Evidence Project Final Report - randd.defra.gov.ukrandd.defra.gov.uk/Document.aspx?Document=13361_evid4_PH0440… · insecticide-degrading enzymes indicates that these oils may be

EVID4 Evidence Project Final Report (Rev. 06/11) Page 1 of 38

General Enquiries on the form should be made to:

Defra, Procurements and Commercial Function (Evidence Procurement Team) E-mail: [email protected]

Evidence Project Final Report

Note

In line with the Freedom of Information Act 2000, Defra aims to place the results of its completed research projects in the public domain wherever possible. The Evidence Project Final Report is designed to capture the information on the results and outputs of Defra-funded research in a format that is easily publishable through the Defra website An Evidence Project Final Report must be completed for all projects.

This form is in Word format and the boxes may be expanded, as appropriate.

ACCESS TO INFORMATION

The information collected on this form will be stored electronically and may be sent to any part of Defra, or to individual researchers or organisations outside Defra for the purposes of reviewing the project. Defra may also disclose the information to any outside organisation acting as an agent authorised by Defra to process final research reports on its behalf. Defra intends to publish this form on its website, unless there are strong reasons not to, which fully comply with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.

Defra may be required to release information, including personal data and commercial information, on request under the Environmental Information Regulations or the Freedom of Information Act 2000. However, Defra will not permit any unwarranted breach of confidentiality or act in contravention of its obligations under the Data Protection Act 1998. Defra or its appointed agents may use the name, address or other details on your form to contact you in connection with occasional customer research aimed at improving the processes through which Defra works with its contractors.

Project identification

1. Defra Project code PH0440

2. Project title

Developing an Integrated Pest Management Approach for the Containment and Eradication of Bemisia tabaci (Gennadius).

3. Contractor organisation(s)

Dr Andrew G S Cuthbertson

Fera, Sand Hutton York YO41 1LZ

54. Total Defra project costs £ 210,000

(agreed fixed price)

5. Project: start date ................ 01/08/2010

end date ................. 30/09/2013

mailto:[email protected]


6. It is Defra’s intention to publish this form.

Please confirm your agreement to do so. ........................................................................................................ YES

(a) When preparing Evidence Project Final Reports contractors should bear in mind that Defra intends that they be made public. They should be written in a clear and concise manner and represent a full account of the research project which someone not closely associated with the project can follow.

Defra recognises that in a small minority of cases there may be information, such as intellectual property or commercially confidential data, used in or generated by the research project, which should not be disclosed. In these cases, such information should be detailed in a separate annex (not to be published) so that the Evidence Project Final Report can be placed in the public domain. Where it is impossible to complete the Final Report without including references to any sensitive or confidential data, the information should be included and section (b) completed. NB: only in exceptional circumstances will Defra expect contractors to give a "No" answer.

In all cases, reasons for withholding information must be fully in line with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.

(b) If you have answered NO, please explain why the Final report should not be released into public domain

Executive Summary

7. The executive summary must not exceed 2 sides in total of A4 and should be understandable to the intelligent non-scientist. It should cover the main objectives, methods and findings of the research, together with any other significant events and options for new work.

● Bemisia tabaci remains a serious threat to the UK horticultural industry. It is of specific economic concern because it is an effective vector of over 111 viruses from several groups, particularly geminiviruses.

● Within the European Community the UK has ‘Protected Zone’ status to prevent spread of B. tabaci. Within this zone the primary concern is that adult whitefly imported on ornamentals such as poinsettia can infect tomatoes with Tomato Yellow Leaf Curl Virus (TYLCV) and cucumbers with Curcubit Yellow Stunting Disorder Virus (CYSDV) and Cucumber Vein Yellowing Virus (CVYV). These viruses are not currently present in the protected area but have been detected in B. tabaci intercepted entering the UK.

• Preserved insects from all historic B. tabaci interceptions held at Fera have been analysed for biotype. Approximately 60% of interceptions were determined to be Q-type whilst the remainder comprised B-type (26%) and specimens of other biotypes (yet to be determined). This confirms widely held suspicions that the Q-type is now frequently entering the UK. This is the first unequivocal determination of the ingress of B. tabaci Q into the UK and the first time that biotyping of whitefly has been undertaken at Fera.

• Bemisia samples received from Finland underwent biotyping. All samples received were determined as Q biotype.

• The potential of novel insecticidal fusion proteins were assessed against adult B. tabaci. Using an artificial diet delivery system, the toxicity of two fusion proteins (FP4 and FP5) was evaluated. Both fusion proteins proved to be highly toxic to Q-type whiteflies, illustrating the potential for these insecticidal proteins to be used against B. tabaci.

• For the first time in the UK, Tomato Yellow Leaf Curl Sardinia Virus was detected in intercepted B-type Bemisia on material originating from Israel using a Real-time Taqman® assay.

• The resistance status of a B. tabaci strain established from insects intercepted from within a UK glasshouse was investigated. Very high levels of resistance to pymetrozine, acetamiprid and imidacloprid (50-100x) were recorded, indicating very strong metabolic resistance. This is the first time that definite evidence of resistance in a strain collected from the UK has been determined and indicates that populations that establish in glasshouses in Britain may be very difficult to eradicate using the insecticides that are currently available.

• The potential for spraying oil to synergise insecticides has been discovered. Effective suppression of insecticide-degrading enzymes indicates that these oils may be used as synergists for products to which Bemisia has become resistant.


• Exposure to insecticides has demonstrated that esterase activity in Q-type whiteflies is elevated markedly on exposure (to acetamiprid), whilst that of the B-type is suppressed slightly. This suggests that alternative insecticide detoxification mechanisms are probably more important than esterases. To this end, cytochrome P450 monooxygenase activity was studied and Q-type Bemisia were shown to have significantly higher levels of these enzymes than the non-resistant B-type flies. This strongly indicates P450-mediated detoxification to be involved in resistance.

• Assessments of entomopathogenic fungi (Beauveria bassiana (Naturalis)) have identified promising formulations and also demonstrated differing susceptibilities between B and Q type insects. Upwards of 50% mortality of B-biotype eggs was achieved using B. bassiana.

• There was little difference in efficacy of the nematodes investigated against the two Bemisia biotypes. Steinernema carpocapsae proved better against B biotype whereas S. feltiae was slightly better in dealing with Q biotype instars. For both species of nematodes overall best efficacy was shown against the 2/3rd instar stages of Q biotype with upwards of 75% mortality being achieved.

• Investigating the feeding rates of three predatory mite species (Amblyseius swirskii, Amblyseius montdorensis, Typhlodromalus limonicus) has proven all three readily feed upon the early life-stages of Bemisia. Approximately 30% of eggs were fed upon by A. swirskii following a 48hr period. Feeding rates slightly decreased for all mite species when feeding on 1st instar life-stages (27, 24, 16% respectively) and significantly decreased when feeding on 2nd instars (8.5, 8.5, 8.7% respectively).

• Investigation of the compatibility of the two commercially available predatory mite species (A. swirskii and A. montdorensis) both directly and indirectly with various chemicals was undertaken. Movento (Spirotetramat) had the least effect on both predatory mite species when applied as direct and indirect treatments. SB-Plant Invigorator when applied as a direct treatment caused the greatest mortality against both mite species. The majority of mites exposed to a direct application of Tri-Tek (awaiting UK registration) were alive but did appear to have been affected by the treatment, with reduced movement observed.

• Investigating mutual compatibility of the mites together proved that both mite species could be applied together. Upwards on 80% mite recovery was obtained when specimens of both mites were placed together for a 72hr period. Neither species seemed detrimental to the other.

● Different control products were deemed better than others for treating various life stages of Bemisia; Eggs: Abamectin, Acetamiprid, Tri-Tek and SB-Plant Invigorator; Instars: Agri-50E, B. bassiana, Tri-Tek and SP-Plant Invigorator; Adults: B. bassiana, Addit, Tri-Tek and Spraying Oil.

• Under glasshouse conditions Tri-Tek proved excellent against B. tabaci Q eggs with 100% mortality being achieved. Beauveria bassiana provided 74% egg mortality. Tank-mixing the two products also produced 100% egg mortality. Against 2nd instar B. tabaci Q larvae Tri-Tek and B. bassiana provided 69% and 65% mortality respectively. Tank-mixing the products increased mortality to 95.5%.

• The sequential spray applications developed in the laboratory have given great potential for eradication of B. tabaci on imported poinsettias. These spray regimes have been readily adopted by PHSI and are now recommended to nursery growers should they be required.

• The research findings and treatment recommendations in the current project allow UK nursery growers and protected horticulturalists to currently stay one step ahead of Bemisia. However, with other biotypes (not B or Q) already being detected entering the UK, Bemisia will no doubt continue to be a major problem.

• Cost benefit analysis has been done outlining the potential of incorporating the spray programmes developed into Bemisia eradication in both poinsettia and tomato crops. For both crops they quite clearly showed that the proposed treatment programmes would be cost effective if successful.

Project Report to Defra

8. As a guide this report should be no longer than 20 sides of A4. This report is to provide Defra with details of the outputs of the research project for internal purposes; to meet the terms of the contract; and to allow Defra to publish details of the outputs to meet Environmental Information Regulation or Freedom of Information obligations. This short report to Defra does not preclude contractors from also seeking to publish a full, formal scientific report/paper in an appropriate scientific or other journal/publication. Indeed, Defra actively encourages such publications as part of the contract terms. The report to Defra should include:

the objectives as set out in the contract;

the extent to which the objectives set out in the contract have been met;

details of methods used and the results obtained, including statistical analysis (if appropriate);

a discussion of the results and their reliability;

the main implications of the findings;


possible future work; and

any action resulting from the research (e.g. IP, Knowledge Exchange).

Introduction

The poinsettia strain of the tobacco whitefly, Bemisia tabaci, remains a serious threat to the UK horticultural industry

1. The damaging B-biotype is of specific economic concern because it is an effective vector of over

111 viruses from several groups, particularly geminiviruses2. In addition this biotype is more polyphagous,

develops faster and is more fecund than other strains. Within the European Community the UK has ‘Protected Zone’ status to prevent spread of B. tabaci

1. Within this zone the primary concern is that adult

whitefly imported on ornamentals such as poinsettia can infect tomatoes with Tomato Yellow Leaf Curl Virus (TYLCV) and Tomato Yellow Leaf Curl Sardinia virus (TYLCSV) and cucumbers with Curcubit Yellow Stunting Disorder Virus (CYSDV) and Cucumber Vein Yellowing Virus (CVYV). These are viruses not currently present in the protected area, but some of which, have now been detected in B. tabaci intercepted entering the UK

3. Direct damage to plants by B. tabaci is caused by feeding activity and indirect damage due

to contamination of leaves with honeydew, on which black mould develops and intercepts light, thereby reducing photosynthesis

4. Both sources of damage affect the marketability of the crop.

Statutory action is taken to prevent live stages of the pest entering the UK1. However, where outbreaks do

occur measures must be taken to eradicate the population. Where crops have a distinct growing season clean up measures can be taken to prevent the pest transferring to subsequent plantings. However, this is particularly difficult when commodities with a longer growing season such as vegetables and cut flowers are planted. It is also difficult to eradicate from areas which allow public access as this often constrains the use of chemical insecticides.

Where intensive cropping regimes exist there is always a continuous supply of young plant material for the pest to infest. There are few opportunities for complete glasshouse sterilisation and unless a targeted and synchronised treatment regime is implemented, long term outbreaks can occur. Commercial constraints and regulatory restrictions applied to pesticides mean that few products are available for use in the UK

1.

Much work has been done on the potential of entomopathogenic biocontrol agents being incorporated into integrated pest management (IPM) strategies against B. tabaci, not least as a result of previous Plant Health Division funded work (Research Projects: PH0157, PH0405). Here, an entomopathogenic nematode (Steinernema feltiae) and the fungus used in the current study (Lecanicillium muscarium) where shown to be most effective against second instar B. tabaci larvae

5-7. Both entomopathogenic control agents also proved

potentially suitable to be incorporated into IPM strategies using commonly used chemical insecticides for the control of B. tabaci within the UK

8-9 and offer potential to control second instar larvae within the glasshouse

environment10-11

. In support of such control and eradication approaches, further information is needed on compatibility of other fungi with candidate conventional insecticides and the efficacy of a wider range of insecticides for the control of B. tabaci.

The aim of the current project was to investigate via a modular approach a range of control options for eradication of B. tabaci on poinsettia plants. Whitefly specimens intercepted on plant produce entering the UK were bio-typed. A range of chemical treatments were investigated along with suitable biological control agents (fungi, nematodes and predatory mites). These treatments were assessed individually as well as their compatibility with each other. The possibility of synergism working within the chemical products was also investigated.

Objective 1: Conducting a literature review to obtain new data and information published since the last review was conducted and determine current industry practice.

Milestone 1: Complete literature review to obtain data on potential eradication methods and determine current industry practice.

A full review was undertaken covering the following areas of B. tabaci research: biological control, chemical control and molecular bio-typing. Information/outlook on the current industry practices was supplied by the industry representatives, Dr Rob Jacobson and Dr John Buxton (since deceased), who were both part of the project science delivery team. A section of the review also outlined the current situation of B. tabaci within the UK (upto 2009). Two papers have been published from the literature review entitled as follows:

1) Cuthbertson, A.G.S., Blackburn, L.F., Eyre, D.P., Cannon, R.J.C., Miller, J. & Northing, P. (2011). Bemisia tabaci: The current situation in the UK and the prospect of developing strategies for eradication using entomopathogens. Insect Science, 18: 1-10.

Abstract: The sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) remains a serious threat to crops worldwide. The damaging B-biotype is of specific economic concern because it is an effective


vector of over 111 viruses from several families, particularly geminiviruses. Bemisia tabaci is regularly intercepted on plants coming into the UK where it is subjected to a policy of eradication. The UK maintains Protective Zone status against this pest. A main pathway of entry of B. tabaci into the Protected Zone involves propagating material, especially Poinsettia (Euphorbia pulcherrima). With increased insecticide resistance continuously being recorded, B. tabaci is becoming more difficult to control/eradicate. Recent research involving both entomopathogenic nematodes and fungi is showing much potential for the development of control programmes for this pest. Both the nematode Steinernema feltiae and the fungus Lecanicillium muscarium have been shown to be most effective against second instar B. tabaci. Fine tuning of the environmental conditions required has also increased their efficacy. The entomopathogens have also shown a high level of compatibility with chemical insecticides, all increasing their potential to be incorporated into control strategies against B. tabaci.

2) Cuthbertson, A.G.S., Blackburn, L.F., Mathers, J.J. & Northing, P. (2011). A review of the use of entomopathogenic nematodes for the control of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect Pathogens and Entomopathogenic Nematodes IOBC/wprs Bulletin 66: 317-320.

The above paper was presented at the 13th European Meeting of the IOBC/WPRS Working Group Insect Pathogens and Entomopathogenic Nematodes” dealing with ‘Biological Control in IPM systems’ in Innsbruck, Austria in June 2011. This paper outlined our work investigating the role of entomopathogenic nematodes in IPM strategies against Bemisia tabaci.

A copy of both papers can be provided upon request.

Objective 2: Collecting samples from all current and new outbreaks and testing for the ‘biotype’ and building up cultures of each of the biotypes commonly intercepted in the UK for use throughout the project.

Milestone 3: Develop and validate protocols for biotyping of B. tabaci.

It is reported that there are as many as 24 different biotypes of B. tabaci which cannot be identified by their morphological traits. They can only be distinguished at the molecular level

12. These biotypes have very different

biological characteristics regarding their invasiveness, insecticidal resistance profile, pathogens they vector and host range

13. It is the B and Q biotypes that are important as they currently represent the most damaging

biotypes. The ability to rapidly and precisely biotype B. tabaci interceptions is vital when developing effective control/eradication strategies.

Materials and Methods

DNA extractions

Historical intercepted B. tabaci samples (n=68) received from the PHSI during 2002 to 2003 underwent DNA extraction (from individual whiteflies) using the methods described by Boonham et al.

14. Briefly, individual

whiteflies were ground in 0.5ml Treff microcentrifuge tubes with 50µl of molecular grade water and stored on ice. A slurry of 50% w:v of Chelex 100 resin (Bio-Rad) was added to each tube and heated at 95°C for 5 min on a thermocycler. The extract was centrifuged at 12000 rpm for 5 min, the supernatant was removed and stored at -20 until use.

TaqMan® real-time PCR

The TaqMan® assay was adapted from Jones et al.15

(Table 1). This assay targets the single nucleotide polymorphism (SNP) in the mitochondrial cytochrome oxidase I (mtCOI) gene. Each 25 µl PCR reaction comprised of 1 µl of DNA extract, 10X Buffer A, 5.5mM of MgCl2, 0.025U AmpliTaq Gold® (Applied Biosystems), 2 mM dNTPs (Web Scientific) and 300 nM of each primer and 100 nM of each probe, with the remaining volume being made up of molecular grade water. Real-time PCR was performed in an ABI Prism 7500 Sequence Detection System (Applied Biosystems) using temperature conditions of 10 min at 95°C followed by 40 cycles of 95°C for 10 s and 60°C for 45s.


Table 1. Details of TaqMan® assay designed to discriminate between B and Q biotypes.

Name Sequence 5’-3’ Probe label

BEMBQ-SNP1F GCCTTTGATTTACAGGATTTTTATTTTTATTTACTATAGGT -

BEMBQ-SNP1R GAAATCAATAGATAACTCCTCCTACAATAGCA -

SNP1V2 Probe ATG CAG ACA CACATC VIC- MGBNFQ

SNP1M2 Probe ATG CAA ACA CACATC 6FAM -MGBNFQ

Results

The TaqMan® assay gave positive results for 57 out of the 68 whitefly samples. The positive results indicated that 68.4% and 31.6% of the interceptions were the Q and B biotype, respectively. Of the biotypes intercepted, 22 originated from Israel, 6 were from Spain and The Netherlands respectively, 4 from Africa, 2 from Portugal and Denmark respectively (Figure 1). For the remainder (18) no information regarding origin was available. All of the insects that were indicated to have originated in Portugal and Denmark were the Q biotype. The proportion of Q biotypes from Spain, Israel, Netherlands, Africa and of unknown origin were variable at 83.3%, 76.2%, 66.7%, 66.7% and 47.0%, respectively (Figure 2).

Figure 1. Number of B and Q biotypes intercepted from country of origin.


Figure 2. Percentage of B and Q biotypes from country of origin.

Discussion

A rapid and accurate method of differentiating between intercepted B. tabaci biotypes has been developed and validated. The majority of intercepetions of B. tabaci entering the UK are now deemed as Q-type. This information is vital in the development and implementation of control/eradication programmes. Q-biotype is considered by Nauen

16 to be showing the most resistance development to neconicotinoid insecticides, in that resistance

develops more quickly and remains more stable in the absence of selection pressure, than in the B-type. Recently Schuster et al.

17 has reported cases of neconicotinoid resistance in B-type. Quickly knowing what biotype is

present at an incerception/outbreak site gives the advantage that certain control methods can be employed immediately.

This work has been published in two papers as follows:

1) Powell, M.E., Cuthbertson, A.G.S., Bell, H.A., Boonham, N., Morris, J. & Northing, P. (2012). First record of the Q Biotype of the sweetpotato whitefly, Bemisia tabaci, intercepted in the UK. European Journal of Plant Pathology, 133: 797-801.

Abstract: The sweetpotato whitefly, Bemisia tabaci, Gennadius (Hemiptera: Alerodidae) is an important worldwide pest of many ornamental and greenhouse crops. Within the UK, B. tabaci poses a threat primarily to protected vegetable crops due to the transmission of several plant-pathogenic viruses. There are at least 24 different biotypes of B. tabaci that cannot be differentiated through morphological traits and can only be distinguished at the molecular level. These biotypes differ markedly with respect to a number of biological characteristics such as their invasiveness, insecticide resistance profile, host range and capacity to vector pathogens. The B and Q biotypes are widely considered to be the most important and, as such, the ability to rapidly and precisely biotype B. tabaci interceptions is vital when developing effective control strategies. Intercepted B. tabaci (n=68) received from the Plant Health Seeds Inspectorate (PHSI) during 2002 to 2003 were biotyped using a real-time TaqMan® assay. This assay targets the single nucleotide polymorphism (SNP) in the mitochondrial cytochrome oxidase I (mtCOI) gene. The TaqMan® assay gave positive results for 57 out of the 68 whitefly samples. The positive results indicated that 68.4% and 31.6% of the interceptions were the Q and B biotype, respectively. Of the biotypes intercepted, 36.8% originated from Israel, 10.5% were from Spain and The Netherlands respectively, 5.3% from Africa, 3.5% from Portugal and Denmark. For the remainder no information regarding origin was available. All of the insects that were indicated to have originated in Portugal and Denmark were the Q biotype. The proportion of Q biotypes from Spain, Israel, Netherlands, Africa and of unknown origin were variable at 83.3%, 76.2%, 66.7%, 66.7% and 47.0%, respectively. The implications in regards to pest management of the pest are discussed.

2) Powell, M.E. & Cuthbertson, A.G.S. (2013). Pest control: distinguishing between different biotypes of Bemisia tabaci in the UK. The Biologist, 60: 18-21.

Abstract: The sweetpotato whitefly (Bemisia tabaci) is not established in the UK, however it poses a threat


primarily to protected vegetable crops due to the transmission of several plant-pathogenic viruses. At least 24 different biotypes of B. tabaci have been recognised. These cannot be differentiated through morphological traits and, as such, the ability to rapidly and precisely biotype B. tabaci interceptions is vital when developing effective control strategies.

Reprints of both papers can be provided upon request.

Objective 3: Evaluating the potential for the use of chemical approaches in an IPM system (e.g. temporal synergism, ‘biorational’ pesticides and any further conventional insecticides against B. tabaci that have not already been investigated).

Milestone 5: (A) Complete 1st series of insecticide dose response experiments against both susceptible and resistant biotypes.


The susceptibility of the B. tabaci (B and Q) strains held in culture in the quarantine facility were screened against a number of commonly used insecticides. Insects were exposed to leaf discs (~40mm dia.) treated with a range of aqueous dilutions of the neonicotinoids imidacloprid (Intercept® WG) and acetamiprid (Gazelle® WG), as well as the feeding inhibitors, pymetrozine (Chess® WG) and flonicamid (Teppeki® WG) using a leaf dip method devised by Cuthbertson et al.

18. Treated leaves were placed in 50mm dia. Petri dishes containing a thin layer (~2mm

depth) of standard agar, abaxial veins upwards, and 10 adult females were introduced into each dish. A minimum of 4 replicates of each dose were set up for each experimental run and dishes were held at 21 ±1°C under a light regime of 16h light: 8h dark. Survival was monitored at 24h intervals over a 96h period and ED50 values were calculated using probit analysis.

Results and Discussion

Comparison of susceptibility of the B and Q strains demonstrated considerable resistance (<30x) in the Q strain to three of the four compounds evaluated, however no resistance to flonicamid was observed in this strain (Table 2). Since the majority of historic and recent interceptions biotyped (within the life of this project) have been the Q-type, it is probable that these insecticides would be rendered ineffective against B. tabaci, should similar levels of resistance occur in future outbreaks. Similar instances of cross resistance to neonicotinoids and pymetrozine have been observed previously.

Table 2. Estimated insecticide dose required to kill 50% of the Lab (susceptible) and Com (field) strains of B. tabaci females.

Lab (B-type) Com (Q-type)

Compound ED50 † (95% CI) ED50 † (95% CI) RF

Acetamiprid (Gazelle® SG) 0.59 (0.43 - 0.86) 18.81 (13.30 - 33.39) 31.94

Imidacloprid (Intercept® WG) 0.70 (0.46 - 1.07) 22.96 (11.66 - 97.65) 32.85

Pymetrozine (Chess® WG) 1.17* - 41.50 (20.31 - 1801.81) 35.62

Flonicamid (Teppeki ®WG) 1.46 (0.95 - 4.20) 0.67 (0.43 - 0.91) 0.46

† - dose expressed as a proportion or multiple of the maximum field application rate.

* - insignificant slope; limits could not be calculated.

(B) Initial Efficacy Tests for Fusion Proteins against B. tabaci (Q-biotype)

Introduction

The high levels of resistance of an intercepted strain of B. tabaci to pymetrozine, acetamiprid and imidacloprid (<30x) have been reported above. Therefore populations that establish in protected UK crops could prove difficult


to eradicate using conventional insecticides currently available. The potential of novel insecticidal fusion proteins has been assessed against adult B. tabaci. Fera and Durham University have discovered and patented a platform technology for producing novel orally toxic insecticidal fusion proteins. Recombinant techniques are used to link a gene encoding an insect-specific toxic peptide or protein whose target of action is accessed via the circulatory system to a gene encoding a carrier protein which is able to cross the gut epithelium and pass into the haemolymph. The resulting construct is expressed in a microbial host, producing a fusion protein containing both components. The fusion with the carrier enables transport of the linked toxin across the gut epithelium, so that insect-specific, biologically active proteins or peptides, which have limited or no toxicity when ingested, can be converted into orally active insecticides19.

Two fusion proteins (FP), each fused to the Galanthus nivalis agglutinin (GNA) carrier, were available for test against the resistant Q-type of B. tabaci. FP4 contains a toxin derived from the Red Scorpion (Mesobuthus tumulus) toxin (ButalT)

20, while FP5 contains an omega-atracotoxin derived from the Funnel-web Spider

(Hadronyche versuta).


Each fusion protein was made up in a 30% (w/v) sugar solution at concentrations of 2.5, 1.25 and 0.625 mg ml-1

. Female B. tabaci adults were placed in 5cm dia. Petri dish bases, sealed with a parafilm® membrane, and 0.2 ml of each FP solution placed on the parafilm® surface and sealed with an additional membrane. Controls using 30% sugar solution and starved adults were also set up and adult mortality was observed over consecutive days. The number of adults feeding was also noted.


The potential of the novel insecticidal fusion proteins against adult B. tabaci has been examined using an artificial diet delivery system (Figure 3). Initial mortality for both proteins, at all concentrations, was consistently lower than the starved controls, but greater than the sugar controls. That a number of adults were also observed feeding during this initial period, suggests that whitefly mortality was due to the toxicity of two fusion proteins. Whilst delivery to the ‘crawler’ stage (1st instar) proved unsuccessful, using a variation of the leaf-dip technique, fusion proteins exhibit potential as an alternative to established pesticides where resistance is present.

Figure 3. Effect of fusion proteins on Bemisia tabaci (Q-type) adults.

Milestone 8: Complete dose response experiments against susceptible and resistant biotypes using the temporal synergist approach.

This milestone aimed to assess the impact of the exposure of B. tabaci to a synergist at set time points prior to insecticide exposure for the reduction of the expression of resistance in Q-type whiteflies. Fundamental to


designing a temporal synergism strategy is an understanding of the detoxification methods employed by the insect. As a result the general esterase activity and cytochrome P450 levels were investigated, as well as the effects on these enzymes of in vivo exposure of adult B. tabaci to synergists and insecticidal compounds.


Temporal Synergism

In vitro assays - esterases. Poinsettia leaf disks were treated through leaf dipping with a 30 mM piperonyl butoxide (PBO) solution and allowed to dry. Bemisia tabaci adults (Q-type) were placed on the leaves and exposed to the PBO for up to 24 hours. Insects were culled at 1 hour intervals and stored at -20°C until extraction. The insects were subsequently extracted in phosphate buffer (1 insect in 2µl) and general esterase activity measured against 1-napthyl acetate at 30 second intervals over the course of 15 minutes according to the methods described by Khot et al.

21. Esterase activity was characterized by an increase in absorbance at 450 nm

over the assay period and activity was expressed through calculation of the slope. Each assay was completed in triplicate. Insufficient insects to determine the protein content of the extracts which would have allowed the results to be adjusted for variations between the samples

Assays were repeated in greater detail for the 6 and 24 hour time points and results expressed in terms of esterase activity per unit protein. Further assays were conducted against insects exposed to acetamiprid and the spraying oil Tri-Tek. In the case of acetamiprid, Q types were exposed to leaves treated with 2x field rate concentrations and the B types to a 0.5 x concentration. For Tri-Tek, Q types only were exposed to a sub-lethal concentration of the material on leaves for 24 hours. For B type esterase activity the procedures were as described above for Q type whitefly except that the substrate was nitrophenyl acetate with the inclusion of Fast Blue RR salt

22. Assays were conducted in triplicate on at least two separate occasions and from at least two

different enzyme preparations.

In vitro assays - cytochrome P450 levels. The quantities of the detoxifying cytochrome P450 enzymes were measured according to the haem-peroxidase method of Brogden et al.

23. This assay quantifies the haem-

containing protein (the majority of which is cytochrome P450). Insects were extracted in potassium phosphate buffer (1-2 insects per 10 µl). A solution of TMBZ solution (10 mg of 3,30,5,50-tetramethyl benzidine in 10 ml methanol mixed with 20 ml of sodium acetate buffer was added to 20 µl aliquots of insect homogenate. Twenty-five microliters of 3% hydrogen peroxide were added, and the mixture left for one hour at room temperature. The change in absorbance was measured at 650 nm in a microtitre plate reader and values were compared with a standard curve of optical densities prepared with known concentrations of cytochrome c from horse heart type VI.

Bemisia tabaci exposed to surface deposits of acetamiprid, PBO and Tri-Tek as well as control insects exposed water-treated leaves were examined. Five assays were conducted for each treatment on at least three separate occasions from at least three different insect homogenates peer treatment.

In vivo synergism. To assess the effect of PBO on the survival of B. tabaci when exposed to acetamiprid, insects were exposed to the synergist for 6 and 12 hours prior to transferral to insecticide treated leaves. A minimum of four replicates were undertaken for a series of acetamiprid comprising of 30 insects each. The mortality of insects was determined daily for four days.

Results

Temporal synergism: Effects of PBO and other compounds on esterase activity.

Exposure to PBO had a significant impact on esterase activity in exposed insects (Figure 4). Although the esterase activity was activated (negative inhibition), the results are valid and meaningful as it is known that activation when using an artificial substrate is indicative of inhibition against insecticidal substrates. As such, the assay indicated that periods of between 5 and 11 hours prior to insecticide exposure should be optimal in terms of synergising insecticide activity with PBO.


Figure 4. The esterase activity in Q-type Bemisia tabaci following exposure to PBO for periods of 1-24 hours relative to non-exposed insects. The activity is not adjusted for protein content.

The six and 24 hour time points were selected to confirm the results of the initial screen. This was undertaken as there was insufficient insect material remaining to allow protein content determinations to be made in the original 24 hour collections which would have corrected for potential differences between the two samples (control and exposed). The second experiment showed that both B and Q type esterase activity were activated by PBO and that increasing the concentration of the synergist led to increased levels of esterase activation. Notably, B-type activation was higher than in the Q-types at both the 3 and 30 mM PBO concentrations (Figure 5) and that activation was marginally greater in B-types at 24 hours and in Q-types at 6 hours. Also, it was notable that B-types showed a greater response to increased PBO concentrations over that seen in the Q-types.

24 hour PBO

Water 3 mM 30 mM0.0

0.5

1.0

1.5

2.0

2.5B type

Q type

Rela

tive a

cti

vit

y

6 hour PBO

Water 3 mM 30 mM0.0

0.5

1.0

1.5

2.0

2.5B type

Q type

Rela

tive a

cti

vit

y

Figure 5. The effect of exposure to PBO on the relative esterase activities of B and Q-type Bemisia tabaci. The results show that activation was observed that increased with synergist concentration. Activity is expressed as the mean relative activities (± SE) per unit mass protein present within the B and Q-type homogenates.

In further investigations, we examined the impact of exposure to acetamiprid and the spraying oil Tri-Tek (originally called Saf-T-Side) on esterase activity. As might be expected, exposure to acetamiprid at 2x field concentration led to an increase in activity in Q-type insects (Figure 6) whilst B-type insects showed a small reduction in activity. Tri-Tek also caused a modest (15%) but extremely consistent increase in esterase activity.


B type Q type0.0

0.5

1.0

1.5

2.0Diluent

Acetampirid

Mean

rela

tive a

cti

vit

y

Q type0.0

0.5

1.0

1.5

2.0

Diluent

Saf-T-Side

Figure 6. The effect of exposure to the neonicotinoid acetamiprid and the spraying oil Tri-Tek (Saf-T-Side) on the esterase activity of B and Q-type Bemisia tabaci.

Cytochrome P450 levels

In addition to esterases, cytochrome P450 enzymes play an important role in the detoxification of neonicotinoids and other insecticides. Therefore, a brief look at the levels of these enzymes was made in various contexts. Figure 7 shows the relative levels of cytochrome P450s that occur normally and after exposure to acetamiprid for 48 hours.

B ty

pe

Q ty

pe

B ty

pe Ace

t 48

hrs

Q ty

pe ac

et 2

4 hr

0

1

2

3

4

Rela

tive v

alu

es

Figure 7. The relative levels of cytochrome P450 levels in untreated and acetamiprid-exposed B and Q-type Bemisia tabaci.

It was seen that the levels of the enzymes are just short of double that in the Q-types over the levels found in the B-types in both contexts. Furthermore, in both biotypes, the levels are approximately doubled by exposure to surface deposits of acetamiprid (24-48 hours), emphasising the importance of these enzymes in insecticide detoxification.

Exposure to PBO had the effect of increasing the levels of Cyt P450s in a dose dependent way whilst exposure to Tri-Tek reduced overall levels of the enzymes (Figure 8).


Dilu

ent

PBO 3

mM

PBO 3

0 m

M

0.0

0.1

0.2

0.3

0.4Diluent

PBO 3 mMC

yt

C e

qu

ivale

nts

(n

g /

µg

pro

tein

)

Dilu

ent

Saf-T

-sid

e

0.0

0.1

0.2

0.3

Diluent

Saf-T-side

Cyt

C e

qu

ivale

nts

(n

g /

µg

pro

tein

)

Figure 8. Effect of exposure to PBO and Tri-Tek (Saf-T-Side) on the levels of cytochrome P450s found in Bemisia tabaci.

In vivo synergism of acetamiprid activity

When exposed to 3 mM PBO for 12 hours prior to exposure to surface deposits of acetamiprid, marked increases in mortality were observed after 1 and 2 days (Figure 9). The effect was most pronounced at the lower acetamiprid concentrations tested (1x and 5x). Notably, the mortalities achieved at the 72 and 96 hour time-points was not appreciably altered except at the very lowest concentration of acetamiprid, potentially indicating the somewhat transient nature of the synergising effect of PBO.

Figure 9. The impact of a PBO pre-exposure (3 mM) for 12 hours on the mortality of Bemisia tabaci exposed to acetamiprid at the stated doses.

Discussion

The results clearly indicate that B. tabaci esterases are sensitive to the effects of PBO. Although activation is recorded here against an artificial substrate, this is known to equate to inhibition in vivo (Graham Moores, personal communication). As a result, the data indicates that the optimal pre-treatment window for PBO is between 6 and 11 hours.


The determination of P450 levels demonstrated that these enzymes are probably playing an important role in neonicotinoid insecticide detoxification in Q type B. tabaci as has been suggested previously

24. Exposure to

acetamiprid, PBO and the “soft” insecticide Tri-Tek all had measureable impacts on cytochrome P450 levels in Q-type insects. In particular, the activation (elevated levels) seen following exposure to PBO and Tri-Tek indicates the potential for in vivo inhibition of cytochrome P450s. The results using Tri-Tek indicate that a component of Tri-Tek is potentially acting as an inhibitor of these enzymes and, as such, a product that is considered to act in a physical fashion actually has a physiological effect. This is a significant finding and one that may be exploitable through the development of novel synergists.

When B. tabaci were exposed to PBO prior to exposure to acetamiprid, increased mortality was observed. In a number of cases mortality was significantly increased (2-4 times greater) by pre-exposure to the synergist for either 6 or 12 hours (times chosen to be at the start and end of the optimal pre-exposure period). However, it was seen that the synergising effect of PBO was only apparent up to 48 hours after the start of exposure to the insecticide and mortalities after this point were largely the same, regardless of whether the insects had been pre-treated with PBO. The experimentation is continuing and it is hoped that greater levels of synergism will be achieved through pre-exposure with PBO at the optimal pre-insecticide exposure time of around 8-10 hours.

Milestone 7: Complete 2nd series of insecticide dose response experiments against both susceptible and resistant biotypes


Leaf dip tests have evaluated the effect of spiromesifen (Oberon SC) and deltamethrin (Decis Protech) against the larvae and adults of the B and Q-types of B. tabaci. An additional test assessed the effect of spirotetramat (Movento) against B-type larvae.

Tests against adults: Leaf discs (2.5cm in diameter) of Poinsettia were treated by dipping the discs in a range of doses for 10 seconds. The leaf discs were left to dry and then put into Petri dishes (5 cm in diameter) containing a thin layer of water agar (2%). Ten adult whiteflies were added to each dish, with 6 replicates prepared for each dose, including a control (distilled water). Mortality was assessed after 24, 48, 72 and 96 hours exposure at 21oC and 65% r.h.

Tests against larvae: Poinsettia leaves were previously infested with B. tabaci larvae by adding adults, contained within clip cages, to the underside of leaves for 48 hours. The adults were then removed and the leaves incubated for 12 days at 25oC and 65% r.h. Leaves infested with the larvae were then dipped in a range of doses for 10 seconds, whilst still attached to the plant. The plants were then incubated at 25oC and 65% r.h. for 7 days before being removed from the plant for mortality assessments. Tests with Movento used detached leaves with mortality recorded at 24, 48, 72, 96 hrs and 10 days.


Tests against adults: Very low mortalities were recorded against the B-type and Q-type adults of B. tabaci exposed to leaf discs treated with spiromesifen (Oberon) with less than 24% mortality recorded even at 100 times the field rate (12 g a.i./l) (Figures 10 and 11). This is not unexpected as spiromesifen predominately acts on whitefly development by reducing adult fecundity and preventing development of younger stages.

With deltamethrin (Decis Protech) mortalities of 5%, 6%, 36% and 95% were recorded with the B-type adults after 96 hours exposure to doses ranging from 0.023 g a.i./l to 0.18 g a.i./l. (Figure 12). There were high control mortalities with the Q-type adults (12-25%) but low mortalities with the pesticide (3-23%) (Figure 13). At doses higher than 0.18 g a.i./l there was a phytotoxic effect on the leaves which may have affected mortality.

Tests against larvae: Leaves treated with spiromesifen (Oberon) produced 30%, 28%, 65% and 81% mortality of B-type larvae at doses ranging from 0.015 g a.i./l to 0.12 g a.i./l (Figure 14). Against the Q-type larvae, spiromesifen produced mortalities of 0%, 9%, 38% and 73% at doses ranging from 0.015 g a.i./l to 0.12 g a.i./l (Figure 15).

Leaves treated with deltamethrin (Decis Protech) produced 16%, 20%, 43% and 69% mortality of the B-type larvae at doses ranging from 0.0045 g a.i./l to 0.036 g a.i./l (Figure 16). Against the Q-type larvae, deltamethrin produced mortalities of 0%, 21%, 27% and 42% at doses ranging from 0.009 g a.i./l to 0.072 g a.i./l (Figure 17).

With spirotetramat (Movento) at 0.12 g a.i./l, there was 71% mortality after 96 hours with 100% of the larvae failing to reach pupation after 10 days exposure (Figure 18).

Probit analysis was performed on the data for spiromesifen and deltamethrin against the larvae of both biotypes and with deltamethrin against the B-type adults (96 hour data) (Table 3). Estimates of the ED50 could only be provided for spiromesifen against the B-type larvae and deltamethrin against the B-type adults and Q-type larvae because there was a significant difference between the experimental data and the fitted line. Figures 19 and 20 show the comparison between the probit lines for the B-type and Q-type larvae following exposure to


spiromesifen and deltamethrin respectively.

0

10

20

30

40

50

60

70

80

90

100

0.012 (x0.1) 0.12 (x1) 1.2 (x10) 12 (x100)

Co

rre

cte

d %

mo

rtal

ity

Dose (g a.i. /l) (proportion of field rate)

Spiromesifen (Oberon) vs Bemisia tabaci adults (B-type)

24 hours

48 hours

72 hours

96 hours

Figure 10. Spiromesifen (Oberon) vs B-type adults.

0

10

20

30

40

50

60

70

80

90

100

0.012 (x0.1) 0.12 (x1) 1.2 (x10) 12 (x100)

Co

rre

cte

d %

mo

rtal

ity


Spiromesifen (Oberon) vs Bemisia tabaci adults (Q-type)

24 hours

48 hours

72 hours

96 hours

Figure 11. Spiromesifen (Oberon) vs Q-type adults.

0

20

40

60

80

100

0.023 / (x1.25) 0.045 / (x2.5) 0.09 / (x5) 0.18 / (x10)

Co

rre

cte

d %

mo

rtal

ity

Dose (g a.i. /l) / (proportion of field rate)

Deltamethrin (Decis Protech) vs Bemisia tabaci adults (B-type)

24 hours

48 hours

72 hours

96 hours

Figure 12. Deltamethrin (Decis Protech) vs B-type adults.


Figure 13. Deltamethrin (Decis Protech) vs Q-type adults.

0

20

40

60

80

100

0.015 (x0.125) 0.03 (x0.25) 0.06 (x0.5) 0.12 (x1)

Co

rre

cte

d %

mo

rtal

ity


Spiromesifen (Oberon) vs Bemisia tabaci larvae (B-type) (attached leaves)

Figure 14. Spiromesifen (Oberon) vs B-type larvae using attached leaves.

0

20

40

60

80

100

0.015 (x0.125) 0.03 (x0.25) 0.06 (x0.5) 0.12 (x1)

Co

rre

cte

d %

mo

rtal

ity


Spiromesifen (Oberon) vs Bemisia tabaci larvae (Q-type) (attached leaves)

Figure 15. Spiromesifen (Oberon) vs Q-type larvae using attached leaves.


0

20

40

60

80

100

0.0045 (x0.25) 0.009 (x0.5) 0.018 (x1) 0.036 (x2)

Co

rre

cte

d %

mo

rtal

ity


Deltamethrin (Decis Protech) vs Bemisia tabaci larvae (B-type) (attached leaves)

Figure 16. Deltamethrin (Decis Protech) vs B-type larvae using attached leaves.

Figure 17. Deltamethrin (Decis Protech) vs Q-type larvae using attached leaves.

Figure 18. Spirotetramat (Movento) vs B-type larvae using detached leaves.


Table 3: Results of Probit analysis

Treatment Lifestage Biotype ED50 (g a.i./l)

95% fiducial limits

for ED50 Slope ± s.e.

Chi-

squared P-value

Spiromesifen Larvae B type Approx. 0.043 Insignificant slope 1.87 ± 0.5 10.02 0.007*

(Oberon) Q type 0.076 0.0703, 0.0819 3.31 ± 0.26 1.45 0.5

Deltamethrin Larvae B type 0.022 0.013, 0.11 1.86 ± 0.33 7.69 0.02*

(Decis Protech) Q type Approx. 0.094 Insignificant slope 1.45 ± 0.46 9.84 0.007*

Deltamethrin Adults B type Approx. 0.097 Insignificant slope 5.35 ± 1.6 10.87 0.004*

(Decis Protech)

Figure 19. Probit lines for B-type larvae (green line) and Q-type larvae (blue line) following exposure to spiromesifen.


Figure 20. Probit lines for B-type larvae (blue line) and Q-type larvae (green line) following exposure to deltamethrin.

Objective 4: Evaluating the potential for control of Bemisia tabaci using existing and novel biological control agents.

Milestone 2: Select BCAs, insecticide(s) for use in the temporal synergism approach and biorational insecticides for study.

The following biological control agents were selected for investigation within the project:

Entomopathogenic fungi:

• Naturalis-L (Beauveria bassiana)

•‘BUEXP1778’ (Beauveria spp.) (confidential trial for BeckerUnderwood Ltd.)

• Myctol (Lecanicillium muscarium)

Entomopathogenic nematodes:

•Capsanem (Steinernema carpocapsae)

•Entonem (Steinernema feltiae)

Predatory mites:

•‘Swirskiline’ (Amblyseius swirskii)

•‘Montyline’ (Amblyseius montdorensis)

•Typhlodromalus limonicus – confidential trial of a species being developed by Syngenta Bioline

Insecticides:

The following physical acting products were selected which have all shown much potential in previous Fera based work to control B. tabaci eggs: Tri-Tek, Spraying Oil, SB-Plant Invigorator.


Milestone 4: Provide protocols to PHSI for sending samples from outbreak site for biotyping and potential culturing.

Samples collected by Fera PHSI were sent in for confirmation and biotyping as outlined in the Plant Health and Seeds Inspectorate Handbook: General – Sample Packaging and Dispatch. Some live larvae where delivered onsite (at Fera) by Dr John Buxton from a private grower. Unfortunately these never took off in culture.

Milestone 6: Complete small scale experiments to ascertain/confirm efficacy against first set of selected BCA’s.

Efficacy of entomopathogenic fungi and nematodes against Bemisia tabaci B and Q biotypes


Products and insect cultures

Under quarantine conditions both biotypes of B. tabaci were cultured separately in Perspex® cages (60 x 60 x 80 cm) on poinsettia plants following the method of Cuthbertson et al.

6 The entomopathogenic fungus Lecanicillium

muscarium (reclassified from Verticillium lecanii, though still marketed under this product name) was supplied as Mycotal® from Koppert Biological Systems Ltd., UK. Beauveria bassiana was supplied as Naturalis® from Intrachem Production Ltd. A strain of B. bassiana was supplied by BeckerUnderwood Ltd. for a confidential trial. This strain was named: BUEXP1778. The nematodes were supplied as Capsanem® (Steinernema carpocapsae) from Koppert UK Ltd. and Nemasys® (S. feltiae) from BeckerUnderwood Ltd.

Following the protocols of Cuthbertson et al.25,26

plants were divided into three groups, each containing 5 poinsettia (Euphorbia pulcherrima) plants. Each group of plants was infested with one of the B. tabaci life stages (eggs, instars or adult flies). Two clip cages (25mm diameter), modelled after those described by MacGillivray and Anderson

27, were each positioned on individual leaves (one cage per leaf) of each plant. Two male and five

female B. tabaci were added to each cage and the plants were incubated at 25 ± 1°C, 65% relative humidity (r.h.) and 16:8-h L:D while the females oviposited. Adults were removed after 48hr and infested leaves labelled. Plants were then incubated at 25°C and the desired life-stages were reared through based on the studies of Butler et al.

28, Bethke et al.

29 and Wang and Tsai

30. This allowed all life-stages to be available for experimental use on the

same date. The above procedure was repeated for both fungi and nematode trials.

Both nematodes and the fungi were applied using a Hozelock® Polyspray 2 hand-held sprayer with a cone nozzle

25,26. The application rate resulted in approximately 160 infective juvenile nematodes and 1 x 105 fungal

spores per cm2 of leaf area respectively. Following spray application plants were incubated at 20°C. Mortality was assessed following 3 days for the nematodes and 7 days for the fungi treated leaves.

Results

The different fungi had different impacts upon the two biotypes of Bemisia (Figure 21). The two Beauveria strains (Naturalis-L and BUEXP1778) both showed better efficacy against both biotypes than L. muscarium (Mycotal). Adult Q-type were particularly susceptible to B. bassiana

1,32 (Naturalis-L) (Figure 22). The new strain

(BUEXP1778) showed better potential against the egg stages that the other fungi with upwards on 50% mortality of B-type eggs being achieved.


0

10

20

30

40

50

60

70

80

90

100

B Q B Q B Q B Q

Mycotal Naturalis-L BUEXP1778 Water control

Egg

2nd instar

Adult%

Mo

rtal

ity

Figure 21. Efficacy of entomopathogenic fungi against Bemisia tabaci B and Q-biotypes.

Figure 22. Naturalis-L infested Bemisia tabaci Q adults32

.

There was little difference in efficacy of the nematodes against the two biotypes. Steinernema carpocapsae proved better against B-type (Figure 23) whereas S. feltiae was slightly better in dealing with Q-type instars (Figure 24). For both species of nematodes best efficacy was again shown against the 2/3rd instar stage of Q-type as was shown for the B-type in previous Defra funded work by Cuthbertson et al.

6,33.


Figure 23. Efficacy of Steinernema carpocapsae against Bemisia tabaci instars.

Figure 24. Efficacy of Steinernema feltiae against Bemisia tabaci instars.

Discussion

Much previous Defra funded work has shown the potential of L. muscarium to be utilised within control programmes against B. tabaci

7,9,18,25,31,41. This work was carried out on what we now know was Biotype B of B.

tabaci34

. The entomopathogenic fungus B. bassiana has within the past year become available within the UK for use on protected ornamentals, hence its inclusion in the current work. From the trials undertaken it has proven to


have a higher efficacy against both Bemisia biotypes than L. muscarium32

. The strain of Beauveria under development by Becker Underwood Ltd is showing perhaps even better efficacy, further proving the value of continued screening of biological agents. The nematodes continue to prove their worth, with up to 75% mortality of 2nd instars being recorded.

Milestone 9: Complete small scale experiments to ascertain/confirm efficacy against further set of selected BCA’s

Efficacy of predatory mites against Bemisia tabaci Q.


Products and insect cultures

Under quarantine conditions Q biotype of Bemisia tabaci was cultured in Perspex® cages (60 x 60 x 80 cm) on poinsettia plants following the method of Cuthbertson et al.

6. The two commercially available predatory mite

species Amblyseius swirskii and Amblyseius montdorensis were supplied by Syngenta Bioline. A confidential trial for Syngenta BioLine using, Typhlodromalus limonicus was also undertaken within the study.

Following the method of Cuthbertson et al.35

developed within Defra project PH0404, a single predatory mite was placed on poinsettia leaf discs, together with 10 B. tabaci eggs as prey. The leaf discs, eggs and mites were then contained in an experimental arena36, and incubated in a controlled environment cabinet at 21± 2

oC, 65%

relative humidity (r.h.), and 16:8 Light:Dark (L:D). The number of eggs that were attacked or had clear symptoms of feeding damage were recorded after five days to determine consumption rates. The experiment was replicated 20 times. The controls (20 replicates for each species of mite) consisted of an identical experimental procedure to those used for each treatment, with the exception that a predatory mite was not placed in the experimental arenas.

The above procedure was repeated for 1st and 2nd instar Bemisia life stages and for each mite species separately. A trial was also undertaken combining A. swirskii and A. montdorensis together.

Results

Investigating the feeding rates of three predatory mite species (Amblyseius swirskii, Amblyseius montdorensis, Typhlodromalus limonicus) has proven all three readily feed upon the early life-stages of Bemisia. Approximately 30% of eggs were fed upon by A. swirskii following a 48hr period (Figure 25). Feeding rates slightly decreased for all mite species when feeding on 1st instar life-stages (27, 24, 16% respectively) and significantly decreased when feeding on 2nd instars (8.5, 8.5, 8.7% respectively). Combining the two mite species (A. swirskii and A. montdorensis) increased mortality of Bemisia eggs to 36% (Figure 25).


Figure 25. The impact of predatory mites against Bemisia tabaci Q lifestages. AS - Amblyseius swirskii; Am - Amblyseius montdorensis; TL - Typhlodromalus limonicus.

Discussion

Phytoseiid mites are known to feed on phytophagous insects such as thrips37

and whiteflies38

. In many cases they have been successfully applied in the control of thrips but until recent years no attempt has been made to use them in whitefly control

38. Previous Defra funded work (PH0404) has shown the potential of predatory mites to be

important components of IPM strategies against the non-indigenous pest species Thrips palmi35

. The predatory mites currently investigated show equal potential in regards to their efficacy against B. tabaci. Predatory mites are known to show best efficacy against egg and early instars of whiteflies

39, simply as adult whiteflies will fly away

from an attacking predatory mite except during emergence from the last nymphal stage40

. Combining the two species of mites gave some increase in mortality of all life-stages of Bemisia tested against.

Objective 5: Establishing the compatibility of the selected BCA’s with the most effective products from Objective 3.

Milestone 10: Confirm the insecticide treatments and BCAs that will be investigated within the compatibility testing

The following agents were chosen for compatibility testing:

Insecticides:

Tri-Tek – Refined petroleum oil, physically acting product.

SB Plant invigorator – Refined petroleum oil, physically acting product.

Movento (a.i. spirotetramat) - Foliar applied systemic insecticide.

Biological agents:

Nematode: Steinernema carpocapsae

Fungus: Beauveria bassiana

Predatory mites: Amblyseius swirskii and Amblyseius montdorensis


Milestone 11: Ascertain level of insecticide on imported plants to gauge potential mortality of BCAs if introduced immediately.

A meeting of the Science Delivery Team was held in June 2012 where Fera scientists met with the three sub-contractors to discuss the worth of addressing this element of the work. It was decided that this milestone is unlikely to yield results of any value and to attempt it would require significant time and resource inputs. It was, therefore decided that expansion of the areas associated with synergisms would make a more viable course of action. These issues will be discussed with the Project Officer from Policy Division at the annual steering group meeting (November 2012).

Milestone 13: Establish mutual compatibility of selected BCAs with selected insecticides and regularly used fungicides

Compatibility of BCA’s with chemicals:

1) Fungi

Following the protocol of Cuthbertson et al.9 the effect of direct suspension of the fungal spores in insecticide

solutions was investigated. The three chemical products were tested for their direct compatibility with B. bassiana. The selected products were also tested against L. muscarium to add to the knowledge base of direct compatibility of chemicals with this fungus for whitefly control

9,41. Briefly, B. bassiana conidia were suspended (approx. 10

7

conidia/ml) in solutions of the insecticide products. All insecticides were diluted to recommended rates for application to protected ornamentals in the UK. The suspensions were transferred to beakers, sealed with parafilm and incubated in the dark at 20°C for 24 h after which 10 µl of each mixture was pipetted onto a sterile Petri dish containing 10% non-bacterial agar. The dishes were sealed with parafilm and again incubated in the dark for a further 24 h at 20°C before viability of conidia (germinated spores) from a total of 200 randomly chosen conidia were assessed under the microscope. Each experiment (insecticide solution) consisted of two replicates each from three different batches of fresh dilution in order to replicate the work over time and space (six replicates in total). The above procedure was repeated using all the chemical products.

SB-Plant Invigorator significantly (P<0.01) reduced germination of Beauveria bassiana spores and so could not be recommended as a tank-mix with Naturalis (Figure 26). The other products, Tri-Tek Oil and Movento proved much more compatibility (Figure 26). Tri-Tek showed the best potential to be used as a tank-mix with over 90% B. bassiana spore germination following exposure to the test product for 24 h. This product has therefore excellent potential for tank mixing with Naturalis.

Products that had not already been tested in previous Defra projects (PH0157 & PH0405 9,41

) for compatibility with L. muscarium were also investigated. Here, direct mixing with Tri-Tek still allowed full fungal spore germination (Figure 27).

This information has added to the knowledge base of fungal/chemical compatibility in the drive to obtain eradication strategies against Bemisia. This work has been published as a scientific paper in Crop Protection. The following is the reference and abstract:

Cuthbertson, A.G.S., Buxton, J.H., Blackburn, L.F., Mathers, J.J., Robinson, K.A., Powell, M.E., Fleming, D.A., Bell, H.A. (2012). Eradicating Bemisia tabaci Q biotype on poinsettia plants in the UK. Crop Protection, 42: 42-48.

Abstract: ‘The sweetpotato whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) continues to be a serious threat to crops worldwide. The UK holds Protected Zone status against this pest and as a result B. tabaci entering on plant material is subjected to a policy of eradication. Q biotype (Mediterranean species) is the predominant whitefly now being intercepted entering the UK. With increasing reports of neonicotinoid resistance in this biotype it is becoming more problematic to control/eradicate. The current study evaluated sequential insecticide applications of a range of chemicals and two entomopathogenic fungi Beauveria bassiana and Lecanicillium muscarium, applied within the first 21 days after potting poinsettia cuttings. All sequential treatment programmes tested eradicated Q biotype from poinsettia plants. The efficacy of chemicals and fungi against various Q biotype life-stages was also evaluated as individual treatments. Against the egg stage, abamectin (Dynamec), acetamiprid (Gazelle), refined petroleum spraying oil (Tri-Tek) and the physically acting product SB-Plant Invigorator all proved excellent. None of the products gave total control of second instar larvae. However, Agri-50E, B. bassiana, Tri-Tek and SB-Plant Invigorator all gave over 71% mortality. For adult control, B.


bassiana and the oil based products (Addit, Tri-Tek and Spraying Oil) all produced 100% mortality. The work also demonstrated that B. bassiana offers better control of B. tabaci than L. muscarium. Investigating direct tank-mixing of the fungi with the chemical products proved that Majestic (physically acting product), spiromesifen (Oberon), Savona (physically acting product) and SB-Plant Invigorator significantly reduced germination of B. bassiana spores and so could not be recommended as mixes. Tri-Tek Oil, Spraying Oil, Addit, Dynamec and Gazelle showed best potential to be used as tank-mixes with over 90% B. bassiana spore germination following exposure to the test products for 24 hours. A direct tank mix of L. muscarium with Tri-Tek allowed full fungal spore germination. The implications of the work in regards to continued protection of the UK horticultural industry from B. tabaci and overcoming insecticide resistance among biotypes is discussed.’

A reprint of the above paper can be provided upon request.

Figure 26. Naturalis (Beauveria bassiana) spore germination following 24h exposure of the entomopathogenic fungus to a range of chemical products. Bars represent standard errors of the mean (±SEM).

Figure 27. Mycotal (Lecanicillium muscarium) spore germination following 24h exposure of the entomopathogenic fungus to a range of chemical products. Bars represent standard errors of the mean (±SEM).


2) Nematodes

Following the approach used to investigate the effect of insecticide solutions on nematodes under Defra project PH0517

8,42 infective juveniles of S. carpocapsae were suspended (500 nematodes/ml) in solutions of the

insecticides. All the insecticides were diluted to the recommended rates for application to protected ornamentals in the UK. Suspensions were prepared in 50ml glass beakers, which were then sealed with parafilm and incubated at 20 ± 1ºC in the dark for 24 hours, after which 5ml of each of the nematode suspensions was removed and washed.

The infectivity of the washed nematodes was assessed using the method of Fan & Hominick43

. Sand was sieved (1.18mm aperture sieve), washed, autoclaved and dried before four percent water by volume was added, and it was used to fill 30ml universal tubes. A further 1ml of nematode suspension was introduced into a 4cm deep hole in the sand which was then filled by shaking the tube. The number of nematodes introduced was assessed by counting the number in four samples (250 µl each) taken from the suspension. A single Galleria mellonella larva was added to the sand before the tube was sealed, inverted, and incubated at 20ºC for three days. After this period the G. mellonella was removed from the tube, washed in water and maintained on moistened filter paper in a Petri dish for a further day. Larvae were then dissected. The number of nematodes present were counted and expressed as a percentage of those originally introduced into the tubes. The procedure was replicated ten times for each of the insecticides and a control of a nematode suspension in water that was maintained and assessed using the same technique only with the insecticides omitted.

All three chemical products allowed good nematode recovery and therefore could be recommended as tank-mixes (Figure 28). This information again adds to the knowledge base for nematode and chemical compatibility (Defra project PH0157

8,42).

Figure 28. Steinernema carpocapsae infectivity (±SEM) of Galleria mellonella larvae measured after a 72 h period, following 24 hours exposure of the infective juveniles to chemical insecticides or water control.

3) Mites

Direct exposure of mites to chemical pesticides

Following the method of Cuthbertson et al.35

developed under Defra Project PH0404, using a fine camel-hair brush, 10 predatory mites were placed onto a glass cover slip. This was then ‘floated’ in a 9 cm Petri dish containing moist filter paper to prevent the mites from escaping. Topical application of pesticides at the recommended field rates was conducted using an Auto-Load Potter Precision Laboratory Spray Tower (Burkhard Scientific, Hertfordshire, UK) fitted with a medium atomiser. After spray application the cover slip was placed onto a leaf disc (4cm diameter leaf discs of poinsettia plants were used for the experiments) along with some pollen as a food source. The leaf was placed on a wad of wet cotton wool and the lid replaced on the Petri dish. These were placed in a CE cabinet at 21°C, 65% r.h. 16:8 hr L:D. Mortality of the mites (defined as when no movement was recorded after gentle mechanical stimulation using a camel-hair brush) was assessed after 24 and 48 hrs. This procedure was repeated 10 times for each mite species and each pesticide. Mites sprayed with water provided a control.

Movento had the least effect on both predatory mite species when applied as direct treatments (Figures 29 & 30). SB Plant Invigorator when applied as a direct treatment had the greatest effect against both mite species,


although there was a high degree of variation between the replicates. The majority of mites exposed to the direct application of Tri-Tek were alive but did appear to have been affected by the treatment, with reduced movement observed. Mortality may have increased if exposure periods were extended.

Figure 29. Mean percentage mortality of Amblyseius swirskii at 24 and 48 hours after direct application of Tri-Tek, SB Plant Invigorator and Movento.

Figure 30. Mean percentage mortality of Amblyseius montdorensis at 24 and 48 hours after direct application of Tri-Tek, SB Plant Invigorator and Movento.

Effect of chemical residues on predatory mites

Again following the method of Cuthbertson et al.35

poinsettia leaf discs (as detailed above) were sprayed with pesticide using a Potter Tower and left to air-dry for 3 hrs before being placed in 9 cm Petri dishes on a wad of wet cotton wool. These were placed in a CE cabinet at 21°C, 65% r.h. 16:8 hr L:D. Following a period of 24 hrs, 10 predatory mites were placed on the leaf surface along with some pollen as a food source. The lids were replaced on the Petri dishes which were then put back into the CE cabinet. Mortality of mites was assessed following 24, 48 and 72 hrs. The procedure was repeated 10 times for each mite species. Leaves sprayed with water provided a control, replicated 10 times.

Movento again had the least effect on both predatory mite species when present as a residue (Figures 31 & 32). Mite mortality caused by SB Plant Invigorator decreased significantly compared to direct application.


Figure 31. Mean percentage mortality of Amblyseius swirskii after 24, 48 and 72 hours exposure to leaves treated with Tri-Tek, SB Plant Invigorator and Movento.

Figure 32. Mean percentage mortality of Amblyseius montdorensis after 24, 48 and 72 hours exposure to leaves treated with Tri-Tek, SB plant invigorator and Movento.

All three chemicals tested show a level of compatibility with the various biological agents. In particular Tri-Tek can be used as a tank-mix with B. bassiana. The results indicate good survival of predatory mites especially after application of Movento. This component of the work has established that careful design of eradication protocols would enable the combined use of conventional chemical insecticides and biological control agents for control/eradication of B. tabaci.

Objective 6 & 7: Establishing the mutual compatibility of the selected BCAs and Evaluating the potential advantages of using the selected control agents in combination rather than individually in the above categories.

Milestone 12: Establish mutual compatibility of selected BCA’s and impact of simultaneous use.

Fungi and nematodes:

Nematodes (10,000 per ml) were suspended in fungal suspensions (10x106 conidia/ml) for direct application

against Bemisia 2nd instars. For sequential treatments fungi were applied following the method of Cuthbertson et al.

9 Then after 24hrs the nematodes were applied using the method of Cuthbertson et al.

6 Mortality of Bemisia


larvae was assessed after 72 hours.

In general, sequentially applying B. bassiana with either of the two nematode species gave slightly better larvae control of both Bemisia biotypes (Figures 33 & 34). Assessing direct combinations of fungi and nematodes under the microscope over time lead to the conclusion that the nematodes in some way were inhibiting fungal spore growth. This may be due to toxins produced by the symbiotic bacteria within the nematodes.

Figure 33. The impact of combining fungi and nematodes against Q-type Bemisia 2nd instar larvae.

Figure 34. The impact of combining fungi and nematodes against B-type Bemisia 2nd instar larvae.

Mites:

Trials were undertaken using the same methodology as outlined in Milestone 9. The only difference being that 10 individual predatory mites of a given species were contained within a Tashiro cage

36. Mortality was assessed after

48 hrs. To test mutual compatibility between the two mite species, 5 mites of each species were contained within a Tashiro cage. Again mortality was assessed after 48 hours. There were 10 replicates per trial.

Simultaneous use of the two predatory mites against early instar Bemisia life-stages (as outlined under Milestone 9) produced higher mortality than either mite applied individually. 36% Bemisia egg mortality was recorded (Figure 25). Neither mite species had any detrimental effect on the other.

Objective 8: Designing, evaluating and refining preliminary modular-based strategies for the control of Bemisia tabaci, including the production of user protocols.

Milestone 13 & 14: Complete first draft of IPM protocols and develop these protocols into IPM strategies against specific biotypes in specific crops.

Work undertaken has identified that certain products are better than others for treating different life-stages of B. tabaci (Table 4) on poinsettia plants

32.


Table 4. Products that show best efficacy against various life-stages of Bemisia tabaci32

.

Eggs Instars Adults

Abamectin Agri-50E B. bassiana

Acetamiprid B. bassiana Addit

Tri-Tek Tri-Tek Tri-Tek

SB-Plant Invigorator SB-Plant Invigorator Spraying Oil

The following control strategies (Table 5) were tested in the laboratory situation for control of eggs and 2nd instar larvae

32.

Table 5. Sequential applications for Q biotype eradication32

.

Crop Stage 3 days after

potting/infestation

7 days after

potting/infestation

14 days after

potting/infestation

20 days after

potting/infestation

Likely

Bemisia life-

stage

Eggs Eggs + 1st Instar

scales

1st + 2

nd Instar

scales

2nd

+ 3rd

Instar

scales

Programme 1 Water only Water only Water only Water only

Programme 2 Majestik Oberon + Mycotal

+ Addit

Spraying Oil Dynamec + Chess

Programme 3 SB Plant

Invigorator

Oberon + Mycotal

+ Addit

Oberon + Mycotal

+ Addit

Spraying Oil

Programme 4 Spraying Oil Majestik Savona Agri 50-E

Programme 5 Savona Spraying Oil Dynamec + Chess Gazelle

Programme 6 SB Plant

Invigorator

Majestik Dynamec + Chess Gazelle

Programme 7 Naturalis Naturalis Naturalis Naturalis

Following the individual programmes outlined in Table 5, Q-type was eradicated in all cases (apart from the water control). When starting with the egg stage, some insects developed during the process in treatment programmes 2 and 5 but nothing survived through to adult. However, with the continued treatments the insects were efficiently controlled with nothing surviving through to adult

32.

When the trials were initiated with the 2nd instar life-stage, again some developed through to the 3/4th stadia after 14 and 20 days in all treatment programmes but no adults emerged, unlike the control where adults readily developed. Either the larvae were all killed or their development was severely slowed however, after maintaining the treated plants for a week under favourable conditions (23°C, 65% r.h) following the final treatment no adults developed. Therefore, control must have been complete.

Objective 9: Conducting a test of the protocols developed either at an outbreak site (if PHSI recommend a site) or by glasshouse experiments.

Permission was obtained to extend the current invertebrate quarantine license to cover a glasshouse cubicle onsite at Fera in order to carry out some glasshouse trials of products previously not tested under glasshouse conditions before. The products tested were Tri-Tek and B. bassiana.

The trials were carried out following the methods of Cuthbertson et al.26,41

. Briefly, plants were infested in the secure quarantine unit after which all adults were removed. Infested plants were then transferred to the designated glasshouse cubicle in sealed boxes. Only egg and early instar stages were tested against. All plant material was assessed and subsequently destroyed before any adult life-stages could arise.


Tri-Tek proved excellent against B. tabaci Q eggs with 100% mortality being achieved (Figure 35). Naturalis provided 74% egg mortality. Tank-mixing the two products also produced 100% egg mortality. Against 2nd instar B. tabaci Q larvae Tri-Tek and Naturalis provided 69% and 65% mortality respectively. Tank-mixing the products increased mortality to 95.5% (Figure 36).

Figure 35. Efficacy of Tri-Tek and Beauveria bassiana against Bemisia tabaci Q eggs under glasshouse conditions.

Figure 36. Efficacy of Tri-Tek and Beauveria bassiana against Bemisia tabaci Q 2nd instars under glasshouse conditions.

Interestingly, some eggs did hatch in the Tri-Tek treatments and larvae appeared but these did not develop. They appeared dehydrated and detached from the leaf surface, obviously they were not feeding (Figure 37a,b). The Tri-Tek must have been having some repellent effect or perhaps the young larvae could not penetrate through the residue layer produced in order to feed.


A

B

Figure 37a,b. Early Bemisia instars detached from the leaf surface on Tri-Tek treated leaves.

The following two desk-studies were undertaken to investigate the cost-benefit analysis of the IPM-based protocols developed. Two studies were prepared. Firstly, on poinsettia crops (the target crop of the current project) and secondly, looking at the possibility of transferring the findings to a second crop, in this instance, tomato.

1) Cost-benefit analysis of Bemisia control programmes in UK poinsettia plants

Six potential control programmes have been developed via small-scale studies for the control of B. tabaci on poinsettia

32. This desk study considers their probable cost in relation to the various spray volumes used in relation

to the value of the crop.

Some growers do produce poinsettias using biological controls however the introduction of biological controls does not commence until after a spray programme has been implemented in the first few weeks of the crops life. Biological controls can safely be introduced 7 days after the final application of insecticides in four of the six control programmes (Table 5). Gazelle is not considered IPM compatible so would be very difficult to integrate in the existing IPM programmes without causing secondary problems.

Poinsettia crops are produced in a range of pot sizes in the UK, this influences the value of an individual unit, a typical crop would be produced in 13cm pots. As with other crops their overall value depends on many factors including weather conditions, marketable yield, demand from retailers and negotiated price. A mid-range figure of £185k per hectare has been selected for the purpose of this study. Glasshouse-grown poinsettias are a high-value crop however they also require high-inputs and profit margins are relatively small. As a consequence, even a small reduction in marketable yield can tip the balance from profit to loss. The financial risks for growers are therefore very high; as energy costs have increased the number of UK producers has decreased in recent years.

Without effective control measures, B. tabaci would become a major crop contaminant issue. High numbers of the pest would secrete honeydew onto the crop. This would be colonized by sooty mould which would effectively render crops unsalable. The actual loss to the grower will depend on the point within the growing season that the damage occurs. In this study, we have considered reductions in marketable yield of 10%, 30%, 60% and 90%; i.e. £18.5k, £55.5k, £111k and 166.5k per hectare. All of these scenarios would result in substantial financial loss to the grower.

The cost of the consumable items used in the proposed control programmes would vary depending on the chosen supplier and the purchasing power of the grower. For the purpose of this study, we have considered prices most


likely to be paid when purchasing sufficient product to treat at least one hectare of crop. The cost of labour to apply the control measures as a two way spray to ensure sufficient coverage has been set at £140 per hectare, which includes employment costs but no other overheads.

The amount of diluted spray required to treat a mature poinsettia crop to the point of run-off varies depending on the application method; i.e. whether high tech boom sprayers or RIPA spray pistols are used. Therefore water volumes can vary from about 1,000 to 5,000 litres per hectare depending on the efficiency of the application method and size of crop canopy. For the purpose of this study, we have used a mid-range figure of 3,000 litres per hectare.

Using the information summarised above, the cost per hectare of the six proposed treatment programmes would be:

Programme 2 £ 2.4k

Programme 3 £ 2.1k

Programme 4 £ 1.6k

Programme 5 £ 1.7k

Programme 6 £ 1.8k

Programme 7 £ 3.2k

Assuming each control programme was successful in controlling the B. tabaci population, the potential financial benefit to the grower, expressed as a multiplication factor of the cost of the control programme, would be:

At 10% loss At 30% loss At 60% loss At 90% loss Programme 2 8x 24x 48x 72x Programme 3 9x 27x 55x 83x Programme 4 12x 37x 74x 111x Programme 5 11x 34x 69x 104x Programme 6 10x 32x 65x 97x Programme 7 5x 17x 35x 53x

This quite clearly shows that the proposed treatment programmes would be cost effective if successful.

2) Cost-benefit analysis of Bemisia control programmes in UK tomato crops

Six potential control programmes (Table 5) have been developed via small-scale studies for the control of B. tabaci on poinsettia

32. It has been suggested that these programmes may also be suitable for UK tomato crops.

This desk study explores the suitability of the components of those programmes for inclusion in the existing tomato IPM programme and considers their probable cost in relation to the value of the crop.

Of the proposed products, it should be possible to integrate Addit, Chess, Oberon, Naturalis and Mycotal without any serious detrimental side-effects on the existing control agents. Although Agri 50-E, Majestik, Savona, SB Plant Invigorator and Certis Spraying Oil are considered to be safe to mammals, they are not target specific and would have to be used with care to avoid harming biological control agents. Dynamec and Gazelle would be very difficult to integrate in the existing IPM programmes without causing secondary problems.

There are many types and cultivars of tomato grown in the UK. Most tend to be at the premium end of the price scale; eg vine ripened cherry, baby plum and cocktail tomatoes harvested as complete trusses. Their overall value depends on many factors including weather conditions, marketable yield, demand from retailers and negotiated price. A mid-range figure of £650k per hectare has been selected for the purpose of this study. Glasshouse-grown tomatoes are clearly of high-value but it must be remembered that they also require high-inputs and profit margins are relatively small. As a consequence, even a small reduction in marketable yield can tip the balance from profit to loss. The financial risks for growers are therefore very high.

Without effective control measures, B. tabaci and associated virus infections will destroy a tomato crop in a relatively short time. The actual loss to the grower will depend on the point within the growing season that the damage occurs. We have considered reductions in marketable yield of 10%, 30% and 60%; i.e. £65k, £195k and £390k per hectare. All of these scenarios would result in substantial financial loss to the grower.

The cost of the consumable items used in the proposed control programmes would vary depending on the chosen supplier and the purchasing power of the grower. For the purpose of this study, we have considered prices most likely to be paid when purchasing sufficient product to treat at least one hectare of crop. The cost of labour to


apply the control measures has been set at £60 per hectare, which includes employment costs but no other overheads.

The amount of diluted spray required to treat a mature tomato crop to the point of run-off varies from about 2,000 to 4,000 litres per hectare depending on the size of crop canopy. The latter depends on the type of tomato and cultivar being grown, the vegetative state of the crop and the grower’s individual deleafing policy. For the purpose of this study, we have used a mid-range figure of 3,000 litres per hectare.

Using the information summarised above, the cost per hectare of the six proposed treatment programmes would be:

Programme 2 £ 2.3k

Programme 3 £ 2.0k

Programme 4 £ 1.5k

Programme 5 £ 1.6k

Programme 6 £ 1.7k

Programme 7 £ 3.1k

Assuming each control programme was successful in controlling the B. tabaci population and thereby preventing infection by the associated virus, then the potential financial benefit to the grower, expressed as a multiplication factor of the cost of the control programme, would be:

At 10% loss At 30% loss At 60% loss

Programme 2 28x 85x 169x






This quite clearly shows that the proposed treatment programmes would be cost effective if successful.

Objective 10: Forging links with researchers in Europe, particularly Finland (under the EUPHRESCO umbrella) working on Bemisia tabaci to facilitate information exchange and to reduce duplication.

From 8-11th November 2011, Dr’s Andrew Cuthbertson and Howard Bell travelled to MTT Agrifood Research in Finland for a meeting with Dr Irene Vänninen. Here Bemisia associated research was discussed in regards to ‘Protected Zone’ status with our Finnish and Swedish (Dr Johanna Jansson) counterparts. Useful areas of collaboration were investigated and plans for future joint project proposals discussed. A summary report of the meeting was produced and circulated to interested parties. Continued contact with Dr Vänninen was maintained throughout the life of the project. Bemisia tabaci samples were received from Finland during the project for biotyping purposes. This work was completed and the results returned to Dr Vänninen (all specimens tested were confirmed as Q-type). The following manuscript following our collaboration with Dr Vänninen is also currently in draft:

Cuthbertson, A.G.S. and Vänninen, I. (201-). Bemisia tabaci: the value of protected zone status. In draft.

References cited:

1) Cuthbertson, A.G.S. (2013). Update on the status of Bemisia tabaci in the UK and the use of entomopathogenic fungi within eradication programmes. Insects, 4: 198-205.

2) Alegbejo, M.D. (2000). Whitefly transmitted plant viruses in Nigeria. Journal of Sustainable Agriculture, 17: 99-109.

3) Powell, M.E., Cuthbertson, A.G.S., Boonham, N., Morris, J., Bell, H.A. & Northing, P. (2012). First record of the Q Biotype of the sweetpotato whitefly, Bemisia tabaci, intercepted in the UK. European Journal of Plant


Pathology, 133: 797-801.

4) Nomikou, M., Janseen, A., Schraag, R. & Sabelis, M.W. (2001). Phytoseiid predators as potential biological control agents for Bemisia tabaci. Experimental and Applied Acarology, 25: 271-291.

5) Cuthbertson, A.G.S. & Walters, K.F.A. (2005). Evaluation of exposure time of Steinernema feltiae against second instar Bemisia tabaci. Tests of Agrochemicals and Cultivars, 26: 34-35.

6) Cuthbertson, A.G.S., Head, J., Walters, K.F.A. & Gregory, S.A. (2003). The efficacy of the entomopathogenic nematode, Steinernema feltiae, against the immature stages of Bemisia tabaci. Journal of Invertebrate Pathology, 83: 267-269.

7) Cuthbertson, A.G.S., Walters, K.F.A. & Northing, P. (2005). Susceptibility of Bemisia tabaci immature stages to the entomopathogenic fungus Lecanicillium muscarium on tomato and verbena foliage. Mycopathologia, 159: 23-29.

8) Cuthbertson, A.G.S., Head, J., Walters, K.F.A. & Murray, A.W.A. (2003). The integrated use of chemical insecticides and the entomopathogenic nematode, Steinernema feltiae, for the control of sweetpotato whitefly, Bemisia tabaci. Nematology, 5: 713-720.

9) Cuthbertson, A.G.S., Walters, K.F.A. & Deepe, C. (2005). Compatibility of the entomopathogenic fungus Lecanicillium muscarium and insecticides for eradication of sweetpotato whitefly, Bemisia tabaci. Mycopathologia, 160: 35-41.

10) Cuthbertson, A.G.S. and Walters, K.F.A. (2005). Pathogenicity of the entomopathogenic fungus, Lecanicillium muscarium, against the sweetpotato whitefly Bemisia tabaci under laboratory and glasshouse conditions. Mycopathologia, 160: 315-319.

11. Cuthbertson, A.G.S., Walters, K.F.A. & Northing, P. (2007). Efficacy of the entomopathogenic nematode, Steinernema feltiae, against sweetpotato whitefly, Bemisia tabaci, under laboratory and glasshouse conditions. Bulletin of Entomological Research, 97: 9-14.

12) De Barro, P.J., Liu, S.S., Boykin, L.M. & Dinsdale, A.B. (2011). Bemisia tabaci: a statement of species. Annual Review of Entomology, 56: 1-19.

13) Shatters, R.G., Powell, C.A., Boykin, L., Liansheng, H. & McKenzie, C.L. (2009). Improved DNA barcoding method for Bemisia tabaci and related Aleyrodidae: Development of Universal and Bemisia tabaci Biotype-Specific Mitochondrial Cytochrome c Oxidase I Polymerase Chain Reaction Primers. Journal of Economic Entomology, 102: 750-758.

14) Boonham, N., Smith, P., Walsh, K., Tame, J., Morris, J., Spence, N., Bennison, J. & Barker, I. (2002). The detection of Tomato spotted wilt virus (TSWV) in individual thrips using real time fluorescent RT-PCR (TaqMan). Journal of Virological Methods, 101: 37-48.

15) Jones, C.M., Gorman, K., Denholm, I. & Williamson, M.S. (2008). High-throughput allelic discrimination of B and Q biotypes of the whitefly, Bemisia tabaci, using TaqMan allele-selective PCR. Pest Management Science, 64:12–15.

16) Nauen, R. (2005). Insecticide resistance in European agriculture: research instead of rumours. The BCPC International Congress – Crop Science & Technology 2005. Congress Proceedings Volume 1, 123-130. ISBN 1 901396 65 7.

17) Schuster, D.J., Mann, R.S., Toapanta, M., Cordero, R., Thompson, S., Cyman, S., Shurtleff, A. & Morris, R.F. (2010). Monitoring neonicotinoid resistance in biotype B of Bemisia tabaci in Florida. Pest Management Science, 66: 186-195.

18) Cuthbertson, A.G.S., Blackburn, L.F., Northing, P., Luo, W., Cannon, R.J.C. & Walters, K.F.A. (2009). Leaf dipping as an environmental screening measure to test chemical efficacy against Bemisia tabaci on poinsettia plants. International Journal of Environmental Science and Technology, 6: 347-352.

19) Fitches, E.C., Bell H.A., Powell, M.E., Back, E., Sargiotti, C., Weaver, R.J. & Gatehouse, J.A. (2010). Insecticidal activity of scorpion toxin (ButaIT) and snowdrop lectin (GNA) containing fusion proteins towards pest species of different orders. Pest Management Science, 66: 74-83

20) Trung, N.P., Fitches, E. & Gatehouse, J. A. (2006). A fusion protein containing a lepidopteran-specific toxin from the South Indian red scorpion (Mesobuthus tamulus) and snowdrop lectin shows oral toxicity to target insects BMC Biotechnology, 6: 18.

21) Khot, A.C., Bingham, G., Field, L.M. and Moores, G.D. (2008). A novel assay reveals the blockade of esterases by piperonyl butoxide. Pest Management Science, 64: 1139-1142.

22) Devonshire A.L. and Moores, G.M. (1982). A carboxylesterase with broad substrate-specificity causes organo-phosphorus, carbamate and pyrethroid resistance in peach-potato aphids (Myzus persicae). Pesticide Biochemistry and Physiology, 18: 235-246.

23) Brogden, K.A., Ackermann, M. and Huttner, K.M. (1997). Small, anionic and charge-neutralizing propeptide fragments of zymogens are antimicrobial. Antimicrobial Agents and Chemotherapy, 41: 1615-1617.

24) Nauen, R., Stumpf, N. and Elbert, A. (2002). Toxicological and mechanistic studies on neonicotinoid cross


resistance in Q-type Bemisia tabaci (Hemiptera: Aleyrodidae). Pest Management Science, 58: 868-875.

25) Cuthbertson, A.G.S., Walters, K.F.A. & Deepe, C. (2005a). Compatibility of the entomopathogenic fungus Lecanicillium muscarium and insecticides for eradication of sweetpotato whitefly, Bemisia tabaci. Mycopathologia, 160: 35-41.

26) Cuthbertson, A.G.S., Walters, K.F.A. & Northing, P. (2005b). Efficacy of the entomopathogenic nematode, Steinernema feltiae, against sweetpotato whitefly, Bemisia tabaci, under laboratory and glasshouse conditions. Bulletin of Entomological Research, 160: 315-319.

27) MacGillivray, M.F. & Anderson, G.B. (1957). Three useful insect cages. Canadian Entomologist, 89: 43-46.

28) Butler, G.D., Henneberry, T.J. & Clayton, T.E. (1983). Bemisia tabaci: Development, Oviposition, and Longevity in relation to temperature. Annals of Entomological Society of America, 76: 310-313.

29) Bethke, J.A., Paine, T.D. & Nuessly, G.S. (1991). Comparative biology, morphometrics and development of two populations of Bemisia tabaci on cotton and poinsettia. Annals of Entomological Society of America, 84: 407-411.

30) Wang, K.H. & Tsai, J.H. (1996). Temperature effect on development and reproduction of silverleaf whitefly (Homoptera: Aleyrodidae). Annals of Entomological Society of America, 89: 375-384.

31) Cuthbertson, A.G.S., Blackburn, L.F., Northing, P., Luo, W., Cannon, R.J.C. & Walters, K.F.A. (2008). Further compatibility tests of the entomopathogenic fungus Lecanicillium muscarium with conventional insecticide products for control of sweetpotato whitefly, Bemisia tabaci on poinsettia plants. Insect Science, 15: 355-360.

32) Cuthbertson, A.G.S., Buxton, J.H., Blackburn, L.F., Mathers, J.J., Robinson, K.A., Powell, M.E., Fleming, D.A. & Bell, H.A. (2012). Eradicating Bemisia tabaci Q biotype on poinsettia plants in the UK. Crop Protection, 42: 42-48.

33) Cuthbertson, A.G.S., Mathers, J.J., Northing, P., Luo, W. & Walters, K.F.A. (2007). The susceptibility of immature stages of Bemisia tabaci to infection by the entomopathogenic nematode Steinernema carpocapsae. Russian Journal of Nematology, 15: 153-156.

34) Powell, M.E., Cuthbertson, A.G.S., Bell, H.A. Boonham, N., Morris, J. & Northing, P. (2012). First record of the Q Biotype of the sweetpotato whitefly, Bemisia tabaci, intercepted in the UK. European Journal of Plant Pathology, 133: 797-801.

35) Cuthbertson, A.G.S., Mathers, J.J., Croft, P., Nattriss, N., Blackburn, L.F., Luo, W., Northing, P., Murai, T., Jacobson, R.J. & Walters, K.F.A. (2012). Prey consumption rates and compatibility with pesticides of four predatory mites from the family Phytoseiidae attacking Thrips palmi Karny (Thysanoptera: Thripidae). Pest Management Science, 68: 1289-1295.

36) Tashiro, H. (1967). Self-watering acrylic cages for confining insects and mites on detached leaves. Journal of Economic Entomology, 60: 354–356

37) Messelink, G.J., van Steenpaal, S.E.F. & Ramakers, P.M.J. (2006). Evaluation of phytoseiid predators for control of western flower thrips on greenhouse cucumber. Biocontrol, 51: 753-768.

38) Nomikou, M., Sabelis, M.W. & Janssen, A. (2010). Pollen subsidies promote whitefly control through the numerical response of predatory mites. Biocontrol, 55: 253-260.

39) Nomikou, M., Janssen, A., Schraag, R. & Sabelis, M.W. (2004). Vulnerability of Bemisia tabaci immatures to phytoseiid predators: Consequences for oviposition and influence of alternative food. Entomologia Experimentalis et Applicata, 110: 95-102.

40) Nomikou, M., Janssen, A., Schraag, R. & Sabelis, M.W. (2002). Phytoseiid predators suppress populations of Bemisia tabaci on cucumber plants with alternative food. Experimental and Applied Acarology, 27: 57-68.

41) Cuthbertson, A.G.S., Blackburn, L.F., Northing, P., Luo, W., Cannon, R.J.C. & Walters, K.F.A. (2010). Further chemical compatibility testing of the entomopathogenic fungus Lecanicillium muscarium to control Bemisia tabaci in glasshouses. International Journal of Environmental Science and Technology, 7: 405-409.

42) Cuthbertson, A.G.S., Mathers, J.J., Northing, P., Prickett A.J. & Walters, K.F.A. (2008). The integrated use of chemical insecticides and the entomopathogenic nematode, Steinernema carpocapsae (Nematoda: Steinernematidae), for the control of sweetpotato whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae). Insect Science, 15: 447-453.

43) Fan, X. & Hominick, W.M. (1991). Efficiency of the Galleria (wax moth) baiting technique for recovering infective stages of entomopathogenic rhabditids (Steinernematidae and Heterorhabditidae) from soil and sand. Revue de Nématologie, 14: 381-387.


References to published material

9. This section should be used to record links (hypertext links where possible) or references to other published material generated by, or relating to this project.

Publications and other outputs arising from this project:

2010:

Cuthbertson, A.G.S. (2010). Tackling the tobacco whitefly risk. Certis News. pp14.

Cuthbertson, A.G.S. (2010). Eradicating Bemisia in UK glasshouses. Greenhouse Yearbook & Buyers

Guide. pp.21.

2011:

Bell, H., Fleming, D., Cuthbertson, A.G.S., Powell, M. & Northing, P. (2011). Biotype, origin and insecticide resistance of Bemisia tabaci interceptions in the UK: Implications for IPM. Integrated Control in Protected crops, Temperate Climate IOBC/wprs Bulletin 68: 11-14.

Cuthbertson, A.G.S., Blackburn, L.F., Eyre, D.P., Cannon, R.J.C., Miller, J. & Northing, P. (2011). Bemisia tabaci: The current situation in the UK and the prospect of developing strategies for eradication using entomopathogens. Insect Science 18: 1-10.

Cuthbertson, A.G.S., Blackburn, L.F., Mathers, J.J. & Northing, P. (2011). A review of the use of entomopathogenic nematodes for the control of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect Pathogens and Entomopathogenic Nematodes IOBC/wprs Bulletin 66: 317-320.

2012:

Cuthbertson, A.G.S. & Powell, M.E. (2012). Bemisia tabaci – a cryptic species complex. Biodiversity News 57: 17-18.

Cuthbertson, A.G.S., Buxton, J.H., Blackburn, L.F., Mathers. J.J., Robinson, K.A., Powell, M.E., Fleming, D.A. & Bell, H.A. (2012). Eradicating Bemisia tabaci Q biotype on poinsettia plants in the UK. Crop Protection 42: 42-48.

Powell, M.E. & Cuthbertson, A.G.S. (2012). First record of Bemisia tabaci Q biotype entering the UK. Fera Matters 35: 8.

Powell, M.E., Cuthbertson, A.G.S., Bell, H.A., Boonham, N., Morris, J. & Northing, P. (2012). First record of the Q Biotype of the sweetpotato whitefly, Bemisia tabaci, intercepted in the UK. European Journal of Plant Pathology 133: 797-801.

2013:

Cuthbertson, A.G.S. (2013). Update on the status of Bemisia tabaci in the UK and the use of entomopathogenic fungi within eradication programmes. Insects 4: 1-8.

Cuthbertson, A.G.S. (2013). A review of the use of entomopathogenic fungi for the control of Bemisia tabaci (Hemiptera: Aleyrodiae) in the UK. Insect Pathogens and Entomoparasitic Nematodes, IOBC/wprs Bulletin 90: 87-90.

Powell, M.E. & Cuthbertson, A.G.S. (2013). Pest control: distinguishing between different biotypes of

Bemisia tabaci in the UK. The Biologist 60: 18-21.

Documents

Evidence Project Final Report - randd.defra.gov.ukrandd.defra.gov.uk/Document.aspx?Document=13361_evid4_PH0440… · insecticide-degrading enzymes indicates that these oils may be