994) during times when surrounding

water temperatures are unfavorable for Vibrio prolif-

eration. However, the data for other pathogenic Vib-

rios is sparse. In a recent report by our group (Jones

et al., 2012), we reported levels of V. vulnificus and V.

parahaemolyticus found in fish intestine samples as

determined by multiple molecular detection meth-

ods. However, in that study, we did not correlate re-

ported levels to species of fish, sampling location, or

associated environmental data. These correlations,

in conjunction with the previously unreported levels

of V. cholerae in the same finfish intestine samples,

are the basis of the current report.

As such, the objective of this study was to simulta-

neously enumerate the three Vibrio spp. of greatest

human health concern in finfish intestines during a

period of cooler weather (September to December).

This time period was selected because Vibrio infec-

tions are rarely reported during these months and

detection of pathogenic Vibrios in finfish intestines

would further support the theory that this is an im-

portant reservoir for V. vulnificus and V. parahaemo-

lyticus while providing preliminary evidence of finfish

intestines as a reservoir for V. cholerae. Additionally,

insights into environmental factors influencing these

levels were examined.


Fish sampling

Sampling locations in and around Mobile Bay, Ala-

bama, are identified in Figure 1. Fish were collected

by rod and reel between the months of September

and December 2008 from three sampling locations:

the Gulf of Mexico, Mobile Bay, and Fowl River. Ten

finfish species were examined during this study: At-

lantic spadefish (Chaetodipterus faber), blue fish

(Pomatomus saltatrix), blue runner (Caranx crysos),

crevalle jack (Caranx hippos), king mackerel (Scomb-

eromorus cavalla), pin fish (Lagodon rhomboides),

red snapper (Lutjanus campechanus), red drum (Sci-

aenops ocellatus), sea catfish (Arius felis), sheeps-

head (Archosargus probatocephalus), and Spanish

mackerel (Scomberomorus maculates). Half of the


fish species were represented by a single sample (At-

lantic spadefish, blue fish, crevalle jack, king mack-

erel, and Spanish mackerel). Of the species sampled

multiple times, only sheepshead were caught at all

locations.

Fish intestine preparation for bacterial analysis

The entire intestinal tract (posterior to the stom-

ach) was aseptically removed and contents were

massaged into a sterile bag. Intestinal contents

were diluted 1:10 with phosphate buffered saline

(7.65 g sodium chloride, 0.724 g anhydrous disodi-

um phosphate, 0.21 g potassium phosphate, pH 7.4;

PBS) and homogenized in a Pulsifier® (Microgen Bio-

products, Camberley, Surrey, United Kingdom) for 30

sec. Serial ten-fold dilutions were made in PBS.

Vibrio enumeration

A modified MPN-real-time PCR (Rti-PCR) format

was used to enumerate V. vulnificus, V. parahaemo-

lyticus, and V. cholerae. In microtiter plates, 180 µL

alkaline peptone water (1% peptone, 1% NaCl, pH

8.5±0.2; APW) were inoculated in triplicate with 20 µL

Figure 1. Satellite photograph of Mobile Bay, Alabama. Approximate collection sites are noted with yellow stars and site names.


of serially diluted samples for a three-“tube” MPN.

The microtiter plates were incubated for 18 to 24 h at

35°C. After incubation, an aliquot from each turbid

well was tested for V. vulnificus, V. parahaemolyticus,

and V. cholerae using the BAX® Real-Time PCR Kit

using the manufacturer’s protocol (DuPont Qualicon,

Wilmington, DE).

Identification of interfering microflora

Interfering microflora are those that produce simi-

lar colonies on culture media. To identify these or-

ganisms from Vibrio-specific selective medium, ali-

quots of serially diluted samples were spread onto

CPC+ agar. Plates were incubated for 18 to 24 h at

35°C. Individual colonies were selected based on

their typical morphology (flat and yellow or flat with

a yellow halo). Colonies were streaked for isolation

on Marine Agar (Difco, Sparks, MD). Once a purified

isolate was obtained, a single colony was inoculat-

ed into Marine Broth (Difco) and incubated at 35°C

for 48 h. A 100 µL aliquot was removed, heated to

100°C for 10 min, and then put on ice. This was used

as template in PCR for 16S rDNA amplification as de-

scribed below.

Isolate identification by 16S rDNA se-quence

PCR conditions were as previously described for

amplification of bacterial 16S rDNA (DeLong, 1992).

PCR products were examined by 2% agarose gel

electrophoresis at a constant voltage of 100V. PCR

products from isolates producing an amplicon of

the appropriate size were purified using QiaQuick

(Qiagen, Valencia, CA). Concentrations of the puri-

fied DNA were determined using a Nanodrop spec-

trophotometer (Thermo Fisher, Pittsburg, PA). Each

purified PCR product was sent to MCLAB (South San

Francisco, CA) for two sequencing reactions, one us-

ing the forward primer and the other using the re-

verse primer for PCR. Chromatographs were viewed

and manually edited using FinchTV (Geospiza, Se-

attle, WA). Overlapping regions of the edited for-

ward sequences and reverse complement of reverse

sequences were aligned to obtain a full sequence

(~1400 bp). Organisms were identified by a BLAST

(nt) search of the full sequence. A phylogenetic tree

was constructed in MegAlign (Lasergene Core Suite,

DNASTAR, Madison, WI) using clustal W alignment.

Sequences were submitted to GenBank under ac-

cession numbers JX999943-JX999946 and JX999948-

JX999960.

Data analysis

Rti-PCR observations were recorded as positive or

negative for each well in an MPN series for each Vib-

rio tested. These observations were used for MPN

estimates following standard methods (Blodgett,

2010). MPN estimates were log transformed and

Student’s t-test was used to determine significant

differences between observed levels, while Pear-

son’s correlation coefficient was used to determine

correlations between Vibrio levels and temperature

or salinity.

RESULTS AND DISCUSSION

Of the 21 finfish samples, 13 (62%), 16 (76%), and

4 (19%) had detectable levels (≥3 MPN/g) of V. vulni-

ficus, V. parahaemolyticus, and V. cholerae, respec-

tively. The highest levels of Vibrios detected were

7.63, 7.97, and 4.58 log MPN/g of V. vulnificus, V.

parahaemolyticus, and V. cholerae, respectively (Fig-

ure 2). While these rates of detection and levels for

V. vulnificus and V. parahaemolyticus were provided

in our previous report (Jones et al., 2012), results

were not presented in relation to the origin of sam-

ples (harvest location, fish species, or environmental

parameters at time of collection). This report details

those connections to provide appropriate perspec-

tive to the observed data. The current report also

includes the first documentation of V. cholerae levels

in finfish intestines, to our knowledge.

In this study, all of the fish collected from estua-


Figure 2. Levels of V. vulnificus, V. parahaemolyticus, and V. cholerae in finfish intestines. Water salinity (dark blue circles) and temperature (yellow diamonds) at time of collection are plotted on the secondary Y-axis. Species of fish (along with identification number), collection site, and col-lection date are provided on the X-axis.


rine environments (Mobile Bay and Fowl River sites)

were positive for V. vulnificus and V. parahaemolyti-

cus; this is slightly higher than a previous report of

an 82% detection rate of V. vulnificus (DePaola et

al., 1994). The only samples with V. vulnificus and V.

parahaemolyticus levels below the limit of detection

were collected at the Gulf of Mexico site with high

salinities (>30 ppt). These results are consistent with

earlier investigations that found 10 to 12% of fish

from full oceanic salinity (>30 ppt) sites were posi-

tive for V. vulnificus or V. parahaemolyticus (DePaola

et al., 1994; Jaksic et al., 2002). As the current study

reports similar detection rates of V. vulnificus and V.

parahaemolyticus in fish intestine samples as previ-

ously reported, we feel this validates the application

of the microtiter plate MPN-Rti-PCR methodology to

this sample type.

When detectable levels were present in fish in-

testines collected from the high salinity site, Gulf of

Mexico, they were lower than levels detected at the

two, lower salinity, estuarine sites. V. vulnificus lev-

els were 2.83, 4.63, and 7.20 mean log MPN/g from

the Gulf of Mexico, Fowl River, and Mobile Bay sites,

respectively. Similarly, V. parahaemolyticus was de-

tected at 4.17, 5.43, and 7.67 mean log MPN/g from

the Gulf of Mexico, Fowl River, and Mobile Bay sites,

respectively. The difference in levels of V. vulnificus

and V. parahaemolyticus between the high salinity

and estuarine sites is statistically significant (P<0.01).

A previous study of V. vulnificus in finfish also found

lower prevalence and densities in Gulf of Mexico fish

than estuarine fish (DePaola et al., 1994). A previous

study enumerating V. parahaemolyticus in finfish in-

testines from market fish in Malaysia also found simi-

lar levels (Noorlis et al., 2011).

The highest levels of V. vulnificus (6.18 to 7.63 log

MPN/g) and V. parahaemolyticus (6.63 to 7.97 log

MPN/g) were detected in samples from Mobile Bay

(Figure 2). Water temperature (24.7°C) and salinity

(13.7 ppt) were within the optimal ranges for V. vulni-

ficus (>20°C and 5 to 15 ppt) and V. parahaemolyticus

(>15°C and 15 to 25 ppt) during this collection (De-

Paola et al., 2003; McLaughlin et al., 2005; Motes et

al., 1998; Wright et al., 1996). During the Fowl River

collection in September, temperature was also opti-

mal (25.7°C) and salinity (10.3 ppt) was slightly below

optimal for V. parahaemolyticus, but still within the

optimal range for V. vulnificus. Mean V. parahae-

molyticus levels were 3.79 log MPN/g (range of 0.56

to 6.18) and mean V. vulnificus levels were 4.31 log

MPN/g (range of 3.38 to 5.38) during this sampling

trip. A significant negative correlation with salinity

and V. vulnificus and V. parahaemolyticus levels was

observed (P<0.005).

Environmental temperatures (11.2°C) at Fowl Riv-

er in December were sub-optimal for Vibrio growth.

Mean levels recorded at this sampling site and pe-

riod were 3.55 log MPN/g (range of 1.63 to 4.63) and

1.89 log MPN/g (range of 0.96 to 2.38) for V. parahae-

molyticus and V. vulnificus, respectively (Figure 2). V.

vulnificus levels were approximately 2 logs lower with

the colder temperatures. In contrast, V. parahaemo-

lyticus, levels were similar (0.24 logs less) to the Sep-

tember Fowl River collection (25.7°C and 10.3 ppt).

Although the levels were generally lower than during

the warmer sampling from the same site, levels well

over the LOD (0.48 log MPN/g) were still observed in

the finfish intestines. Additionally, no significant cor-

relation between V. vulnificus or V. parahaemolyticus

levels and temperature was observed.

Only 4 of the 21 finfish intestinal samples col-

lected contained detectable (≥3 MPN/g) levels of

V. cholerae; all of which were obtained from the es-

tuarine sites. Three of the samples with detectable

levels of V. cholerae (0.48 to 0.87 log MPN/g) were

found during the Fowl River September collection,

when the water temperature was 25.7°C and salin-

ity 10.3 ppt. This was the collection date when the

salinity was the lowest, so it is not unexpected to see

a greater prevalence of V. cholerae, as V. cholerae

prefers lower salinity environments (Thomas et al.,

2006). The fourth sample containing V. cholerae was

the December Fowl River collection when the water

temperature was 11.2°C and salinity 14.2 ppt. This

sample contained the highest level of V. cholerae

(4.58 log MPN/g), but only one of the three fish from

this collection had detectable levels. These data

suggest that surrounding water salinity influences

the V. cholerae levels in finfish intestines, but as only

four samples had detectable levels of V. cholerae, no


statistical significance could be assigned.

It is important to note that 42°C is the optimal

incubation temperature for V. cholerae, (DePaola

et al., 1988) but 35°C was used in this study to fa-

cilitate detection by the BAX® Real-Time PCR V.

parahaemolyticus/V. vulnificus/V. cholerae Kit, which

may lead to an underestimation of these popula-

tions. Currently, no reports of total V. cholerae den-

sities in fish intestines are available for comparison

to the results presented here.

A previous study in the Mobile Bay area deter-

mined the intestinal content of sheepshead con-

tained the highest levels (7.1 log MPN/g) of V. vul-

nificus of fish examined (DePaola et al., 1994). In

the current study, we also found the highest levels

of V. vulnificus (7.63 log MPN/g) in sheepshead. The

same sheepshead sample also contained the high-

est level of V. parahaemolyoticus (7.97 log MPN/g)

and a different sheepshead harbored the highest

level of V. cholerae (4.58 log MPN/g) observed in this

study. Other species of fish in this study with high

levels of Vibrios were Atlantic spadefish and pinfish

(>4 log MPN/g of V. vulnificus and >6 log MPN/g of

V. parahaemolyticus).

Samples collected from the Gulf of Mexico site

were spread plated on CPC+ to identify organisms,

Figure 3. Phylogenetic tree of non- V. vulnificus strains isolated on CPC+. Strains with accession names provided were included as reference for relatedness of unknown isolates.


other than V. vulnificus, with typical colony appear-

ance. Finfish from the Gulf of Mexico September

collection (red snapper, red drum, sheepshead, and

blue runner) and October collection (red snapper,

red drum, and sea catfish) yielded isolates typical of

V. vulnificus, but these could not be confirmed us-

ing species-specific PCR (BAX® Real-Time PCR V.

parahaemolyticus/V. vulnificus/V. cholerae Kit). Par-

tial 16S sequencing was done to identify these or-

ganisms. Of the 17 isolates, 6 were identified as V.

sinaloensis, 2 as V. shilonii, 1 as V. campbellii, 1 as V.

harveyi, while 6 could only be matched to the Vibrio

genus (Figure 3). Additionally, one strain was identi-

fied as Morganella morganii (Figure 3). This high-

lights the need for confirmatory testing of typical

isolates, even from a medium as selective as CPC+.

This is the first report of identification of competing

microflora on V. vulnificus-specific media.

CONCLUSIONS

This is the first report, to our knowledge, using an

MPN-Rti-PCR method to simultaneously enumerate

the levels of human pathogenic Vibrios in fish intes-

tines and associate those levels with surrounding

water temperature and salinity. The levels of V. vul-

nificus, V. parahaemolyticus, and V. cholerae in fin-

fish intestines reported here support the theory that

finfish serve as a reservoir for potentially pathogenic

Vibrios in estuarine and marine environments. The

greatest frequency of detection and highest levels

of V. vulnificus, V. parahaemolyticus, and V. cholerae

were found in fish from estuarine areas favorable for

shellfish production, posing the possibility of trans-

mission via fish feces. Additionally, this study iden-

tified non-pathogenic species, such as V. shilonii, V.

sinaloensis, and V. harveyi on selective plating me-

dia, emphasizing the need for isolate confirmation,

even from selective media.

ACKNOWLEDGEMENTS

A part of this study was supported by a Research

on Food Safety in Health and Labour Science Re-

search Grant in Japan.

REFERENCES

Aiso, K., U. Simidu, and K. Hasou. 1968. Microflora in

the digestive tract of inshore fish in Japan. J. Gen.

ral Microbiol. 52:361-364.

Baross, J. and J. Liston. 1970. Occurrence of Vibrio

parahaemolyticus and related hemolytic Vibrios in

marine environments of Washington State. Appl.


Blodgett, R. 2010. Most probable number from se-

rial dilutions. Bacteriological Analytical Manual -

online: 9th. http://www.fda.gov/Food/FoodScien-

ceResearch/LaboratoryMethods/ucm109656.htm

Cantas, L., J. R. Sorby, P. Alestrom, and H. Sorum.

2012. Culturable gut microbiota diversity in zebraf-

ish. Zebrafish. 9:26-37.

Chakraborty, S., G. B. Nair, and S. Shinoda. 1997.

Pathogenic Vibrios in the natural aquatic environ-

ment. Rev. Environ. Health 12:63-80.

Colwell, R. R., J. Kaper, and S. W. Joseph. 10-28-

1977. Vibrio cholerae, Vibrio parahaemolyticus,

and other Vibrios: occurrence and distribution in

Chesapeake Bay. Science 198:394-396.

DeLong, E. F. 6-15-1992. Archaea in coastal ma-

rine environments. Proc. Natl. Acad. Sci. U. S. A

89:5685-5689.

DePaola, A., G. M. Capers, and D. Alexander. 1994.

Densities of Vibrio vulnificus in the intestines of fish

from the U.S. Gulf Coast. Appl. Environ. Microbiol.

60:984-988.

DePaola, A., M. L. Motes, and R. M. McPhearson.

1988. Comparison of APHA and elevated temper-

ature enrichment methods for recovery of Vibrio

cholerae from oysters: collaborative study. J. As-

soc. Off Anal. Chem. 71:584-589.

DePaola, A., J. L. Nordstrom, J. C. Bowers, J. G.

Wells, and D. W. Cook. 2003. Seasonal abundance

of total and pathogenic Vibrio parahaemolyti-


cus in Alabama oysters. Appl. Environ. Microbiol.

69:1521-1526.

Iwamoto, M., T. Ayers, B. E. Mahon, and D. L. Swerd-

low. 2010. Epidemiology of seafood-associated in-

fections in the United States. Clinical Microbiology

Reviews 23:399-411.

Jaksic, S., S. Uhitil, T. Petrak, D. Bazulic, and L. G.

Karolyi. 2002. Occurrence of Vibrio spp. in sea fish,

shrimps and bivalve molluscs harvested from Adri-

atic Sea. Food Control 13:491-493.

Johnson, C. N., A. R. Flowers, N. F. Noriea, III, A. M.

Zimmerman, J. C. Bowers, A. DePaola, and D. J.

Grimes. 2010. Relationships between environmen-

tal factors and pathogenic Vibrios in the Northern

Gulf of Mexico. Appl. Environ. Microbiol. 76:7076-

7084.

Jones, J. L., Y. Hara-Kudo, J. A. Krantz, R. A. Benner,

Jr., A. B. Smith, T. R. Dambaugh, J. C. Bowers, and

A. DePaola. 2012. Comparison of molecular detec-

tion methods for Vibrio parahaemolyticus and Vib-

rio vulnificus. Food Microbiol. 30:105-111.

McLaughlin, J. B., A. DePaola, C. A. Bopp, K. A. Mar-

tinek, N. P. Napolilli, C. G. Allison, S. L. Murray,

E. C. Thompson, M. M. Bird, and J. P. Middaugh.

10-6-2005. Outbreak of Vibrio parahaemolyticus

gastroenteritis associated with Alaskan oysters. N.

Engl. J. Med. 353:1463-1470.

Motes, M. L., A. DePaola, D. W. Cook, J. E. Veazey, J.

C. Hunsucker, W. E. Garthright, R. J. Blodgett, and

S. J. Chirtel. 1998. Influence of water temperature

and salinity on Vibrio vulnificus in Northern Gulf

and Atlantic Coast oysters (Crassostrea virginica).

Appl. Environ. Microbiol. 64:1459-1465.

Noorlis, A., F. M. Ghazali, Y. K. Cheah, T. C. Tuan

Zainazor, J. Ponniah, R. Tunung, J. Y. H. Tang, M.

Nishibuchi, Y. Nakaguchi, and R. Son. 2011. Preva-

lence and quantification of Vibrio species and Vib-

rio parahaemolyticus in freshwater fish at hyper-

market level. Int. Food Research J. 18:689-695.

Ringo, E. and R. E. Olsen. 1999. The effect of diet on

aerobic bacterial flora associated with intestine of

Arctic charr (Salvelinus alpinus L.). J. Appl. Micro-

biol. 86:22-28.

Scallan, E., R. M. Hoekstra, F. J. Angulo, R. V. Tauxe,

M. A. Widdowson, S. L. Roy, J. L. Jones, and P. M.

Griffin. 2011. Foodborne illness acquired in the

United States-major pathogens. Emerg. Infect.

Dis. 17:7-15.

Senderovich, Y., I. Izhaki, and M. Halpern. 2010. Fish

as reservoirs and vectors of Vibrio cholerae. PLoS.

One. 5:e8607-

Silva, F. C., J. R. Nicoli, J. L. Zambonino-Infante, S.

Kaushik, and F. J. Gatesoupe. 2011. Influence of

the diet on the microbial diversity of faecal and

gastrointestinal contents in gilthead sea bream

(Sparus aurata) and intestinal contents in goldfish

(Carassius auratus). FEMS Microbiol. Ecol. 78:285-

296.

Smriga, S., S. A. Sandin, and F. Azam. 7-1-2010.

Abundance, diversity, and activity of microbial as-

semblages associated with coral reef fish guts and

feces. FEMS Microbiol. Ecol. 73:31-42.

Sudha, S., P. S. Divya, B. Francis, and A. A. Hatha.

2012. Prevalence and distribution of Vibrio para-

haemolyticus in finfish from Cochin (south India).

Vet. Ital. 48:269-281.

Thomas, K. U., N. Joseph, O. Raveendran, and S.

Nair. 2006. Salinity-induced survival strategy of

Vibrio cholerae associated with copepods in Co-

chin backwaters. Mar. Pollut. Bull. 52:1425-1430.

Wright, A. C., R. T. Hill, J. A. Johnson, M. C. Rogh-

man, R. R. Colwell, and J. G. Morris, Jr. 1996. Distri-

bution of Vibrio vulnificus in the Chesapeake Bay.





ABSTRACT

Foodborne Salmonella spp. continue to be problematic in food production and processing. This is partly

due to their ability to survive and adapt to a wide range of environments and colonize and infect various

hosts. Consequently not only the ability to detect low numbers of Salmonella spp. in these various niches

is important but also quantitation is emerging as an important consideration for assessing effectiveness

of control measures and better profiling of potential problematic areas for control in food production and

processing. Immunoassays offer promise for both detection and quantitation as well as high-throughput

analyses. Although both monoclonal and polyclonal antibodies have been utilized for immunoassays,

polyclonal antibodies offer additional versatility and ease of production, which makes them more attractive

for routine use. In this review, recent advances in the use of immunological approaches, particularly egg

yolk antibodies are discussed and compared. Finally the potential for feed grade egg yolk antibodies as a

therapeutic agent to be added to feed is discussed along with ongoing limitations and possible solutions

using clay materials as carriers.

Keywords: Immunological approaches, egg yolk antibodies, foodborne, Salmonella

Correspondence:Soohyoun Ahn, [email protected]: +1 -352-392-1991 Ext. 310.

REVIEWUtility of Egg Yolk Antibodies for Detection and Control

of Foodborne Salmonella

P. Herrera1, M. Aydin2, S. H. Park3, A. Khatiwara4# and S. Ahn5

1Food Safety and Inspection Service, 2736 Lake Shore Drive, Waco, TX 727082Molecular Biosciences Graduate Program, Arkansas State University, Jonesboro, AR 72401

3Department of Food Science and Center for Food Safety, University of Arkansas, Fayetteville, AR 727044Cell and Molecular Biology Program, Department of Poultry Science, University of Arkansas, Fayetteville, AR 72701

5Food Science and Human Nutrition Department, University of Florida, Gainesville, FL 32611

#Current address: Food & Drug Administration/Center for Food Safety and Applied Nutrition, College Park, MD 20740



INTRODUCTION

Salmonella spp. are members of the family En-

terobacteriaceae and individual species are differen-

tiated primarily on basis of the host they are general-

ly attributed to associate with on a regular frequency

(Bhunia, 2008; Pui et al., 2011; Li et al., 2013). Salmo-

nellosis is one of the most common foodborne dis-

eases in the United States, with Salmonella enterica

serovars Enteritidis (S. Enteritidis), S. Typhimurium

and S. Heidelberg being some of the more com-

mon isolates found on a wide range of food as well

as associated with foodborne disease and/or iso-

lated from humans (St. Louis et al., 1988; Ricke et

al. 2001; Committee on Salmonella, 2002; Mumma

et al., 2004; Patrick et al., 2004; Braden, 2006; CDC,

2006; Boyen et al., 2008; Hanning et al., 2009; Foley

et al., 2011; Scallan et al., 2011; Finstad et al., 2012;

Howard et al., 2012; Koo et al., 2012; Li et al., 2013).

The annual cost of salmonellosis due to medical

costs and lost production has been estimated to be

several billion dollars (Frenzen et al., 1999; Bhunia,

2008; Scallan et al., 2011). The Food Safety and In-

spection Service (FSIS) of the United States Depart-

ment of Agriculture has identified it as a pathogen

of importance and has consequently implemented

a testing regime in meat/poultry processing facilities

to aid in the surveillance and control of Salmonella

(FSIS-USDA, 2006).

In many food animal production systems such as

poultry, Salmonella can readily become established

in the gastrointestinal tract and be easily dissemi-

nated into the surrounding environment. General

persistence of Salmonella can also influence all as-

pects of food production and processing (Murray,

2000; Park et al., 2008; Dunkley et al., 2009a). Con-

sequently, a wide range of intervention strategies

to reduce Salmonella contamination has taken into

account not only the particular food production or

processing system but any restriction on what can be

applied from a government regulatory standpoint

(Ricke and Pillai, 1999; Ricke, 2003a,b; Ricke et al.,

2005; Maciorowski et al., 2004; O’Bryan et al., 2008;

Sirsat et al., 2009; Vandeplas et al., 2010; Cox et al.,

2011; Ricke et al., 2012a,b; Siragusa and Ricke, 2012).

Many of these interventions have proven to be rel-

atively effective but success is not always universal

and can depend on several factors. One of the pri-

mary reasons for limited effectiveness of certain in-

tervention measures is that Salmonella spp. possess

the capability with a wide range of gene systems to

survive environmental changes including decreases

in pH and water activity, sudden increases in temper-

ature, and other fairly drastic changes that can com-

monly occur in food production (Juven et al., 1984;

Ha et al., 1998a,b; Durant et al., 1999a,b, 2000a,b,c;

Kwon and Ricke, 1998, 1999; Kwon et al., 2000; Ricke,

2003b; Carrique-Mas et al., 2007; Dunkley et al.,

2009b; Milillo and Ricke 2010; Milillo et al., 2011; Pet-

kar et al., 2011; Sirsat et al., 2009, 2010, 2011). In

addition, the fact that not all Salmonella serovars ge-

netically respond equally to certain stresses such as

low pH further complicates intervention approaches

(González-Gil et al., 2012; Shah et al., 2012a). There-

fore, the combination of a complex genetic system

coupled with the high adaptability of Salmonella to

a range of stressors have limited the ability to not

only predict the persistence of a particular Salmonel-

la serovar, but also detect and develop the appropri-

ate control measures to minimize its dissemination

(Ricke, 2003b; Ricke et al., 2005, 2013b; Spector and

Kenyon, 2012). However, the development of rapid

detection approaches, next generation sequencing

methods and other approaches such as metabolo-

mics offer opportunities to more specifically target

foodborne Salmonella in many of the corresponding

food production systems (Maciorowski et al., 2005,

2006; Jarquin et al., 2009; Kwon and Ricke, 2011; Park

et al. 2013; Ricke et al., 2013b).

The objectives of this review are to examine the

prevalence of certain Salmonella serovars in specific

food production systems and to discuss immuno-

logical Salmonella detection systems with an em-

phasis on polyclonal egg yolk antibodies. Although

several Salmonella serovars are problematic for food

production, our review on the prevalence of Salmo-

nella in food production systems will be focused on

Salmonella enterica serovar Enteritidis (Salmonella

Enteritidis) as an example since this serovar can rep-

resent the complexity in disseminating Salmonella


through a host animal and its associated food prod-

ucts and the ensuing difficulty of developing ap-

propriate intervention measures. In our review on

immunological Salmonella detection systems, the

application of polyclonal egg yolk antibodies as

a potential intervention in the form of feed grade

antibodies will also be discussed in addition to the

discussion on their utility for incorporation into Sal-

monella detection systems.

SALMONELLA ENTERITIDIS AND EGG PRODUCTION

The difficulty of limiting Salmonella in food pro-

duction systems is especially evident with particular

serovars that can be entrenched in food production

ecosystems and become continually problematic

during all phases of production. Consequently as

mores cases are documented these serovars be-

come characteristically identified with a particu-

lar food product. Historically, eggs contaminated

with S. Enteritidis strains have represented one of

the more prevalent exposure routes in human out-

breaks. For example, in the year 1999, estimates of

the number of human salmonellosis cases ranged

from 800,000 to 4 million (Angulo and Swerdlow,

1999). For the past two decades, the number of cas-

es of gastroenteritis due to S. Enteritidis infections

has increased markedly in the United States and

Europe and still remains a serious food safety issue

(Humphrey, 1999; Guard-Petter, 2001; Patrick, 2004;

Mumma et al., 2004; Schroeder et al., 2006; CDC,

2010; Norberg et al., 2010; Howard et al., 2012; Ricke

et al., 2010, 2013a).

One of the primary problems with S. Enteritidis is

that it can easily become systemic and invade multi-

ple organ systems in susceptible hosts such as laying

hens (Guard-Petter, 2001; Holt, 1999, 2003; Shah et

al., 2012b). It became evident that periodic clusters

of contaminated eggs produced by laying hens were

attributed to specific management practices such as

feed withdrawal-based molting (Durant et al., 1999a;

Holt, 1999, 2003; Ricke, 2003a; Ricke et al. 2013a).

Traditionally, the commercial egg industry used

these types of molting procedures to interrupt the

first cycle of egg production by causing a cessation

and retrenchment of the reproductive tract so that it

could enter a period of rest and rejuvenation prior

to ending the molt period to start a second egg lay-

ing cycle (Bell, 2003; Berry, 2003; Ricke, 2003a; Ricke

et al., 2010; 2013a). Generally speaking, induced

molting was considered economically advantageous

by not only enabling an extension in egg produc-

tion but also potentially increasing eggs produced

by older laying hens (Keshavarz and Quimby, 2002;

Bell, 2003; Berry, 2003; Holt, 1999, 2003; Ricke et al.,

2013a). The advantages of induced molting became

evident by the fact that 60 percent of the estimated

240 million laying hens nationwide and 90 percent

in California were force-molted and the practice

became more popular (Bell, 1987; 2003; Holt, 1999;

2003).

Feed deprivation-based molt induction, however,

proved to be problematic as it disrupted the activ-

ity of protective intestinal microflora and allowed S.

Enteritidis to colonize the gastrointestinal tract of

birds and become pathogenic in them (Thiagarajan

et al., 1994; Durant et al., 1999a; Ricke, 2003a; Dunk-

ley et al., 2007a, 2009a; Golden et al., 2008; Shah et

al., 2012b; Ricke et al., 2013a). Depending on micro-

ecological conditions created by the removal of feed

in the gastrointestinal tract, S. Enteritidis after initial

colonization could initiate the expression of several

key regulatory and functional virulence genes and

through a series of steps become more pathogenic

leading to systemic invasion of multiple organ sys-

tems including the reproductive tract (Thiagarajan et

al., 1994; Holt, 1999; Humphrey et al., 1999; Ricke,

2003a; Dunkley et al., 2007a; Norberg et al., 2010;

Shah et al., 2012b; Ricke et al., 2010; 2013a). Be-

cause of this invasiveness into the reproductive tract

organs including the ovaries, S. Enteritidis possessed

the potential ability to contaminate eggs by trans-

ovarian transmission following establishment in the

intestinal tract (Thiagarajan et al., 1994; Holt, 1999;

Humphrey et al., 1999). Administration of particu-

lar antibiotics, followed by introduction of probiotic

cultures, has been demonstrated to limit S. Enteriti-

dis in susceptible birds (Seo et al., 2000; Holt, 2003);


however, due to the emergence of antibiotic resis-

tant microorganisms, there are public health con-

cerns that such practices may lead to dissemination

of antibiotic resistant pathogens and an increase of

untreatable human disease (Jones and Ricke, 2003).

Several alternative means for limiting Salmonella

establishment in laying hens and occurrence in table

eggs have been examined, including vaccination of

the hens and treatments designed to remove bac-

teria from the surfaces of egg shells (Kinner and

Moats, 1981; Holley and Proulx, 1986; LeClair et al.,

1994; Kuo et al., 1996, 1997a,b,c;, 2000 McKee et al.,

1998; Knape et al., 1999, 2001; Holt, 2003; Howard

et al., 2012; Ricke et al., 2012a; 2013a). The most

extensively examined approach has been focused

on modifying the molt induction process such that it

no longer is invoked by removal of feed but instead

is done via an alteration on the diet. A number of

different dietary amendments have been examined

over the years that have involved an alteration of

dietary components such as sodium or calcium and

these have been summarized elsewhere (Bell, 2003;

Berry, 2003; Park et al., 2004b,c; Ricke et al., 2010;

2013a). Increasing the dietary level of zinc has been

shown to initiate molt in laying hens and although

experimental infection studies indicated that S. En-

teritidis establishment could be limited by these di-

ets, potential management issues and other issues

precluded their practical use (McCormick and Cun-

ningham, 1984a,b; Cunningham and McCormick,

1985; Berry and Brake, 1985; Goodman et al., 1986;

Berry et al., 1987; Alodan and Mashaly, 1999; Bar et

al., 2003; Park et al., 2004a,b,c,d; Moore et al., 2004;

Ricke et al., 2004). Adding dietary ingredients con-

taining high levels of fiber sources such as alfalfa,

wheat middlings, and guar gum, were also demon-

strated in a wide range of studies to have the ability

to induce molt, alter gastrointestinal fermentation,

shift microbial populations, and limit S. Enteritidis in

laying hens (Seo et al., 2001; Holt, 2003; Hume et al.,

2003; Ricke, 2003a; Woodward et al., 2005; McReyn-

olds et al., 2005, 2006; Dunkley et al., 2007a,b;

Donalson et al., 2008; Gutierrez et al., 2008; Ricke et

al., 2010; 2013a). The remainder of this review will

discuss general concepts for immunological assay

technologies, utility of egg yolk polyclonal antibod-

ies, and their potential applications for foodborne

Salmonella.

IMMUNOLOGICAL METHODS – GENER-AL CONCEPTS

Enzyme-Linked Immunosorbent Assay (ELISA)

based immunoassays are extensively reviewed else-

where and will only briefly be described here (Clark

and Engvall, 1980; Maggio, 1980; Yolken, 1982; Butt,

1984; Blake and Gould, 1984; O’Sullivan, 1984; Ma-

ciorowski et al., 2006). In a typical sandwich con-

figuration of ELISA, primary antibodies (also called

capture antibodies) are immobilized to a solid matrix

such as a microtiter plate, and subsequently capture

the target antigen from enriched samples. Target

antigens can include either the whole microorgan-

ism of interest or a more purified isolated protein

from the target microorganism such as toxins. Sec-

ondary antibodies (also called detection antibodies)

that are conjugated to an enzyme such as horse-

radish peroxidase or alkaline phosphatase bind

directly to alternative site(s) on the target antigen

and function in the detection of the bound antigen.

Conversely, the antigen can be initially bound to

the solid plate followed by adding primary antibod-

ies that bind directly to the antigen and finally the

secondary chromogenic antibodies that bind to the

primary antibodies. In this approach, it is critical that

the antigens or target microorganisms bind on the

solid phase equally to ensure that any difference de-

tected during the assay is strictly due to differences

in the antigen-antibody binding relationship.

Successful antigen-antibody binding is detected

when the enzyme conjugated to the detection an-

tibodies reacts with added chromogenic substrate

and generates a detectable color reaction. The pres-

ence of an antigen can be detected and quantified

by reading the generated color reaction with a spec-

trophotometer, and the amount of antigen is corre-

lated to the intensity of the color (Clark and Engvall,

1980; Maggio, 1980; Yolken, 1982; Butt, 1984; Blake

and Gould, 1984; O’Sullivan, 1984). The ELISA plat-


form offers several advantages in comparison to

cultural detection methods, which include much

shorter total assay times than cultural methods (1 to

2 days including pre-enrichment versus 4 to 7 days)

and the possibility for automation to further reduce

the total assay time and manual labor input. Con-

sequently this offers the opportunity for enhanced

throughput to allow large number of samples to be

simultaneously analyzed. Another key advantage of

ELISA-based immunological approaches over cultur-

al methods is the increased specificity due not only

to the affinity between antibodies and the respective

antigens they have been generated against but the

ability to amplify detection sensitivity via enzyme re-

actions and use of chromogenic, colorimetric or fluo-

rometric agents (Maggio, 1980; Yolken, 1985; 1988).

SOURCES OF ANTIBODIES

Large quantities of antibodies can be produced

by fusing an activated B lymphocyte to an immortal

cell line to form a hybridoma (Kimball, 1983). Anti-

bodies produced by hybridoma cells are monoclo-

nal, and they can react to specific determinant of

a particular antigen of interest (Kimball, 1983). This

specificity has advantages for detection of Salmo-

nella in immunological assays and also offers a cer-

tain level of uniformity that is highly reproducible

(Kimball, 1983). Their development, generation and

application has been documented for a wide vari-

ety of microorganisms over the years (Macario, and

Conway de Macario, 1985; Hazlewood et al., 1986;

Brooker and Stokes, 1990; Bhunia et al., 1991; Bhu-

nia and Johnson, 1992; Di Padova et al., 1993; Chai-

yaroj et al., 1995; Corthier et al., 1996; Young et al.,

1997; Nannapaneni et al., 1998a,b; Geng et al., 2006;

Zhang et al., 2006; Heo et al., 2007, 2009) and only

their utility for foodborne Salmonella will be briefly

discussed here. Durant et al., (1997a) assessed the

specificity of mouse monoclonal antibodies made

to probiotic bacteria Veillonella and Enterococcus

avium previously isolated from a continuous culture

of chicken cecal contents versus antibodies gener-

ated to a S. Typhimurium poultry isolate in an ELISA

test (Ziprin et al., 1990; Corrier et al., 1995; Nisbet et

al., 1996a,b; Durant et al., 1997b; Young et al., 1997).

To test these respective antibodies for the detection

sensitivity and quantification of the corresponding

bacteria, the cultures were grown anaerobically in

batch culture containing a nutrient rich broth both

as pure cultures and in a mixed culture. The detec-

tion limits for the ELISA were 104 cells per mL for all

three bacteria with no cross reactivity between the

antibodies and bacteria. In addition, when cells enu-

merated by selective plating were compared to the

numbers of cells estimated by ELISA, the resulting

enumeration from the respective method demon-

strated linearity as the cell numbers were propor-

tionally increased (r2 above 0.9). Durant et al. (1997a)

concluded that monoclonal antibodies generated

for each of these microorganisms could be used to

quantitate these microorganisms in mixed cultures

as well as potentially in vivo. As the authors pointed

out, however, reliable quantification would require

the antigens be consistently and proportionally ex-

pressed under all environmental conditions.

While monoclonal antibodies can provide high

specificity in bacterial detection, this specificity can

also limit their usefulness in simultaneous detection

of multiple strains as an antibody made toward the

antigen of one strain may not react to another close-

ly related strain and therefore may require different

screening methods to retrieve multiple monoclonal

antibodies for each strain (Mierendorf and Dimond,

1983). Furthermore the creation, culturing and the

purification of antibodies from hybridomas can be

both time-consuming and expensive (Kimball, 1983).

Polyclonal antibodies derived from the sera of im-

munized animals offer an alternative to avoid some

of these limitations in monoclonal antibodies. De-

tection of microorganisms based on the immune

response of an animal host is long-standing basis

for generating fairly specific antibody probes for

differentiating among genera, species and even at

the strain level (Mims¸ 1976; Dawson and Cresswell,

1988). The essential process for antigen preparation

and animal immunization has been described much

more extensively in previous reviews (Mims¸ 1976;

Amos, 1988; Dawson and Cresswell, 1988; Cook and


Trott, 2010). Briefly, the antibody-producing animal

host is introduced to either the whole organism or

selected antigens from that target organism that

have been purified to some extent. When this entity

is introduced into the animal via oral or intramuscu-

lar routes, it mounts an immune response, which in

turn generates highly specific antibody populations

as exposure to the antigen is continued mostly via

repeated booster administration. These antibodies

are referred to as polyclonal antibodies due to the

presence of different subpopulations of antibodies,

which are specific for the particular antigen but each

identifies different epitopes associated with the re-

spective antigen (Mims¸ 1976; Amos, 1988; Dawson

and Cresswell, 1988). Polyclonal antibodies have

been developed for a wide range of microorgan-

isms (Archer and Best, 1980; Minnich et al., 1982;

Archer, 1984; Mårtensson et al., 1984; Aleixo et al.,

1985; Singleton et al., 1985; Maciorowski et al., 2006;

Zhang et al., 2006). Polyclonal antibodies are gen-

erally recovered from the serum after bleeding the

animal immunized over a sufficient time to the anti-

gen in question; however, bleeding can be avoided

altogether in laying hens where similar types of an-

tibodies to those generated in the animal sera can

also be deposited in the egg yolks. The following

sections describe the use and development of poly-

clonal antibodies with particular emphasis on egg

yolk antibodies.

EGG YOLK ANTIBODIES AS A POLY-CLONAL ANTIBODY SOURCE

A relatively recent development has been the

ability to recover specific antibodies from eggs of

hens that have been immunized to a specific anti-

gen or microorganism. These antibodies are simi-

lar to the antibodies recovered from serum that are

used for immunoassays but are deposited in the egg

yolk and biologically are intended to be used by the

hatchling as a source of passive immunity to poten-

tial threats it may encounter early in its life (Malkin-

son, 1965; Kramer and Cho, 1970; Kowalczyk et al.,

1985; Anton, 1998; Hamal et al., 2006). The benefits

of avian antibodies have been recognized for sev-

eral decades and their use offers many advantages

compared to mammalian antibodies. The major se-

rum antibody in chicken is immunoglobulin G (IgG

or IgY) which is transported into the egg in a manner

similar to the placental transfer of IgG in mammals

(Coleman, 2000). The protection against pathogens

that the relatively immunocompetent newly hatched

chick possesses is through transmission of antibod-

ies from the mother via the egg (Kovacs-Nolan and

Mine, 2004).

The yolk of immunized chickens is a rich and in-

expensive source of a variety of high value proteins

including polyclonal antibodies (Cook, 2004; Kovacs-

Nolan and Mine, 2004; Cook and Trott, 2010). Ko-

vacs-Nolan and Mine (2004) pointed out that a hen

typically producing 50 to 100 mg IgY per egg and

5 to 7 eggs in one week compared to 200 mg per

bleed (40 mL) in a mammal will equate to 40, 000

mg antibody in a year for a hen versus 1,400 for the

mammalian source. Cook and Truitt (2010) summa-

rized studies that demonstrated that the concentra-

tion of antibody appears to be independent of the

rate of lay or size of the egg and the amount depos-

ited could not be increased.

In addition to avoiding the bleeding of the ani-

mal altogether, egg yolk antibodies can be retrieved

daily without bleeding the hen (Karlsson et al., 2004;

Kovacs-Nolan and Mine, 2004). Only IgG (IgY) and

not IgM is selectively deposited in the yolk and its

levels are similar to those found in serum, and the

antibody activity is stable in eggs stored from 4 to 6

weeks and storage can be extended by spray drying

whole eggs and holding at 21°C or lower (Brandly

et al., 1946; Patterson, et al., 1962a,b; Malkinson,

1965; Orlans, 1967; Brambell, 1970; Faith and Clem,

1973; Rose and Orlans, 1981; Ricke et al., 1988; Cook

and Trott, 2010; Sun et al., 2013). In addition, Cook

and Truitt (2010) pointed out that although thermal

(steam) exposure such as that experienced during

feed pelleting can cause loss of their biological ac-

tivity this can be alleviated to some extent by the

addition of certain carbohydrates which offered

some protection. Applications of egg yolk antibod-

ies in the food animal industry have been two-fold,


namely as therapeutic agents to food animals for

disease prevention and growth promotion and as a

source of polyclonal antibodies for diagnostic detec-

tion of microorganisms (Lösch et al., 1986; Pimentel,

1999; Mine and Kovacs-Nolan, 2002; Tini et al., 2002;

Cook, 2004; Karlsson et al., 2004; Kovacs-Nolan and

Mine, 2004; Berghman et al., 2005; Schade et al.,

2005; Trott et al., 2009; Kim et al., 2013). These two

applications will be addressed in more detail in the

following sections.

EGG YOLK ANTIBODIES FOR DETEC-TION ASSAYS

Egg yolk antibodies have been used as the

source of polyclonal antibodies for detection as-

says for several microorganisms. In a series of stud-

ies hens immunized to rumen bacteria produced

specific antibodies that could be used in immu-

noassays to differentiate them (Ricke et al., 1988).

By week 2 of post immunization cross reactivity for

most rumen bacteria tested was reduced except for

Streptococcus bovis antibodies which still exhibit-

ed considerable cross reactivity with heterologous

antigens of the other rumen bacteria tested. Ricke

et al. (1988) speculated that this sustained cross

reactivity may be related to Streptococcus bovis

being a Gram positive organism with an extensive

capsule that masks some of the surface antigens

that might be important for eliciting an optimal im-

mune response in the bird (Lancefield , 1933; Dain

et al., 1956; Deibel, 1964; Cheng et al., 1976; Rus-

sell and Robinson, 1984; Ricke et al., 1988; Jones

et al., 1991; Holt, 1994; Herrera et al., 2009, 2012).

Further studies demonstrated that specific egg yolk

antibodies could be generated against individual

strains of Selenomonas ruminantium, a common

isolate from the rumen of ruminant animals fed a

variety of diets that has had multiple strains isolat-

ed and characterized over the years (Kingsley and

Hoeniger, 1973; Brooker and Stokes, 1990; Ricke

and Schaefer, 1990a,b, 1991, 1996a,b,c; Ricke et al.,

1996; Patterson et al., 2010). In a study involving

egg yolk antibodies, the authors were able to quan-

titate two strains (Selenomonas ruminantium strain

D versus strain GA192) in a biculture by comparing

microscopic enumerations of individual cells versus

the immunoassay response (Ricke and Schaefer,

1990a). Since the strains were metabolically simi-

lar this proved to be significant that they could be

distinguished by an ELISA assay with polyclonal an-

tibodies and suggested that surface antigens may

differ to some extent (Ricke and Schaefer, 1990a).

As the authors suggested the issue remains as to

whether antibodies made to strains maintained in

the laboratory for several years would react with

similar strains occurring currently found in the ru-

men or if the respective epitopes evolves such that

the resulting reactivity is either altered or lost en-

tirely. Better structural characterization and purifi-

cation of the specific epitopes that are binding to

the egg yolk antibodies would be helpful to allevi-

ate this uncertainty.

There has been considerable evidence that lay-

ing hens could produce specific antibodies to Sal-

monella spp. when the birds are exposed to Salmo-

nella colonization and infection. For example, in a

series of studies it has been demonstrated that se-

rovar S. Enteritidis under certain circumstances can

easily colonize and infect susceptible laying hens

(Durant et al., 1999a; Ricke, 2003a; Woodward et

al., 2005; McReynolds et al., 2005; 2006; Dunkley et

al., 2007a, 2009a; Norberg et al., 2010; Ricke et al.,

2010; 2013a). In these infected hens S. Enteritidis

can usually be recovered from egg contents either

due to penetration of the egg shell or via internal

deposition directly into the yolk from an infected

reproductive tract in the laying hen (Humphrey et

al., 1989, 1991; Humphrey, 1999; Gast and Beard,

1990a; Gast, 1993; Guard-Petter, 2001). It follows

that immune responses would be elicited from S.

Enteritidis colonization and infection, resulting in

antibodies that could be detected in the serum

(Gast and Beard, 1990b). It was also shown that birds

either experimentally infected with S. Enteritidis or

naturally infected deposited detectable serogroup

D specific antibodies in their yolks (Gast and Beard,

1991). More recently, Gürtler and Fehlhaber (2004)

demonstrated that multiple immunizations with S.


Enteritidis would increase the quantity of anti- S.

Enteritidis antibody in the egg yolk. Therefore, it

would appear that specific antibodies suitable for

detection purposes could be generated in the eggs

of hens immunized to the target Salmonella spp.

Biswas et al. (2010) compared the specificity of

egg yolk antibodies generated after immunization

of laying hens with purified antigens from S. Enter-

itidis and S. Typhimurium to that of antibodies pro-

duced against whole cells of common Salmonella

serovars (S. Enteritidis, S. Typhimurium, S. Anatum,

S. Arizona, S. Javiana, S. Muenchen, S. Newport, S.

Rubsilaw, and S. Texas along with Escherichia coli

as a control) prepared by inactivation in 10% forma-

lin phosphate buffered saline solutions. Egg yolk

antibodies had been previously produced in laying

hens immunized against purified fimbriae, flagella

and lipopolysaccharide (LPS) from a specific S. En-

teritidis strain and flagella, LPS and outer mem-

brane proteins (OMP) from a specific S. Typhimuri-

um strain. When serial dilutions of the individual

antibodies were titrated against their respective

homologous (Salmonella antibody reacted against

the same serovar) inactivated whole cell Salmonella

serovar in an ELISA test, the anti-S. Enteritidis anti-

bodes generally showed higher sensitivity than the

S. Typhimurium antibodies. For S. Enteritidis anti-

bodies the highest activity occurred with the fimbri-

al antibody. The next highest activity detected was

the homologous reaction that occurred with the

LPS followed by the reaction of inactivated whole

cells with the flagellar antibody. For S. Typhimurium

antibodies the highest activity occurred with the

flagellar antibody. The next highest activity was the

homologous reactions that occurred with the OMP

followed by the reaction of inactivated whole cells

with the LPS antibody.

When serially diluted aliquots of the individual

antibodies were titrated against the respective het-

erologous (Salmonella antibody reacted against

different serovars) inactivated whole cell Salmonella

serovars the anti-S. Enteritidis antibodes were also

generally more specific than the S. Typhimurium

antibodies. For S. Enteritidis antibodies the least

cross reactivity occurred with the fimbrial antibody

with the S. Enteritidis strains not surprisingly being

the most cross reactive. The next most specific het-

erologous reactions occurred with the flagellar an-

tibodies followed by the LPS antibodies which were

clearly highly cross reactive. For S. Typhimurium an-

tibodies the least cross reactivity occurred with the

flagellar antibody and as expected the most cross

reactivity that was detected occurred with the other

S. Typhimurium strains while there was much less

cross reactivity detected with the non-S. Typhimuri-

um serovars. The S. Typhimurium OMP and LPS an-

tibodies were generally much more cross reactive

with all Salmonella serovars and even cross reacted

to some extent with the inactivated E. coli bacterial

cells.

Biswas et al. (2010) concluded that these particu-

lar Salmonella egg yolk antibodies had two poten-

tial applications. The very specific antibodies such

as the S. Enteritidis fimbriae antibodies would be

highly useful for detection of S. Enteritidis and po-

tentially with further refinement could even be used

to delineate detectable differences among differ-

ent strains. The antibodies which displayed the

most cross reactivity might actually be better suited

for administration in animal diets as feed grade an-

tibodies to limit Salmonella colonization since they

would react with most Salmonella serovars fairly

equally. Ideally, when used in passive immunity

applications these highly cross reactive antibodies

would be able to limit colonization of almost any

Salmonella serovar that the animal host would come

in contact with and potentially help to repress dis-

semination of foodborne Salmonella within flocks

of birds or herds of animals. It would be critical to

determine the resilience of these antibodies as they

traversed the gastrointestinal tract and eventually

reached the environment. If they proved to be rela-

tively fragile some sort of carrier could potentially

be devised that would serve as a potential means

to protect the antibody during passage through the

more harsh elements of specific environments such

as the highly acidic stomach. These aspects will be

discussed in the following sections.


EGG YOLK ANTIBODIES FOR THERA-PEUTIC APPLICATIONS

Feed grade antibodies derived from the egg

yolks of immunized hens have the advantage of be-

ing easily accessible, inexpensive, and a rich source

of polyclonal antibodies (Li et al., 1998; Cook, 2004;

Cook and Trott, 2010). Because of the ability of lay-

ing hens to produce large quantities of egg yolk

antibodies on a relatively ongoing basis they have

been promoted and tested as potential feed grade

prophylactic agents (Cook, 2004; Cook and Trott,

2010). They have been administered as potential

inhibitors of the enzyme uricase to reduce nitrogen

emissions in poultry due to the excess production

of uric acid in the manure by microorganisms (Kim

and Patterson, 2003; Kim et al. 2013). The ability to

generate specific antibodies in fairly large quantities

has also proven advantageous for therapeutic pre-

vention of microbial pathogen colonization. Incor-

porating feed grade egg yolk antibodies into animal

diets has been examined extensively to attempt to

limit pathogenic diarrhea causing Escherichia coli in

swine, and limit Salmonella establishment in calves

and mice, as well as Campylobacter, Clostridium,

and Salmonella in poultry (Wiedemann et al., 1991;

Peralta et al., 1994; Yokoyama et al., 1998; Marquardt

et al., 1999; Sahin et al., 2001; Fulton et al., 2002;

Owusu-Asiedu et al., 2002; 2003; Kassaify, and Mine,

2004; Wilkie et al., 2006; Rahimi et al., 2007; Chalg-

houmi et al., 2009a; Al-Aldawari et al., 2013).

Chicken egg-yolk antibodies when administered

orally have been used for passive immunization

against infectious diarrheal diseases in animals (Mar-

quardt, 1999). Therefore, these antibodies offer a

practical means of controlling certain intestinal dis-

eases (scours) caused by microorganisms such as

enterotoxigenic Esherichia coli in early weaned pigs.

Studies have demonstrated that egg-yolk antibod-

ies obtained from hens immunized with a strain of

enterotoxigenic Esherichia coli, K88, were highly ef-

fective in protecting 3 to 14 day-old piglets against

the pathogenic effects of this organism. Pigs fed

egg-yolk with anti- enterotoxigenic Esherichia coli

antibodies only had transient diarrhea, nearly all sur-

vived and all of the survivors gained weight. In con-

trast, control piglets that were treated with egg-yolk

powder that did not contain the specific antibodies

had severe diarrhea, were dehydrated, lost weight

and several died within 48 hours (Marquardt, 1999).

Oral administration of egg yolk antibodies has also

been successfully used for the prevention of bacte-

rial infections in other animal models. It has been

used to prevent rotavirus infections in mice (Ebina

et al., 1996), Escherichia coli infections in rabbits

(O’Farrelly et al., 1992) and piglets (Wiedemann et

al., 1990), and caries in rats (Hamada et al., 1991).

Egg yolk antibodies have also been developed

for attempts to prevent establishment of foodborne

pathogens that commonly colonize food animals.

Campylobacter jejuni is one of the major foodborne

disease causing microorganisms that also happens

to be very well adapted to the ecological conditions

prevalent in the poultry gastrointestinal tract (Hor-

rocks et al., 2009; Pendleton et al., 2013). In an at-

tempt to isolate antibodies that could limit C. jejuni

colonization Al-Adwani et al. (2013) generated chick-

en egg-yolk-derived antibodies (IgY) in laying hens

against the five different C. jejuni colonization-as-

sociated cell surface proteins. These proteins were

produced in sufficient quantities by first expressing

the respective protein in E. coli and subsequently

purifying the proteins for intramuscular injection as a

water-oil mixture in combination with Freund’s com-

plete adjuvant into C. jejuni-free free laying hens.

Eggs were collected upto 10 weeks post-immuni-

zation and egg yolks were lyophilized for eventual

purification and quantitation of specific egg yolk an-

tibodies reactive to each of the C. jejuni proteins.

After characterizing specificity and reactivity of the

individual egg yolk antibodies generated against the

specific cell surface proteins they demonstrated that

several of these egg antibodies limited attachment

of C. jejuni to chicken hepatocellular carcinoma cells

and concluded that these were candidate egg yolk

antibodies with potential to reduce C. jejuni coloni-

zation in chickens.

In a series of studies, previously developed anti-

Salmonella spp. egg yolk antibodies that were si-

multaneously directed against Salmonella Enteriti-


dis and Salmonella Typhimurium (Chalghoumi et al.

(2008; 2009b) were administered as feed additives in

the form of freeze dried egg yolk powder to broiler

chicks for determining whether the egg yolk anti-

bodies would prevent cecal colonization of both

Salmonella serovars (Chalghoumi et al., 2009a). The

birds were simultaneously infected with these Sal-

monella serovars three days after initial feeding of

the respective dietary treatments with or without the

antibodies and over the 28 day trial, birds were re-

moved on days 7, 14, 21 and 28 days, sacrificed and

cecal contents sampled for the presence of the Sal-

monella serovars using a quantitative real-time poly-

merase reaction assay. When monitoring bird feed

intake and growth rate the authors noted that ex-

perimentally infecting with the Salmonella serovars

negatively decreased performance parameters while

inclusion of egg yolk antibodies enhanced these

performance indicators even though they did not

reach the same levels of the uninoculated control

birds or birds fed antibodies and not inoculated with

Salmonella. However, none of the treatments con-

taining anti-Salmonella specific antibodies reduced

the cecal levels of Salmonella

Chalghoumi et al. (2009a) concluded that any

growth benefit associated with the feeding of the

antibodies were due to properties of the antibod-

ies other than their anti-Salmonella function since

the inclusion of the egg yolk antibody preparations

containing anti-Salmonella antibodies did not statis-

tically reduce the levels of Salmonella in the infected

birds compared to the positive control that did not

receive anti-Salmonella antibodies. The authors

also speculated that the concentration of the anti-

Salmonella antibodies may have been too low to

be effective perhaps due to their becoming dena-

tured and degraded during their transit through the

chicken gastrointestinal tract. Overcoming this loss

of activity remains a potential obstacle for further

practical application of therapeutic antibodies and

suggests the need to develop protective measures

to ensure that specific antibodies can survive as they

travel through the intestinal tract prior to reaching

their target microorganism.

DEVELOPING PROTECTIVE DELIVERY

VEHICLES FOR THERAPEUTIC EGG YOLK ANTIBODIES – POTENTIAL OF CLAY PARTICLES

The disadvantage in using antibodies clinically to

treat gastrointestinal disease is their instability under

gastrointestinal conditions. To be therapeutically

useful, the antibodies have to avoid denaturation by

stomach acid and proteolytic digestion by the intes-

tinal enzymes (Cook and Trott, 2010). Secondly, they

must be transported to the intestines in sufficient

concentration in order to exert their therapeutic ef-

fects. What is needed is a method to protect and

deliver the antibody to the intestinal tract to achieve

maximum antibacterial effect with minimal dosage

(Cook and Trott, 2010). Ideally a carrier should be

inexpensive, non-toxic, easy to handle, and readily

available. Previous research suggests that clay min-

erals may be ideal carriers for this purpose (Herrera

et al., 2004). Clay minerals are products of the chemi-

cal and physical change involved in the erosion of

rocks (Millot, 1979). In clays the elements silicon,

aluminum, oxygen, iron, magnesium, sodium, and

potassium are arranged in a regular crystalline struc-

ture. During the process of weathering, water carries

away or introduces new elements into the crystalline

matrix, altering its chemical composition. Thus clay

minerals represent a chemically diverse class of ma-

terials. Clays have a high affinity for and readily ad-

sorb a diverse array of organic compounds, includ-

ing nucleic acids and proteins.

Multiple studies have researched the binding and

activity of proteins bound to clay particles (Sanjay

and Sugunan, 2005; Lee et al., 2003). Lee et al. (2003)

described the binding and activity of insecticidal

proteins from Bacillus thuringiensis subsp. israelen-

sis. Equilibrium adsorption of the insecticidal toxins

was rapid and concentration-dependent. Adsorp-

tion was pH dependent suggesting that binding

was due to electrochemical adsorption. However,

attempts to desorb the toxins from the clay released

only 2 to 12% of the absorbed toxins signifying the

clay had a high affinity for the toxins. Sodium dodec-

yl sulfate-polyacrylamide gel electrophoresis (SDS-

PAGE) revealed that adsorption did not alter the


structure of the toxin proteins. In fact the insecticidal

activity of the bound proteins was greater than that

of the unbound proteins. The study also suggested

that adsorption of the toxins to clay could protect

them from environmental degradation. The insec-

ticidal activity of the bound proteins in non-sterile

water after 45 d was greater than that of free pro-

teins as 63% versus 25%, respectively. Sanjay and Su-

gunan (2005) described the binding of α-amylase on

acid activated montmorillonite. Isothermal analysis,

x-ray diffraction, and nuclear magnetic resonance

revealed that the enzyme was bound to the clay by

both electrochemical adsorption and covalent bind-

ing. The ability of the bound enzyme to hydrolyze

starch was subsequently investigated. The bound

enzyme retained enzymatic activity and exhibited a

greater stability over a wider range of pH and tem-

perature compared to free enzyme.

There are procedures which can be used to at-

tach antibodies and other proteins to silicate sur-

faces (Pierce Biotechnology, Inc., 2006; Zhao et al.,

2004). One such procedure involves derivatizing the

surface of the adsorbant with primary amines (-NH2)

using an aminosilane reagent. The amines are then

reacted to the heterobifunctional crosslinker Sulfo-

succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-

carboxylate (Sulfo-SMCC), resulting in a maleimide-

activated surface. This crosslinker is able to react

with sulfhydryl groups on antibodies. The antibodies

are subsequently treated in order to cleave disulfide

bonds (-S-S-) and reduce the sulfurs to sulfhydryls

(-SH). The antibodies and silica surface can be react-

ed with each other to form a crosslinked composite

material. While these procedures are effective, they

are also time consuming and expensive. However,

caution must be observed when activating the anti-

bodies in preparation for crosslinking, as the chemi-

cal reaction used in activation can also denature the

protein, rendering it non-functional. The binding of

antibodies to clay should be relatively quick and in-

expensive due to the high surface area, cationic ex-

change capacity and the availability of the clay ma-

terials. Presumably, the immunogenic activity of the

antibodies would not be affected by the adsorption

process. Finally, the clay materials should protect the

antibodies from gastrointestinal conditions allowing

them to exert their antibacterial effects in the lower

intestine.

CONCLUSIONS

Salmonella have been a major foodborne patho-

gen problem in food production and processing

systems and therefore the sensitive detection and

control strategies for Salmonella are highly desirable

for food safety. Use of egg yolk antibodies has been

studied as a component of immunoassays for Salmo-

nella detection and as a therapeutic agent to con-

trol Salmonella in food animals. Egg yolk antibodies

have several advantages over mammalian antibod-

ies from sera of immunized host animals; (1) they are

less expensive; (2) they can be collected in larger

amounts and higher concentration; (3) their collect-

ing procedure is simpler and do not require animal

bleeding. Egg yolk antibodies also have a great po-

tential as a therapeutic agent to prevent infectious

diarrheal diseases in food animals, even though

there are limitations to overcome to use these anti-

bodies for the therapeutic applications such as find-

ing a dependable carrier and avoiding denaturation.

With developing stable and dependable carriers of

these antibodies, it is expected egg yolk antibodies

will be used in various applications in detection of

other pathogens and control of infectious diseases

in food animals.

ACKNOWLEDGEMENTS

We thank the Cell and Molecular Biology (CEMB)

program at the University of Arkansas in Fayetteville,

AR, for supporting a graduate student assistantship

to S. Park.


REFERENCES

Al-Adwani, S.R., R. Crespo, and D. H. Shah. 2013.

Production and evaluation of chicken egg-yolk-

derived antibodies against Campylobacter je-

juni colonization-associated proteins. Foodborne

Pathogens Dis. 10: 624-631.

Aleixo, J.A.G., B. Swaminathan, and S.A. Minnich.

1985. Salmonella detection in foods and feeds in

27 hours by an enzyme immunoassay. J. Microbiol.

Meths. 2: 135-145.

Alodan, M.A. and M.M. Mashaly. 1999. Effect of in-

duced molting in laying hens on production and

immune parameters. Poultry Sci. 78: 171-177.

Amos, B.D. 1988. Chapter 11. Introduction to immu-

nity. pp. 172-179, In: W.K. Joklik, H.P. Willett, D.B.

Amos and C.M. Wilfert (Eds.), Zinsser Microbiol-

ogy, Nineteenth Edition. Appleton & Lange, Nor-

walk, CT.

Angulo, F.J. and D.L Swerdlow. 1999. The changing

epidemiology of foodborne diseases. Am. J. Med.

Sci. 311: 23-29.

Anton, M. 1998. Structure and functional properties

of hen egg yolk constituents. Recent Res. Dev. Ag-

ric. & Food Chem. 2: 839-863.

Archer, D.B. 1984. Detection and quantitation of

methanogens by enzyme-linked immunosorbent

assay. Appl. Environ. Microbiol. 48: 797-801.

Archer, D.B. and J. Best. 1980. Serological related-

ness of Spiroplasmas estimated by enzyme-linked

immunosorbent Aassay and crossed immunoelec-

trophoresis. J. Gen. Microbiol. 119: 413 – 422.

Bar, A. V. Razaphkovsky, D. Shinder, and E. Vax. 2003.

Alternative procedures for molt induction: Practi-

cal aspects. Poultry Sci. 82: 543-550.

Bell, D.D. 2003. Historical and current molting prac-

tices in the U.S. table egg industry. Poultry Sci.

82:965-970.

Bell, D. 1987. Is molting still a viable replacement al-

ternative? Poultry Trib. 93: 32-35.

Berghman, L.R., D. Abi-Ghanem, S.D. Waghela, and

S.C. Ricke. 2005. Antibodies: An alternative for an-

tibiotics? Poultry Science 84: 660-666.

Berry, W.D. 2003. The physiology of induced molt-

ing. Poultry Sci. 82: 971-980.

Berry, W.D. and J. Brake. 1985. Comparison of pa-

rameters associated with molt induced by fasting,

zinc, and low dietary sodium in caged layers. Poul-

try Sci. 64: 2027-2036.

Berry, W.D. R.P. Gildersleeve, and J. Brake. 1987.

Characterization of different hematological re-

sponses during molts induced by zinc or fasting.

Poultry Sci. 66: 1841-1845.

Bhunia, A.K. 2008. Salmonella enterica. In: Foodborne

microbial pathogens: Mechanisms and pathogen-

esis. Pages 201-215. Springer Science + Business

Media, LLC. United States of America.

Bhunia, A.K. and M.G. Johnson. 1992. Monoclonal

antibody specific for Listeria monocytogenes as-

sociated with 66 kDa cell surface antigen. Appl.

Environ. Microbiol. 58: 1924-1929.

Bhunia, A.K., P.H. Ball, A.T. Faud, B.W. Kurtz, J. Em-

erson and M.G. Johnson. 1991. Development and

characterization of a monoclonal antibody specific

for Listeria monocytogenes and L. innocua. Infect.

Immun. 59: 3176-3184.

Biswas, D., Herrera, P., L. Fang, R.R. Marquardt, and

S.C. Ricke. 2010. Cross-reactivity of anti-Salmonel-

la egg-yolk antibodies to Salmonella serovars. J.

Environ. Sci. Health, Part B, 45: 790-795.

Blake, C. and B. J. Gould. 1984. Use of enzymes in

immunoassay techniques a review. Analyst. 109:

533-546.

Boyen F., F. Haesebrouch, D. Maes, F. Van Immer-

seel, R.F. Ducatelle, and F. Pasmans. 2008. Non ty-

phoidal Salmonella infections in pigs: a closer look

at epidemiology, pathogenesis and control. Vet.

Microbiol. 130: 1-9.

Braden, C.R., 2006. Salmonella enterica serotype En-

teritidis and eggs: a national epidemic in the Unit-

ed States. Clinical Infectious Disease 43: 512–517.

Brambell, F. W. R. 1970. The transmission of passive

immunity from mother to young, p. 2041. North-

Holland Publishing Co., Amsterdam.

Brandly, C. A., H. E. Moses, and E. L. Jungherr. 1946.

Transmission of antiviral activity via the egg and the

role of congenital passive immunity to Newcastle

disease in chickens. Am. J. Vet. Res. 7:333-342.

Brooker, J.D. and B. Stokes. 1990. Monoclonal anti-

bodies against the ruminal bacterium Selenomo-


nas ruminantium. Appl. Environ. Microbiol. 56:

2193–2199.

Butt, W.R. (Ed.) 1984. Practical Immunoassy – The

State of the Art. Marcel Dekker, New York, NY.

Carrique-Mas, J.J., S. Bedford, and R.H. Davies. 2007.

Organic acid and formaldehyde treatment of ani-

mal feeds to control Salmonella: Efficacy and mask-

ing during culture. J. Appl. Microbiol. 103: 88-96.

Centers for Disease Control. 2010. Investigation up-

date: multistate outbreak of human Salmonella

Enteritidis infections associated with shell eggs.

Available at: http://www.cdc.gov/salmonella/en-

teritidis/ Accessed 18 January 2011.

Centers for Disease Control. 2006. Salmonella Sur-

veillance: Annual Summary, 2005. Centers for Dis-

ease Control and Prevention, Atlanta, GA.

Chaiyaroj, S.C., T. Sirisereewan, N. Jiamwatanasuk,

and S. Sirisinha. 1995. Production of monoclonal

antibody specific to Campylobacter jejuni and its

potential in diagnosis of Campylobacter enteritis.

Asian Pac. J. Allergy Immunol. 13: 55-61.

Chalghoumi, R., C. Marcq, A. Thewis, D. Portetelle,

and Y. Beckers. 2009a. Effects of feed supplemen-

tation with specific hen egg yolk antibody (im-

munoglobin Y) on Salmonella species cecal colo-

nization and growth performances of challenged

broiler chickens. Poultry Sci. 88: 2081–2092.

Chalghoumi, R., A. Théwis, Y. Beckers, C. Marcq, D.

Portetelle, and Y-J. Schneider. 2009b. Adhesion

and growth inhibitory effect of chicken egg yolk

antibody (IgY) on Salmonella enterica serovars En-

teritidis and Typhimurium in vitro. Foodborne Pat-

hog. Dis. 6:593–604.

Chalghoumi, R., A. Théwis, D. Portetelle, and Y.

Beckers. 2008. Production of hen egg yolk immu-

noglobulins simultaneously directed against Sal-

monella Enteritidis and Salmonella Typhimurium

in the same egg yolk. Poultry Sci. 87:32–40.

Cheng, K. J., R. Hironaka, G. A. Jones, T. Nicas,

and J. W. Costerton. 1976. Frothy feedlot bloat in

cattle: production of extracellular polysaccharides

and development of viscosity in cultures of Strep-

tococcus bovis. Can. J. Microbiol. 22:450-459.

Clark, B.R. and E. Engvall. 1980. Chapter 8. Enzyme-

linked immunosorbent assay (ELISA): Theoretical

and practical aspects. pp. 167-179, In E.T. Maggio

(Ed.) Enzyme Immunoassay, CRC Press, Inc., Boca

Raton, FL.

Coleman, M. 2000. Using egg yolk antibodies to

treat diseases. pp. 352-371. In: Egg Nutrtion and

Biotechnology, CAB International.

Committee on Salmonella, United States Animal

Health Association. (November 8, 2002) Report

of the Committee on Salmonella. (United States

Animal Health Association, 2002 Committee Re-

ports). Available: http://www.usaha.org/reports/

reports02/r02sal.html (Accessed: March 10, 2004.)

Cook, M. E. 2004. Antibodies: Alternatives to anti-

biotics in improving growth and feed efficiency. J.

Appl. Poult. Res. 13:106–119.

Cook, M.E. and D.L. Trott. 2010. IgY – Immune com-

ponent of eggs as a source of passive immunity

for animals and humans. World’s Poultry Sci. J.

66:215-226.

Corthier, C., M.C. Muller, and R. L’Harison. 1996. Se-

lective enumeration of Bacteroides vulgates and

B. distasonis organisms in the predominant human

fecal flora by using monoclonal antibodies. Appl.


Cox, N.A., J.A.Cason, and L.J. Richardson. 2011.

Minimization of Salmonella contamination in raw

poultry. Ann Rev Food Sci & Technol 2: 75-95.

Corrier, D.E., D.J. Nisbet, C.M.Scanlan, A.G. Hollister

and J.R. DeLoach, J.R. 1995. Control of Salmonella

typhimurium colonization in broiler chicks with a

continuous-flow characterized mixed culture of ce-

cal bacteria. Poultry Sci. 74: 916–924.

Cunningham, D.L. and C. C. McCormick. 1985. A

multicycle comparison of dietary zinc and feed

removal molting procedures: Production and in-

come performance. Poultry Sci. 64: 253-260.

Dain, J.A., A.L. Neal and H.W. Seely. 1956. The effect

of CO2, on polysaccharide production by Strepto-

coccus bovis. J . Bacteriol. 72: 209-213.

Dawson, J.R. and P. Cresswell. 1988. Chapter 12.

Immunogens (antigens) and antibodies and their

determination. pp. 180-203, In: W.K. Joklik, H.P.

Willett, D.B. Amos and C.M. Wilfert (Eds.), Zins-

ser Microbiology, Nineteenth Edition. Appleton &

Lange, Norwalk, CT.


Deibel, D.H. 1964. The group D streptococci. Bacte-

riol. Rev. 28: 330-366.

Di Padova, F., E. H. Brade, G.R. Barclay, I.R. Poxton,

E. Liehl, Schuetze, H.P. Kocher, G. Ramsay, M.H.

Schreier, B.L. McClelland, and E.T. Rietschel, 1993.

A broadly cross-protective monoclonal antibody

binding Escherichia coli and Salmonella Lipopoly-

saccharides. Infect. Immun. 61: 3863–3872.

Donalson, L.M., J.L. McReynolds, W.K. Kim, V.I.

Chalova, C.L. Woodward, L.F. Kubena, D.J. Nis-

bet, and S.C. Ricke. 2008. The influence of a

fructooligosacharide prebiotic combined with

alfalfa molt diets on the gastrointestinal tract fer-

mentation, Salmonella Enteritidis infection and

intestinal shedding in laying hens. Poultry Sci.

87:1253-1262.

Dunkley, K.D., T.R. Callaway, V.I. Chalova, J.L.

McReynolds, M.E. Hume, C.S. Dunkley, L.F. Kube-

na, D.J. Nisbet, S.C. and Ricke. 2009a. Foodborne

Salmonella ecology in the avian gastrointestinal

tract. Anaerobe 15: 26-35.

Dunkley, K.D., T.R. Callaway, C. O’Bryan, M.M.

Kundinger, C.S. Dunkley, R.C. Anderson, D.J. Nis-

bet, P.G. Crandall, P.G., and S.C. Ricke. 2009b. Cell

yields and fermentation responses of a Salmonella

Typhimurium poultry isolate at different dilution

rates in an anaerobic steady state continuous cul-

ture (CC). Antonie van Leeuwenhoek J. Gen. Mol.

Microbiol. 96: 537-544.

Dunkley, K.D., J.L. McReynolds, M.E. Hume, C.S.

Dunkley, T.R. Callaway, L.F. Kubena, D.J. Nisbet,

and S.C. Ricke. 2007a. Molting in Salmonella En-

teritidis challenged laying hens fed alfalfa crumbles

I. Salmonella Enteritidis colonization and virulence

gene hilA response. Poultry Sci. 86: 1633-1639.

Dunkley, K.D., J.L. McReynolds, M.E. Hume, C.S.

Dunkley, T.R. Callaway, L.F. Kubena, D.J. Nisbet,

and S.C. Ricke. 2007b. Molting in Salmonella En-

teritidis challenged laying hens fed alfalfa crumbles

II. Fermentation and microbial ecology response.

Poultry Sci. 86: 2101-2109.

Durant, J.A., D.E. Corrier, and S.C. Ricke. 2000a.

Short-chain volatile fatty acids modulate the ex-

pression of the hilA and invF genes of Salmonella

Typhimurium. J. Food Prot. 63: 573-578.

Durant, J.A., V.K. Lowry, D.J. Nisbet, L.H. Stanker,

D.E. Corrier, and S.C. Ricke. 2000b. Short-chain

fatty acids alter HEp-2 cell association and invasion

by stationary growth phase Salmonella typhimuri-

um. J. Food Sci. 65: 1206-1209.


D.E. Corrier, and S.C. Ricke. 2000c. Late logarith-

mic Salmonella typhimurium HEp-2 cell-associa-

tion and invasion response to short chain volatile

fatty acid addition. J. Food Safety 20: 1-11.

Durant, J.A., D.E. Corrier, J.A. Byrd, L.H. Stanker, and

S.C. Ricke. 1999a. Feed deprivation affects crop

environment and modulates Salmonella Enteritidis

colonization and invasion of Leghorn hens. Appl.



D.E. Corrier, and S.C. Ricke. 1999b. Short-chain

volatile fatty acids affect the adherence and inva-

sion of HEp-2 cells by Salmonella typhimurium. J.

Environ. Sci. Health B34: 1083-1099.

Durant, J.A., C.R. Young, D.J. Nisbet, L.H. Stanker,

and S.C. Ricke. 1997a. Detection and quantifica-

tion of poultry probiotic bacteria in mixed culture

using monoclonal antibodies in an enzyme-linked

immunosorbent assay. Int. J. Food Microbiol.

38:181-189.

Durant, J.A., D.J. Nisbet, and S.C. Ricke. 1997b.

Comparison of batch culture growth and fermen-

tation of a poultry Veillonella isolate and selected

Veillonella species grown in a defined minimal me-

dia. Anaerobe 3: 391-397.

Ebina, T. 1996. Prophylaxis of rotavirus using immu-

noglobulin. Arch. Virol. Suppl. 12: 217-223.

Faith, R. E., and L. W. Clem. 1973. Passive cutaneous

anaphylaxis in the chicken biological fractionation

of the mediatingantibody. Immunology 25:151-163.

Finstad, S., C.A. O’Bryan, J.A. Marcy, P.G. Crandall,

and S.C. Ricke. 2012. Salmonella and broiler produc-

tion in the United States: relationship to foodborne

salmonellosis. Food Res. Int. 45:789-794.

Foley, S., R. Nayak, I.B. Hanning, T.L. Johnson, J.

Han, and S.C. Ricke. 2011. Population dynamics of

Salmonella enterica serotypes in commercial egg

and poultry production. Appl. Environ. Microbiol.

77:4273-4279.


Food Safety and Inspection Service, USDA. Salmo-

nella Verification Sample Result Reporting: Agency

Policy and Use in Public Health Protection. Federal

Register. 71 (February 27, 2006): 9772-9777.

Frenzen, P.D., T. L. Riggs, J. C. Buzby, T. Breuer, T.

Roberts, D. Voetsch, S. Reddy, and the FoodNet

Working Group. 1999. Salmonella Cost Estimate

Updated Using FoodNet Data. FoodRev. 22: 10-15.

Fulton, R.M., B.N. Nersessian, and W. M. Reed. 2002.

Prevention of Salmonella Enteritidis infection in

commercial ducklings by oral chicken egg-derived

antibody alone or in combination with probiotics.

Poultry Sci. 81:34–40.

Gast, R.K. 1993. Recovery of Salmonella Enteritidis

from inoculated pools of egg contents. J. Food

Prot. 56: 21-24.

Gast, R.K. and C.W. Beard. 1991. Research note: De-

tection of Salmonella serogroup antibodies in the

yolks of egg laid by hens infected with Salmonella

Enteritidis. Poultry Sci. 70: 1273-1276.

Gast, R.K. and C.W. Beard. 1990a. Production of

Salmonella-contaminated eggs by experimentally

infected hens. Avian Dis. 34: 438-446.

Gast, R.K. and C.W. Beard. 1990b. Serological detec-

tion of experimental Salmonella enteritidis infec-

tions in laying hens. Avian Dis. 34: 438-446.

Geng, T., B.-K. Hahm, and A. K. Bhunia. 2006. Selec-

tive enrichment media affect the antibody-based

detection of stress-exposed Listeria monocyto-

genes due to differential expression of antibody-

reactive antigens identified by protein sequenc-

ing. J. Food Prot. 69: 1879–1886.

Golden, N. J., H. H. Marks, M.E. Coleman, C. M.

Schroeder, N. E. Bauer Jr., and N. D. Schlosser.

2008. Review of induced molting by feed removal

and contamination of eggs with Salmonella enteri-

ca serovar Enteritidis. Vet. Microbiol. 131:215-228.

González-Gil, F., A. Le Bolloch, S. Pendleton, N.

Zhang, A. Wallis, and I. Hanning. 2012. Expression

of hilA in response to mild acid stress in Salmo-

nella enterica is serovar and strain dependent. J.

Food Sci. 77: M292-M297.

Goodman, B.L., R.A. Norton Jr., and O.H. Diambra.

1986. Zinc oxide to induce molt in layers. Poultry

Sci. 65: 2008-2014.

Guard-Petter, J. 2001. The chicken, the egg and Sal-

monella Enteritidis. Environ. Microbiol. 3: 421–430.

Gürtler, M. and K. Fehlhaber. 2004. Growth of Sal-

monella Enteritidis in yolk from eggs laid by im-

munized hens. Int. J. Food Microbiol. 90: 107–113.

Gutierrez, O., C. Zhang, D.J. Caldwell, J. B. Carey,

A.L. Cartwright, and C.A. Bailey. 2008. Guar meal

diets as an alternative approach to inducing molt

and improving Salmonella Enteritidis resistance in

late-phase laying hens. Poultry Sci. 87:536–540.

Ha, S.D., K.G. Maciorowski, F.T. Jones, Y.M. Kwon, and

S.C. Ricke. 1998a. Survivability of indigenous feed

microflora and a Salmonella typhimurium marker

strain in poultry feed treated with buffered propi-

onic acid. Anim. Feed Sci. Technol. 75:145-155.

Ha, S.D., K.G. Maciorowski, Y.M. Kwon, F.T. Jones,

and S.C. Ricke. 1998b. Indigenous feed microflora

and Salmonella typhimurium marker strain survival

in poultry feed with varying levels of protein. Anim.

Feed Sci. Technol. 76: 23-33.

Hamada, S., T. Horikoshi, T. Minami, S. Kawabata,

J. Hiraoka, T. Fujivara, and T. Ooshima. 1991. Oral

passive immunization against dental caries in rats

by use of egg yolk antibodies specific for cell-as-

sociated glucosytransferase of Streptococcus mu-

tanus. Infect. Immun. 59: 4161-4167.

Hamal, K.R., S.C. Burgess, I.Y. Pevzner, and G.F. Erf.

2006. Maternal antibody transfer from dams to

their egg yolks, egg whites, and chicks in meat

lines of chickens. Poultry Sci. 85:1364–1372.

Hanning, I., J.D. Nutt, and S.C. Ricke. 2009. Salmo-

nellosis outbreaks due to fresh produce: Sources

and potential intervention measures. Foodborne

Pathogens and Dis. 6: 635-648.

Hazlewood, G.P., M.K. Theodorou, A. Hutchings,

D.J. Jordan, and G. Galfre. 1986. Preparation and

characterization of monoclonal antibodies to a Bu-

tyrivibrio sp. and the identification of rumen bu-

tyrivibrios, using an enzymelinked immunosorbent

assay. J. Gen. Microbiol. 132: 43–52.

Heo, S.A., R. Nannapaneni, M.G. Johnson, J.S. Park,

and K.H. Seo. 2009. Production and characteriza-

tion of a monoclonal antibody to Campylobacter

jejuni. J. Food Protect. 72: 870-875.

Heo, S. A., R. Nannapaneni, R. Story, and M.G. John-


son. 2007. Characterization of new hybridoma

clones producing monoclonal antibodies reactive

against both live and heat-killed Listeria monocy-

togenes. J. Food Sci. 72: pp M 8-M15.

Herrera, P., C.A. O’Bryan, P.G. Crandall, and S.C.

Ricke. 2012. Growth response of Salmonella en-

terica Typhimurium in co-culture with ruminal bac-

terium Streptococcus bovis is influenced by time of

inoculation and carbohydrate substrate. Food Res.

Int. 45: 1054-1057.

Herrera, P., Y.M. Kwon, K.G. Maciorowski, and S.C.

Ricke. 2009. Ecology and pathogenicity of gastro-

intestinal Streptococcus bovis. Anaerobe 15: 44-54.

Herrera, P., R.C. Burghardt, H.J. Huebner, and T.D.

Phillips. 2004. The efficacy of sand-immobilized

organoclays as filtration bed materials for bacteria.

Food Microbiol. 21:1-10.

Holley, R.A. and M. Proulx. 1986. Use of egg washwa-

ter pH to prevent survival of Salmonella at moder-

ate temperatures. Poultry Sci. 65: 922 - 928.

Holt, P.S. 2003. Molting and Salmonella Enterica se-

rovar Enteritidis infection: The problem and some

solutions. Poultry Sci. 82:1008–1010.

Holt J.G. 1994. Genus Streptococcus. In: D.H. Ber-

gey J.G. Holt N.R. Krieg, and P.H. Sneath, (Eds.).

Bergey’s Manual of Determinative Bacteriology.

Baltimore, MD: Lippincott Williams & Wilkins, Bal-

timore, MD; p. 523.

Holt, P.S. 1999. Chapter 33. Impact of induced molt-

ing on immunity and Salmonella enterica serovar

Enteritidis infection in laying hens. pp. 367-375 In:

A.M. Saeed, R.K. Gast, M.E. Potter, and P.G. Wall

(eds.) Salmonella enterica Serovar Enteritidis in

humans and animals-Epidemiology, pathogenesis,

and control. Iowa State University Press, Ames, IA.

Horrocks, S.M., R.C. Anderson, D.J. Nisbet, and S.C.

Ricke. 2009. Incidence and ecology of Campylo-

bacter in animals. Anaerobe 15:18-25.

Howard, Z.R., C.A. O’Bryan, P.G. Crandall, and S.C.

Ricke. 2012. Salmonella Enteritidis in shell eggs:

Current issues and prospects for control. Food

Res. Int. 45:755-764.

Hume, M.E., L.F. Kubena, T.S. Edrington, C.J. Dons-

key, R.W. Moore, S.C. Ricke, and D.J. Nisbet. 2003.

Poultry digestive microflora diversity as indicated

by denaturing gradient gel electrophoresis. Poul-

try Sci. 82:1100-1107.

Humphrey, T.J. 1999. Chapter 18. Epidemiology of

Salmonella enteric serovar Enteritidis. Pages 183–

192 in Salmonella enterica serovar Enteritidis in hu-

mans and animals—Epidemiology, pathogenesis,

and control. A. M. Saeed, R. K. Gast, M. E. Potter,

and P. G.Wall, ed. Iowa State University Press, Ames.

Humphrey, T.J., A. Baskerville, H. Chart, B. Rowe, and

A. Whitehead. 1991. Salmonella Enteritidis PT4 in-

fection in specific pathogen free hens: Influence of

infecting dose. Vet. Rec. 129:482-485.

Humphrey, T.J., A. Baskerville, S. Mawer, B. Rowe,

and S. Hopper. 1989. Salmonella Enteritidis phage

type 4 from the contents of intact eggs: A study in-

volving naturally infected hens. Epidemiol. Infect.

103:415-423.

Jarquin, R., I. Hanning, S. Ahn, and S.C. Ricke. 2009.

Development of rapid detection and genetic

characterization of Salmonella in poultry breeder

feeds. Sensors 9: 5308-5323.

Jones, B.A., R.E. Muck and S.C. Ricke. 1991. Selection

and application of Streptococcus bovis as a silage

inoculant. Appl. Environ. Microbiol. 57:3000-3005.

Jones, F.T. and S.C. Ricke. 2003. Observations on the

history of the development of antimicrobials and

their use in poultry feeds. Poultry Sci. 82: 613-617.

Juven, B.J., N.A. Cox, J.S. Bailey, J.E Thomson, O.W.

Charles, and J.V. Shutze. 1984. Survival of Salmo-

nella in dry food and feed. J. Food Prot. 47:45-48.

Karlsson, M., H. Kollberg, and A. Larsson. 2004.

Chicken IgY: Utilizing the evolutionary advantage.

World’s Poultry Sci. J. 60:341–347.

Kassaify, Z.G. and Y. Mine. 2004. Effect of food pro-

tein supplements on Salmonella Enteritidis infec-

tion and prevention in laying hens. Poultry Sci.

83:753–760.

Keshavarz, K. and F. W. Quimby. 2002. An investiga-

tion of different molting techniques with an empha-

sis on animal welfare. J. Appl. Poult. Res. 11:54-67.

Kim, W.K., P. H. Patterson, J. C. Rodriguez-Lecompte,

and S. C. Ricke. 2013. The potential to reduce

poultry nitrogen emissions with specific uricase

egg yolk feed grade antibodies. World’s Poultry

Sci. J. 69: 45-55.


Kim, W.K and P.H. Patterson. 2003. Production of an

egg yolk antibody specific to microbial uricase and

its inhibitory effects on uricase activity. Poultry Sci.

82:1554-1558.

Kimball, J.W. 1983. Introduction to immunology, Mac-

millan Publishing Co., Inc., New York, NY, 532 pgs.

Kingsley, V.V. and J.F.M. Hoeniger. 1973. Growth,

structure, and classification of Selenomonas. Bac-

teriol. Rev. 37:479-521.

Kinner, J.A. and W.A. Moats. 1981. Effect of Tem-

perature, pH, and detergent on survival of bacteria

associated with shell eggs. Poultry Sci. 60:761-767.

Knape, K.D., J.B. Carey, and S.C. Ricke. 2001. Com-

parison of chlorine with an iodine based com-

pound on eggshell surface Salmonella typhimuri-

um and S. enteritidis populations in a commercial

egg washer. J. Environ. Sci. Health, B36: 219-227.

Knape, K.D., J.B. Carey, R.P. Burgess, Y.M. Kwon, and

S.C. Ricke. 1999. Comparison of chlorine with an

iodine based compound on eggshell surface mi-

crobial populations in a commercial egg washer. J.

Food Safety 19:185-194.

Koo, O.K., S.A. Sirsat, P.G. Crandall, and S.C. Ricke.

2012. Physical and chemical control of Salmonella

in ready-to-eat products. Agric., Food, Anal. Bac-

teriol. 2:56-68.

Kovacs-Nolan, J., and Y. Mine. 2004. Avian egg an-

tibodies: Basic and potential applications. Avian

Poult. Biol. Rev. 15:25–46.

Kowalczyk, K., J. Daiss, J. Halpern, and T. F. Roth.

1985. Quantitation of maternal-fetal IgG transport

in the chicken. Immunology 54:755–762.

Kramer, T. T., and H. C. Cho. 1970. Transfer of immu-

noglobulins and antibodies in the hen’s egg. Im-

munology 19:157–167.

Kuo, F.-L., Y.M. Kwon, J.B. Carey, and S.C. Ricke.

2000. Current concepts in antibacterial compounds

for sanitizing hatching eggs-A review. Recent Re-

search Developments in Microbiology Vol. 4 (Part

1, Research Signpost, Trivandrum, India): 371-386.

Kuo, F.-L., J.B. Carey, and S.C. Ricke. 1997a. UV ir-

radiation of shell eggs: Effect on populations of

aerobes, molds, and inoculated Salmonella ty-

phimurium. J. Food Prot. 60:639-643.

Kuo, F.-L., Y.M. Kwon, J.B. Carey, B.M. Hargis, D.P.

Krieg, and S.C. Ricke. 1997b. Reduction of Salmo-

nella contamination on chicken egg shells by a

peroxidase-catalyzed sanitizer. J. Food Sci. 62:873-

874, 884.

Kuo, F.-L., S.C. Ricke, and J.B. Carey. 1997c. Shell

egg sanitation- UV radiation and egg to effectively

reduce populations of aerobes, yeasts, and molds.

J. Food Prot. 60:694-697.

Kuo, F.-L., J.B. Carey, S.C. Ricke, and S.D. Ha. 1996.

Peroxidase catalyzed chemical dip, egg shell sur-

face contamination, and hatching. J. Appl. Poultry

Res. 5:6-13.

Kwon, Y.M. and S.C. Ricke (Eds.), 2011. High-

Throughput Next Generation Sequencing: Meth-

ods and Applications. Methods in Molecular Mi-

crobiology 733 - Springer Protocols, Humana

Press, New York, NY 308 pp.

Kwon, Y.M. and S.C. Ricke. 1999. Salmonella ty-

phimurium poultry isolate growth response to pro-

pionic acid and sodium propionate under aerobic

and anaerobic conditions. Int. Biodeterioration

and Biodegradation 43:161-165.

Kwon, Y.M. and S.C. Ricke. 1998. Induction of acid

resistance of Salmonella typhimurium by exposure

to short-chain fatty acids. Appl. Environ. Microbiol.

64:3458-3463.

Kwon, Y.M., S.Y. Park, S.G. Birkhold, and S.C. Ricke.

2000. Induction of resistance of Salmonella ty-

phimurium to environmental stresses by exposure

to short-chain fatty acids. J. Food Sci. 65:1037-1040.

Lancefield, R.C. 1933. A serological differentiation

of human and other groups of hemolytic strepto-

cocci. J. Exp. Med. 57:571–95.

Leclair, K., H. Heggart, M. Oggel, F.M. Bartlett, and

R.C. McKellar. 1994. Modelling the inactivation of

Listeria monocytogenes and Salmonella typhimuri-

um in simulated egg wash water. Food Microbiol.

11:345-353.

Lee, L.N., D. Saxena and G. Stotzky. 2003. Activity

of free and clay-bound insecticidal proteins from

Bacillus thuringiensis subsp. israelensis against the

mosquito Culex pipiens. Appl Environ Microbiol

69:4111-4115.

Li, H., H. Wang, J.Y. D’Aoust, and J. Maurer. 2013.

Chapter 10- Salmonella species. In: M.P. Doyle and


R.L. Buchanan (Eds.), Food Microbiology – Funda-

mentals and rontiers, Fourth edition, American Soc.

Micobiol. Press, Washington, D.C., pp. 225–261.

Li, X., T. H.H. Nakano, H.H. Sunwoo, B.H. Paek, H.S.

Chae, and J.S. Sim, 1998. Effects of egg yolk and

yolk weights on yolk antibody (IgY) production in

laying chickens. Poultry Sci. 77: 266-270.

Lösch, U., I. Schranner, R. Wanke, and L. Jurgens.

1986. The chicken egg, an antibody source. J. Vet-

erinary Med. Series B 33: 609-619.

Macario, A.J.L. and E. Conway de Macario (Eds.)

1985. Monoclonal Antibodies Against Bacteria.

Academic Press, Inc., New York, NY.

Maciorowski, K.G., P. Herrera, F.T. Jones, S.D. Pillai,

and S.C. Ricke. 2006. Cultural and immunological

detection methods for Salmonella spp. in animal

feeds- A review. Vet. Res. Comm. 30:127-137.

Maciorowski, K.G., S.D. Pillai, F.T. Jones, and S.C.

Ricke. 2005. Polymerase chain reaction detection

of foodborne Salmonella spp. in animal feeds. Crit.

Rev. Microbiol. 31:45-53.

Maciorowski, K.G., F.T. Jones, S.D. Pillai, and S.C.

Ricke. 2004. Incidence and control of food-borne

Salmonella spp. in poultry feeds- A review. World’s

Poultry Sci. J. 60: 446-457.

Maggio, E.T. (Ed.) 1980. Enzyme Immunoassay, CRC

Press, Inc., Boca Raton, FL.

Malkinson, M. 1965. The transmission of passive im-

munity to Escherichia coli from mother to young in

the domestic fowl (Gallus domesticus). Immunol.

9:311-316.

Marquardt, R. R., L. Z. Jin, K. Jung-Woo, L. Fang, A.

A. Frohlich, and S. K. Baidoo. 1999. Passive protec-

tive effect of egg-yolk antibodies against entero-

toxigenic Escherichia coli K88+ infection in neo-

natal and early weaned piglets. FEMS Immunol.

Med. Microbiol. 23:283–288.

Mårtensson, A.M., J.-G. Gustafssont , and H.D.

Ljunggren. 1984. A modified, highly sensitive en-

zyme-linked immunosorbent assay (ELISA) for Rhi-

zobium meliloti strain identification. J. Gen. Micro-

biol. 130:241-253.

McCormick, C. C, and D. L. Cunningham, 1984a. High

dietary zinc and fasting as methods of forced resting:

A performance comparison. Poult. Sci. 63:1201-1206.

McCormick, C. C, and D. L. Cunningham, 1984b.

Forced resting by high dietary zinc: Tissue zinc ac-

cumulation and reproductive organ weight chang-

es. Poult. Sci. 63:1207-1212.

McKee, S.R., Y.M. Kwon, J.B. Carey, A.R. Sams, and

S.C. Ricke. 1998. Comparison of a peroxidase-cat-

alyzed sanitizer with other egg sanitizers using a

laboratory-scale sprayer. J. Food Safety 18:173-183.

McReynolds, J.L., R.W. Moore, L.F. Kubena, J.A.

Byrd, C.L. Woodward, D.J. Nisbet, and S.C. Ricke.

2006. Effect of various combinations of alfalfa and

standard layer diet on susceptibility of laying hens

to Salmonella Enteritidis during forced molt. Poult.

Sci. 85:1123-1128.

McReynolds, J., L. Kubena, J. Byrd, R. Anderson, S.

Ricke and D. Nisbet. 2005. Evaluation of Salmonel-

la Enteritidis (SE) in molting hens after administra-

tion of an experimental chlorate product (for nine

days) in the drinking water and feeding an alfalfa

molt diet. Poult. Sci. 84:1186-1190.

Milillo, S.R., E. Martin, A. Muthaiyan and S.C. Ricke.

2011. Immediate reduction of Salmonella enterica

serotype Typhimurium following exposure to mul-

tiple-hurdle treatments with heated, acidified or-

ganic acid salt solutions. Appl. Environ. Microbiol.

77:3765-3772.

Milillo, S.R. and S.C. Ricke. 2010. Synergistic reduc-

tion of Salmonella in a model raw chicken media

using a combined thermal and organic acid salt in-

tervention treatment. J. Food Sci. 75: M121-M125.

Millot, G., 1979. Clay. Scientific American. 240:109-118.

Mims, C.A. 1976. The pathogenesis of infectious dis-

ease, Academic Press, London, UK, 246 pp.

Mine, Y., and J. Kovacs-Nolan. 2002. Chicken egg

yolk antibodies as therapeutics in enteric infectious

disease: A review. J. Medicinal. Food 5:159–169.

Minnich, S.A., P.A. Hartman, and R.C. Heimsch. 1982.

Enzyme immunoassay for detection of salmonellae

in foods. Appl. Environ. Microbiol. 43: 877-883.

Mierendorf, Jr., R.C. and R.L. Dimond. 1983. Func-

tional heterogeneity of monoclonal antibodies

obtained using different screening assays. Anal.

Biochem. 135:221-229.

Moore, R.W., S.Y. Park, L.F. Kubena, J.A. Byrd, J.L.

McReynolds, M.R. Burnham, M.E. Hume, S.G.


Birkhold, D.G. Nisbet, and S.C. Ricke. 2004. Com-

parison of zinc acetate and propionate addition on

gastrointestinal tract fermentation and susceptibil-

ity of laying hens to Salmonella Enteritidis during

forced molt. Poultry Sci. 83:1276-1286.

Mumma, G.A., P.M. Griffin, M.I. Meltzer, C.R. Braden,

and R.V. Tauxe, R. V. 2004. Egg quality assurance

programs and egg-associated Salmonella Enteriti-

dis infections, United States. Emerging Infect. Dis.

10:1782-1789.

Murray, C.J., 2000. Chapter 16 - Environmental as-

pects of Salmonella. In Salmonella In Domestic

Animals, C. Wray and A. Wray (Eds.). pp. 265-283.

Wallingford, UK: CABI Publishing.

Nannapaneni, R., R. Story, A.K. Bhunia, and M.G.

Johnson. 1998a. Unstable expression and thermal

instability of a species-specific cell surface epitope

associated with a 66 kDa antigen recognized by mo-

noclonal antibody EM-7G1 within serotypes of Liste-

ria monocytogenes grown in nonselective and selec-

tive broths. Appl. Environ. Microbiol. 64:3070-3074.

Nannapaneni, R., R. Story, A.K. Bhunia, and M.G.

Johnson. 1998b. Reactivities of genus-specific

monoclonal Antibody EM-6E11 against Listeria

species and serotypes of Listeria monocytogenes

grown in nonselective and selective broth media.

J. Food Prot. 61:1195-1998.

Nisbet, D.J., D.E. Corrier, S.C. Ricke, M.E. Hume, J.A.

Byrd II, and J.R. DeLoach. 1996. Cecal propionic

acid as a biological indicator of the early establish-

ment of a microbial ecosystem inhibitory to Salmo-

nella in chicks. Anaerobe 2:345-350.

Nisbet, D.J., D.E. Corrier, S.C. Ricke, M.E. Hume, J.A.

Byrd II, and J.R. DeLoach. 1996. Maintenance of the

biological efficacy in chicks of a cecal competitive-

exclusion culture against Salmonella by continu-

ous-flow fermentation. J. Food Prot. 59:1279-1283.

Norberg, L.M., J.L. McReynolds, W.-K. Kim, V.I. Cha-

lova, D.J. Nisbet, and S.C. Ricke. 2010. Coloniza-

tion and pathogenesis of foodborne Salmonella

in egg - laying hens. pp. 63-84 In: Perspectives on

Food Safety Issues of Food Animal Derived Foods,

S.C. Ricke and F.T. Jones (eds.) University of Arkan-

sas Press, Fayetteville, AR.

O’Bryan, C.A., P.G., Crandall, P.G. and S.C. Ricke.

2008. Organic poultry pathogen control from farm

to fork. Foodborne Pathog. Disease 5:709-720.

O’Farrely, C.D., D. Branton, and C.A. Wanke. 1992.

Oral ingestion of egg yolk immunoglobulin from

hens immunized with an enterotoxigenic E. coli

strain prevents diarrhea in rabbits challenged with

the same strain. Infect. Immun. 60:2593-2597.

Orlans, E. 1967. Fowl antibody. VIII. A comparison

of natural, primary and secondary antibodies to

erythrocytes in hen sera; their transmission to yolk

and chick. Immunology 12:27-37.

O’Sullivan, M.J. 1984. Chapter 3. Enzyme immunoas-

say. pp. 37-69. In W.R. Butt (Ed.) Practical Immuno-

assy – The State of the Art. Marcel Dekker, New

York, NY.

Owusu-Asiedu, A., C. M. Nyachoti, S. K. Baidoo, R. R.

Marquardt, and X. Yang. 2003. Response of early-

weaned pigs to an enterotoxigenic Escherichia coli

(K88) challenge when fed diets containing spray-

dried porcine plasma or pea protein isolate plus

egg yolk antibody. J. Anim. Sci. 81:1781–1789.

Owusu-Asiedu, A., S.K. Baidoo, C.M. Nyachoti, and

R.R. Marquardt. 2002. Response of early-weaned

pigs to spray-dried poricine or animal plasma-

based diets supplemented with egg-yolk anti-

bodies aganst enterotoxigenic Escherichia coli. J.

Anim. Sci. 80:2895-2903.

Park, S.H., I. Hanning, A. Perrota, B. J. Bench, E. Alm,

and S. C. Ricke. 2013. Modifying the gastrointesti-

nal ecology in alternatively raised poultry and the

potential for molecular and metabolomic assess-

ment. Poultry Sci. 92:546–561.

Park, S.Y., C.L. Woodward, L.F. Kubena, D.J. Nisbet,

S.G. Birkhold, and S.C. Ricke. 2008. Environmental

dissemination of foodborne Salmonella in prehar-

vest poultry production: Reservoirs, critical factors

and research strategies. Critical Rev. Environmen-

tal Sci. Technol. 38:73-111.

Park, S.Y., S.G. Birkhold, L.F. Kubena, D.J. Nisbet,

and S.C. Ricke. 2004a. Effects of high zinc diets

using zinc propionate on molt induction, organs,

and postmolt egg production and quality in laying

hens. Poultry Science 83:24-33.

Park, S.Y., S.G. Birkhold, L.F. Kubena, D.J. Nisbet,

and S.C. Ricke. 2004b. Review on the role of dietary


zinc in poultry nutrition, immunity, and reproduc-

tion. Biological Trace Element Res. 101:147-163.

Park, S.Y.,W.K. Kim, S.G. Birkhold, L.F. Kubena, D.J.

Nisbet, and S.C. Ricke, 2004c. Induced moulting is-

sues and alternative dietary strategies for the egg

industry in the United States. World’s Poultry Sci-

ence J. 60:196-209.

Park, S.Y., W.K. Kim, S.G. Birkhold, L.F. Kubena, D.J.

Nisbet, and S.C. Ricke. 2004d. Using a feed grade

zinc propionate to achieve molt induction in lay-

ing hens and retain postmolt egg production and

quality. Biological Trace Element Res. 101:165-179.

Patrick, M.E., P.M. Adcock, T.M. Gomez, S.F. Altek-

ruse, B.H. Holland, R.V. Tauxe, and D.L. Swerdlow.

2004. Salmonella Enteritidis infections, United

States, 1985-1999. Emerg. Infect. Dis. 10:1-7.

Patterson, J.A., V.I. Chalova, R.B. Hespell, and S.C.

Ricke. 2010. Dilution rates influence ammonia as-

similating enzyme activities and cell parameters

of Selenomonas ruminantium strain D in continu-

ous (glucose-limited) culture. J. Appl. Microbiol.

108:357-365.

Patterson, R., J. S. Youngner, W.O. Weigle, and F. J.

Dixon. 1962a. The metabolism of serum proteins in

the hen and chick and secretion of serum proteins

by the ovary of the hen. J. Gen. Physiol. 45:501-513.

Patterson, R., J. S. Youngner, W.O. Weigle, and F. J.

Dixon. 1962b. Antibody production and transfer to

egg yolk in chickens. J. Immunol. 89:272-278.

Pendleton, S., I. Hanning, D. Biswas, and, S.C. Ricke.

2013. Evaluation of whole genome sequencing

as a genotyping tool for Campylobacter jejuni in

comparison with pulsed-field gel electrophoresis

and flaA typing. Poultry Sci. 92:573–580.

Peralta, R.C., H. Yokoyama, Y. Ikemori, M. Kuroki, and

Y. Kodama. 1994. Passive immunization against

experimental salmonellosis in mice by orally ad-

ministratered hen egg-yolk antibodies specific for

14- kDa fimbriae of Salmonella Enteritidis. J. Med.

Microbiol. 41:29–35.

Petkar, A., W.Q. Alali, M.A. Harrison, and L.R. Beu-

chat. 2011. Survival of Salmonella in organic and

conventional broiler feed as affected by tempera-

ture and water activity. Agric. Food, Anal. Bacte-

riol. 1:175-185.

Pierce Biotechnology, Inc. (January 2006) Tech tip #5:

Attach an antibody onto glass, silica or quartz sur-

face. Publication number: TR0005.3. Available at:

www.piercenet.com/files/TR0005-Attach-Ab-glass.

pdf (Accessed: September 1, 2006.)

Pimentel, J.L. 1999. Commercial uses of avian anti-

bodies examined. Feedstuffs 71:12-19.

Pui, C.F., C. Wong, L.C. Chai, R. Tunung, P. Jeyalet-

chumi, M.S. Noor Hidayah, A. Ubong, M.G. Farina-

zleen, Y.K. Cheah, and R. Son. 2011. Salmonella: A

foodborne pathogen. Int. Food Res. J. 18: 465-473.

Rahimi, S., Z. M. Shiraz, T. Z. Salehi, M. A. K. Torshizi,

and J. L. Grimes. 2007. Prevention of Salmonella

infection in poultry by specific egg-derived anti-

body. Int. J. Poult. Sci. 6:230–235.

Ricke, S.C. 2003a. The gastrointestinal tract ecology

of Salmonella Enteritidis colonization in molting

hens. Poultry Sci. 82:1003-1007.

Ricke, S.C. 2003b. Perspectives on the use of organic

acids and short chain fatty acids as antimicrobials.

Poultry Sci. 82:632-639.

Ricke, S.C. and S.D. Pillai. 1999. Conventional and

molecular methods for understanding probiotic

bacteria functionality in gastrointestinal tracts. Crit.

Reviews Microbiol. 25:19-38.

Ricke, S.C. and D.M. Schaefer. 1996a. Growth and

fermentation responses of Selenomonas ruminan-

tium to limiting and non-limiting concentrations of

ammonium chloride. Appl. Microbiol. Biotechnol.

46:169-175.

Ricke, S.C. and D.M. Schaefer. 1996b. Nitrogen-lim-

ited growth response of ruminal bacterium Sele-

nomonas ruminantium strain D to methylamine

addition in a minimal medium. J. Rapid Methods

Automation Microbiol. 4:297-306.

Ricke, S.C. and D.M. Schaefer. 1996c. Glucose fer-

mentation and growth of Selenomonas sputigena

on a minimal medium. J. Rapid Methods Automa-

tion Microbiol. 4:173-181.

Ricke, S.C. and D.M. Schaefer. 1991. Growth inhi-

bition of the rumen bacterium Selenomonas ru-

minantium by ammonium salts. Appl. Microbiol.

Biotechnol. 36:394-399.

Ricke, S.C. and D. M. Schaefer. 1990a. Character-

ization of egg yolk antibodies for detection and


quantitation of rumen selenomonads using an en-

zyme - linked immunosorbent assay. Appl. Envi-

ron. Microbiol. 56:2795-2800.

Ricke, S.C. and D.M. Schaefer. 1990b. An ascorbate

- reduced medium for nitrogen metabolism stud-

ies with Selenomonas ruminantium. J. Microbiol.

Methods 11:219-227.

Ricke, S.C., C.S. Dunkley, and J.A. Durant. 2013a.

A review on development of novel strategies for

controlling Salmonella Enteritidis colonization in

laying hens: Fiber – based molt diets. Poultry Sci.

92:502–525.

Ricke, S.C., Khatiwara, A., and Y.M. Kwon. 2013b. Ap-

plication of microarray analysis of foodborne Sal-

monella in poultry production: A review. Poult. Sci.

(In press).

Ricke, S.C., P. Hererra, and D. Biswas. 2012a. Chap-

ter 23. Bacteriophages for potential food safety

applications in organic meat production. pp. 407-

424. In: S.C. Ricke, E.J. Van Loo, M.G. Johnson and

C.A. O’Bryan (Eds.), Organic Meat Production and

Processing. Wiley Scientific/IFT, New York, NY.

Ricke, S.C., E.J. Van Loo, M.G. Johnson and C.A.

O’Bryan (Eds.), 2012b. Organic Meat Production and

Processing. Wiley Scientific/IFT, New York, NY 444 pp.

Ricke, S.C., C.S. Dunkley, J.L. McReynolds, K.D.

Dunkley, and D.J. Nisbet. 2010. Molting in laying

hens and Salmonella infection. In: Dynamics in

Animal Nutrition. P.J. van der Aar and J. Doppen-

berg (Eds.) Wageningen Academic Publishers, Wa-

geningen, the Netherlands pp. 135-146.

Ricke, S.C., M.M. Kundinger, D.R. Miller and J.T.

Keeton. 2005. Alternatives to antibiotics: Chemical

and physical antimicrobial interventions and food-

borne pathogen response. Poult. Sci. 84:667-675.

Ricke S.C., M.E. Hume, S.Y. Park, R.W. Moore, S.G.

Birkhold, L.F. Kubena, and D.J. Nisbet. 2004. De-

naturing gradient gel electrophoresis (DGGE) as

a rapid method for assessing gastrointestinal tract

microflora responses in laying hens fed similar zinc

molt induction diets. J. Rapid Meth. Automation


Ricke, S.C., S.G. Birkhold and R.K. Gast. 2001. Chap.

46: Eggs and egg products. pp. 473-481. In: F.P.

Downes, and K. Ito (Eds.), Compendium of Meth-

ods for the Microbiological Examinations of Foods,

4th Edition. American Public Health Association,

Washington, D.C.

Ricke, S.C., S.A. Martin, and D.J. Nisbet. 1996. Ecol-

ogy, metabolism, and genetics of ruminal sele-

nomonads. Crit. Reviews Microbiol. 22:27-65.

Ricke, S.C., D.M. Schaefer, M.E. Cook and K.H. Kang.

1988. Differentiation of ruminal bacterial species

by enzyme-linked immunosorbent assay using egg

yolk antibodies from immunized chicken hens.


Rose, M. E., and E. Orlans. 1981. Immunoglobulins

in the egg, embryo and young chick. Dev. Comp.

Immunol. 5:15-20.

Russell, J.B. and P.H. Robinson. 1984. Compositions

and characteristics of strains of Streptococcus bo-

vis. J Dairy Sci 67:1525-1531.

Sahin, O., Q. Zhang, J.C. Meitzler, B.S. Harr, T.Y.

Morishita, and R. Mohan. 2001. Prevalence, anti-

genic specificity, and bactericidal activity of poul-

try anti-Campylobacter maternal antibodies. Appl.

Environ. Microbiol. 67:3951–3957.

Sanjay, G., and S. Sugunan. 2005. Immobilization of

{alpha}-amylase onto K-10 montmorillonite: char-

acterization and comparison of activity in a batch

and a fixed-bed reactor. Clay Minerals 40: 499-510.

Scallan, E., R.M. Hoekstra, F.J. Angulo, R.V. Tauxe,

M.A. Widdowson, S.L. Roy, J.L. Jones, and P.M.

Griffin. 2011. Foodborne illness acquired in the

United States—major pathogens. Emerging Infect.

Dis. 17:7-15.

Schade, R., E.G. Calzado, R. Sarmiento, P. A. Cha-

cana, J. Porankiewicz-Asplund, and H. R. Terzolo.

2005. Chicken egg yolk antibodies (IgY-technolo-

gy): A review of progress in production and use in

research and human and veterinary medicine. Al-

tern. Lab. Anim. 33:129–154.

Seo, K. H., P. S. Holt, and R. K. Gast. 2001. Com-

parison of Salmonella Enteritidis infection in hens

molted via long-term feed withdrawal versus full-

fed wheat middling. J. Food Prot. 64: 1917- 1921.

Seo, K.-H., P. S. Holt, R. K. Gast, and C.L. Hofacre. 2000.

Combined effect of antibiotic and competitive exclu-

sion treatment on Salmonella Enteritidis fecal shed-

ding in molted laying hens. J. Food Prot. 63:545–548.


Schroeder, C.M., H.K. Latimer, W.D. Schlosser, N.J.

Golden, H.M. marks, M.E. Coleman, A.T. Hogue,

E.D. Ebel, N.M. Quiring, A.-R.M. Kadry, and J.

Krause. 2006. Overview and summary of the food

safety and inspection service risk assessment for

Salmonella Enteritidis in shell eggs. Foodborne

Path. Dis. 3:403-412.

Shah, D.H., C. Casavant, Q. Hawley, T. Addwebi, D.R.

Call, and J. Guard. 2012a. Salmonella Enteritidis

strains from poultry exhibit diffential responses to

acid stress, oxidative stress, and survival in the egg

albumen. Foodborne Path. Dis. 9:258-264.

Shah, D.H., X. Zhou, H.-Y. Kim, D.R. Call, and J.

Guard. 2012b. Transposon mutagenesis of Salmo-

nella enterica serovar Enteritidis identifies genes

that contribute to invasiveness in human and

chicken cells and survival in egg albumen. Infect.

Immun. 80:4203-4215.

Siragusa, G.R. and S.C. Ricke. 2012. Chapter 20.

Probiotics as pathogen control agents for organic

meat production. In: S.C. Ricke, E.J. Van Loo, M.G.

Johnson and C.A. O’Bryan (Eds.), Organic Meat

Production and Processing. Wiley Scientific/IFT,

New York, NY pp. 331-349.

Singleton, Jr., R., J. Denis, and L.L. Campbell. 1985.

Whole-cell antigens of members of the sulfate-

reducing genus Desulfovibrio. Arch. Micobiol.

141:195-197.

Sirsat, S.A., K.M. Burkholder, A. Muthaiyan, S.E.

Dowd, A.K. Bhunia and S.C. Ricke. 2011. Effect of

sublethal heat stress on Salmonella Typhimurium

virulence. J. Appl. Microbiol. 110:813-822.

Sirsat, S.A., A. Muthaiyan, S.E. Dowd, Y.M. Kwon, and

S.C. Ricke. 2010. The potential for application of

foodborne Salmonella gene expression profiling

assays in postharvest poultry processing. pp. 195-

222. In: Perspectives on Food Safety Issues of Food

Animal Derived Foods, S.C. Ricke and F.T. Jones

(eds.) University of Arkansas Press, Fayetteville, AR.

Sirsat, S.A., A. Muthaiyan, and S.C. Ricke. 2009. An-

timicrobials for pathogen reduction in organic and

natural poultry production. J. Appl. Poult. Res.

18:379-388.

Spector, M.P. and W.J. Kenyon. 2012. Resistance and

survival strategies of Salmonella enterica to envi-

ronmental stresses. Food Res. Int. 45:455-481.

St. Louis, M.E., D.L. Morse, M.E. Potter, T.M. DeMelfi,

J.J. Guzewich, R.V. Tauxe, and P.A. Blake. 1988. The

emergence of grade A eggs as a major source of

Salmonella Enteritidis infections – New implica-

tions for the control of salmonellosis. J. Amer.

Med. Assoc. 259:2103-2107.

Sun, H., S. Chen, X. Cai, G. Xu, and L. Qu. 2013.

Correlation analysis of the total IgY level in hen se-

rum, egg yolk and offspring serum. J. Anim. Sci.

Biotechnol. 4:10.

Thiagarajan, D., A. M. Saeed, and E.K. Asem. 1994.

Mechanism of transovarian transmission of Salmo-

nella Enteritidis in laying hens, Poult. Sci. 73:89-98.

Tini, M., U.R. Jewell, G. Camenisch, D. Chilov, and

M. Gassmann. 2002. Generation and application

of chicken egg-yolk antibodies. Comp. Biochem.

Physiol. 131:569–574.

Trott , D. L., M. Yang, P. L. Utterback , C. W. Utter-

back, K.W. Koelkeback , and M. E. Cook. 2009.

Utility of spent Single Comb White Leghorn hens

for production of polyclonal egg yolk antibody. J.

Appl. Poult. Res. 18:679–689.

Vandeplas, S., R.D. Dauphin, Y. Beckers, P. Thonart,

and A. Théwis. 2010. Salmonella in chicken: Cur-

rent and developing strategies to reduce contami-

nation at farm level. J. Food Prot. 73:774-785.

Wiedemann, V., E. Linckh, R. Kühlmann, P. Schmidt,

and U. Lösch. 1991. Chicken egg antibodies for

prophylaxis and therapy of infectious intestinal

diseases. J. Vet. Med. 38:283-290.

Wiedemann, V., E. Linckh, R. Kühlman, P. Scmide,

and U. Lösch. 1990. Chicken egg antibodies for

prophylaxis and therapy of infectious intestinal

disease: In vivo tenacity in piglets with artificial je-

nunal fistula. J. Vet. Med. 37:163-172.

Wilkie, D. C., A. G. Van Kessel, T. J. Dumonceaux,

and M. D. Drew. 2006. The effect of hen-egg anti-

bodies on Clostridium perfringens colonization in

the gastrointestinal tract of broiler chickens. Prev.

Vet. Med. 74:279–292.

Woodward, C.L., Y.M. Kwon, L.F. Kubena, J.A. Byrd,

R.W. Moore, D.J. Nisbet, and S.C. Ricke. 2005. Re-

duction of Salmonella enterica serovar Enteritidis

colonization and invasion by an alfalfa diet during


molt in Leghorn hens. Poultry Sci. 84:185-193.

Yokoyama, H., R.C. Peralta, K. Umeda, T. Hashi,

F.C. Icatlo, M. Kuroki, Y. Ikemori, and Y. Kodama.

1998. Prevention of fatal salmonellosis in neonatal

calves, using orally administered chicken egg yolk

Salmonella-specific antibodies. Am. J. Vet. Res.

59:416–420.

Yolken, R.H. 1988. Nucleic acids of immunoglobu-

lins: Which are the molecular probes of the future?

Molecular Cell Probes 2: 87-96.

Yolken, R.H. 1985.Chapter 98. Solid-phase immu-

noassays for the detection of microbial antigens

in body fluids. pp. 949-957, In Edwin H. Lennette

(Ed.) Manual of Clinican Microbiology, 4th Edition.

Amer. Soc. Microbiology, Washington, D.C.

Yolken, R.H. 1982. Enzyme immunoassays for the de-

tection of infectious antigens in body fluids: Cur-

rent limitations and future prospects. Revs. Infect.

Dis. 4:35-68.

Young, C.R., D.J. Nisbet, L.H. Stanker, and J.R. De-

Loach. 1997. Production and characterization of

monoclonal antibodies to a Veillonella species

from a continuous-flow culture system of chicken

cecal bacteria. Anaerobe 3:27–34.

Zhao X, L.R. Hilliard S.J. Mechery Y. Wang R.P.

Bagwe S. Jin and W. 2004. A rapid bioassay for

single bacterial cell quantitation using bioconju-

gated nanoparticles. Proc. Nat. Acad. Sci., USA

101:15027-15032.

Zhang, S., T. Huang, R. Bridgman, and J. Weese.

2006. Development and characterization of mono-

clonal and polyclonal antibodies against Salmo-

nella enterica Typhimurium for biosensor detec-

tion. J. Food Sci. 71: M100–M104.

Ziprin, R.L., D.E. Corrier, A. Hinton, R.C. Beier, G.E.

Spates, J.R. DeLoach, and M.H. Elissalde. 1990.

Intracloacal Salmonella typhimurium infection of

broiler chickens: Reduction of colonization with

anaerobic organisms and dietary lactose. Avian

Dis. 34:749–753.




ABSTRACT

Consumption of raw sprouts have been associated with several outbreaks of foodborne diseases. Con-

taminated seeds used to produce sprouts are the main source of pathogenic microorganisms that multiply

during the sprouting process, which is favored by high moisture contents and temperatures in the optimal

range for microbial growth. The current intervention recommended by the Food and Drug Administration

to decrease seeds’ microbial load is the use of 20,000-ppm calcium hypochlorite, which produces a reduc-

tion of around 3-logarithmic cycles for Escherichia coli and Salmonella. Therefore, there is a need for new

procedures to further reduce or eliminate microorganisms in seeds used for the preparation of sprouts.

One potential treatment is the application of dry thermal treatments which have been used for decades to

reduce plant pathogens from seeds to eliminate pathogenic E. coli and Salmonella in seeds used for sprout

production while preserving seed vigor and viability. This review will discuss the potential for dry heat

treatment of seeds from the Brassicaceae and Leguminosae families to reduce contaminated pathogenic

microorganisms.

Keywords: Pathogens, dry heat, sprout seeds

INTRODUCTION

oodborne disease outbreaks associated with veg-

etables and vegetable processing continue to be

one of major sources of public health and economic

concerns associated with food systems (Hedberg

et al., 1999; Sewell and Farber, 2001; Sivavapalas-

Correspondence: Ruben Morawicki, [email protected]: +1 -479-575-2980

ingham et al., 2004; Hanning et al., 2008; 2009). Al-

though most of the primary bacterial pathogens and

viruses responsible for the majority of the foodborne

illnesses have been historically identified with a par-

ticular animal food source, such as poultry for Sal-

monella and Campylobacter (Ricke, 2003b; Park et

al., 2008; Dunkley et al., 2009; Horrocks et al., 2009;

Foley et al., 2011; Finstad et al., 2012; Ricke et al,

2013), beef for pathogenic E. coli (Anderson et al.,

2009; Callaway et al., 2013), and retail deli meats for

MINI-REVIEWPotential for Dry Thermal Treatments

to Eliminate Foodborne Pathogens on Sprout Seeds

T. Hagger1 and R. Morawicki1

1 Food Science Department, 2650 Young Ave., University of Arkansas, Fayetteville, AR



Listeria (Lungu et al., 2010; Crandall et al., 2011; Mi-

lillo et al, 2012) most of these same pathogens can

contaminate vegetable crops as well. The fact that

many vegetable products are consumed raw fur-

ther increases the risk as pathogens are capable of

growing on these raw products (Escartin et al., 1989;

Asplund and Nurmi, 1991; Abdul-Raouf et al., 1993;

Hedberg et al., 1999; Nutt et al., 2003a,b). It has also

been shown that supernatants derived from cen-

trifugation of some raw vegetables after mechani-

cal stomaching will not only support growth but

increase virulence in pathogens such as Salmonella

(2003a,b; 2004).

Part of the difficulty in assessing the impact of

potential foodborne pathogen contamination is the

multitude of routes and sources that these patho-

gens can originate from at the production as well as

the retail side (Sagoo et al., 2003; Gibson and Ricke,

2012; Neal et al., 2012b). Routes and sources of con-

tamination include manure used to fertilize fields,

aerosols from contaminated wastes, contaminated

irrigation water, contaminated wash water used dur-

ing processing, and sick humans, who handle the

produce, just to name the more extensively studied

sources (Beuchat and Ryu, 1997; Pillai and Ricke,

2002; Islam et al., 2004; Fonseca and Ravishankar,

2007; Jay et al., 2007). Raw sprouts represent one

aspect of vegetable commodity production that has

proven to be somewhat difficult to construct con-

sistently effective and comprehensive food safety

protocols for their application during production.

Sprouts are produced from seeds that are germinat-

ed in high moisture environments at temperatures

that are optimal for the development of pathogenic

bacteria. Contaminated seeds are the main source

of microorganisms during sprouts production, and

certainly, the fact that sprouts can be consumed raw

is a primary issue that promotes food borne illness-

es. However, there are limited interventions available

that have been shown effective to eliminate patho-

gens while retaining seeds vigor and germination

rate. This review will offer discussion on raw sprouts

as a source of foodborne pathogens, current control

measures, and the potential for dry heat as an alter-

native treatment of seeds.

SPROUT PRODUCTION AND FOOD-BORNE DISEASE

Sprouts are primarily consumed raw in the Unit-

ed States and are derived from numerous types of

seeds, including beans, radishes, and alfalfa. Nutri-

tionally, they are considered a good source of amino

acids, oligopeptides, fiber, vitamins, trace elements

and minerals as well as phytochemicals with pur-

ported health benefits (Marton, et al., 2010). In the

United States, sprouts are produced commercially

and by individuals using home sprouters. As the

popularity of sprouts has increased, the outbreaks of

foodborne illness related to pathogenic microorgan-

isms have presented significant challenges to the

sprout industry. Recommendations were introduced

in 1999 by the Food and Drug Administration to treat

sprout seeds with bleach (calcium hypochlorite) to

reduce pathogenic loads; however, the recommend-

ed treatment has limited effectiveness (Brooks et al,.

2001; Fett, 2002; Montville and Schaffner, 2004).

In addition, gastrointestinal illnesses from the con-

sumption of raw sprouts continue. The Centers for

Disease Control and Prevention (2012) reported a

very recent multi-state outbreak of a Shiga-toxin pro-

ducing strain of Escherichia coli (STEC) associated

with clover sprouts with a hospitalization rate of more

than 25% of those reportedly affected. This most re-

cent outbreak did not result in any known cases of

hemolytic uremic syndrome (HUS) or deaths. How-

ever, another strain of STEC on fenugreek sprouts in

Germany (in 2011) was responsible for approximate-

ly 50 deaths and 850 cases of HUS. The increasing

popularity of sprouts and the sprouting conditions

that permit a single pathogenic cell to grow to an

infective dose is very problematic, particularly for im-

mune-compromised individuals that are highly sus-

ceptible to severe complications from foodborne ill-

ness. There is no single treatment method, including

the Food and Drug Administration -recommended

chemical treatment that completely destroys all Sal-

monella and E. coli on contaminated seeds (Mont-

ville and Schaffner, 2005) therefore, the purpose of

this review is to discuss safe, non-chemical treat-

ments of sprout seeds that could be made commer-


cially-feasible and would potentially alleviate health

risks associated with sprout consumption.

PATHOGENIC BACTERIA ON SPROUTS

Although sprout-related illnesses are predomi-

nantly attributed to Salmonella spp. and enterohem-

orrhagic E. coli (serotype O157:H7), there have been

outbreaks involving other STECs, Bacillus cereus,

Listeria monocytogenes, Staphylococcus aureus,

and Aeromonas hydrophila (Bari et al., 2010). The

seeds are considered the primary source of contami-

nation with exponential growth of the microorgan-

isms throughout sprouting due to the conditions

(temperature and moisture) maintained during the

sprouting process (Figure 1), which can permit a sin-

gle viable pathogen cell to grow to an infective dose

of 2 to 3 log colony forming units (CFU)/g in only 2

days (Hu et al., 2004). Although contamination dur-

ing sprouting, irrigation, and post-harvesting is pos-

sible, the majority of cases of foodborne-illness are

attributed to contaminated seeds which is likely from

the use of contaminated irrigation water or fertilizer,

fecal contamination from animals (residing in neigh-

boring fields or wild animals with access to the seed

fields), or inadequate hygiene practices during seed

collection (National Advisory Committee on Micro-

biological Criteria for Foods (NACMCF) 1999). Addi-

tionally, treatment of the sprouts after germination is

impractical due to the delicate nature of the sprouts.

Treatment of seeds is considered more effective due

to the lower microbial load and potential problems

with bacteria located within the sprout tissues (Penas

et al., 2010) therefore elimination of the pathogens

on the seed and the maintenance of sterilized condi-

tions for growth are the most favorable preventative

methods.

Figure 1. Sprout Production Process (Adapted from NACMCF, 1999)


SOURCES OF SPROUTS

Sprouts are derived from a wide variety of seeds

including grains, beans, nuts, and various brassica

vegetables (Table 1). Although alfalfa and mung

bean sprouts are among the more well-known va-

rieties, there are numerous other legumes, such as

peanuts, soybeans, lentils, and peas that are con-

sumed as sprouts (Sproutpeople, n.d.). Other seed

sources are eclectic and range from onion to almond

to sunflower; thus, sprout consumption is diverse

which generates additional challenges in seed treat-

ments since some seeds may be more susceptible to

certain treatments. For example, mung bean seed

coats are tough and considered relatively heat resis-

tant thus less affected by heat treatment than other

seeds (Bari et al., 2010). Consequently, germination

rates of treated seeds should be evaluated on a

case-by-case basis (Bari et al., 2010).

CURRENT ANTIMICROBIAL TREATMENTS

The current recommendations by the Food and

Drug Administration for reducing pathogenic loads

on sprouts is to treat the seeds (prior to sprouting)

with 20,000 ppm Ca(OCl)2 or other approved antimi-

crobial agents (Food and Drug Administration, 1999).

The recommended treatment does not completely

eliminate the pathogenic load with a mean reduction

of only 2.81 log CFU/g and 3.21 log CFU/g for E. coli

and Salmonella, respectively (Fett, 2002; Food and

Drug Administration, 1999; Montville, and Schaff-

ner 2004). Based on a case study of an outbreak of

Table 1. Classifications and common names of sprout seeds (Adapted from Sproutpeople, n.d.)

Family Common Names

Amaranthaceae Amaranth

Amaryllidaceae Garlic chive, leek, onion

Brassicaceae/Cruciferae Broccoli, cabbage, mustard, tatsoi, arugula, mizuna, garden cress, radish

Chenopodiaceae Quinoa

Compositae Sunflower

Cucurbitaceae Pumpkin

Gramineae/Poaceae Oats, barley, millet, rye, wheat, spelt, triticale, corn

Leguminosae Peanut, garbanzo bean, soybean, lentil, alfalfa, black bean, pinto bean, pea, clover, fenugreek, adzuki bean, mung bean

Linaceae Flax

Pedaliaceae Sesame

Polygonacea Buckwheat

Rosaceae Almond

Umbelliferae Celery, dill


Salmonella Typhimurium on treated and untreated

sprout seeds, Brooks et al. (2001) concluded that the

risk of infection is only reduced but not completely

eliminated with the Food and Drug Administration

-recommended treatment. In addition, there is sig-

nificant waste generated with chlorinated water pos-

ing ecological and economic challenges for sprout

producers (Bari et al., 2010). Lastly, the majority of

raw sprout consumers are demographically classified

as health-conscience individuals that are generally

averse to chemically-treated products; thus, there is

significant interest in effective, safe, and natural ap-

proaches to the removal of E. coli and Salmonella.

Since simply washing the seeds or the sprouts with

sterilized water is insufficient to remove the patho-

gens, antimicrobial treatment is the only mechanism

to reduce the microbial load. Various physical and

chemical treatments have been applied to seeds to

enhance the chlorine efficacy, reduce the effective

chlorine dose, or to provide an alternative to the use

of chlorine altogether, but the results have been in-

consistent. This may be partly attributed to bacteria

embedded deep in crevices, naturally occurring on

the surface of certain seeds or generated by dam-

age during handling that are not readily removed

with traditional antimicrobial washes (Takeuchi and

Frank, 2000; 2001; Enomoto et al. 2002; Solomon et

al., 2002; Takeuchi et al., 2002; Wachtel et al., 2002;

Feng et al., 2007; Brandl, 2008; Gomes et al., 2009;

Kroupitski et al., 2009; Erickson, 2012; Neal et al.,

2012a). Gandhi et al., (2001) used a green fluores-

cent protein expressing Salmonella Stanley to dem-

onstrate this microorganism’s ability to penetrate

alfalfa sprout tissue. In addition, extreme conditions

can dramatically reduce seed viability so germina-

tion rates limit the extent of treatment. Sodium bi-

carbonate, trisodium phosphate, acetic acid, hydro-

gen peroxide, ethanol, commercial peroxyacetate

solutions, and acidic electrolyzed water (a solution

comprised of less than 80 mg/L free chlorine with a

high oxidation-reduction potential and a pH range

of 2.3 to 2.7) are some of the chemical treatments

evaluated over the past decade with varying results

but no single method is able to achieve the Food

and Drug Administration recommended 5-logrith-

mic reduction of all pathogens (Kim et al., 2006, Nei,

et al. 2011, Pandrangi et al., 2003). There are other

potential chemical antimicrobial treatments that

have been evaluated in other food model systems or

against pure cultures (Aldrich et al., 2011; Ganesh et

al., 2012; Muralli et al., 2012; Neal et al., 2012c). Irra-

diation, ultrasound, and pressure have also been ex-

amined under a variety of conditions for various food

systems but were generally inadequate methods to

eradicate inoculated pathogens without combining

with other treatments (Penas et al., 2010; Kim et al.,

2006; O’Bryan et al., 2008).

Overall, combining hurdles (or treatments), often

a physical and a chemical treatment, is considered

more effective than isolated treatments; however,

although combinatorial methods can dramatically

reduce microbial loads, most are incapable of fully

eliminating Salmonella and E. coli (Penas et al., 2010;

Beuchat and Scouten, 2002; Ricke, 2003b; Ricke et

al., 2005; Sirsat et al., 2009). Furthermore, selection

of antimicrobials must proceed with caution as there

is potential for cross protection among different anti-

microbials which renders the combinations less effec-

tive (Kwon et al., 2000; Sirsat et al., 2010). This has led

to the concept of using genomic screening tools to

better predict when cross protection might occur by

identifying which gene(s) or gene families are shared

for the respective microorganism to successfully re-

sist multiple antimicrobials (Sirsat et al., 2010). Ge-

nomic analysis based on transcriptome microarrays

have been applied to assess potential genetic re-

sponses in foodborne pathogens such as Salmonella

and Listeria to either external antimicrobial combina-

tions or intrinsic food properties generated during

food processing (Milillo et al., 2011, 2012; Sirsat et al.,

2011; Chalova et al., 2012). Combination treatments

are also generally cumbersome and, in some cases,

expensive so practical usage would be very limited.

THERMAL ANTIMICROBIAL TREATMENTS

The application of heat (also known as “thermo-

therapy”) to eradicate various phytopathogens from

seeds is an agronomic practice that has existed for


over a century and is used to reduce the losses at-

tributed to diseased plants (Baker, 1962). The basic

premise is that the seed can withstand slightly greater

thermal treatments than the host pathogens (fungal,

bacterial, or viral) thereby eliminating pathogens but

retaining germination capabilities of the seed (Jen-

sen, 1888; Grondeau and Samson, 1994). In modern

horticulture, treatment of seeds by hot water, dry

heat, and hot, moist air is still a practical, ecologi-

cal alternative to chemical treatments (Gilbert, 2009;

Forsberg et al., 2005; Miller and Lewis-Ivey, 2005).

The use of prolonged dry heat as opposed to hot

water or steam to reduce plant pathogen loads has

been primarily used over the last 30 years (Luthra,

1953). However, in India, the practice of controlling

loose smut (a fungal infection) in wheat by exposure

to solar radiation was successfully implemented as

early as 1929 (Luthra, 1953). In spite of the lengthier

treatment times, the application of dry heat gener-

ally causes less damage to the seed than hot water

(Grondeau and Samson, 1994; Feng et al., 2007).

Since thermotherapy of all types is still used in

horticulture to control plant pathogens, it is rea-

sonable that heat treatment of sprout seeds to kill

bacteria that are pathogenic to humans is a viable

and acceptable alternative to chemicals. Although,

outbreaks are not as common in Japan since most

sprouts are consumed in cooked dishes hot water

treatments of sprout seeds is a relatively common

practice in Japan (Bari et al., 2010). However, in the

United States, sprouts are primarily consumed raw

so the efficacy of the method to eliminate pathogen-

ic microorganisms remains under scrutiny (Bari et al.,

2010). Although several studies have evaluated hot

water treatment of seeds as a solitary treatment or in

combination with other hurdles (Table 2) (Bari et al.,

2010; Enomoto et al., 2002; Kim et al., 2006) there is

still limited and conflicting data regarding the use of

dry heat on sprout seeds. One of the initial studies

demonstrated that dry heat treatment was a highly

promising technique for mung bean seeds (Hu et al.,

2004). Even three days post-sprouting, the authors

demonstrated that the levels of inoculated E. coli

O157:H7 and Salmonella remained non-detectible

if seeds were treated at 55°C for four and five days,

respectively.

Table 2. Treatment conditions used in various studies to determine the most effective hot water treatment of seeds

Temp

(oC)Time References

55 2 d, 5 d, 10 d, 15 d, 20 dFeng et al., 2007; Beuchat and Scouten, 2002; Neetoo and Chen, 2011; Hu et al., 2004

60 24 h, 4 d, 8 d, 12 d, 15 d Neetoo and Chen, 2011; Bang et al., 2011

65 12 h, 24 h, 3 d, 6 d, 12 d Neetoo and Chen, 2011

70 2 h, 5 h, 10 h, 15 h, 24 h Neetoo and Chen, 2011; Bang et al., 2011

75 15 min, 60 min, 3 h, 6 h, 12 h Beuchat and Scouten, 2002; Neetoo and Chen, 2011

80 10 min, 60 min, 2 h, 4 h, 8 h Beuchat and Scouten, 2002; Neetoo and Chen, 2011


Although studies that have attempted to treat al-

falfa seeds with dry heat have been confounded by

the thermostability of Salmonella, there is evidence

that the method is still a viable option. Neetoo and

Chen (2011) were able to successfully reduce both

pathogens to non-detectible levels by treating the

seeds at 65°C for 10 days while maintaining germina-

tion rates greater than 90%. The lengthy treatment

was necessary due to the heat tolerance of Salmo-

nella; E. coli was eliminated after only 2 days. In con-

trast to this response, Feng et al. (2007) demonstrat-

ed that holding alfalfa seeds at 55°C for eight days

was insufficient to eliminate Salmonella with expo-

nential growth of the pathogen observed during the

three-day sprouting period. The same study dem-

onstrated, however, that a six day treatment at 55°C

very effectively controlled E. coli. The differences in

the results of the two studies are likely attributable

to the extent of heat treatment (55°C for eight days

versus 65°C for 10 days); thus, further studies are

warranted to determine optimum conditions. Addi-

tionally, there was no evidence presented by Neetoo

and Chen (2011) that damaged bacteria would not

recover and still grow on the sprouts since they only

evaluated the pathogenic load of the seeds. Inter-

estingly, a recent study by Bang et al. (2011) demon-

strated that humidity control (i.e. RH of 23%) during

heating can also permit longer heating times and

higher temperatures with minimal effects on ger-

mination; therefore, the implementation of humid-

ity control during dry heating may ensure complete

elimination of the more recalcitrant bacteria.

Although the use of dry heat alone as a means

to control bacterial pathogens has not been exten-

sively evaluated, dry heat has been combined with

several different treatments with relatively good

outcomes including various chemical (sodium hypo-

chlorite, chlorine dioxide, ethanol, phytic acid, ox-

alic acid) and physical (radiation, pressure) hurdles

(Bang et al, 2011; Kim et al, 2010; Neetoo and Chen,

2011; Bari et al, 2009). In general, the primary interest

in using combinatorial techniques is to reduce the

length of time necessary to treat the seeds with the

dry heat. For example, although Neetoo and Chen

(2011) were able to control pathogens with dry heat

alone, they also demonstrated that high hydrostatic

pressure applied after heat treatment reduced the

effective dry heat application time from 10 days to 12

hours. Although the combinatorial technique was ef-

fective, the need to implement pressure treatments

would be significantly more laborious for seed farm-

ers and would require additional equipment and

supplies. Ideally, dry heat treatments alone would be

a preferred method, but the efficacy of treatments

needs to be systematically evaluated and optimized

for each seed type to reduce losses in germination

and retain non-detectible levels of pathogens in

sprouts.

CONCLUSIONS

Sprouts continue to be a source for foodborne

disease outbreaks when consumed raw. Microbial

contamination including foodborne pathogens oc-

curs early in sprout production primarily via contami-

nated seeds which as they sprout, support microbial

growth due to the favorable moisture and tempera-

ture conditions. To reduce microbial levels on seed

the Food and Drug Administration recommends ap-

plication of 20,000-ppm calcium hypochlorite that

will lead to a 3-logarithmic reduction of Escherichia

coli and Salmonella. To further reduce or eliminate

microorganisms and foodborne pathogens in seeds

that serve as a source of raw sprouts for human con-

sumption will require interventions that are more ef-

fective. Dry thermal treatments have been used for

decades to reduce plant pathogens from seeds and

offer a potential treatment to eliminate pathogenic

E. coli and Salmonella in seeds. However, preserva-

tion of seed vigor and viability must be retained and

unfortunately some strains of foodborne pathogens

can be somewhat heat resistant. Overcoming this

will probably require combining dry heat treatment

with some additional antimicrobial treatments to

achieve synergism in the form of a multiple hurdle

intervention approach and thus a more effective re-

duction in foodborne pathogen levels. Designing

optimal multiple hurdle intervention strategies will

require not only testing under conditions similar to


the seed environment that the foodborne pathogen

is associated with but a better understanding of the

biology and genetic responses of the microorganism

in the presence of the antimicrobials being used as

potential interventions.

REFERENCES

Abdul-Raouf, U.M., L.R. Beuchat, and M.S. Aromar.

1993. Survival and growth of Escherichia coli O157:

H7 on salad vegetables. Appl. Environ. Microbiol.

59:1999-2006.

Aldrich, H.T., L. Goodridge, M. Bunning, C. Stushnoff

and P. Kendall. 2011. Impact of calcium chloride

dip and temperature on microbial quality of or-

ganically and conventionally grown melons. Agric.

Food Anal. Bacteriol. 1:150-158.

Anderson, R.C., S.C. Ricke, B. Lungu, M.G. Johnson,

C. Oliver, S.M. Horrocks and D.J. Nisbet. 2009.

Food safety issues and the microbiology of beef.

pp. 115-145. In: Microbiologically Safe Foods, N.

Heredia, I. Wesley and S. Garcia (eds.) John Wiley

& Sons, Inc. Hoboken, NJ.

Asplund, K., and E. Nurmi. 1991. The growth of

Salmonellae in tomatoes. Int. J. Food Microbiol.

13:177-182.

Baker, K.F. 1962. Thermotherapy of planting mate-

rial. Phytopath. 52:1244-1255.

Bang, J.,H. Kim, H. Kim , L. R. Beuchat, and J. H. Ryu.

2011. Inactivation of Escherichia coli O157:H7 on

radish seeds by sequential treatments with chlo-

rine dioxide, drying, and dry heat without loss of

seed viability. Appl. Environ. Microbiol.. 77:6680-

6686.

Beuchat, L.R., and A.J. Scouten 2002. Combined

effects of water activity, temperature and chemi-

cal treatments on the survival of Salmonella and

Escherichia coli O157:H7 on alfalfa seeds. J. Appl.


Beuchat, L.R. and L.-H. Ryu. 1997. Produce handling

and processing practices. Emerging Infect. Dis.

3:459-465.

Bari, M.L., K. Enomoto, D. Nei, and S. Kawamoto.

2010. Practical evaluation of mung bean seed

pasteurization method in Japan. J. Food Protect.

73:752-757.

Bari, M.L., D. Nei , K. Enomoto, S. Todoriki, and S.

Kawamoto. 2009. Combination treatments for

killing Escherichia coli O157:H7 on alfalfa, rad-

ish, broccoli, and mung bean seeds. J. Food Prot.

72:631-636.

Brandl, M.T. 2008. Plant lesions promote the rapid

multiplication of Escherichia coli O157:H7 on post-

harvest lettuce. Appl. Environ. Microbiol. 74:5285-

5289.

Brooks, J.T., S.Y. Rowe, P. Shillam, D.M. Heltzel, S.B.

Hunter, L. Slutsker, R.M. Hoekstra, and S.P. Luby.

2001. Salmonella typhimurium infections transmit-

ted by chlorine-pretreated clover sprout seeds.

Am. J. Epid. 154:1020-1028.

Callaway, T.R. T. S. Edrington, G. H. Loneragan, M. A.

Carr, and D.J. Nisbet. 2013. Shiga toxin-producing

Escherichia coli (STEC) ecology in cattle and man-

agement based options for reducing fecal shed-

ding. Agric. Food Anal. Bacteriol. 3:39-69.

Center for Disease Control (CDC). Multistate out-

break of shiga toxin-producing Escherichia coli

026 infections linked to raw clover sprouts at Jim-

my John’s restaurants. http://www.cdc.gov/eco-

li/2012/O26-02-12/index.html.

Chalova, V.I., O. Hernández-Hernández, A. Muthaiyan,

S.A. Sirsat, S. Natesan, M.L. Sanz, F. Javier Moreno,

C.A. O’Bryan, P.G. Crandall, and S.C. Ricke. 2012.

Growth and transcriptional response of Salmonella

Typhimurium LT2 to glucose-lysine-based Maillard

reaction products generated under low water activ-

ity conditions. Food Res. Int. 45:1044-1053.

Duffy, E.A., L. Cisneros-Zevallos, A. Castillo, S.D. Pil-

lai, S.C. Ricke, and G.R. Acuff. 2005. Survival of Sal-

monella transformed to express green fluorescent

protein on Italian parsley as affected by processing

and storage. J. Food Prot. 68:687-695.

Dunkley, K.D., T.R. Callaway, V.I. Chalova, J.L.

McReynolds, M.E. Hume, C.S. Dunkley, L.F. Kube-

na, D.J. Nisbet, and S.C. Ricke. 2009. Foodborne

Salmonella ecology in the avian gastrointestinal

tract. Anaerobe 15:26-35.

Enomoto, K., T. Takizawa, N. Ishikawa, and T. Suzuki.

2002. Hot-water treatments for disinfecting al-


falfa seeds inoculated with Escherichia coli ATCC

25922. Food Sci. Technol. Res. 8:247-251.

Erickson, M.C. 2012. Internalization of fresh pro¬duce

by foodborne pathogens. Ann. Rev. Food Sci.

Technol. 3:283–310.

Escartin, E.F., A.C. Ayala, and J.S. Lozano. 1989. Sur-

vival and growth of Salmonella and Shigella on

sliced fresh fruit. J. Food Prot. 52: 471-472.

Feng, G., J.J. Churey, and R. W. Worobo. 2007. Ther-

mal inactivation of Salmonella and Escherichia

coli O157:H7 on alfalfa seeds. J. Food Protect.

70:1698-1703.

Fett, W.F. 2002. Reduction of Escherichia coli 0157:H7

and Salmonella spp. on laboratory-inoculated

mung bean seed by chlorine treatment. J. Food

Protect. 65:848-852.

Finstad, S., C.A. O’Bryan, J.A. Marcy, P.G. Crandall,

and S.C. Ricke. 2012. Salmonella and broiler produc-

tion in the United States: relationship to foodborne

salmonellosis. Food Res. Int. 45:789-794.

Foley, S., R. Nayak, I.B. Hanning, T.L. Johnson, J.

Han, and S.C. Ricke. 2011. Population dynamics of

Salmonella enterica serotypes in commercial egg

and poultry production. Appl. Environ. Microbiol.

77:4273-4279.

Fonseca, J.M. and S. Ravishankar. 2007. Contaminat-

ed fruits and vegetables and more common than

ever. Why? And what can consumers do to protect

themselves? Am. Sci. 95:494-501.

Food and Drug Administration (FDA). 1999. Guid-

ance for industry: Reducing microbial food safety

hazards for sprouted seeds and guidance for in-

dustry: Sampling and microbial testing of spent ir-

rigation water during sprout production. . Docket

Nos: 99D-4488; 99D-4489(64 (7)):57893-57902.

Gandhi, M., S. Golding, S. Yaron, and K.R. Matthews.

2001. Use of green fluorescent protein expressing

Salmonella Stanley to investigate survival, spatial

location, and control on alfalfa sprouts. J. Food

Prot. 64:1891-1898.

Ganesh, V., N.S. Hettiarachchy, C.L. Griffis, E.M. Martin,

and S. C. Ricke. 2012. Electrostatic spraying of food-

grade organic and inorganic acids and plant extracts

to decontaminate Escherichia coli O157:H7 on spin-

ach and iceberg lettuce. J. Food Sci. 77:M391-M396.

Gilbert, J., S.M. Woods, T.K. Turkington, and A.

Tekauz. 2005. Effect of heat treatment to control

Fusarium graminearum in wheat seed. Can. J.

Plant Pathol. 27:448-452.

Gomes, C., P. Da Silva, R. G. Moreira, E. Castell-

Perez, E. A. Ellis, and M. Pendleton. 2009. Under-

standing E. coli internalization in lettuce leaves for

optimization of irradiation treatment. Int. J. Food

Microbiol. 135:238-247.

Grad, Y.H., M. Lipsitch, M. Feldgarden, H.M. Arach-

chi, G.C. Cerqueira, , M. FitzGerald, P. Godfrey,

B.J. Haas, C.I. Murphy, C. Russ, S. Sykes, B.J Walk-

er, J.R. Wortman, S. Young, Q. Zeng, A. Abouel-

leil, J. Bochicchio, S. Chauvin, T. DeSmet, S. Gu-

jja, C. McCowan, A. Montmayeur, S. Steelman,

J. Frimodt-Moller, A.M. Petersen, C. Struve, K.A.

Krogfelt, E. Bingen, F.X. Weill, E.S. Lander, C. Nus-

baum, B.W. Birren, D.T. Hung, and W. P. Hanage.

2012. Genomic epidemiology of the Escherichia

coli O104:H4 outbreaks in Europe, 2011. Proc. Nat.

Acad. Sci.109 :3065-3070.

Grondeau, C. and R. Samson. 1994. A review of ther-

motherapy to free plant materials from pathogens,

especially seeds from bacteria. Crit. Rev. Plant Sci.

13:57-75.

Hanning, I., J.D. Nutt, and S.C. Ricke. 2009. Salmo-

nellosis outbreaks due to fresh produce: Sources

and potential intervention measures. Foodborne

Pathog. Dis. 6:635-648.

Hanning, I., M.G. Johnson, and S.C. Ricke. 2008.

Pre-cut lettuce pre-packaged lettuce: A risk for lis-

teriosis? Foodborne Pathog. Dis. 5:731-746.

Hedberg, C.W., F.J. Angulo, K.E. White, W. Langko-

po, W. L. Schell, M. G. Stobierskf, A. Schuchat, J. M.

Besser, S. Dietrich, L. Helsel, P.M. Griffin, J.W. Mc-

Farland, and M.T. Osterhom., and The Investigation

Team. 1999. Outbreaks of salmonellosis associated

with eating uncooked tomatoes: implications for

public health. Epidemiol. Infect. 122:385-393.

Horrocks, S.M., R.C. Anderson, D.J. Nisbet, and S.C.

Ricke. 2009. Incidence and ecology of Campylo-

bacter in animals. Anaerobe 15:18-25.

Hu, H., J.J. Churey and R.W. Worobo. 2004. Heat

treatments to enhance the safety of mung bean

seeds. J. Food Prot. 67:1257-1260.


Islam, M., M.P. Doyle, S. C. Phatak, P. Millner, and

X. Jiang. 2004. Persistence of enterohemorrhagic

Escherichia coli O157:H7 in soil and on leaf let-

tuce and parsley grown in fields treated with con-

taminated manure composts or irrigation water. J.

Food Prot. 67:1365–1370.

Jay, M.T., M. Cooley, D. Carychao, G. W. Wiscomb,

R. A. Sweitzer, L. Crawford-Miksza, J.A. Farrar, D. K.

Lau, J.O’Connell, A. Millington, R. V. Asmundson,

E.R. Atwill, and R.E. Mandrell. 2007. Escherichia

coli O157:H7 in feral swine near spinach fields and

cattle, central California coast. Emerging Infect.

Dis. 13:1908-1911.

Jensen, J.L. 1888. The propagation and prevention

of smut in oats and barley. J. Royal Agric. Soc. Eng-

land 49:397-415.

Kim, H., H. Kim, J. Bang, L.R. Beuchat, and J. Ryu.

2010. Synergistic effect of chlorine dioxide and

drying treatments for inactivating Escherichia coli

O157:H7 on radish seeds. J. Food Prot. 73:1225-

1230.

Kim, H.J., H. Feng, M.M. Kushad, and F. Xuetong.

2006. Effects of ultrasound, irradiation, and acidic

electrolyzed water on germination of alfalfa and

broccoli seeds and Escherichia coli O157:H7. J.

Food Prot. 71:168-173.

Kroupitski, Y., D. Golberg, E. Belausiv, R. Pinto,

D. Swatzberg, D. Granot, and S. Sela. 2009.

Internal¬ization of Salmonella enterica in leaves

is induced by light and involves chemotaxis and

penetration through open stomata. Appl. Environ.

Microbiol. 75: 6076-6086.

Kwon, Y.M., S.Y. Park, S.G. Birkhold, and S.C. Ricke.

2000. Induction of resistance of Salmonella ty-

phimurium to environmental stresses by exposure

to short-chain fatty acids. J. Food Sci. 65:1037-

1040.

Lungu, B., S.C. Ricke, and M.G. Johnson. 2010. Oc-

currence of Listeria monocytogenes in raw and

ready-to-eat foods and food-processing envi-

ronments and intervention strategies for control.

pp. 129-152 In: Perspectives on Food Safety Is-

sues of Food Animal Derived Foods, S.C. Ricke

and F.T. Jones (eds.) University of Arkansas Press,

Fayetteville, AR.

Luthra J. 1953. Solar energy treatment of wheat

loose smut (Ustilago tritici (pers.) rostr.). Indian

Phytopath. 6:49-56.

Marton, M., Z. Mandoki, Z. Csapo-Kiss, and J. Csapo.

2010. The role of sprouts in human nutrition. A re-

view. Acta Univ Sapientiae, Alimentaria. 3:81-117.

Millilo, S.R., C.A. O’Bryan, E.M. Shannon, M.G.

Johnson, P.G. Crandall, and S.C. Ricke. 2012. En-

hanced inhibition of Listeria monocytogenes by a

combination of cold pressed terpeneless Valencia

orange and antibiotics. Foodborne Pathog. Dis.

9:370-372.

Milillo, S.R., E. Martin, A. Muthaiyan and S.C. Ricke.

2011. Immediate reduction of Salmonella enterica

serotype Typhimurium following exposure to mul-

tiple-hurdle treatments with heated, acidified or-

ganic acid salt solutions. Appl. Environ. Microbiol.

77: 3765-3772.

Miller, S.A., and M.L. Lewis-Ivey. 2005. Hot water and

chlorine treatment of vegetable seeds to eradicate

bacterial plant pathogens. Hyg. 3085-05.

Montville, R. and D. Schaffner. 2004. Analysis of pub-

lished sprout seed sanitization studies shows treat-

ments are highly variable. J. Food Prot. 67:758-

765.

Montville R. and D. Schaffner. 2005. Monte Car-

lo simulation of pathogen behavior during the

sprout production process. App Environ. Micro-

biol.71:746-753.

Murali, N., G. S. Kumar-Phillips, N.C. Rath, J. Marcy

and M. F. Slavik. 2012. Antibacterial activity of plant

extracts on foodborne bacterial pathogens and

food spoilage bacteria. Agric. Food Anal. Bacte-

riol. 2:209-221.

National Advisory Committee on Microbiological

Criteria for Foods (NACMCF). 1999. Microbiologi-

cal safety evaluations and recommendations on

sprouted seeds. Int. J. Food Microbiol. 52:123-153.

Neal, J.A. E. Cabrera-Diaz, and A. Castillo. 2012a. At-

tachment of Escherichia coli O157:H7 and Salmo-

nella on spinach (Spinacia oleracea) using confocal

microscopy. Agric. Food Anal. Bacteriol. 2:275-279.

Neal, J.A., M. Dawson, and J. M. Madera. 2012b.

Food safety for a diverse workforce; One size does

not fit all. Agric. Food Anal. Bacteriol. 2:46-55.


Neal, J.A., M. Marquez-Gonzalez, E. Cabrera-Diaz,

L.M. Lucia, C. O’Bryan, P.G. Crandall, S.C. Ricke

and A. Castillo. 2012c. Comparison of multiple

chemical sanitizers for reducing Escherichia coli

O157:H7 and Salmonella on spinach (Spinacia ol-

eracea) leaves. Food Res. Int. 45:1123-1128.

Neetoo, H., and H. Chen. 2011. Individual and com-

bined application of dry heat with high hydrostatic

pressure to inactivate Salmonella and Escherichia

coli O157:H7 on alfalfa seeds. Food Microbiol.

28:119-127.

Nei, D., B.M. Latiful, K. Enomoto, Y. Inatsu, and S.

Kawamoto. 2011. Disinfection of radish and alfalfa

seeds inoculated with Escherichia coli O157:H7

and Salmonella by a gaseous acetic acid treat-

ment. Foodborne Pathog. Dis. 8:1089-1094.

Nutt, J.D., C.L. Woodward, L.F. Kubena, D.J. Nisbet,

Y.M. Kwon, and S.C. Ricke. 2004. Potential for rapid

in vitro assays to measure foodborne Salmonella

virulence in foods - A review. J. Rapid Meths. Auto.


Nutt, J.D., X. Li, I.B. Zabala Díaz, C.L. Woodward, and

S.C. Ricke. 2003a. Development of a microtiter-

based assay for assessment of virulence response of

Salmonella Typhimurium exposed to fresh produce

extracts. J. Rapid Meth. Autom. Microbiol. 11:1-9.

Nutt, J.D., X. Li, I.B. Zabala Diaz, C.L. Woodward, and

S.C. Ricke. 2003b. Growth kinetics response of a

Salmonella typhimurium marker strain to fresh pro-

duce extracts. Bioresource Technol. 89:313-316.

Nutt, J.D., S.D. Pillai, C.L. Woodward, K.L. Sternes,

I.B. Zabala Díaz, Y.M. Kwon, and S.C. Ricke. 2003c.

Use of a Salmonella Typhimurium hilA fusion strain

to assess effects of environmental fresh water

sources on virulence gene expression. Water Re-

search 37:3319-3326.

O’Bryan, C.A., P.G. Crandall, S.C. Ricke, and D.G. Ol-

son. 2008. Impact of irradiation on the safety and

quality of poultry and meat products: A review.

Crit. Rev. Food Sci. Nutr. 48:442-447.

Pandrangi, S., M.W. Elwell, R.C. Anantheswaran, and

L.F. LaBorde. 2003. Efficacy of sulfuric acid scari-

fication and disinfectant treatments in eliminating

Escherichia coli O157:H7 from alfalfa seeds prior to

sprouting. J. Food Sci. 68:613-618.

Penas, E., R. Gomez , J. Frias, and C. Vidal-Valverde.

2010. Effects of combined treatments of high pres-

sure, temperature and antimicrobial products on

germination of mung bean seeds and microbial

quality of sprouts. Food Control 21:82-88.

Park, S.Y., C.L. Woodward, L.F. Kubena, D.J. Nisbet,

S.G. Birkhold, and S.C. Ricke. 2008. Environmental

dissemination of foodborne Salmonella in prehar-

vest poultry production: Reservoirs, critical factors

and research strategies. Critical Rev. Environmen-

tal Sci. Technol. 38:73-111.

Pillai, S.D. and S.C. Ricke. 2002. Aerosols from mu-

nicipal and animal wastes: Background and con-

temporary issues, Can. J. Microbiol. 48: 681-696.

Ricke, S.C. 2003a. The gastrointestinal tract ecology

of Salmonella Enteritidis colonization in molting

hens. Poultry Sci. 82:1003-1007.

Ricke, S.C. 2003b. Perspectives on the use of organic

acids and short chain fatty acids as antimicrobials.

Poultry Sci. 82:632-639.

Ricke, S.C., C.S. Dunkley, and J.A. Durant. 2013. A

review on development of novel strategies for

controlling Salmonella Enteritidis colonization in

laying hens: Fiber – based molt diets. Poultry Sci.

92:502–525.

Ricke, S.C. , M.M. Kundinger, D.R. Miller and J.T.

Keeton. 2005. Alternatives to antibiotics: Chemical

and physical antimicrobial interventions and food-

borne pathogen response. Poult. Sci. 84:667-675.

Sagoo, S.K. C. L. Little, and R. T. Mitchell. 2003. Mi-

crobiological quality of open ready-to-eat salad

vegetables: Effectiveness of food hygiene training

of management. J. Food Prot. 66:1581–1586.

Sewell, A.M. and J. M. Farber. 2001. Foodborne out-

breaks in Canada linked to produce. J. Food Prot.

64:1863–1877.

Sirsat, S.A., K.M. Burkholder, A. Muthaiyan, S.E.

Dowd, A.K. Bhunia and S.C. Ricke. 2011. Effect of

sublethal heat stress on Salmonella Typhimurium

virulence. J. Appl. Microbiol. 110:813-822.

Sirsat, S.A., A. Muthaiyan, S.E. Dowd, Y.M. Kwon,

and S.C. Ricke. 2010. The potential for applica-

tion of foodborne Salmonella gene expression

profiling assays in postharvest poultry process-

ing. pp. 195-222. In: Perspectives on Food Safety


Issues of Food Animal Derived Foods, S.C. Ricke

and F.T. Jones (eds.) University of Arkansas Press,

Fayetteville, AR.

Sirsat, S.A., A. Muthaiyan, and S.C. Ricke. 2009. An-

timicrobials for pathogen reduction in organic and

natural poultry production. J. Appl. Poultry Res.

18:379-388.

Sivavapalasingham, S., C. R. Friedman, L. Cohen,

and R.V. Tauxe. 2004. Fresh Produce: A growing

cause of outbreaks of foodborne illness in the

United States, 1973 through 1997. J. Food Prot.

67:2342–2353.

Solomon, E. B., S. Yaron, and K. R. Matthews. 2002.

Transmission of Escherichia coli O157:H7 from con-

taminated manure and irrigation water to lettuce

plant tissue and its subsequent internaliza¬tion.


Sproutpeople. Sprouting seed taxonomy. http://

sproutpeople.org/sprouts/grow/taxonomy.html.

Takeuchi, K., and J. F. Frank. 2001. Quantitative

de¬termination of the role of lettuce leaf struc-

tures in protecting Escherichia coli O157:H7 from

chlorine disinfection. J. Food Prot. 64:147-151.

Takeuchi, K., and J. F. Frank. 2000. Penetration of

Escherichia coli O157:H7 into lettuce tissues as

affected by inoculum size and temperature and

the effect of chlorine treatment on cell viability. J.

Food Prot. 63:434-440.

Takeuchi, K., C. M. Matute, A. N. Hassan, and J. F.

Frank. 2000. Comparison of the attachment of

Escherichia coli O157:H7, Listeria monocytogenes,

Salmonella Typhimurium, and Pseudomonas fluore-

scens to lettuce leaves. J. Food Prot. 63:1433-1437.

Wachtel, M. R., L. C. Whitehand, and R. E. Mandrell.

2002. Association of Escherichia coli O157:H7

with preharvest leaf lettuce upon exposure to

contami¬nated irrigation water. J. Food Prot.

65:18-25.

Weiss, A., and W.P. Hammes. 2003. Thermal seed

treatment to improve the food safety status of

sprouts. J. Appl. Bot. 77:152-155.




ABSTRACT

Secretion of heterologous proteins using Bacillus species is a well-established system, but inefficient

translocation of the proteinacross the plasma membrane is a problem with these expression hosts. A recent

study demonstrated that the prepropeptide of Staphylococcus hyicus lipase enhanced the secretion of het-

erologous proteins in B. subtilis. In the study reported here, prepropeptides of S. hyicus lipase, B. subtilis

nprE, and B. megaterium nprM were investigated by using hydrolase from T. fusca (Tfh) and E. coli alkaline

phosphatase PhoA as models. The results indicate that the secreted Tfh and PhoA activities were lower

when the proteins fused with propeptides, compared to those without propeptides. Only propeptide S.

hyicus lipase protected Propionibacterium acnes linoleic acid isomerase from proteolytic degradation and

did not impede the translocation. However, no activity of isomerase was detectable. Linoleic acid isomer-

ase was subjected to matrix-assisted laser desorption ionization time-of-flight mass spectrometryand it was

discovered that the propeptide was still attached with secreted protein. In addition, the results of the pro-

peptide S. hyicus lipase fused with B. subtilis nprE demonstrated that enzymatic activities were interfered

with by the attached propeptide S. hyicus lipase.

Keywords: Heterologous protein, Bacillus subtilis, Bacillus megaterium, Bacillus licheniformis, pre-

propeptide, Staphylococcus hyicus

INTRODUCTION

Heterologous protein production in bacterial sys-

tems, particularly Escherichia coli, is economical due

Correspondence: Suwat Saengkerdsub, [email protected]

to the ability of bacteria to grow rapidly and yield

high cell concentrations on inexpensive substrates

(Terpe, 2006). However, inclusion body formation,

incorrect protein folding, and inefficient bond for-

mation may occur during intracellular production in

E. coli (Schallmey et al., 2004) . Using Bacillus species

as the host is an alternative way to produce heterolo-

Suitability of Various Prepeptides and Prepropeptides for the Production and Secretion of Heterologous Proteins

by Bacillus megaterium or Bacillus licheniformis

S. Saengkerdsub1,2, Rohana. Liyanage3, Jackson Oliver Lay Jr.3

1 Center for Food Safety, and Department of Food Science, University of Arkansas, Fayetteville, AR, 727042 Department of Poultry Science, University of Arkansas, Fayetteville, AR 72701

3 State Wide Mass Spectrometry Facility, Department of Chemistry and Biochemistry, University of Arkansas, Fayetteville, AR 72701



gous proteins that are secreted into the surrounding

medium and avoids the problems associated with E.

coli (Pohl and Harwood, 2010).

Bacillus subtilis is widely used in industry to pro-

duce enzymes that are naturally produced by it as

well as by closely related species and these enzymes

are released into the growth medium in commer-

cially relevant quantities (Harwood and Cranen-

burgh, 2008). However when used for production of

heterologous proteins there may be problems with

translocating the foreign protein across the plasma

membrane, release of the protein from the cell enve-

lope into the medium, or with the correct folding of

the protein (Bolhuis et al, 1999; Kouwen et al., 2010;

Puohiniemi et al., 1992; Saunders et al., 1987).

Proteins that are destined to act outside of a cell

are taken from the site of synthesis to the cell mem-

brane with the help of pre-peptide helper proteins

(von Heijne 1990a; von Heijne 1990b). Most proteins

are translocated across the membrane in an unfold-

ed state, the signal peptide is cleaved and the pro-

tein then folded (Tjalsma et al., 2004; van Wely et al.,

2001). Many proteins are also produced with a pro-

peptide that acts as a chaperone to assist in fold-

ing and release from the plasma membrane (Sarvas

et al., 2004; Shinde and Inouye, 2000; Takagi et al.,

2001). Since these signal proteins have been opti-

mized for specific proteins in particular bacteria they

may not function as efficiently for the production of

heterologous proteins (Kouwen et al., 2010), leading

to a search for better secretion signals for heterolo-

gous proteins in organisms such as B. subtilis (Brock-

meier et al., 2006). A recent study demonstrated that

the prepropeptide of Staphylococcus hyicus lipase

enhanced the secretion of heterologous proteins in

B. subtilis (Kouwen et al., 2010) .

Bacillus megaterium in contrast to B. subtilis has

the advantage of highly stable, freely replicating

plasmids (Vary, 1994). In addition, a recent study de-

veloped expression plasmids for maximizing heter-

ologous protein production (Stammen et al., 2010).

In this study we investigated the suitability of sev-

eral prepeptides and prepropeptides for the heter-

ologous production and secretion of proteins by B.

megaterium YYBm1 and Bacillus licheniformis NRRL

B-14212. Prepropeptides from S. hyicus lipase, B.

subtilis nprE, and B. megaterium nprM were evalu-

ated for promoting heterologous secretion by us-

ing hydrolase from Thermobifida fusca and E. coli

alkaline phosphatase PhoA as models. The prepro-

peptide from S. hyicus lipase was chosen because

it had been previously demonstrated to be success-

ful for enhancing E. coli alkaline phosphatase PhoA

secretion in B. subtilis (Kouwen et al., 2010) while B.

subtilis nprE, and B. megaterium nprM are the major

extracellular proteases in B. subtilis, and B. megate-

rium, respectively.


Plasmids and bacterial growth condi-tions

Plasmids used in this study are listed in Table 1.

All B. megaterium and B. licheniform is transformed

with plasmids were grown in baffled shake flasks at

30 or 37°C in Luria-Bertani (LB) medium (BD, Franklin

Lakes, NJ), TM medium (Takara Bio Inc. USA, Moun-

tain View, CA), 2SY medium (Takara Bio Inc. USA),

Modified Plasma Broth (MPB) medium (Chiang et al.,

2010), or Modified Super Rich (MSR) medium (Chi-

ang et al., 2010) at 200 rpm. Recombinant expression

of genes under transcriptional control of the xylose-

inducible promoter was induced by the addition of

0.5% (w/v) xylose at OD578 of 0.4.

DNA manipulation for the construction of plasmids

The synthetic oligonucleotides used in this work

are listed in Table S1 in the supplemental material.

E. coli 10G (Lucigen, Middleton, WI) was used for all

cloning purposes. B. megaterium YYBm1 and B. li-

cheniformis NRRL B-14212 were used as protein pro-

duction hosts. Antibiotics were used at the following

concentrations: ampicillin, 100 µg/mL and tetracy-

cline 10 µg/mL.


Plasmid Description Source

pSSBm97 PxylA-(-35+rbs+)-prepeptideyocH-tfhStammen et al., (2010)

pPlipprepeptide of S. hyicus lipA lipase inserted into BsrGI and SpeI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptidelipA-tfh

This study

pPPlipprepropeptide of S. hyicus lipA lipase inserted into BsrGI and SpeI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptidelipA-propeptidelipA-tfh

This study

pPnprEprepeptide of B. subtilis nprE neutral protease inserted into BsrGI and SpeI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptidenprE-tfh

This study

pPPnprEprepropeptide of B. subtilis nprE neutral protease insert-ed into BsrGI and SpeI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptidenprE-propeptidenprE-tfh

This study

pPnprMprepeptide of B. megaterium nprM neutral protease inserted into BsrGI and SpeI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptidenprM-tfh

This study

pPPnprMprepropeptide of B. megaterium nprM neutral protease inserted into BsrGI and SpeI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptidenprE-propeptidenprM-tfh

This study

pCR®4-TOPO Plasmid used for cloning PCR product Invitrogen

pA97E. coli phoA alkaline phosphatase inserted into SpeI and EagI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptideyocH-PhoA

This study

pAPLE. coli phoA alkaline phosphatase inserted into SpeI and EagI sites of pPlip; PxylA-(-35+rbs+)-prepeptidelipA-PhoA

This study

pAPPLE. coli phoA alkaline phosphatase inserted into SpeI and EagI sites of pPPlip; PxylA-(-35+rbs+)-prepeptidelipA-propeptidelipA-PhoA

This study

pAPEE. coli phoA alkaline phosphatase inserted into SpeI and EagI sites of pPnprE; PxylA-(-35+rbs+)-prepeptidenprE-PhoA

This study

pAPPEE. coli phoA alkaline phosphatase inserted into SpeI and EagI sites of pPPnprE; PxylA-(-35+rbs+)-prepeptidenprE-propeptidenprE-PhoA

This study

pAPME. coli phoA alkaline phosphatase inserted into SpeI and EagI sites of pPnprM; PxylA-(-35+rbs+)-prepeptidenprM-PhoA

This study

Table 1. Plasmids used in this study


Table 1. (Continued)

Plasmid Description Source

pAPPME. coli phoA alkaline phosphatase inserted into SpeI and EagI sites of pPPnprM; PxylA-(-35+rbs+)-prepeptidenprE-propeptidenprM-PhoA

This study

pL97P. acnes linoleateisomerase inserted into SpeI and EagI sites of pSSBm97; PxylA-(-35+rbs+)-prepeptideyocH-pal

This study

pLPLP. acnes linoleateisomerase inserted into SpeI and EagI sites of pPlip; PxylA-(-35+rbs+)-prepeptidelipA-pal

This study

pLPPLP. acnes linoleateisomerase inserted into SpeI and EagI sites of pPPlip; PxylA-(-35+rbs+)-prepeptidelipA-propeptidelipA-pal

This study

pLPEP. acnes linoleateisomerase inserted into SpeI and EagI sites of pPnprE; PxylA-(-35+rbs+)-prepeptidenprE-pal

This study

pLPPEP. acnes linoleateisomerase inserted into SpeI and EagI sites of pPPnprE; PxylA-(-35+rbs+)-prepeptidenprE-propeptidenprE-pal

This study

pLPMP. acnes linoleateisomerase inserted into SpeI and EagI sites of pPnprM; PxylA-(-35+rbs+)-prepeptidenprM-pal

This study

pLPPMP. acnes linoleateisomerase inserted into SpeI and EagI sites of pPPnprM; PxylA-(-35+rbs+)-prepeptidenprE-propeptidenprM-pal

This study

pEPLB. subtilis nprE inserted into SpeI and EagI sites of pPlip; PxylA-(-35+rbs+)-prepeptidelipA-nprE

This study

pEPPLB. subtilis nprE inserted into SpeI and EagI sites of pPPlip; PxylA-(-35+rbs+)-prepeptidelipA-propeptidelipA-nprE

This study


The basic expression plasmid of this study was

pSSBm97. The oligonucleotides lipF, lipR, and lipR2

were used as primers for the PCR to amplify pre- and

prepropeptide S. hyicus lipA lipase by using oligo-

nucleotide PL1 to Pu12 as the template. For pre- and

prepropeptide B. subtilis nprE neutral protease am-

plification, the oligonucleotide nprEF, nprER, nprER2

were used as primers and B. subtilis genomic DNA

was used as the template. The oligonucleotides

nprMF, nprMR, nprMR2 were used as primers for the

PCR to amplify the pre- and prepropeptide B. mega-

terium nprM gene by using B. megaterium DSM319

as the template. Insertion of all PCR products via the

corresponding BsrGI and SpeI restriction sites led to

pPL, pPPL, pPE, pPPE, pPM, and pPPM, respectively.

The phoA gene was amplified from E. coli K12

by using primers PhoF and PhoR. The resulting PCR

product was cloned into pCR®4-TOPO and later into

pSSBm97, pPL, pPPL, pPE, pPPE, pPM, and pPPM af-

ter SpeI-EagI digestion, resulting in construction of

pA97, pAPL, pAPPL, pAPE, pAPPE, pAPM, pAPPM,

respectively.

For P. acnes linoleate isomerase, the new DNA se-

quence was designed by JCat software (http://www.

jcat.de/) (Grote et al., 2005) and was synthesized by

Integrated DNA Technologies, Coralville, IA. The li-

noleate isomerase fragment was flanked by SpeI-EagI

restriction sites, was digested with these respective

enzymes, and subsequently inserted into pSSBm97,

pPL, pPPL, pPE, pPPE, pPM, and pPPM after SpeI-

EagI digestion, creating the plasmids pL97, pLPL,

pLPPL, pLPE, pLPPE, pLPM, pLPPM, respectively.

The oligonucleotides enprEF and enprER were

used as nprE gene amplification by using B. subti-

lis genome as the template and PCR product was

cloned into pCR®4-TOPO. Insertion of the nprE PCR

products via the corresponding SpeI and EagI re-

striction sites in plasmids pPL and pPPL led to pEPL

and pEPPL, respectively. Protoplast B. megaterium

YYBm1 cells were transformed with the appropriate

expression plasmids using a polyethylene glycol-me-

diated procedure described by Christie et al.(2008)

while plasmids were transferred into B. licheniformis

NRRLB-14212 by electroporation as described in Xue

et al. (1999).

Localization of heterologous protein ex-pression

The subcellular localization of heterologous pro-

tein production was determined using the protocol

described in Kouwen et al. (2010). After separation

by SDS-PAGE, proteins were transferred to a nitro-

cellulose membraneand detected with 6X his tag

antibody (Abcam, Cambridge, MA) and horseradish

peroxidase–anti-rabbit immunoglobulin G conju-

gates.

Proteomics

Cells of B. megaterium were grown at 30°C at

200 rpm. Cells were separated from the growth me-

dium by centrifugation. The secreted proteins in the

growthmedium were collected for SDS-PAGE, gels

were stained with Coomassie Brilliant Blue, and the

respective protein bands were identified by matrix-

assisted laser desorption ionization–time of flight

mass spectrometry (MALDI-TOF MS).

Matrix-Assisted Laser Desorption Ion-ization Time-of-Flight Mass Spectrometry (MALDI-TOF-MS)

After Sephadex LH-20 cleanup, the extract was

mixed with a 1 M solution of dihydroxybenzoic acid

(DHB) in 90% methanol in a 1:1 ratio, and 1 µL of

the mixture was spotted onto a ground stainless

steel MALDI target for MALDI analysis using the dry

droplet method. A Bruker Reflex III MALDI-TOF-MS

(Billerica, MA) equipped with a N2 laser (337 nm) was

used in the MALDI analysis, and all the data were

obtained in positive ion reflectron TOF mode.

Enzymatic activity measurements

The hydrolase activity of the enzyme Tfh was mea-

sured as described by Stammen et al. (2010). The en-

zymatic release of p-nitrophenol was photometrical-

ly detected at 410 nm. One enzyme unit was defined

as the amount that caused the release of 1 µmol p-

nitrophenol per minute under the given assay condi-


tions. The enzymatic activity was calculated using a

molar absorption coefficient of 15,000 M-1 cm-1.

Alkaline phosphatase (PhoA) activity was carried

out as described by Darmon et al. (2006). Briefly,

PhoA activity was determined by measuring the rate

of p-nitrophenyl phosphate hydrolysis. Aliquots of

fractions were mixed with freshly prepared substrate

and incubated at room temperature for 10 to 30 min,

and the reactions were stopped by addition of 2 M

NaOH. The PhoA activity, expressed in U/ml/unit of

optical density at 600 nm (OD600), was determined by

measuring changes in the optical density at 405 nm

as a function of the time of incubation (in minutes)

and the OD600. To do this, the following formula was

used: [2/3 × (OD405× 352)]/(t × OD600), where t is the

time of incubation.

Protease activity was measured as described by

Mansfeld and Ulbrich-Hofmann (2007). One unit of

proteolytic activity was defined as the amount of

enzyme yielding an increase of 0.001 per min in the

optical density at 275 nm at 30°C under standard re-

action conditions. Linoleate isomerase activity was

carried out as described by Peng et al. (2007) . The

preparation of fatty acid methyl esters (FAME) was

described in Lewis et al. (2000) and FAME was de-

tected by GC with tridecanoic acid as the internal

standard. Analyses of the FAME were performed

with a Hewlett Packard 5890 GC equipped with a

50 m x 0.32 mm internal diameter cross-linked HP5

methyl silicone (0.17 µm film thickness) fused-silica

capillary column and flame ionization detector.

Figure 1. Secretion of active Tfh. Strain YYBm1 without plasmid was used as a negative control. Samples were taken 6 hours after the xylose supplement. The activities are expressed in U/mL. a,b,cMeans within the same sample measurements with unlike superscripts (P < 0.05). Error bars indicate standard deviations between enzyme activities detected for each construct.

0.0000

0.5000

1.0000

1.5000

2.0000

2.5000

3.0000

YYBm1 SSBm97 PL PPL PE PPE PM PPM

Tfh

acti

vity

(U/m

l)

a

b

b, c

cc c c

c


Statistical analyses

Where standard deviations are presented in the

respective figures, these values represent the aver-

age of at least triplicate measurements. The statisti-

cal tests for treatment effects were performed using

an analysis of variance (ANOVA) procedure of Statis-

tica 9.1 Analytical Software (SAS Institute, Cary, NC).

Means were further separated using least-significant

difference multiple comparisons.

RESULTS

Fusion of Tfh and PhoA with prepro-peptides from S. hyicus lipase, B. subtilis nprE, and B. megaterium nprM

Kouwen et al. (2010) demonstrated that the pre-

propeptide of S. hyicus lipase enhanced the secre-

tion of PhoA in B. subtilis. The prepropeptides of B.

subtilis nprE and B. megaterium nprM were chosen

because both are major extracellular proteases in

these organisms. In this study, all plasmids originat-

ed from pSSBm97 (Stammen et al., 2010). Plasmid

pSSBm97 contains an optimal the -35 region and the

ribosome-binding site, enhancing heterologous pro-

duction in B. megaterium YYBm1 (Stammen et al.,

2010).

The secreted amounts of active Tfh were assessed

by measuring hydrolase activity in growth medium of

cells containing the seven different prepropeptides

(Figure 1). Analysis of the medium fractions showed

that the highest Tfh activity was detected in growth

medium of cells carrying yocH as the prepeptide

(pSSBm97), while the levels of Tfh activity were lower

Figure 2. Secretion of active PhoA. Strain YYBm1 without plasmid was used as a negative control.Samples were taken 6 hours after the xylose supplement. The activities are expressed in U/mL/OD600. a,b Means within the same sample measurements with unlike superscripts (P < 0.05). Error bars indicate standard deviations between enzyme activities detected for each construct.

0

500

1000

1500

2000

2500

3000

YYBm1 A97 APL APPL APE APPE APM APPM

Pho

A a

ctiv

ity

(U/m

l/O

D60

0)

a

a

a

a

a

a

bb


Figure 3. Secretion of linoleate isomerase in B. megaterium. Cells carrying plasmids were cul-tured in LB at 37°C and were collected at 6 hours after xylose induction. Proteins from 3 mL of cell-free supernatants from B. megaterium cultures carrying plasmids were precipitated with trichloroacetic acid. Samples were used for SDS-PAGE and Western blotting. The 6X His tag anti-body was used to detect the proteins.

Figure 4. Total cell samples of linoleate isomerase in B. megaterium. Cells carrying plasmids were cultured in LB at 37°C and were collected at 6 hours after xylose induction. Proteins from 50 µL of cells were collected by centrifugation. Samples were used for SDS-PAGE and Western blot-ting. The 6X His tag antibody was used to detect the proteins.


Figure 5. Secretion and subcellular localization of linoleate isomerase in B. megaterium. Cells carrying pLPPL were cultured in LB at 37°C and were collected at 6 hours after xylose induction. The sample was divided into medium, total cells, cell walls, protoplasts. Protoplasts were incubated for 30 min in the presence of 1 mg/mL of trypsin with or without 1% Triton X-100. Samples were used for SDS-PAGE and Western blotting, and 6X His tag antibody was used to detect the proteins. (Note: medium fraction was from 6 mL culture while other fractions were from 75µL culture).

Figure 6. Secretion of linoleate isomerase in B. megaterium. Cells carrying pLPPL were cultured in LB, 2SY, TM, MPB, and MSR media at 37°C and were collected at 6 hours after xylose induction. Pro-teins from 6 mL of cell-free supernatants from B. megaterium cultures carrying plasmids were precipi-tated with trichloroacetic acid. Samples were used for SDS-PAGE and Western blotting. The 6X His tag antibody was used to detect the proteins. (Note: all samples were originated from 6 mL culture).


(P < 0.05) in the medium of cells expressing other

prepropeptides. Surprisingly, the levels of active Tfh

in the medium of cells expressing prepropeptide S.

hyicus lipase and B. subtilis nprE were significantly

lower than those cells containing only prepeptides.

For secreted PhoA levels in B. megaterium, seven

prepropeptides were fused with PhoA at the N-ter-

minus. Analysis of the medium fractions showed that

the levels of PhoA of cells expressing prepropep-

tides were lower than cells expressing only their pair

prepeptides (Figure 2); however, the levels between

their pair prepeptides and prepropeptides were not

significantly different. In this case, the lowest level of

active PhoA in the medium fraction was cells carry-

ing yocH as prepeptide (pA97).

Linoleate isomerase production in B. megaterium and B. licheniformis

Linoleate isomerase in P. acnes is the enzyme that

isomerizes the double bond at the C9 position in lin-

oleic acid (c9,c12, 18:2) to form t10,c12 conjugated

linoleic acid (Deng et al., 2007). The conjugated lin-

oleic acids have been demonstrated to exhibit anti-

cancer, anti-diabetic, and immune-enhancing prop-

erties (Pariza, 2004). This gene was expressed in E.

coli BL21 (DE3) as the host; unfortunately, the recom-

binant enzyme formed an inclusion body (Deng et al.,

2007). Secreted protein production might solve the

formation of insoluble protein inclusion bodies from

intracellular accumulations (Schallmey et al., 2004).

The major goal of this investigation was extracellu-

lar linoleate isomerase production by B. megaterium

and B. licheniformis. By using the 6X His tag antibody

detection, only cells expressing prepropeptide S.

hyicus lipase produced linoleate isomerase (Figure

3). To analyze whether the lack of P. acnes linoleate

isomerase production after fusions with prepropep-

tides, except with prepropeptide S. hyicus lipase,

was due to a failure in secretion or to instability of

the protein, the total cell samples were probed with

the 6X his tag-specific antibody (Figure 4). Only a dis-

tinct band from B. megaterium carrying pLPPL was

observed, suggesting that the protein was reason-

ably stable. No corresponding protein occurred in

the other cells with prepropeptides, indicating that

these proteins were less stable.

To observe the efficiency of translocation across

the protoplast membrane, the cells expressing pre-

propeptide S. hyicus lipase fused with linoleate isom-

erase were divided into medium, total cell, cell wall,

protoplast, protoplast incubated with trypsin, and

protoplast incubated with trypsin and Triton X-100

fractions. The proteins from medium, total cell, cell

wall, and protoplast fractions were all the same size

(Figure 5), representing no processing of translocat-

ed linoleate isomerase after crossing the membrane.

The protein in protoplasts was degraded when add-

ing trypsin, suggesting that the protein was effec-

tively translocated across the protoplast membrane.

In order to maximize linoleate isomerase produc-

tion, the cells carrying pLPPL were cultured under

various conditions. The results from the 6X His tag

antibody detection showed that MPB enhanced

more linoleate isomerase production than other me-

dia (Figure 6). In addition, a different set of forms of

linoleate isomerase larger than the major band could

represent an aggregated form of linoleate isomer-

ase or linoleate isomerase bound to other proteins.

In addition to the major protein from cells culturing

in MSR medium, minor bands of lower mass reacted

with the antibody, suggesting that they represented

shortened species of the fusion protein. By cultur-

ing at 37°C in MPB medium, the supernatant of cells

expressing prepropeptide S. hyicus lipase exhibited

smear bands, indicating proteolytic degradation,

compared to supernatant from cells cultured at 30°C

(Figure 7). The 6X His tag antibody detection showed

that the linoleateisomerase was initially detectable 4

hours and increased production up to 8 hoursafter

xylose addition (Figure 8). After 8 hours induction,

the amounts of protein were reduced due to possible

proteolytic degradation.

To observe linoleate isomerase activity, B. mega-

terium YYBm1 carrying pLPPL was cultured in MPB

medium and the supernatant was collected at 8

hours after xylose addition. The supernatant was

incubated with linoleate as described in Peng et al.

(2007). FAME was prepared as described in Lewis et

al. (2000); however, no activity was detected.


Figure 7. Secretion of linoleate isomerase in B. megaterium. Cells carrying pLPPL were cultured in MPB medium at 30 and 37°C and were collected at 6 hours after xylose induction. Proteins from 4.5 mL of cell-free supernatants from B. megaterium cultures carrying plasmids were precipitated with trichloroacetic acid. Samples were used for SDS-PAGE and Western blotting. The 6X His tag anti-body was used to detect the proteins. (Note: both samples were originated from 4.5 mL culture).

Figure 8. Secretion of linoleate isomerase in B. megaterium. Cells carrying pLPPL were cultured in MPB medium at 30°C and were collected at 0, 4, 6, 8, 10, 15, and 20 hours after xylose induction. Proteins from 4.5 mL of cell-free supernatants from B. megaterium cultures carrying plasmids were precipitated with trichloroacetic acid. Samples were used for SDS-PAGE and Western blotting. The 6X His tag antibody was used to detect the proteins. (Note: all samples were originated from 4.5 mL culture).


Since no activity was found when B. megaterium

YYBm1 was used as the host, B. licheniformis and B.

subtilis were chosen due to their abilities to secrete

large quantities of extracellular enzymes (Schallmey

et al., 2004). The plasmids L97 to pLPPL were trans-

ferred into B. licheniformis NRRL B-14212 by elec-

troporation; however, plasmid pLPPE transformation

was unsuccessful. Unfortunately, no plasmid trans-

formations were successful in B. subtilis. B. licheni-

formis carrying these plasmids were cultured in LB

medium at 37°C and the supernatant was collected

at 6 hours after xylose supplement; unfortunately, no

protein was detected by using the 6X His tag anti-

body.

Protease production in B. megaterium

Since prepropeptide S. hyicus lipase fusion im-

peded Tfh (Figure 1) and PhoA activities (Figure 2)

but supported secreted linoleate isomerase pro-

duction (Figure 3), B. subtilis nprE gene was chosen

for the further evaluation of this propeptide on se-

creted protein in B. megaterium. By measuring ac-

tive protease in the medium fractions collected from

B. megaterium expressing pre- and prepropeptide

S. hyicus fused with nprE gene, the results showed

that the secreted NprE did not require propeptide

for translocation; however, its activity was inhibited

by the propeptide fusion (Figure 9). In addition, the

Figure 9. Secretion of active protease. Strain YYBm1 without plasmid was used as a negative control. Samples were taken 6 hours after the xylose supplement. The activities are expressed in U/mL. a,b Means within the same sample measurements with unlike superscripts (P < 0.05). Error bars indi-cate standard deviations between enzyme activities detected for each construct.

0

10

20

30

40

50

60

70

YYBm1 EPL EPPL

Pro

teas

eac

tivi

ty(U

/mL)

a

b

b


results from the secreted NprE proteins detected by

the 6X His tag antibody showed that cells express-

ing prepropeptide S. hyicus lipase produced a larger

form than proteins from cells expressing prepeptide

(data not shown).

Peptide analysis by MALDI-TOF MS

B. megaterium carrying pLPPL was cultured in MPB

medium at 30°C and the sample was collected at 8

hours after xylose induction. The major protein band

in SDS-PAGE was excised and digested with trypsin.

Subsequently, the peptide sample was analyzed by

MALDI-TOF MS. From the peptide mass fingerprint

obtained from the MALDI-TOF MS (Figure 10), the

intense peaks were selected and subjected to MS/

MS ion search. The MS/MS data were analyzed both

by running MASCOT (http://www.matrixscience.

com) as well as manual analysis in order to identify

the protein. MS/MS spectra were searched with GPS

software using 95% confidence interval threshold (P

< 0.05), with which a minimum Mascot score of > 61

was considered imperative for further analysis. From

the peptide analysis, the results demonstrated that

propeptide S. hyicus lipase was still attached with

the linoleate isomerase (Figure 11).

DISCUSSION

In this study, two enzymes,Tfh and PhoA, were

chosen to be model proteins to study the influence

of prepropeptides on export efficiency in B. megate-

rium. Tfh has been shown to be successful for gener-

ating secreted protein in B. megaterium YYBm1 up

to 7,200 U per liter (Stammen et al., 2010). PhoA from

E. coli was the other model protein because it con-

tains two disulfide bonds which is one of the limita-

tions for heterologous production in Bacillus species

(Kouwen and van Dijl, 2009).

From Tfh and PhoA activity measurement, the re-

sults showed that prepeptide yocH and prepeptide

nprE were the best choices for secreted protein pro-

duction. Currently, every secreted heterologous pro-

tein requires prepeptide optimization (Brockmeier

et al., 2006). In some cases, the efficiency of het-

Figure 10. A typical peptide mass fingerprint of trypsin digested proteins from B. megaterium carry-ing pLPPL.


erologous protein secretion with each prepeptide

depends on each strain. By comparing between two

strains of B. lichniformis, most prepeptides, except

SacC, showed related secretion efficiency (Degering

et al., 2010). Surprisingly, the Tfh and PhoA activities

in medium of three-pair propeptide addition were

lower compared to the cells proteins expressing

without propeptides.

Linoleate isomerase is the enzyme for modifying

linoleic acid to conjugated linoleic acids which are

anti-carcinogenic compounds (Deng et al., 2007).

This enzyme formed inclusion bodies when express-

ing in E. coli BL21 (DE3) (Deng et al., 2007) . The goal

of this investigation was to secrete active linoleate

isomerase in B. megaterium. Sturmfels et al. (2001)

demonstrated propeptide lipase was necessary for

human growth hormone translocation process at S.

carnosus membrane and Kouwen et al. (2010) dem-

onstrated that propeptide S. hyicus lipase signifi-

cantly enhanced the secretion of PhoA by B. subtilis.

In general, heterologous proteins are vulnerable

to wall-associated proteases during the slow pro-

tein-folding process (Braun et al., 1999). The results

in this study demonstrated that the propeptide pro-

tected linoleate isomerase from proteolytic degra-

dation in B. megaterium cells. Demleitner and Gotz

(1994) reported that the second half of this propep-

tide maintained lipase stability in S. carnosus cells

and proposed that the heterologous protein without

propeptide was degraded in intracellular or at the

Figure 11. Amino acid sequences of prepropeptide S. hyicus lipase and P. cenes linoleate isomerase in plasmid LPPL. The underlines show the amino acid sequences obtained from MALDI-TOF MS results.

Prepeptide sequenceM K E T K H Q H T F S I R K S A Y G A A S V M V A S C I F V I G GG V A E A

Propeptide sequenceN D S T T Q T T T P L E V A Q T S Q Q E T H T H Q T P V T S L H T A T P E H V D D S K E A T P L P E K A E S P K T E V T V Q P S S H T Q E V P A L H K K T Q Q Q P A Y K D K T V P E S T I A S K S V E S N K A T E N E M S P V E H H A S N V E K R E D R L E T N E T T P P S V D R E F S H K I I N N T H V N P K T D G Q T N V N V D T K T I D T V S P K D D R I D T A Q P K Q V D V P K E N T T A Q N K F T S Q A S D K K P T

Linoleate isomerase sequenceM S I S K D S R I A I I G A G P A G L A A G M Y L E Q A G F H D Y T I L E R T D H V G G K C H S P N Y H G R R Y E M G A I M G V P S Y D T I Q E I M D R T G D K V D G P K L R R E F L H E D G E I Y V P E K D P V R G P Q V M A A V Q K L G Q L L A T K Y Q G Y D A N G H Y N K V H E D L M L P F D E F L A L N G C E A A R D L W I N P F T A F G Y G H F D N V P A A Y V L K Y L D F V T M M S F A K G D L W T W A D G T Q A M F E H L N A T L E H P A E R N V D I T R I T R E D G K V H I H T T D W D R E S D V L V L T V P L E K F L D Y S D A D D D E R E Y F S K I I H Q Q Y M V D A C L V K E Y P T I S G Y V P D N M R P E RL G H V M V Y Y H R W A D D P H Q I I T T Y L L R N H P D Y A D K T Q E E C R Q M V L D D M E T F G H P V E K I I E E Q T W Y Y F P H V S S E D Y K A G W Y E K V E G M Q G R R N T F Y A G E I M S F G N F D E V C H Y S K D L V T R F F V


membrane site during translocation. Kouwen and

van Dijl (2009) proposed that the propeptide might

function like a chaperone to form protein correctly,

and therefore the enzyme was not degraded inside

the cells. Meens et al. (1997) concluded that the

propeptide facilitates the release of unfolded pro-

teins from the translocase and/or passage through

the cell wall, protecting them from proteases at the

membrane-cell wall interface.

In this study, MPB medium appeared to maximize

linoleate isomerase production, similar to Rluc pro-

duction in B. subtilis (2011). When the host cells Ba-

cillus subtilis grew on the MSR medium, production

of recombinant protein Rluc was unsuccessful. A de-

tectable amount of Rluc was found when B. subtilis

growing on MPB medium. It should be noted that

the composition of the MSR and MPB media are sim-

ilar except that glucose in the former is substituted

with casamino acid in the latter. It suggests that the

nitrogen source instead of carbon is favorable for

the production of Rluc by B. subtilis.

The results of linoleate isomerase activity, NprE

activity, NprE detection by the 6X His tag antibody,

peptide analysis of by MALDI-TOF MS showed that

the propeptide was still attached with the enzymes

and might inhibit enzyme activities. In S. hyicus, the

prepeptide is cleaved after the propeptide-enzyme

complex is released into the culture medium (Sar-

vas et al., 2004). The propeptide is subsequently

removed by a metalloprotease, and full enzymatic

activity is achieved (Sarvas et al., 2004; Yabuta et al.,

2001). Ayora et al.(1994) demonstrated that ShpII,

a neutral metalloprotease in S. hyicus, is necessary

for the propeptide removal. The propeptide-PhoA

complex produced by B. subtilis 168 (trpC2) showed

that the propeptide was removed when the complex

was released into the medium (Kouwen et al., 2010);

however, the propeptide-OmpA complex produced

by B. subtilis DB104 (his, nprR2, nprE18, ΔaprA3)

was unprocessed after releasing into the medium

(Meens et al., 1997). NprE is an extracellular major

metalloprotease in B. subtilis (He et al., 1991) and

might remove the propeptide from the propep-

tide-PhoA complex. From B. megaterium DSM319

genome analysis, an extracellular metalloprotease

InhA was reported (Eppinger et al, 2011); however,

the propeptide removal was not found in the study

reported here.

CONCLUSIONS

The goal of this investigation was to secrete ac-

tive linoleate isomerase in B. megaterium. While

the propeptide protected linoleate isomerase from

proteolytic degradation in B. megaterium cells,the

propeptide was still attached to the enzyme after se-

cretion and possibly inhibited enzyme activities.The

activity of secreted Tfh and PhoA were lower when

the proteins fused with propeptides, compared to

those without propeptides. Although propeptide S.

hyicus lipase protected linoleic acid isomerase from

proteolytic degradation and did not impede translo-

cation, no activity of isomerase was detectable.

ACKNOWLEDGEMENTS

We would like to thank Simon Stammen, Re-

bekka Biedendieck, and Dieter Jahn of Institute of

Microbiology, Technische Universitat Braunschweig

for providing plasmids and B. megaterium YYBm1.

We appreciate Robert Story, Center for Food Safety

and Department of Food Science, the University of

Arkansas for providing Bacillus licheniformis NRRL

B-14212.

REFERENCES

Ayora, S., P. E. Lindgren, and F. Götz. 1994. Bio-

chemical properties of a novel metalloprotease

from Staphylococcus hyicus subsp. hyicus involved

in extracellular lipase processing. J. Bacteriol.

176:3218-3223.

Bolhuis, A., H. Tjalsma, H. E. Smith, A. de Jong, R.

Meima, G. Venema, S. Bron, and J. M. van Dijl.

1999. Evaluation of bottlenecks in the late stages

of protein secretion in Bacillus subtilis. Appl. Envi-

ron. Microbiol. 65:2934 - 2941.


Braun, P., G. Gerritse, J. M. van Dijl, and W. J. Quax.

1999. Improving protein secretion by engineering

components of the bacterial translocation machin-

ery. Curr. Opin. Biotechnol. 10:376-381.

Brockmeier, U., M. Caspers, R. Freudl, A. Jockwer,

T. Noll, and T. Eggert. 2006. Systematic screening

of all signal peptides from Bacillus subtilis: a pow-

erful strategy in optimizing heterologous protein

secretion in Gram-positive bacteria. J. Mol. Biol.

362:393-402.

Chiang, C.-J., P. T. Chen, and Y.-P. Chao. 2010. Se-

creted production of Renilla luciferase in Bacillus

subtilis. Biotechnol. Prog. 26:589-594.

Christie, G., M. Lazarevska, and C. R. Lowe. 2008.

Functional consequences of amino acid substitu-

tions to GerVB, a component of the Bacillus mega-

terium spore germinant receptor. J. Bacteriol.

190:2014-2022.

Darmon, E., R. Dorenbos, J. Meens, R. Freudl, H.

Antelmann, M. Hecker, O. P. Kuipers, S. Bron, W.

J. Quax, J. Y. Dubois, and J. M. van Dijl. 2006. A

disulfide bond-containing alkaline phosphatase

triggers a BdbC-dependent secretion stress re-

sponse in Bacillus subtilis. Appl. Environ. Microbiol

72:6876-6885.

Degering, C., T. Eggert, M. Puls, J. Bongaerts, S.

Evers, K.-H. Maurer, and K.-E. Jaeger. 2010. Opti-

mization of protease secretion in Bacillus subtilis

and Bacillus licheniformis by screening of homolo-

gous and heterologous signal peptides. Appl. En-

viron. Microbiol. 76:6370-6376.

Demleitner, G., and F. Götz. 1994. Evidence for im-

portance of the Staphylococcus hyicus lipase pro-

peptide in lipase secretion, stability and activity.

FEMS Microbiol. Lett.121:189-197.

Deng, M. D., A. D. Grund, K. J. Schneider, K. M.

Langley, S. L. Wassink, S. S. Peng, and R. A. Ros-

son. 2007. Linoleic acid isomerase from Propioni-

bacterium acnes: purification, characterization,

molecular cloning, and heterologous expression.

Appl. Biochem. Biotechnol. 143:199-211.

Eppinger, M., B. Bunk, M. A. Johns, J. N. Edirisinghe,

K. K. Kutumbaka, S. S. K. Koenig, H. Huot Creasy,

M. J. Rosovitz, D. R. Riley, S. Daugherty, M. Martin,

L. D. H. Elbourne, I. Paulsen, R. Biedendieck, C.

Braun, S. Grayburn, S. Dhingra, V. Lukyanchuk, B.

Ball, R. Ul-Qamar, J. r. Seibel, E. Bremer, D. Jahn, J.

Ravel, and P. S. Vary. 2011. Genome sequences of

the biotechnologically important Bacillus megate-

rium strains QM B1551 and DSM319. J. Bacteriol.

193:4199-4213.

Grote, A., K. Hiller, M. Scheer, R. Münch , B. Nörte-

mann, D. C. Hempel, and D. Jahn. 2005. JCat: a

novel tool to adapt codon usage of a target gene

to its potential expression host. Nucleic Acids Res.

33:W526-W531.

Harwood, C. R., and R. Cranenburgh. 2008. Bacillus

protein secretion: an unfolding story. Trends Mi-

crobiol. 16:73-79.

He, X.-S., R. Bruckner, and R. H. Doi. 1991. The pro-

tease genes of Bacillus subtilis. Res. Microbiol.

142:797-803.

Kakeshita, H., Y. Kageyama, K. Ara, K. Ozaki, and K.

Nakamura. 2011. Propeptide of Bacillus subtilis

amylase enhances extracellular production of hu-

man interferon-α in Bacillus subtilis. Appl. Micro-

biol. Biotechnol. 89:1509-1517.

Kouwen, T. R. H. M., A. K. Nielsen, E. L. Denham,

J.-Y. F. Dubois, R. Dorenbos, M. D. Rasmussen, W.

J. Quax, R. Freudl, and J. M. van Dijl. 2010. Contri-

butions of the pre- and pro-regions of a Staphylo-

coccus hyicus lipase to secretion of a heterologous

protein by Bacillus subtilis. Appl. Environ. Micro-

biol. 76:659-669.

Kouwen, T. R. H. M., and J. M. van Dijl. 2009. Inter-

changeable modules in bacterial thiol-disulfide ex-

change pathways. Trends Microbiol. 17:6-12.

Lewis, T., P. D. Nichols, and T. A. McMeekin. 2000.

Evaluation of extraction methods for recovery

of fatty acids from lipid-producing microhetero-

trophs. J. Microbiol. Methods. 43:107-116.

Li, W., X. Zhou, and P. Lu. 2004. Bottlenecks in the

expression and secretion of heterologous proteins

in Bacillus subtilis. Res. Microbiol. 155:605-610.

Mansfeld, J., and R. Ulbrich-Hofmann. 2007. The

stability of engineered thermostable neutral pro-

teases from Bacillus stearothermophilus in organ-

ic solvents and detergents. Biotechnol. Bioeng.

97:672-679.

Meens, J., M. Herbort, M. Klein, and R. Freudl. 1997.


Use of the pre-pro part of Staphylococcus hyicus

lipase as a carrier for secretion of Escherichia coli

outer membrane protein A (OmpA) prevents pro-

teolytic degradation of OmpA by cell-associated

protease(s) in two different gram-positive bacteria.


Pariza, M. W. 2004. Perspective on the safety and ef-

fectiveness of conjugated linoleic acid. Am. J. Clin.

Nutr. 79:1132S-1136S.

Peng, S. S., M.-D. Deng, A. D. Grund, and R. A. Ros-

son. 2007. Purification and characterization of a

membrane-bound linoleic acid isomerase from

Clostridium sporogenes. Enzyme Microb. Technol.

40:831-839.

Pohl, S., and C. R. Harwood. 2010. Heterologous

protein secretion by Bacillus species from the cra-

dle to the grave. Adv. Appl. Microbiol. 73:1-25.

Puohiniemi, R., M. Simonen, S. Muttilainen, J.-P. Hi-

manen, and M. Sarvas. 1992. Secretion of the Esch-

erichia coli outer membrane proteins OmpA and

OmpF in Bacillus subtilis is blocked at an early in-

tracellular step. Mol. Microbiol. 6:981-990.

Sarvas, M., C. R. Harwood, S. Bron, and J. M. van Dijl.

2004. Post-translocational folding of secretory pro-

teins in Gram-positive bacteria. Biochim. Biophys.

Acta. 1694:311-327.

Saunders, C. W., B. J. Schmidt, R. L. Mallonee, and M.

S. Guyer. 1987. Secretion of human serum albumin

from Bacillus subtilis. J. Bacteriol. 169:2917-2925.

Schallmey, M., A. Singh, and O. P. Ward. 2004. Devel-

opments in the use of Bacillus species for industrial

production. Can. J. Microbiol. 50:1 - 17.

Shinde, U., and M. Inouye. 2000. Intramolecular chap-

erones: polypeptide extensions that modulate pro-

tein folding. Semin. Cell Dev. Biol. 11:35-44.

Stammen, S., B. K. Müller, C. Korneli, R. Biedendi-

eck, M. Gamer, E. Franco-Lara, and D. Jahn. 2010.

High-yield intra- and extracellular protein produc-

tion using Bacillus megaterium. Appl. Environ. Mi-

crobiol. 76:4037-4046.

Sturmfels, A., F. Götz, and A. Peschel. 2001. Secre-

tion of human growth hormone by the food-grade

bacterium Staphylococcus carnosus requires a

propeptide irrespective of the signal peptide

used. Arch. Microbiol. 175:295-300.

Takagi, H., M. Koga, S. Katsurada, Y. Yabuta, U.

Shinde, M. Inouye, and S. Nakamori. 2001. Func-

tional analysis of the propeptides of subtilisin E

and aqualysin I as intramolecular chaperones.

FEBS Lett. 508:210-214.

Terpe, K. 2006. Overview of bacterial expression

systems for heterologous protein production:

from molecular and biochemical fundamentals to

commercial systems. Appl. Microbiol. Biotechnol.

72:211-222.

Tjalsma, H., H. Antelmann, J. D. Jongbloed, P. G.

Braun, E. Darmon, R. Dorenbos, J. Y. Dubois, H.

Westers, G. Zanen, W. J. Quax, O. P. Kuipers, S.

Bron, M. Hecker, and J. M. van Dijl. 2004. Pro-

teomics of protein secretion by Bacillus subtilis:

separating the “secrets” of the secretome. Micro-

biol. Mol. Biol. Rev. 68:207 - 233.

Vary, P. S. 1994. Prime time for Bacillus megateriurn.

Microbiology. 140:1001-1013.

von Heijne, G. 1990a. Protein targeting signals. Curr.

Opin. Cell Biol. 2:604-608.

von Heijne, G. 1990b. The signal peptide. J. Membr.

Biol. 115:195-201.

Xue, G. P., J. S. Johnson, and B. P. Dalrymple. 1999.

High osmolarity improves the electro-transforma-

tion efficiency of the gram-positive bacteria Bacil-

lus subtilis and Bacillus licheniformis. J. Microbiol.

Methods. 34:183-191.

Yabuta, Y., H. Takagi, M. Inouye, and U. Shinde. 2001.

Folding pathway mediated by an intramolecular

chaperone: propeptide release modulates acti-

vation precision of pro-subtilisin. J. Biol. Chem.

276:44427-44434.


Primer Sequence 5’ to 3’

PL1TTC ACG TTT TTC CAC ATT TGA AGC ATG ATG TTC AAC AGG TGA CAT CTC ATT TTC TGT TGC

PL2TTT ATT TGA TTC AAC CGA CTT TGA TGC TAT CGT TGA CTC TGG TAC CGT TTT ATC CTT ATA

PL3CGC CGG TTG TTG CTG TGT TTT TTT ATG TAA CGC AGG TAC TTC CTG TGT ATG CGA TGA AGG

PL4TTG AAC TGT CAC TTC GGT TTT TGG TGA CTC TGC TTT TTC AGG TAA AGG TGT TGC TTC TTT

PL5AGA GTC ATC AAC ATG TTC AGG TGT TGC AGT ATG TAA TGA TGT AAC AGG TGT TTG ATG TGT

PL6ATG TGT TTC TTG CTG CGA CGT TTG AGC GAC TTC TAG TGG TGT CGT TGT TTG TGT TGT CGA

PL7ATC ATT TGC CTC TGC CAC GCC CCC ACC GAT GAC AAA TAT ACA TGA TGC GAC CAT AAC CGA

PL8 CGC GGC ACC ATA AGC CGA CTT ACG GAT AGA AAA TGT GTG

PL9 TTG ATG TTT TGT TTC TTT CAT GAC CTT GTG TTC TCC TCC TCT

PL10TGT TGG TTT TTT GTC GCT CGC TTG TGA TGT AAA TTT ATT TTG TGC CGT TGT ATT TTC TTT

PL11AGG AAC GTC GAC TTG TTT CGG TTG CGC CGT ATC TAT TCT GTC ATC TTT CGG TGA AAC GGT

PL12GTC TAT CGT TTT CGT ATC AAC ATT AAC GTT TGT TTG TCC ATC CGT TTT TGG ATT TAC GTG

PL13 CGT ATT ATT GAT GAT TTT ATG GCT AAA TTC ACG GTC CAC TGA TGG

PL14 CGG TGT TGT CTC ATT AGT CTC CAA TCT ATC TTC ACG TTT TTC CAC

PU1AGA GGA GGA GAA CAC AAG GTC ATG AAA GAA ACA AAA CAT CAA CAC ACA TTT TCT ATC CGT

PU2AAG TCG GCT TAT GGT GCC GCG TCG GTT ATG GTC GCA TCA TGT ATA TTT GTC ATC GGT GGG

PU3 GGC GTG GCA GAG GCAAAT GAT TCG ACA ACA CAA ACA ACG ACA CCA CTA GAA GTC GCT CAA

PU4ACG TCG CAG CAA GAA ACA CAT ACA CAT CAA ACA CCT GTT ACA TCA TTA CAT ACT GCA ACA

PU5CCT GAA CAT GTT GAT GAC TCT AAA GAA GCA ACA CCT TTA CCT GAA AAA GCA GAG TCA CCA

PU6AAA ACC GAA GTG ACA GTT CAA CCT TCA TCG CAT ACA CAG GAA GTA CCT GCG TTA CAT AAA

Table S1. Oligonucleotides used in this study


Primer Sequence 5’ to 3’

PU7AAA ACA CAG CAA CAA CCG GCG TAT AAG GAT AAA ACG GTA CCA GAG TCA ACG ATA GCA TCA

PU8 AAG TCG GTT GAA TCA AAT AAA GCA ACA GAA AAT GAG ATG

PU9 TCA CCT GTT GAA CAT CAT GCT TCA AAT GTG GAA AAA CGT GAA

PU10GAT AGATTG GAG ACT AAT GAG ACA ACACCG CCA TCA GTG GAC CGT GAA TTT AGC CAT AAA

PU11ATC ATC AAT AAT ACG CACGTA AAT CCA AAA ACG GAT GGA CAA ACA AAC GTT AAT GTT GAT

PU12ACG AAA ACG ATA GAC ACC GTT TCACCG AAA GAT GAC AGA ATA GAT ACG GCGCAAC-CG AAA

lipF TAT ATGTAC AAT GAA AGAAAC AAA ACA TCA ACA CAC AT

lipR TAT AAG ATC TACTAG TAT TTG CCT CTG CCA CGC C

lipR2 TAT AAG ATC TACTAGTTGTTG GTT TTT TGTCGC TCG

nprEF TAT ATGTAC AAT GGG TTT AGG TAA GAA ATT GTC TG

nprER TAT AAG ATC TACTAGTAGCAG CCT GAA CAC CT

nprER2 TAT AAG ATC TACTAG TAT GTT CTACTT TAT TTT GCT GTT TTA AAA

nprMF TAT ATGTAC AATGAAAAAGAAAAAACAGGCTTTAAAGG

nprMR TAT AAG ATC TACTAG TATG TGC AAA AGC AAA TGA TGA AG

nprMR2 TAT AAG ATC TACTAG TAGG TTT CGCTGC CGG C

phoF TAT AAG ATC TACTAG TCG GGCTGCTCAGGGCGA TAT

phoR TAT ACG GCC GTT AGT GAT GGT GAT GGT GGT GTT TCA GCC CCA GAG CGG C

enprEF TAT AAG ACT T ACT AGT GCC GCCGCC ACT GGA AGC

enprER TAT A CGG CCGTTA GTG ATG GTG ATG GTG GTGCAATCCAACAGC ATT CCA GGC

Restriction sites are highlighted in bold letters.

Table S1. (Continued)



Shiga Toxin-Producing Escherichia coli (STEC) Ecology in Cattle and Management Based Options for Reducing Fecal Shedding T. R. Callaway, T. S. Edrington, G. H. Loneragan, M. A. Carr, D. J. Nisbet

39

Can Salmonella Reside in the Human Oral Cavity?S. A. Sirsat

30

Growth of Acetogenic Bacteria In Response to Varying pH, Acetate Or Carbohydrate Concentration

R. S. Pinder, and J. A. Patterson

6

Independent Poultry Processing in Georgia: Survey of Producers’ PerspectiveE. J. Van Loo, W. Q. Alali, S. Welander, C. A. O’Bryan, P. G. Crandall, S. C. Ricke

70

ARTICLES

Greenhouse Gas Emissions from Livestock and PoultryC. S. Dunkley and K. D. Dunkley

17

REVIEW




VOLUME 3 ISSUE 1


Linoleic Acid Isomerase Expression in Escherichia coli BL21 (DE3) and Bacillus sppS. Saengkerdsub

145

Current and Near-Market Intervention Strategies for Reducing Shiga Toxin-Producing Escherichia coli (STEC) Shedding in Cattle.

T. R. Callaway, T. S. Edrington, G. H. Loneragan, M. A. Carr, and D. J. Nisbet

103

Potential for Rapid Analysis of Bioavailable Amino Acids in Biofuel Feed Stocks D. E. Luján-Rhenals, and R. Morawicki

121

Isolation and Initial Characterization of Acetogenic Ruminal Bacteria Resistant to Acidic ConditionsP. Boccazzi and J. A. Patterson

129

ARTICLESConsumers’ Interest in Locally Raised, Small-Scale Poultry in GeorgiaE. J. Van Loo, W. Q. Alali, S. Welander, C. A. O’Bryan, P. G. Crandall, and S. C. Ricke

94




VOLUME 3 ISSUE 2

REVIEW


MANUSCRIPT SUBMISSION

Authors must submit their papers electronically

([email protected]). According to instruc-

tions provided online at our site: www.afabjournal.

com. Authors who are unable to submit electroni-

cally should contact the editorial office for assistance

by email at [email protected].

INSTRUCTIONS TO AUTHORS

• Aerobic microbiology

• Aerobiology

• Anaerobic microbiology

• Analytical microbiology

• Animal microbiology

• Antibiotics

• Antimicrobials

• Bacteriophage

• Bioremediation

• Biotechnology

• Detection

• Environmental microbiology

• Feed microbiology

• Fermentation

• Food bacteriology

• Food control

• Food microbiology

• Food quality

• Food Safety

• Foodborne pathogens

• Gastrointestinal microbiology

• Microbial education

• Microbial genetics

• Microbial physiology

• Modeling and microbial kinetics

• Natural products

• Phytoceuticals

• Quantitative microbiology

• Plant microbiology

• Plant pathogens

• Prebiotics

• Probiotics

• Rumen microbiology

• Rapid methods

• Toxins

• Veterinary microbiology

• Waste microbiology

• Water microbiology

CONTENT OF MANUSCRIPT

We invite you to consider submitting your re-

search and review manuscripts to AFAB. The jour-

nal serves as a peer reviewed scientific forum for to

the latest advancements in bacteriology research

on Agricultural and Food Systems which includes

the following fields:


With an open access publication model of this

journal, all interested readers around the world can

freely access articles online. AFAB publishes origi-

nal papers including, but not limited to the types

of manuscripts described in the following sections.

Papers that have been, or are scheduled to be, pub-

lished elsewhere should not be submitted and will

not be reviewed. Opinions or views expressed in pa-

pers published by AFAB are those of the author(s)

and do not necessarily represent the opinion of the

AFAB or the editorial board.

MANUSCRIPT TYPES

Full-Length Research Manuscripts

AFAB accepts full-length research articles con-

taining four (4) figures and/or tables or more. AFAB

emphasizes the importance of sound scientific ex-

perimentation on any of the topics listed in the focus

areas followed by clear concise writing that describes

the research in its entirety. The results of experi-

ments published in AFAB must be replicated, with

appropriate statistical assessment of experimental

variation and assignment of significant difference.

Major headings to include are: Abstract, Introduc-tion, Materials and Methods, Results, Discussion (or Results and Discussion), Conclusion, Acknowl-edgements (optional), Appendix for abbreviations (optional), and References.

Manuscripts clearly lacking in language will be re-

turned to author without review, with a suggestion

that English editing be sought before the paper is

reconsidered. AFAB offers a fee based language

service upon request. Please contact [email protected] for more information about our fees

and services.

Rapid Communications

Under normal circumstances, AFAB aims for re-

ceipt-to-decision times of approximately one month or less. Accepted papers will have priority for publi-

cation in the next available issue of AFAB. However,

if an author chooses or requires a much more rapid

peer review, the journal editorial office has the capa-

bility to shorten the review timing to one week or less.

Any type of manuscript whether it be a full length

manuscript, brief communication or review paper can

be submitted as a rapid communication. There will be

additional costs for processing and page charges will

be double the normal rate. Authors who choose this

option must select Rapid Communications as the pa-

per type when submitting the paper and the editors

will judge whether a rapid review is possible and let

the author know immediately.

Brief Communications

Brief communications are short research notes giv-

ing the results of complete experiments but are con-

sidered less comprehensive than full-length articles

with three (3) figures and/or tables or less. Manuscripts

should be prepared with the same subheadings as full

length research papers. The running head above the

title of the paper is “Brief Communications.”

Unsolicited Review Papers

Review papers are welcome on any topic listed in

the focus section and have no page limits. Reviews

are assessed the same pages charges as all other

manuscripts. All AFAB guidelines for style and form

apply. Major headings to include are: Abstract, In-troduction, Main discussion topics and appropri-ate subheadings, Conclusions, Acknowledgements (optional) and References. Review papers shorter

than 20 pages of double spaced text and references

will be considered mini-reviews with the subhead-

ing above the title on the first page. The running

head above the title of the paper is either “Review”

or “Mini-review”.

Solicited Review Papers

Solicited reviews will have no page limits. The

editor-in-chief will send invitations to the authors

and then review these contributions when they are

submitted. Nominations or suggestions for potential

timely reviews are welcomed by the editors or edito-


rial board members and should be sent to submit@

afabjournal.com. There will be no page charges for

solicited review papers but the solicitation must origi-

nate from the editor-in-chief or one of the editors. Re-

quests from authors will automatically be classified as

unsolicited review papers. The running head above

the title of the paper will be “Invited Review.”

Conference and Special Issues Reviews

AFAB welcomes opportunities to publish papers

from symposia, scientific conference, and/or meet-

ings in their entirety. Conference organizers need

simply to contact AFAB at [email protected]

and a rapid decision is guaranteed. If in agreement,

the conference organizers must guarantee delivery

of a set number of peer reviewed manuscripts within

a specified time and submitted in the same format

as that described for unsolicited review papers. Con-

ference papers must be prepared in accordance with

the guidelines for review articles and are subject to

peer review. The conference chair must decide

whether or not they wish to serve as Special Issue

Editor and conduct the editorial review process. If

the conference chair/organizer chooses to serve as

special issue editor, this will involve review of the pa-

pers and, if necessary, returning them to the authors

for revision. The conference organizer then submits

the revised manuscripts to the journal editorial of-

fice for further editorial examination. Final revisions

by the author and recommendations for acceptance

or rejection by the chair must be completed by a

mutually agreed upon date between the editor and

the conference organizer. Manuscripts not meeting

this deadline will not be included in the published

symposium proceedings but if submitted later can

still be considered as unsolicited review papers. Al-

though offprints and costs of pages are the same

as for all other papers, the symposium chair may be

asked to guarantee an agreed upon number of hard

copies to be purchased by conference attendees. If

the decision is not to publish the symposium as a

special issue, the individual authors retain the right

to submit their papers for consideration for the jour-

nal as ordinary unsolicited review manuscripts.

Book Reviews

AFAB publishes reviews of books considered to

be of interest to the readers. The editor-in-chief ordi-

narily solicits reviews. Book reviews shall be prepared

in accordance to the style and form requirements of

the journal, and they are subject to editorial revision.

No page charges will be assessed solicited reviews

while unsolicited book reviews will be assigned the

regular page charge rate.

Opinions and Current Viewpoints

The purpose of this section will be to discuss, cri-

tique, or expand on scientific points made in articles

recently published in AFAB. Drafts must be received

within 6 months of an article’s publication. Opinions

and current perspectives do not have page limits.

They shall have a title followed by the body of the

text and references. Author name(s) and affiliation(s)

shall be placed between the end of the text and list

of references. If this document pertains to a par-

ticular manuscript then the author(s) of the original

paper(s) will be provided a copy of the letter and of-

fered the opportunity to submit for consideration a

reply within 30 days. Responses will have the same

page restrictions and format as the original opinion

and current viewpoint, and the titles shall end with

“Opinions.” They will be published together. Letters

and replies shall follow appropriate AFAB format

and may be edited by the editor-in-chief and a tech-

nical editor. If multiple letters on the same topic are

received, a representative set of opinions concern-

ing a specific article will be published. A disclaimer

will be added by the editorial staff that the opinion

expressed in this viewpoint is the authors alone and

does not necessarily represent the opinion of AFAB

or the editorial board.

COPYRIGHT AGREEMENT

The copyright form is published in AFAB as space

permits and is available online (www.afabjournal.com).


AFAB grants to the author the right of re-publication

in any book of which he or she is the author or edi-

tor, subject only to giving proper credit to the original

journal publication of the article by AFAB. AFAB re-

tains the copyright to all materials accepted for pub-

lication in the journal. If an author desires to reprint

a table or figure published from a non-AFAB source,

written evidence of copyright permission from an au-

thority representing that source must be obtained by

the author and forwarded to the AFAB editorial office.

PEER REVIEW PROCESS

Authors will be requested to provide the names

and complete addresses including emails of five (5) potential reviewers who have expertise in the research

area and no conflict of interest with any of the authors.

Except for manuscripts designated as Rapid Commu-

nication each reviewer has two (2) weeks to review

the manuscript, and submit comments electronically

to the editorial office. Authors have three (3) weeks

to complete the revision, which shall be returned to

the editorial office within six (6) weeks after which the

authors risk having their manuscript removed from

AFAB files if they fail to ask the editorial office for

an extension by email. Deleted manuscripts will be

reconsidered, but they will have to be processed as

new manuscripts with an additional processing fee as-

sessed upon submission. Once reviewed, the author

will be notified of the outcome and advised accord-

ingly. Editors handle all initial correspondence with

authors during the review process. The editor-in chief

will notify the author of the final decision to accept or

reject. Rejected manuscripts can be resubmitted only

with an invitation from the editor or editor-in chief. Re-

vised versions of previously rejected manuscripts are

treated as new submissions.

PRODUCTION OF PROOFS

Accepted manuscripts are forwarded to the edito-

rial office for technical editing and layout. The manu-

script is then formatted, figures are reproduced, and

author proofs are prepared as PDFs. Author proofs

of all manuscripts will be provided to the correspond-

ing author. Author proofs should be read carefully and

checked against the typed manuscript, because the

responsibility for proofreading is with the author(s).

Corrections must be returned by e-mail. Changes

sent by e-mail to the technical editor must indicate

page, column, and line numbers for each correction

to be made on the proof. Corrections can also be

marked using “track changes” in Microsoft Word or

using e-annotation tools for electronic proof correc-

tion in Adobe Acrobat to indicate necessary chang-

es. Author alterations to proofs exceeding 5% of the

original proof content will be charged to the author. All

correspondence of proofs must be agreed to by the

editorial office and the author within 48 hours or proof

will be published as is and AFAB will assume no re-

sponsibility for errors that result in the final publication.

PUBLICATION CHARGES

AFAB has two publication charge options: conven-

tional page charges and rapid communication. The

current charge for conventional publication is $25 per printed page in the journal. There is no additional

charge for the publication of pages containing color

images, micrographs or pictures. For authors who

wish to have their papers processed as a rapid com-

munication, authors will pay the rapid communication

fee when proofs are returned to the editorial office

in addition to twice the conventional page charges.

Charges for rapid communications are $1000 per manuscript for guaranteed peer review within one

week and $100 per journal page.

HARD COPY OFFPRINTS

If you are wishing to obtain a physical hard copy of

the AFAB journal, offprints are available in any quan-

tity at an additional charge: $100/page for black-white

and $150/page for color prints. You may order your

offprints at any time after publication on our website.

Scientific conference organizers may be expected to

agree to a set number of offprints as a part of their

agreement with AFAB.


MANUSCRIPT CONTENT REQUIREMENTS

Preparing the Manuscript File

Manuscripts must be written in grammatically

correct English. AFAB offers a fee based language

service upon request ([email protected]).

Manuscripts should be typed double-spaced, with

lines and pages numbered consecutively. All docu-

ments must be submitted in Microsoft Word (.doc or

.docx, PC or Mac). All special characters (e.g., Greek,

math, symbols) should be inserted using the sym-

bols palette available in this font. Tables and figures

should be placed in separate sections at the end of

the manuscript (not placed in the text). Failure to fol-

low these instructions will cause delays of the pro-

cessing and review of the manuscript.

Title Page

At the very top of the title page, include a title of

not more than 100 characters. Format the title with

the first letter of each word capitalized. No abbre-

viations should be used. Under the title, the authors

names are listed. Use the author’s initials for both first

and middle names with a period (full-stop) between

initials (e.g., W. A. Afab). Underneath the authors, a

list affiliations must be listed. Please use numerical

superscripts after the author’s names to designate

affiliation. If an authors address has changed since

the research was completed, this new information

must be designated as “Current address:”. The cor-

responding author should be indicated with an aster-

isk e.g., * Corresponding author. The title page shall

include the name and full address of the correspond-

ing author. Telephone and e-mail address must also

be provided for the corresponding author, and email-addresses must be provided for all authors.

Editing

Author-derived abbreviations should be defined

at first use in the abstract and again in the body of

the manuscript. If abbreviations are extensive au-

thors may need to provide a list of abbreviations

at the beginning of the manuscript. In vivo, in vitro

and bacterial names must be italicized (obligatory).

Authors must avoid single sentence paragraphs and

merge such paragraphs appropriately. Authors must

not begin sentences with “Figure or Table shows…”

as these are inanimate objects and cannot “show”

anything. When number are reported in text or in ta-

bles, always put a zero in front of decimal numbers:

“0.10” instead of “.10”.

MANUSCRIPT SECTIONS

Abstract

The abstract provides an abridged version of the

manuscript. Please submit your abstract on a sepa-

rate page after the title page. The abstract should

provide a justification of your work, objectives, meth-

ods, results, discussion and implications of study or

review findings . Your abstract must consist of com-

plete sentences without references to other work or

footnotes and must not exceed 250 words. On the

same page as your abstract, please provide at least ten (10) keywords to be used for linking and index-

ing. Ideally, these keywords should include signifi-

cant words from the title.

Introduction

The introduction should clearly present the foun-

dation of the manuscript topic and what makes the

research or the review unique. The introduction

should validate why this topic is important based on

previously published literature, and the relevance of

the current research. Overall goals and project ob-

jectives must be clearly stated in the final sentence

of the last paragraphs of the introduction.

Materials and Methods

Information on equipment and chemicals used

must include the full company name, city, and state

(country if outside the United States or Province if

in Canada) [i.e., (Model 123, ACME Inc., Afab, AR)].


Variability, Replication, and Statistical Analysis

To properly assess biological systems indepen-

dent replication of experiments and quantification

of variation among replicates is required by AFAB.

Reviewers and/or editors may request additional

statistical analysis depending on the nature of the

data and it will be the responsibility of the authors

to respond appropriately. Statistical methods com-

monly used in the bacteriology do not need to be

described in detail, but an adequate description

and/or appropriate references should be provided.

The statistical model and experimental unit must

be designated when appropriate. The experimen-

tal unit is the smallest unit to which an individual

treatment is imposed. For bacterial growth stud-

ies, the average of replicate tubes per single study

per treatment is the experimental unit; therefore,

individual studies must be replicated. Repeated

time analyses of the same sample usually do not

constitute independent experimental units. Mea-

surements on the same experimental unit over time

are also not independent and must not be consid-

ered as independent experimental units. For analy-

sis of time effects, assess as a rate of change over

time. Standard deviation refers to the variability

in the biological response being measured and is

presented as standard deviation or standard error

according to the definitions described in statistical

references or textbooks.

Results

Results represent the presentation of data in

words and all data should be described in same

fashion. No discussion of literature is included in

the results section.

Discussion

The discussion section involves comparing the

current data outcomes with previously published

work in this area without repeating the text in the

results section. Critical and in-depth dialogue is

encouraged.

Results and Discussion

Results and discussion can be under combined or

separate headings.

Conclusions

State conclusions (not a summary) briefly in one

paragraph.

Acknowledgments

Acknowledgments of individuals should include

institution, city, and state; city and country if not U.S.;

and City or Province if in Canada. Copies being re-

viewed shall have authors’ institutions omitted to re-

tain anonymity.

References

a) Citing References In Text

Authors of cited papers in the text are to be pre-

sented as follows: Adams and Harry (1992) or Smith

and Jones (1990, 1992). If more than two authors of

one article, the first author’s name is followed by the

abbreviation et al. in italics. If the sentence structure

requires that the authors’ names be included in pa-

rentheses, the proper format is (Adams and Harry,

1982; Harry, 1988a,b; Harry et al., 1993). Citations to a

group of references should be listed first alphabeti-

cally then chronologically. Work that has not been

submitted or accepted for publication shall be listed

in the text as: “G.C. Jay (institution, city, and state,

personal communication).” The author’s own un-

published work should be listed in the text as “(J.

Adams, unpublished data).” Personal communica-

tions and unsubmitted unpublished data must not

be included in the References section. Two or more

publications by the same authors in the same year

must be made distinct with lowercase letters after

the year (2010a,b). Likewise when multiple author ci-

tations designated by et al. in the text have the same

first author, then even if the other authors are differ-

ent these references in the text and the references

section must be identified by a letter. For example


“(James et al., 2010a,b)” in text, refers to “James,

Smith, and Elliot. 2010a” and “James, West, and Ad-

ams. 2010b” in the reference section.

b) Citing References In Reference Section

In the References section, references are listed in

alphabetical order by authors’ last names, and then

chronologically. List only those references cited in the

text. Manuscripts submitted for publication, accepted

for publication or in press can be given in the refer-

ence section followed by the designation: “(submit-

ted)”, “(accepted)’, or “(In Press), respectively. If the

DOI number of unpublished references is available,

you must give the number. The year of publication fol-

lows the authors’ names. All authors’ names must be

included in the citation in the Reference section. Jour-

nals must be abbreviated. First and last page num-

bers must be provided. Sample references are given

below. Consult recent issues of AFAB for examples

not included in the following section.

Journal manuscript:

Examples:

Chase, G., and L. Erlandsen. 1976. Evidence for a

complex life cycle and endospore formation in the

attached, filamentous, segmented bacterium from

murine ileum. J. Bacteriol. 127:572-583.

Jiang, B., A.-M. Henstra, L. Paulo, M. Balk, W. van

Doesburg, and A. J. M. Stams. 2009. A typical

one-carbon metabolism of an acetogenic and

hydrogenogenic Moorella thermioacetica strain.

Arch. Microbiol. 191:123-131.

Book:

Examples:

Hungate, R. E. 1966. The rumen and its microbes

Academic Press, Inc., New York, NY. 533 p.

Book Chapter:

Examples:

O’Bryan, C. A., P. G. Crandall, and C. Bruhn. 2010.

Assessing consumer concerns and perceptions

of food safety risks and practices: Methodologies

and outcomes. In: S. C. Ricke and F. T. Jones. Eds.

Perspectives on Food Safety Issues of Food Animal

Derived Foods. Univ. Arkansas Press, Fayetteville,

AR. p 273-288.

Dissertation and thesis:

Maciorowski, K. G. 2000. Rapid detection of Salmo-

nella spp. and indicators of fecal contamination

in animal feed. Ph.D. Diss. Texas A&M University,

College Station, TX.

Donalson, L. M. 2005. The in vivo and in vitro effect

of a fructooligosacharide prebiotic combined with

alfalfa molt diets on egg production and Salmo-

nella in laying hens. M.S. thesis. Texas A&M Uni-

versity, College Station, TX.

Van Loo, E. 2009. Consumer perception of ready-to-

eat deli foods and organic meat. M.S. thesis. Uni-

versity of Arkansas, Fayetteville, AR. 202 p.

Web sites, patents:

Examples:

Davis, C. 2010. Salmonella. Medicinenet.com.

http://www.medicinenet.com/salmonella /article.

htm. Accessed July, 2010.

Afab, F. 2010, Development of a novel process. U.S.

Patent #_____

Author(s). Year. Article title. Journal title [abbreviated].

Volume number:inclusive pages.

Author(s) [or editor(s)]. Year. Title. Edition or volume (if

relevant). Publisher name, Place of publication. Number

of pages.

Author(s) of the chapter. Year. Title of the chapter. In:

author(s) or editor(s). Title of the book. Edition or vol-

ume, if relevant. Publisher name, Place of publication.

Inclusive pages of chapter.

Author. Date of degree. Title. Type of publication, such

as Ph.D. Diss or M.S. thesis. Institution, Place of institu-

tion. Total number of pages.


Abstracts and Symposia Proceedings:

Fischer, J. R. 2007. Building a prosperous future in

which agriculture uses and produces energy effi-

ciently and effectively. NABC report 19, Agricultural

Biofuels: Tech., Sustainability, and Profitability. p.27

Musgrove, M. T., and M. E. Berrang. 2008. Presence

of aerobic microorganisms, Enterobacteriaceae and

Salmonella in the shell egg processing environment.

IAFP 95th Annual Meeting. p. 47 (Abstr. #T6-10)

Vianna, M. E., H. P. Horz, and G. Conrads. 2006. Op-

tions and risks by using diagnostic gene chips. Pro-

gram and abstracts book , The 8th Biennieal Con-

gress of the Anaerobe Society of the Americas. p.

86 (Abstr.)

Data Presentation in Tables and Figures

Figures and tables to be published in AFAB must

be constructed in such a fashion that they are able

to “stand alone” in the published manuscript. This

means that the reader should be able to look at

the figure or table independently of the rest of the

manuscript and be able to comprehend the experi-

mental approach sufficiently to interpret the data.

Consequently, all statistical analyses should be very

carefully presented along with variation estimates

and what constitutes an independent replication

and the number of replicates used to calculate the

averages presented in the table or figure.

Each table and figure must be on a separate

page in the submitted paper. In addition, you will

need to submit all data for charts, tables and

figures in native format when possible (e.g., Mi-

crosoft Excel, Powerpoint). Photographs should

be submitted as high-resolution (600 dpi) .jpg or

tif. files. All figures should be clearly presented with

well defined axis and units of measurement. Sym-

bols, lines, and bars must be made distinct as “stand

alone” black and white presentations. Stippling,

dashed lines etc. are encouraged for multiple com-

parison but shades of gray are discouraged. Color

images, micrographs, pictures are recommended

and there is no additional fee for their submission.

AFAB Online Edition is Now Available!

www.AFABjournal.com

• Free Access

• Print PDFs

• Flip Through Issues

• Search Article Archives

• Order Reprints

• Submit a Paper

Online Publication: www.AFABjournal.com

Documents

AFAB Volume 3 Issue 3