Agilent BioAnalyser Potato Genotyping (Q01128)

Final Report

- 2 -

CONTENTS

Executive Summary 3

Scope of Work (original contract) 4-7

Introduction 7

Materials and Methods 8-10

Results 11-13

Discussion 13-16

Conclusions 16

Acknowledgement 16

References 16

- 3 -

EXECUTIVE SUMMARY Background Microsatellites are widely accepted as the reliable markers for forensics. They are ubiquitous in eukaryotic genomes and generally highly polymorphic.

Rationale and Objectives SSRs are proven markers for variety discrimination and, in potatoes, there exists publicly available data that can be used for their deployment, thus cutting out developmental costs which is reflected in the six month labour required to perform the work of this project. The project seeks to identify a set of SSRs that could be used to discriminate between 20 common ware potato varieties using an Agilent BioAnalyser (AB) machine and develop standard operating procedures that would allow the use of the markers by Public Analysts who may be asked by Local Authority Trading Standards Inspectors to investigate suspected cases of mislabelling. Approach To meet the call “to develop markers for potato variety discrimination using an AB”, we have utilised publicly available SSR sequences to circumvent the need to isolate and characterise de novo such markers. SSRs that contained 4 bp or greater core repeats were selected given the restricted resolution of the AB system in the hope that the machine may be able to resolve repeat differences. Duplicate potato samples for the 20 most common ware potato varieties were obtained from Science and Advice for Scottish Agriculture (SASA) and extracted DNAs were tested using a commercial potato identification test. Samples were also amplified with the selected loci primers and alleles scored using an Applied Biosystems 3730 genotyper, before loading in an AB machine. A second approach to use inter-SSR polymorphisms was investigated but robustness problems appear to exist when using these markers. Outcome /Key Results Obtained The „limited‟ resolution of the AB means that there will always be problems differentiating between DNA fragments close in size. However, of greater importance is the observation that fragments that are produced by PCR, although easily visible in a DNA sequencer, are faint when run as double stranded DNA. We attribute this to loss of products due to mis-annealing to form heteroduplexes during the final PCR steps. As such, these problems make SSR analyses unsuitable for the discrimination of potatoes using an AB. What it means and why it’s important If SSRs are not suitable, then an alternative marker system must be developed for this purpose of potato variety discrimination. Since any system is intended for use by Public Analysts, simple presence/absence diagnostic markers may run into problems with contamination. SNP markers may provide a workable system but as potato is a vegetatively propagated tetraploid, there could be an excessive of heterozygotes for any given marker, suggesting that a lot of SNPs may need to be tested to find a set capable of differentiating between 20 potato varieties.

- 4 -

SCOPE OF WORK

SW1 - SCIENTIFIC OBJECTIVE(S) i

Objective No. Objective Description

01 Collect and test potato tubers: DNA from a set of potato tubers will be verified using SSRs.

02 Identify a set of 10 microsatellite markers that have 4 or more nucleotides in their repeat motif: a set of primers for amplifying these markers in PCR will be designed.

03 Evaluate primers: an informative (sub)set of markers able to differentiate the collection of potato varieties will be identified.

04 Allele ladders generated: DNA fragments encompassing the different alleles identified for the chosen microsatellites that can be used as controls for allele calling will be made.

05 Development of a database of genetic profiles for chosen markers: a database that can be interrogated for misclassification.

06 Standard Operating Procedures (SOPs) and software for identifying misclassification of potatoes will be produced: SOPs for the genotyping procedure will be written in accordance to FSA guidelines (from tuber to fingerprint) and tested by a PA laboratory

07 Validation of results in second site: data and samples will be provided to a Public Analyst lab (Worcestershire Scientific Services) for a blind test to show inter-laboratory transferability of method and quality of SOP.

08 Potato training course for PAs.

09 Final Report.

- 5 -

SW2 - APPROACHES AND PROJECT RESEARCH PLAN ii

The use of the Agilent Bioanalyser for analyzing DNA fragments has simplified the DNA separation steps and the process of identification by introducing stringent conditions in which electrophoresis is performed and producing reproducible results giving more confidence in the interpretation of the generated profile(s). With its sizing error of ± 5% for fragments the Agilent Bioanalyser cannot resolve fragments that are very close in size. For example, it would not be able to resolve dinucleotide microsatellite repeats, differing in a single repeat length. The current NIAB potato identification testing procedure which utilizes a set of 5 microsatellite markers that are amplified from purified DNA by PCR (Corbett et al., 2001), was developed from funding provided originally by the FSA (Q01013). Alleles for each marker are identified by running labelled products in an ABI genotyper and potato identification is performed using the combined data from the 5 microsatellite profiles compared against a database containing a „wide‟ collection of reference potato varieties. Since it is not possible to resolve all of the bands from the currently adopted highly polymorphic markers using the Agilent Bioanalyser, we propose to screen a set of 10 microsatellites that have motifs of 4 nucleotide repeats or greater to evaluate their discriminatory ability between 20 selected potato varieties (to be agreed with the Agency), consisting of the most commonly grown in the UK along with possible problematic samples (for example see Table 1). Potential markers have already been identified (Milbourne et al., 1998) so no development work is required in this task. Classification software will incorporate both phenotypic and genotypic data and require operator input. The software will use a „dichotomous key‟ approach requiring yes/no answers to simple questions such as “is the skin white?”. The questions will lead the operator to come to a decision whether DNA genotyping is required to assess the sample(s) in question. If microsatellite data is required, that is, the phenotypic details match, then the programme will help with the assessment of that data.

Table 1. Twelve most grown potato varieties in the UK (2005) plus others that are most commonly tested.

Potato Variety Type Tuber Colour

1. Maris Piper Main Crop Cream skin, cream flesh.

2. Estima Second Early Light yellow skin, light yellow flesh

3. Lady Rosetta

Early Main Crop Red skin and yellow flesh

4. Maris Peer Second Early Cream skin and cream flesh

5. Pentland Dell

Main Crop Cream skin, cream flesh.

- 6 -

6. Nadine Second Early Cream skin, cream flesh

7. Saturna Main Crop Cream skin, medium yellow flesh

8. Marfona Second Early Light yellow skin, light yellow flesh

9. King Edward

Main Crop White skin with pink colouration, cream to pale yellow flesh

10. Saxon Second Early White skin and white flesh

11. Russet Burbank

Speciality Processing Cream skin, white flesh

12. Desiree Main Crop Red skin and light yellow flesh

Ambo Main Crop Red skin, cream flesh

Charlotte Speciality/ Salad Pale yellow skin, yellow flesh

Exquisa Salad Pale yellow skin, yellow flesh

International Kidney

Early Maincrop/ Salad

White skin, light yellow flesh

Maris Bard First Early White skin, white to cream flesh

Nicola Salad Long oval shape, yellow skin, light yellow flesh

Romano Main Crop Red skin, cream flesh

Sante Main Crop Light yellow skin and flesh

A spreadsheet of variety vs allelic variants will allow an assessment of the minimum numbers of microsatellite markers required to discriminate the varieties and these will be selected for use in the test. Two of the potential markers identified are already used by NIAB. Analyses of the potato varieties listed in Table 1 with SSR data show that most of the potato varieties in the list can be discriminated by these two markers alone so the probability of success in this project can be considered high when other markers are considered. These two markers allow corroboration of the variety set of DNAs extracted from the tubers. Error in sizing may make it difficult to identify some alleles unambiguously, allele ladders run alongside the test samples would make allele calling easier and aid variety identification. Once the markers have been selected an allelic ladder for each microsatellite marker will be made. Standard operating procedures will be written up in accordance with the Agency guidelines. A second site validation involving Worcestershire Scientific Services, who are accredited users of the Agilent Bioanalyser for fish identification, will be set up and the transferability of the methods and SOPs will be evaluated from the data returned and amended where necessary. NIAB will organise a training course, for up to 20 PAs, for anyone interested in offering a commercial potato genotyping service following satisfactory results. As a final aid to the adoption and implementation of the test, NIAB is in discussions with Biogene, who have agreed in principle to commercially supply potato testing kits for the Public Analysts if the developed test is implemented.

- 7 -

References

Corbett G, Lee D, Donini P and Cooke RJ (2001). Identification of potato varieties by DNA profiling. Acta Horticulturae 546: 387-390.

Milbourne D., Meyer R.C., Collins A.J., Ramsay L.D., Gebhardt C. and Waugh, R. (1998). Isolation, characterisation and mapping of simple sequence repeat loci in potato. Mol. Gen. Genet. 259: 233-245.

SW3 - PROJECT MILESTONES iii

Milestone Number

Target Date Milestone Title

01/01 31/12/08 20 potato varieties agreed, authentic samples sourced from SASA & validated DNA from chosen potato varieties verified

01/02 28/02/09 Microsatellite database for potato varieties generated

01/03 31/03/09 Project meeting held to discuss draft SOP and classification software.

01/04 31/04/09 Second site validation

01/05 31/05/09 Training course held for PA labs

01/06 31/06/09 Final report

SW4 - PROJECT DELIVERABLES iv

Deliverable Number

Target Date Deliverable Title

01 31/12/08 List of potato varieties included in study, evidence of authenticity of samples and details of primers for the amplification of 10 potato microsatellites with ≥ 4 nucleotide repeats submitted

02 31/05/09 Draft standard operating procedures and classification software for DNA profiling potatoes submitted

03 31/06/09 Final Report, including results of second site test, training course, final SOP‟s and software submitted

- 8 -

Agilent BioAnalyser Potato Genotyping (Q01128)

David Lee, Helen Appleyard, Pravina Solanki, Carole Lincoln*, Huw Jones and Andy Greenland

John Bingham Laboratory, National Institute of Agricultural Botany, Huntingdon Road, Cambridge CB3 0LE

*Worcester Scientific Services, Unit 5, Berkeley Business Park, Wainwright Road, Worcester WR4 9FA

1. Introduction DNA has proved to be the most reliable biological material for forensic identification due to the following properties:

DNA is durable - that we can still extract usable DNA from archaeological specimens is testament its durability;

mutations in the DNA sequence produce differences between genomes that can be used to identify or differentiate individuals;

the physical properties of DNA that have made it an ideal „genetic material‟, that it has polarity and base complementarity necessary for replication, makes it possible to resynthesise one strand from the sequence of the other, allowing DNA amplification of specific sequences.

The discovery of „hypervariable minisatellites‟ was a major advance in the use of DNA for forensics. Changes in the numbers of tandemly repeating units of 10-15 bp were responsible for their polymorphic nature (Jeffreys et al., 1985). The ubiquitous polymorphic microsatellites with their smaller repeating units of 1-6 bp, that were more amenable for amplification by PCR, make these markers more practical for diagnostics. As with their larger brethrens, differences between microsatellite alleles were due to differences in repeat numbers. In a mononucleotide repeat this may be as small as one bp in length and their resolution requires „DNA sequencing‟ systems such as denaturing polyacrylamide gels. In this project we aim to develop molecular markers for potato variety discrimination for use with an Agilent BioAnalyser (AB). We investigate the use of SSRs with repeat length of 4 bp or more due to the restricted resolution capabilities of the AB. We also looked at the use of inter-SSR polymorphisms for variety discrimination when it became clear that technical problems SSRs would impede their use. 2. Materials and Methods 2.1. DNA samples Potato tubers for twenty common ware potato varieties (Ambo, Charlotte, Desiree, Estima, Exquisa, International Kidney, King Edward, Lady Rosetta, Marfona, Maris Bard, Maris Peer, Maris Piper, Nadine, Nicola, Pentland Dell, Romano, Russet Burbank, Sante, Saturna and Saxon) were obtained from Science and Advice for

Scottish Agriculture (SASA). DNA was extracted from two tubers of each variety using a DNAeasyTM kit (Qiagen, Crawley, Sussex) following the manufacturer‟s

instructions. Each sample was eluted in 100 l of buffer at a concentration of 5-10

mgl-1 to yield approximately half to one g of DNA (see Figure 1).

- 9 -

Table 1. Primers used for the amplification of SSR repeats that contain 4 or more base repeats. Primer sequences were obtained from Milbourne et al. (1998).

Locus Designation

Microsatellite Motif

Primer Sequences

Expected Size (bp)

Location Within Gene

Mapped Location

STM0030 Compound

(GT/GC) GT)8 F - AGAGATCGATGTAAAACACGT

R - GTGGCATTTTGATGGATT 147 XII

STM1054 (AATT)4 F - CACCAAACCTCAACAAAAG R - ATTTATGGTATTACTTGGGTTACA

156 5' - UTR

STM1055 (AATT)5 F - CACAACCAACAAGGTAAATG R - TGTGTTAGACACCTTATTACTACG

218 5' - UTR VIII

STM1056 (AAAAT)4 F - AGGTAAGTTTTATTTTCAATTGC R - GGGTATGGGAATAGGTAGTTT

229 Intron 2 VIII

STM1057 (AAAT)4 F - TTATGTTTCGGTTAAAATGTA R - AAATTAAATGGAAGACAACC

107 3' - UTR VIII

STM1097 (CGTTT)5 F - TGATTTAGTTGCTTGTTTG

R - GCTTTCGATCCTAATACACC 124 Intron 1

STM1105 (ACTC)6 F - AAACCTGCTACAAATAAGGC

R - CAGAAATAATTGGAGGAGATG 114 5' - UTR VIII

STM2005 (CTGTTG)3 F - TTTAAGTTCTCAGTTCTGCAGGG R - GTCATAACCTTTACCATTGCTGG

166 XI

STM2013 (TCTA)6 F - TTCGGAATTACCCTCTGCC R - AAAAAAAGAACGCGCACG

160 VII

Figure 1. DNA extracted from 20 potato tubers using a DNAeasy™ kit. On the right are three samples of commercial lambda DNA of known weight of DNA for reference. M denotes size marker (Bioline Hypperladder IV) showing that the DNA is of good integrity (size).

2.2. PCR amplification Primers used in this study were purchased from Sigma-Genosys (Haverhill, Suffolk). The five primers used in the NIAB commercial test have been described elsewhere (Report for FSA project Q01013). Table 1 provides information of the primers used to amplify the SSRs containing motifs of 4 or more nucleotides.

SSR-PCRs were performed in 20 l of reaction comprising of 1 X buffer (supplied),

200 mM each dNTP, 2.5 mM MgCl2, 0.5 M each primer 20 ng DNA template and 1 U FastStart Taq polymerase (Roche, Burgess Hill, Sussex). Cycling parameters were: 7 mins at 92°C initial denaturation and enzyme activation, 35 cycles of 92°C for 15s, 55°C for 30s and 72°C for 60s followed by a final extension of 72°C for 5 mins. Samples were held at 15°C until used for analyses.

20

0 ng

100

ng

20

ng 2 ul of each potato sample

Qiagen DNeasy Plant DNA extraction kit

m

- 10 -

Inter-SSR amplifications were performed as above except the annealing temperature was lowered to 50°C, the extension step was lengthened to 60s and the number of cycles increased to 40. 2.3. Single nucleotide resolution of SSR amplicons

SSR PCR reactions (1 l) were mixed with 9 l of HiDi containing Liz 500 markers (ABI, Warrington, Cheshire). The samples were injected into an ABI 3730 genotyper. Peaks were analysed peaks sizes estimated using Applied Biosystems software. 2.4. Fragment analyses in an Agilent BioAnalyser

One l of each PCR sample was analysed using an Agilent BioAnalyser following the manufacturer‟s instructions. Table 2. Verification of potato samples using NIAB commercial test. SSR profiles obtained for DNA from the potato samples were compared with profiles in NIAB database. Bands highlighted in orange depict bands observed in the samples that are not observed in database. Bands highlighted in red show the absence of a previously observed allele.

Sample Name 150 153 155 156 158 159 160 164 169 196 197 199 201 203 152 160 172 196 236 238 240 242 246 248 250 254 258 290 300 369 380 392 406 409

ambo 150 165 169 197 199 152 160 172 236 242 254 291 369

ambo 150 165 169 197 199 152 160 172 236 242 254 291 369

ambo-2 150 165 169 197 199 152 160 172 236 242 254 291 369

charlotte 159 165 196 197 199 152 160 172 254 291 369 392

charlotte 159 165 169 197 199 152 160 172 242 254 291 369 392

charlotte-2 153 165 169 197 199 152 160 172 242 254 291 369 392

desiree 150 165 169 197 152 160 172 236 242 248 254 291 369

desiree 150 165 169 197 152 160 172 236 242 248 254 291 369

desiree-2 150 165 169 197 152 160 172 236 242 248 254 291 369

estima 159 165 169 152 172 242 254 291 369

estima 150 159 165 169 152 172 242 254 291 369

estima-2 150 159 165 169 152 172 242 254 291 369

exquisa 150 159 165 169 199 203 152 160 172 236 248 254 291 300

exquisa 150 159 165 169 199 203 152 160 172 236 248 254 291 300

exquisa-2 150 159 165 169 199 203 152 160 172 236 248 254 291 300 369

international kidney 150 160 165 169 199 203 172 196 238 254 291 300

international_kidney 150 160 165 169 199 203 172 196 236 238 254 291 300 369

international_kidney-2 150 160 165 169 199 203 172 196 236 238 254 291 300 369

king edward 153 160 165 169 203 152 172 196 238 242 248 254 291

king_edward 153 160 165 169 203 152 172 196 238 242 248 254 291 369

king_edward-2 153 160 165 169 203 152 172 196 238 242 248 254 291 369

lady rosetta 160 165 169 199 160 172 236 242 254 258 291

lady_rosetta 160 165 169 199 160 172 236 242 254 258 291

lady_rosetta-2 160 165 169 199 160 172 236 242 254 258 291

marfona 160 169 199 152 160 172 196 236 242 254 300 369

marfona 150 160 169 199 152 160 172 196 236 242 254 300 369

marfona-2 153 160 165 169 199 152 160 172 236 242 254 291 300

maris bard 150 165 169 160 172 242 254 300 369

maris_bard 150 165 169 160 172 242 254 291 300 369

maris_bard-2 150 165 169 160 172 242 254 291 300 369

maris peer 159 160 165 169 160 172 240 248 254 291 369

maris_peer 159 160 165 169 160 172 240 248 254 291 369

maris_peer-2 159 160 165 169 160 172 240 248 254 291 300 369

maris piper 159 160 165 169 199 160 172 196 242 246 254 291

maris_piper 159 160 165 169 199 160 172 196 242 246 254 291

maris_piper-2 159 160 165 169 199 160 172 196 242 246 254 291 369

nadine 150 153 160 169 201 203 152 160 172 242 258 406 409

nadine 150 153 160 169 201 203 152 160 172 242 258 300 369 406 409

nadine-2 150 153 160 169 201 203 152 160 172 242 258 300 369 406 409

nicola 160 165 169 197 199 152 160 172 242 248 254 291 369

nicola 150 160 165 169 197 199 152 160 172 242 248 254 291 369

nicola-2 150 160 165 169 197 199 152 160 172 242 248 254 291 369

pentland_dell 150 156 165 169 152 160 248 254 291 369

pentland_dell 150 156 165 169 152 160 242 248 254 291 369

pentland_dell-2 150 156 165 169 152 160 242 248 254 291 369

romano 150 165 169 197 152 160 236 248 250 254 291 369

romano 150 165 169 197 152 160 172 236 248 250 254 291 369

romano-2 150 165 169 197 152 160 172 236 248 250 254 291 369

russet_burbank 156 159 165 169 197 201 172 196 248 254 291 300

russet_burbank 156 159 165 169 197 203 152 160 172 196 242 254 291 369

russet_burbank-2 156 159 165 169 197 203 152 160 172 196 242 254 291 369

sante 153 165 169 197 199 203 152 160 172 242 254 258 291 369

sante 153 165 169 197 199 203 152 160 172 242 254 258 291 369

sante-2 153 165 169 197 199 203 152 160 172 242 254 258 369

saturna 150 160 165 169 199 152 160 172 238 242 248 254 291 300 369

saturna 150 160 165 169 199 152 160 172 238 242 248 254 291 300 369

saturna-2 150 160 165 169 199 152 160 172 238 242 248 254 291 300 369

saxon 159 165 169 199 160 172 236 242 246 291 369

saxon 150 160 165 169 199 160 172 236 242 246 291 369

saxon-2 150 160 165 169 199 160 172 236 242 246 291 369

Marker 12Marker 11marker 9Marker 1 Marker 8

- 11 -

3. Results 3.1. Potato sample verification Potato DNA samples were amplified using five SSR developed at NIAB (Corbett et al., 2001) and the allele sizes compared to those on the database. The Applied Biosystem system currently used for SSR allele calling is more sensitive that the LI-COR genotyper that was originally used and this can lead to discrepancies between the obtained SSR profiles and that on the database. Increase in sensitivity of equipment has a predictable consequence in that more bands may be observed that had not been seen previously. This is taken into account when analysing and comparing profiles. The lost of a band is taken as a better indicator for mislabelling this is unlikely to occur using a more sensitive system. The alleles of the 5 NIAB microsatellites for the 20 potato varieties were scored and compared to those in our database (Table 2). Extra bands observed in some samples are coloured in orange, red alleles denote variation (loss of expected band) that is indicative of mislabelling. The data show differences between the two Marfona samples, with the second sample in discordance with the SSR profile in the database. Although both Russet Burbank samples gave the same profile these did not agree with the database profile for this variety. The two Marfona samples produced different profiles and since the second differs from the profile on the database. Although microsatellite variation has been observed, possibly due to somatic mutations, these variations are limited to one SSR locus. Since there are more than one locus that differ between the samples it is likely the second tuber is not a Marfona potato. Table 3. SSR profiles obtained for the potato samples using selected microsatellite loci. Bands amplified are shown in the table for each SSR primer pair. Highlighted bands show variations between the two potato tubers. Numbers at top of columns denote the apparent sizes (in nucleotides) of the alleles

- 12 -

SSR Alleles in Agilent BioAnalyser (AB) All the SSRs tested amplified polymorphic alleles which can be detected using an Applied Biosystem genotyper (ABI 3730) (Table 3). However, when the samples are run on an AB, the bands are very weak and the sizes do not match up with the length determined by an Applied Biosystem genotyper. This can be explained by the presence of the fluorophore on the DNA molecules which would retard the migration of the molecules in agarose gels resulting in overestimation of their sizes, as observed.

Figure 2. Profiles of two microsatellite markers in an Agilent BioAnalyser (AB). The profiles of the markers M12 (A) and STM0030 (B) are shown. Tracks 1-20 denote the 20 varieties tested in alphabetical order, as listed in section 2.1. Fragment sizes of the marker (M) are shown in bp. Though the SSR profiles for both can be scored using an Applied Biosystem genotyper, both show faint bands in an AB. In B, visible bands are difficult to resolve, but there is correlation between the bands observed between 170-200 nucleotides that in AB and those observed in Applied Biosystem genotyper.

Marker M12

Marker STM0030 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

163 163 163 163 163 163 163 163 163 163 163 163 163

146 146 148 146 148 146 146

140 140 138/40 138 138/40 138/40 138/40 138 138 138 138/40 140 135 138 140 138/40 138 138/40 138 138

}

Heteroduplexes?

Bands that appear to match the alleles observed by in Applied Biosystem genotyper (below)

SSR alleles identified in Applied Biosystem genotyper, numbers are in

nucleotides

}

M

1 2 3 4 5 6 7 8 M 9 10 11 12 13 14 15 16 17 18 19 20

B

A

- 13 -

3.3. Inter-SSRs bands as an alternative marker system? We tested DNA markers amplified by SSR primers as an alternative system for potato discrimination. Since they bind to microsatellites, the region amplified are regions between two inverted SSRs and are known as inter-SSR or I-SSR markers. As SSR primers can bind anywhere along the microsatellite repeats extra bases are used to fix or anchor the primers to specific points along the SSR. Fischer et al. (1996) used extra bases at the 5‟ end of SSR primers to anchor the primer to the 5‟ end of microsatellites to exploit the length variation of the microsatellites. Here the annealing temperature is critical: it must not allow annealing of the primer to the SSR region alone, to ensure specificity of the 5‟ anchor, otherwise the primer can „slip‟. A more robust method, but less polymorphic, is the use of extra bases at the 3‟ end of the primers. This ensures that amplification will start at the 3‟ of the SSR since the last base must anneal to a non-microsatellite region. The polymorphism of the microsatellite length is not exploited but 3‟ anchored SSR primers amplify multiple bands reflecting the microsatellite-containing nature of eukaryotic genomes and polymorphisms are usually in the presence/absence of bands. Here we have used two SSR motifs as primers with an extra 3‟ base as an anchor to test if these could be used for potato discrimination. Figure 3 shows the amplification profiles for five potato samples using three I-SSR primers, singly and in pairs. Some polymorphisms are amplified between the samples and the variability increases when primers are combined. When the primers are tested using different DNA concentrations some bands fade and appear to be dependent on this variable (Figure 4). As such it was considered that I-SSRs were not of sufficient robustness to be used for variety discrimination in potatoes.

Figure 3. Potato i-SSR profiles. Five potato DNA samples (charlotte, estima, maris bard, maris peer, maris piper – loaded in that order) were amplified using 3 i-SSR primers [(GTC)5A, (GTC)5C and (GTC)5T], singly and in pairs. Profiles amplified show polymorphisms between the samples.

4. Discussion The SSR data throws up a number of issues relating to potato profiles and uniformity. The Russett Burbank fingerprints differ from that in our database and since these samples have originated from SASA, the official potato DUS testing station in the UK, it is accepted that the new profile is correct for this variety.

- 14 -

However, that some duplicate potato profiles differ highlights the problems of maintaining potato purity, even for SASA, when samples are defined using morphological characters. Errors during potato processing leading to mislabelling are probably the most common source genetic differences. Since potatoes are propagated vegetatively, somatic mutation could provide an alternative explanation but such changes are unlikely to produce changes in more than one locus. Assays designed to amplify SSR are clearly visible and scorable when the primers are labelled using fluorophores and detected using automated genotyper. However, when visualised using DNA intercalating dyes, either using agarose gels or the Agilent BioAnalyser, the signal obtained is very weak and even when visible, does not allow easy scoring of the alleles (see Figure 2). Furthermore, there are bands visible that do not appear to be related to the predicted microsatellite containing fragments. We have tried to use more cycles in the PCR in the hope that more products may be amplified allowing easier visualisation of the bands. This did not produce the desired effect (data not shown).

Figure 4. Variable I-SSR profiles. DNA from 2 samples of the varieties Ambo and King Edwards were amplified using the I-SSR primer (GTC)5A. From right to left the amount of DNA in adjacent tracks represent a ten-fold decrease, starting with ~10 ng per reaction. Arrows denote bands that vary in intensity with DNA amount.

Real-time PCR data offer a simple explanation. Increases in fluorescence during PCR reflect the synthesis of new DNA fragments. The sigmoidal curves generated show that most PCR reactions peak and the latter cycles do not generate more signal (plateau). This stationary phase of PCR is caused by the exhaustion of some factor (dNTPs or primers). During this stage DNA fragments are denatured and re-hybridised depending on the reaction temperature. In samples where multiple related fragments are present, homology between these allow mistmatched hybrids to form. This is similar to the method of heterduplex analyses, where different fragments are

- 15 -

mixed together, denatured and allowed to anneal to form homo- and heteroduplex DNA (see Figure 5). This process offers an answer to both the weak signal from fragments and the unexplained fragments that was observed. The formation of heteroduplexes acts to compete with homoduplex formation. In a simple case, a diploid with two alleles, there is the potential to form the two homoduplexes but also the potential to form two heteroduplexes. This leads to a 50% reduction in the signal of each band. The fact that potato is a tetraploid increases the number of alleles found in an individual, leading to further reduction in signal. Since most alleles differ by changes in numbers of SSR repeats, heteroduplexes formed from length variants will contain „kinks‟ due to looping out of the extra repeats. These act to impede the migration of the DNA during electrophoresis, resulting in heteroduplexes migrating behind the homoduplexes on gels. Furthermore, the loop that is formed could take place in any of the extra repeats to produce any number of heteroduplex „isoschizomers‟ (see Figure 5). Finally, sequence variation within the non-SSR sequences provides a final complication to the possible heteroduplexes that can form. Due to the weak signals it is therefore unlikely that SSRs would provide a robust marker system to use with the Agilent BioAnalyser.

Figure 5. Heteroduplexes formed during PCR. Two SSR alleles have the potential to form homoduplexes or heteroduplexes when denatured and allowed to anneal together. The circles denote the „looping out‟ of the extra SSR repeats from the longer allele and the letters A and B denote single strands of the two length variants and A‟ and B‟ their reverse complement, respectively. Filled boxes denote non SSR sequences within the fragments. The arrows denote the alternative isoschizomers that can form or through migration of the loop.

As an alternative system we tested the use of inter-SSRs (I-SSR) as an alternative marker for potato variety identification. Unlike SSRs, the non-SSR regions of the

A

A’

B

B’

Homoduplex

hybridisation

Heteroduplex

hybridisation

A

B’

B

A’

- 16 -

different fragments will not be related and thereby unable to hybridise to form heteroduplex. Firstly we tested I-SSR primers for their ability to amplify variable products and then tested their reproducibility in a set of samples. Although polymorphisms are amplified which are indicative of variety, bands amplified were affected by DNA concentration (see Figure 4) and thus were unlikely to be sufficiently robust to stand up as evidence in a court of law. 5. Conclusions The use of SSRs in the Agilent BioAnalyser for discrimination/identification of potato varieties is hampered by a combination of insufficient resolution based on size determination of fragments combined with weak signals on the gels. Although it is possible to group fragments within a size range, there are always those on the border between the different ranges. These problems become more acute when weak signals from each fragment, postulated to be due to heteroduplex formation during the amplification process, make it more difficult to visualise the products. For these reasons, SSRs are not a good marker system to use on the Agilent BioAnaylser. 6. Acknowledgements Liz Moran (Worcester Scientific Services) is thanked for providing free access to an AB. 7. References

Jeffreys A.J., Wilson V. and Thein S.L. (1985). Hypervariable 'minisatellite' regions in human DNA. Nature 314: 67-73.

Corbett G., Lee D., Donini P. and Cooke R.J. (2001). Identification of potato varieties by DNA profiling. Acta Horticulturae 546: 387-390.

Milbourne D., Meyer R.C., Collins A.J., Ramsay L.D., Gebhardt C. and Waugh, R. (1998). Isolation, characterisation and mapping of simple sequence repeat loci in potato. Mol. Gen. Genet. 259: 233-245.

Fisher P.J., Gardner R.C. and Richardson, T.E. (1996). Single locus microsatellites isolated using 5‟ anchored PCR. Nucl. Acids Res. 24: 4369-4371.