ArgRII, a Component of the ArgR-Mcm1 Complex Involved in the

MOLECULAR AND CELLULAR BIOLOGY,0270-7306/00/$04.0010

Mar. 2000, p. 2087–2097 Vol. 20, No. 6

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

ArgRII, a Component of the ArgR-Mcm1 Complex Involved in theControl of Arginine Metabolism in Saccharomyces cerevisiae,

Is the Sensor of ArginineNAJET AMAR, FRANCINE MESSENGUY,* MOHAMED EL BAKKOURY, AND EVELYNE DUBOIS

Institut de Recherches Microbiologiques J.-M. Wiame and Laboratoire de Microbiologiede l’Universite Libre de Bruxelles, B-1070 Brussels, Belgium

Received 20 September 1999/Returned for modification 11 November 1999/Accepted 16 December 1999

Repression of arginine anabolic genes and induction of arginine catabolic genes are mediated by a three-component protein complex, interacting with specific DNA sequences in the presence of arginine. AlthoughArgRI and Mcm1, two MADS-box proteins, and ArgRII, a zinc cluster protein, contain putative DNA bindingdomains, alone they are unable to bind the arginine boxes in vitro. Using purified glutathione S-transferasefusion proteins, we demonstrate that ArgRI and ArgRII1-180 or Mcm1 and ArgRII1-180 are able to reconsti-tute an arginine-dependent binding activity in mobility shift analysis. Binding efficiency is enhanced when thethree recombinant proteins are present simultaneously. At physiological concentration, the full-length ArgRIIis required to fulfill its functions; however, when ArgRII is overexpressed, the first 180 amino acids aresufficient to interact with ArgRI, Mcm1, and arginine, leading to the formation of an ArgR-Mcm1-DNAcomplex. Several lines of evidence indicate that ArgRII is the sensor of the effector arginine and that thebinding site of arginine would be the region downstream from the zinc cluster, sharing some identity with thearginine binding domain of bacterial arginine repressors.

Yeast ArgRII (Arg81) is one of the four proteins whichcoordinate the expression of arginine anabolic and catabolicgenes in response to arginine. ArgRII is 880 amino acids (aa)long and belongs to the Zn2Cys6 binuclear cluster proteins(21). Unlike Gal4 and Ppr1, which bind as dimers to DNAsequences with the palindromic CGG separated by 11 bp forGal4 and 6 bp for Ppr1, ArgRII does not bind by itself to thearginine boxes. It requires the presence of two other proteins,Mcm1 and ArgRI, belonging to the MADS-box family of tran-scription factors (6, 19). The target site of these three proteins(called the ArgR-Mcm1 complex) consists of a large DNAregion of about 40 to 60 nucleotides containing two arginineboxes homologous to the binding site of Mcm1 (PBox) (1, 7,20).

Pairwise interactions between ArgRII, ArgRI, and Mcm1were identified using the two-hybrid system. ArgRI and Mcm1interact also with ArgRIII, a pleiotropic regulatory factor re-quired for the stability of these two proteins (9). Binding of theArgR-Mcm1 proteins to DNA requires the presence of argi-nine, whereas the interactions between ArgRII, ArgRI, andMcm1 occur in the absence of the effector. Arginine is thusrequired for the interaction of the complex with the arginineboxes and not for the modulation of the activation ability, as inmost of the other systems identified in yeast. Since Mcm1 is apleiotropic regulator, one of the two specific regulatory pro-teins of the system, ArgRI or ArgRII, could contain the argi-nine binding site. Comparison of the amino acids sequence ofArgRII with those of the arginine repressors of Escherichia coli(ArgR) and Bacillus subtilis (AhcR) (18, 26) revealed that tworegions of ArgRII, located between aa 89 and 114 and aa 563and 587, share some identity with the C-terminal domain of thetwo bacterial repressors (Fig. 1). Different studies showed that

this domain of the hexameric E. coli ArgR repressor containsan arginine binding pocket defined in part by two aspartic acidresidues and is responsible for oligomerization (4, 25, 29, 30).

The present study aimed at defining in the ArgRII proteinthe regions interacting with DNA, with ArgRI and Mcm1, andalso with arginine, the effector. Although the mode of action ofmany regulatory proteins in response to physiological signalshas been extensively studied, the site of action of the smallmolecule effector in signaling environmental changes has beendefined in very few cases. It was shown only recently that theC-terminal end of Ppr1, the activator of the pyrimidine bio-synthetic pathway, contains the dihydroorotic acid-responsivedomain, which colocalizes with the activation domain. Thebinding of the effector converts DNA bound Ppr1 from atranscriptionally inactive state to an active one (11).

In this report, we provide evidence that the N-terminal endof ArgRII is sufficient for the formation of the DNA-ArgR-Mcm1 complex in response to arginine.

MATERIALS AND METHODS

Strains and media. Saccharomyces cerevisiae HY (diploid strain obtained bycrossing strains HF7c (MATa ura3-52 his3-200 lys2-801 ade2-101 trp1-901 leu2-3,112 gal4-542 gal80-538 LYS2::GAL1-HIS3 URA3::(GAL4(17-mers)3-CYC1-lacZ)and Y187 (MATa ura3-52 his3-200 ade2-101 trp1-901 leu2-3,112 met2 gal4Dgal80D URA3::GAL1-lacZ; Clontech) (15) was the recipient strain for experi-ments using the two-hybrid system. These strains lack both GAL4 and GAL80genes and contain an integrated GAL1-lacZ reporter gene activated by the GALupstream activation sequence (URA3::GAL1-lacZ) and an integrated GAL1-HIS3 reporter gene.

Strain 02463dII (MATa leu2 ura3 argRII::KanMX4) (9) was used as recipientstrain for transformation with plasmids expressing wild-type or mutated ARGRIIgenes.

All yeast strains were grown on minimal medium containing 3% glucose or 1%galactose, vitamins, and mineral traces (17) (M.glucose or M.galactose, respec-tively). Nitrogen source was 0.02 M ammonium sulfate. For the two-hybridexperiments, yeast cells were grown in synthetic medium containing 0.7% yeastnitrogen base without amino acids. This medium was supplemented with 2%glucose and all amino acids except those whose omission was required forplasmid selection.

The lithium acetate procedure was used to transform the recipient yeaststrains (13).

* Corresponding author. Mailing address: Institut de RecherchesMicrobiologiques J.-M. Wiame, 1 Ave. E. Gryzon, B-1070 Brussels,Belgium. Phone: 32-2-5267277. Fax: 32-2-5267273. E-mail: [email protected].

2087

on February 11, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

E. coli XL1B and JM109 (Stratagene) were used for plasmid amplification andin vitro mutagenesis.

Construction of plasmids expressing different N-terminal portions of ArgRIIunder GAL10 or its own promoter. To overexpress the first 128 and 180 aa ofArgRII, plasmid pME52 containing the wild-type ARGRII gene was used tosynthesize by PCR BamHI-NotI DNA fragments using oligonucleotides RII38(BamHI)-RII39 (NotI) and RII38-RII58 (NotI), respectively (Table 1). Thesefragments were inserted in the BamHI and NotI sites of vector pYeF2 (pUC19,2mm URA3 GAL10 promoter) (5), yielding plasmids pNA44 (GAL10-ArgRII1-128) and pNA53 (GAL10-ArgRII1-180). To fuse the activation domain of Gal4(GAD) to the first 180 aa of ArgRII, we synthesized by PCR a NotI DNAfragment encoding aa 768 to 881 of Gal4 from plasmid pCL1 (10), using oligo-nucleotides OAD1 and OAD2. This fragment was inserted into the NotI site ofplasmid pNA53, generating in-frame ArgRII1-180-GAD fusion protein (pNA54).All genes were sequenced to ensure that no mutation was introduced during thePCR procedure.

Creation of mutations in the full-length ARGRII gene. Different oligonucleo-tides (Table 1) were used to create substitutions by in vitro mutagenesis onsingle-stranded DNA prepared from pME52 (pGem7-ARGRII) or pNA84(pALTER1-ARGRII) containing the full-length ARGRII gene expressed fromits own promoter. The resulting plasmids were pNA31 (pGem7-argRIIC31L),pNA56 (pGem7-argRIIC38L,C41L), pWS1 (pALTER1-argRIIP36L), pNA88(pALTER1-argRIID101A,E102A,E103A), pNA89 (pALTER1-argRIIE108A,D109A),pNA119 (pALTER1-argRIIQ89A,D96A,D111A,D112A), pNA120 (pALTER1-argRIID96A,D111A,D112A), pNA123 (pALTER1-argRIID101A,E102A,E103A,E108A,D109A),pNA124 (pALTER1-argRIID101A,E102A,E103A,D111A,D112A), pNA131 (pALTER1-argRIIQ89A,E108A,D109A), and pNA132 (pALTER1-argRIID96A,E108A,D109A).The wild-type and different mutated 3.4-kb BamHI-BamHI DNA fragmentswere inserted into the centromeric vector pFL38 (pUC19, CEN6 ARS URA3),

leading to plasmids pNA109 (wild type), pNA36, pNA110, pWS4, pNA114,pNA115, pNA125, pNA126, pNA129, pNA130, pNA139, and pNA140, respec-tively. We also recreated in vitro three mutations localized in the N-terminal endof ArgRII corresponding to mutations isolated by in vivo selection, leading tothe following changes: D32N, G50D, and R99P. After mutagenesis, the 3.4-kbBamHI-BamHI DNA fragments were inserted into pFL38 vector, leading toplasmids pBJ250, pBJ202, and pBJ211.

Creation of mutations in the N-terminal end of ArgRII (aa 1 to 180). Tooverexpress the wild-type and mutated N-terminal ends of ArgRII, we usedplasmids pNA84, pNA31, pNA56, pBJ250, pWS1, pBJ202, pBJ211, pNA123, andpNA124 (described above) to synthesize BamHI-NotI DNA fragments by PCR,using oligonucleotides RII38 and RII58, containing a BamHI and a NotI restric-tion site, respectively (Table 1). After amplification by PCR, these differentfragments were digested by BamHI and NotI and inserted into the BamHI andNotI sites of vector pYeF2 (pUC19, 2mm URA3 GAL10 promoter) (5), yieldingplasmids pNA53 (GAL10-ArgRII1-180), pNA63 (GAL10-argRII1-180C31L),pNA64 (GAL10-argRII1-180C38L,C41L), pNA78 (GAL10-argRII1-180D32N), pNA79(GAL10-argRII1-180P36L), pNA77 (GAL10-argRII1-180G50D), pNA76 (GAL10-argRII1-180R99P), pNA137 (GAL10-argRII1-180D101A,E102A,E103A,E108A,D109A),pNA138 (GAL10-argRII1-180D101A,E102A,E103A,D111A,D112A). All genes were se-quenced to ensure that no additional mutation was introduced during the PCRprocedure.

Construction of GAD-ARGRII fusions. GBD refers to the DNA binding do-main of the Gal4 activator, Gal4(1-147), and GAD refers to its activation do-main, Gal4(768-881). GBD and GAD will refer to the DNA sequences encodingthese domains. GBD-ARGRI and GBD-MCM1 fusions were constructed as de-scribed elsewhere (9). GAD-ARGRII fusions were constructed in vector pACTII(8); transformants harboring the vector or a derivative thereof were selected byomitting leucine from the growth medium.

(i) GAD-ARGRII fusion. To construct the GAD-ARGRII gene fusion, we usedoligonucleotide-directed in vitro mutagenesis to create a BamHI restrictionsite at the initiator codon of the ARGRII gene in plasmid pME52, bearing theARGRII gene on a 3.4-kb DNA fragment (using oligonucleotide RII52), yieldingplasmid pME8. The 3.2-kb BamHI-BamHI DNA fragment from plasmid pME8was inserted in the BamHI site of the vector pACTII, leading to plasmid pME9(GAD-ARGRII). In this GAD-ARGRII fusion, we determined the nucleotidesequence of the junction between the GAD-encoding region and the ARGRIIgene to ensure that the fusions were in frame.

(ii) GAD-argRII fusions containing deletions in the ARGRII gene. To fusedifferent portions of ARGRII to GAD, we amplified by PCR different DNAfragments, using as template the ARGRII gene present on pME52 and as primers

FIG. 1. Amino acid alignment between yeast ArgRII and E. coli ArgR andB. subtilis AhrC. Identical amino acids are shaded, and amino acids contactingarginine in E. coli ArgR are underlined. The first and last residue numbers areindicated.

TABLE 1. Oligonucleotides used for in vitro mutagenesis in ARGRII and CAR1 genes

Oligomer Length(nucleotides) Sequence Amino acid change(s)

RII38 27 CCCGGGGATCCAGATATAATGGGAATT Creation of a BamHI site at position 27RII39 30 CCCAAATTTCTTTATGAGGATCCACTAGTT Creation of a NotI site at position 1410RII58 30 CCGGCGGCCGCTAGTTGAAGAAGATGGTAA Creation of a NotI site at position 1542RII103 37 GCCGGATCCTCTTCTCTGTACCTCTTTAATG Creation of a BamHI site at position 1901RII78 21 AAAGTTAAGTTAGATCTTCGG C31LRII40 30 CATCCCCACTTACAACGATTAGAAAAGTCT C38L, C41LRII61 27 GATCTTCGGCATTTACACTGCCAACGA P36LRII79 21 GATGAACCAGCATACCAACGA Q89ARII80 21 CGGAACATCGCTTTTGTGCGC D96ARII81 27 GTGCGCTATGCTGCAGCATACGTGTAT D101A, E102A, E103ARII82 24 GTGTATCATGCAGCTATGGATGAT E108A, D109ARII83 24 GAAGATATGGCTGCTGAGCTAACA D111A, D112ARII52 30 AAGTTGCAGATAGGATCCGAATTTTCAGCA Creation of a BamHI site at position 11RII09 30 GCCGGGATCCTAAGTTGAAGAAGATGGTAA Creation of a BamHI site at position 1542RII16 28 GCCGCCGGGATCCTTAATCATTGGCACTGGC Creation of a BamHI site at position 1901RII64 27 GCCGGGATCCCTATGCAATTTGACCCG Creation of a BamHI site at position 1179RII08 27 GCCGGGATCCAACGACGGAACATCGAT Creation of a BamHI site at position 1272RII10 30 GCCGGGATCCATATTATACCCAAAACAG Creation of a BamHI site at position 11139RII11 33 GCCGGGATCCTATTTTTGTAGTTTGTAGTTCCT Creation of a BamHI site at position 11412RII93 27 GCCGGGATCCACAAACTACAAAAATAC Creation of a BamHI site at position 11397RII94 27 GCCGGGATCCTAAAATTTTCGGGGTAC Creation of a BamHI site at position 12146RII14 27 GCCGGGATCCCTGTACCCCGAAAATTT Creation of a BamHI site at position 12129RII15 30 GCCGGGATCCTTATGATAGCATCAGATT Creation of a BamHI site at position 12641CAR1-99 39 CAAGCACCGTGTTTCCTAATTAGGAAATCAACAGCGC Replacement of arginine box B by PPALCAR1-100 39 GCGCTGTTGATTTCCTAATTAGGAAACACGGTGCTTTG Replacement of arginine box B by PPALCAR1-DE 08 30 CCGCTCGAGCGCCGCGAAAATATCGGCTAG Primer to generate CAR1 fragmentCAR1-DE 09 30 CCGCTCGAGTGATAGAAAGTGGGCCGCAAG Primer to generate CAR1 fragmentOAD1 30 CCGTCTGCTTTGGGCGGCCGCGCCAATTTT Primer to generate GAD fragment in GAL4OAD2 33 GGGGGCGGCCGCTTACTCTTTTTTTGGGTTTGG Primer to generate GAD fragment in GAL4

2088 AMAR ET AL. MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

synthetic oligonucleotides containing a BamHI restriction site. OligonucleotidesRII52-RII09, RII52-RII16, RII52-RII39, RII64-RII09, RII08-RII09, RII08-RII16, RII10-RII11, RII93-RII94, and RII14-RII15 (Table 1) allowed amplifi-cation of the regions from aa 2 to 180 (534 bp), 2 to 302 (900 bp), 2 to 128 (378bp), 60 to 180 (360 bp), 91 to 180 (267 bp), 91 to 302 (633 bp), 381 to 470 (267bp), 467 to 715 (744 bp), and 710 to 881 (513 bp), respectively. The differentBamHI-BamHI DNA fragments were inserted in the BamHI site of pACTII vec-tor, leading to plasmids pNA47 (GAD-ArgRII2-180), pNA58 (GAD-ArgRII2-302), pNA43 (GAD-ArgRII2-128), pNA48 (GAD-ArgRII60-180), pNA23 (GAD-ArgRII91-180), pNA27 (GAD-ArgRII91-302), pNA46 (GAD-ArgRII381-470),pNA150 (GAD-ArgRII470-710), and pNA25 (GAD-ArgRII710-880) in vectorpACTII. All genes were sequenced to ensure that the fusions were in frame andthat no mutation had been introduced during the PCR procedure.

(iii) GAD-argRII2-180 fusions containing different mutations in the ARGRIIgene. Plasmids pNA31, pNA56, pBJ250, pWS1, pBJ202, pNA86, pBJ211,pNA87, pNA88, pNA89, pNA90, pNA123, and pNA124 (described above)were used to synthesize 540-bp BamHI-BamHI DNA fragments by PCR, us-ing oligonucleotides RII52 and RII09 (Table 1). These fragments were insert-ed in the BamHI restriction site of plasmid pACTII (GAD), yielding plas-mids pNA65 (GAD-argRII2-180C31L), pNA66 (GAD-argRII2-180C38L,C41L),pNA74 (GAD-argRII2-180D32N), pNA75 (GAD-argRII2-180P36L), pNA73(GAD-ArgRII2-180G50D), pNA72 (GAD-argRII2-180R99P), pNA146 (GAD-argRII2-180D101A,E102A,E103A,E108A,D109A), and pNA161 (GAD-argRII2-180D101A,E102A,E103A,D111A,D112A). All genes were sequenced to ensure that thefusions were in frame and that no additional mutation had been introducedduring the PCR procedure.

Construction and purification of GST fusion proteins. To produce purifiedArgRI, ArgRII, and Mcm1 proteins, we expressed them as glutathione S-trans-ferase (GST) fusions in E. coli. To construct GST-ArgRI, we inserted a 1.7-kbBamHI fragment from plasmid pYM3 (9) containing the ARGRI gene in whicha BamHI restriction site was introduced in the initiator codon, allowing in-framefusion with GST. This fragment was inserted into the BamHI site of plasmidpGEX-5X-3 (Pharmacia), yielding plasmid pME53. To construct GST-Mcm1,we inserted a 0.9-kb BamHI fragment from plasmid pME15 (9) containing theMCM1 gene in which a BamHI restriction site was introduced in the initiatorcodon, allowing in-frame fusion with GST. This fragment was inserted into theBamHI site of plasmid pGEX-5X-3, yielding plasmid pME58. To constructfusions between GST and the wild-type and mutated N-terminal end (180 aa) ofArGRII, we synthesized by PCR BamHI-NotI fragments using oligonucleotidepair RII52-RII58 and plasmids pME52 (ArgRII wild type) and pNA123(argRIID101A,E102A,E103A,E108A,D109A). These fragments were inserted intothe BamHI-NotI sites of plasmid pGEX-5X-3, yielding plasmids pME106 andpNA162, respectively, allowing in-frame fusions of the different proteins withGST.

Following transfection of E. coli XL1-B by plasmids expressing the differentGST fusion proteins, induction of the fusion genes was achieved by addition of500 mM isopropyl-b-D-thiogalactopyranoside for 3 h at 37°C. Bacterial pelletswere resuspended in phosphate-buffered saline (PBS; 140 mM NaCl, 2.7 mMKCl, 10 mM Na2HPO4, 1.8 mM KH2PO4) containing a mixture of proteaseinhibitors and sonicated on ice for 3 min. After spinning at 12,000 rpm for 15min, the supernatants were collected and sieved through a column containingglutathione-Sepharose 4B beads (Pharmacia) at 4°C. After extensive washes withPBS buffer, the GST fusions proteins were eluted by 0.1 M glutathione–50 mMTris-HCl buffer (pH 8).

Replacement of the arginine boxes of the CAR1 promoter by a perfect PPALsequence. Nucleotides from 2211 to 2199 were replaced by the sequence 59TTTCCTAATTAGGAAA39. In vitro mutagenesis was performed as described byStratagene, using plasmid pCV7 (pFL38-CAR1) (7) and oligonucleotides CAR1-99 and CAR1-100 (Table 1), yielding plasmid pFV72.

Enzyme assay. b-Galactosidase activity was assayed as described by Miller(24). Protein contents were determined by the Folin method. Ornithine carba-moyltransferase (OTCase) and arginase activities were assayed as describedpreviously (22).

DNA manipulation and DNA sequencing. Restriction reactions were per-formed as recommended by the enzyme supplier. DNA fragments were isolatedfrom agarose gels by Geneclean. Plasmid DNA was prepared by the alkaline lysismethod (2) or rapid boiling lysis (12).

Denatured double-stranded DNA was used as template for DNA sequencing.Double-stranded DNA was prepared using Qiagen columns. DNA was se-quenced by the dideoxynucleotide chain termination method of Sanger et al.(28), oligonucleotides being used as primers. Site-directed in vitro mutagenesiswas performed with a Sculptor in vitro mutagenesis system (Amersham), anAltered Sites II in vitro mutagenesis system (Promega), or a QuikChange site-directed mutagenesis kit (Stratagene). Preparation of single-stranded DNA tem-plates for in vitro mutagenesis is described by Messing (23).

Gel retardation assays. Extract preparation and the binding assays were per-formed as described in reference 6. For binding studies, a 160-bp AluI-AluIfragment containing the control region of the ARG5,6 gene was used. Thedifferent CAR1 DNA fragments were synthesized by PCR from plasmids pCV7and pFV72 as templates, using oligonucleotides CAR1-DE08 and CAR1-DE09,generating 170-bp DNA fragments. These fragments were end labeled with[g-32P]ATP (Amersham) by using polynucleotide kinase by the standard method

(16). For the experiments described in Fig. 5, the bands were scanned with aSharp JX330 scanner and quantified using Macintosh computer image analysissoftware (BioImage IQ version 2.1.1).

Western blot analysis. For ArgRII detection, 25 ml of exponentially growingcells was harvested by centrifugation, and the proteins were extracted by thetrichloroacetic acid method described by Clontech. About 50 mg of total proteinswas separated on a 10% polyacrylamide gel containing sodium dodecyl sulfate(SDS) as described by Laemmli (14). After electrotransfer of proteins to Hybondmembranes, specific proteins were detected with polyclonal antibodies raisedagainst GST-ArgRII2-180 obtained by injection of this purified protein in mice.Antibodies were a gift from Paul Jacobs. After incubation with anti-mouseimmunoglobulin G-specific antibody conjugate to horseradish peroxidase, per-oxidase activity was revealed with an enhanced chemiluminescence kit as spec-ified by the supplier (Boehringer).

In vitro protein-protein interaction. GST-ArgRII2-180 and the GST moietywere prepared as described above and independently immobilized on glutathi-one-Sepharose 4B beads. After being washed, beads were split into severalportions for subsequent binding experiments. Semipurified yeast extracts (100mg) (6) overexpressing ArgRI or Mcm1 were incubated overnight at 4°C withGST-ArgRII2-180 fusion protein immobilized on glutathione-Sepharose 4Bbeads. After being extensively washed with cold PBS, beads were boiled in SDSloading buffer, samples were separated on SDS–10% polyacrylamide gels, andproteins were transferred to Hybond membranes and detected by Western anal-ysis with polyclonal antibodies raised against GST-Mcm1, GST-ArgRI, and aC-terminal ArgRI peptide (6), and peroxidase activity was revealed with anenhanced chemiluminescence kit as specified by the supplier (Boehringer).

RESULTS

The first 180 aa of ArgRII are sufficient for the formationof an arginine-dependent regulatory complex at the arginineboxes. We previously showed that the formation of a protein-DNA complex with the arginine boxes in vitro required thepresence of arginine and the integrity of ArgRI, Mcm1, andArgRII. The use of antibodies in gel shift assays demonstratedthat ArgRI and Mcm1 were part of the DNA-protein complex.Overexpression of ArgRII strongly enhanced the formation ofthis complex, indicating its participation (6, 19).

Previous experiments have also shown that most of the de-letions created along the ARGRII gene affected ArgRII func-tions in vivo, but only the deletions of aa 1 to 60, containing thezinc cluster, and aa from 96 to 165, containing the first putativearginine binding domain, impaired the binding of the ArgR-Mcm1 complex to DNA in vitro (27). It is noteworthy that thedeletion of the region from aa 533 to 625, comprising thesecond putative arginine binding domain (aa 563 to 587), im-paired the ArgRII function but not its capacity to participate inthe formation of the ArgR-Mcm1-DNA complex (27). Thesedata suggested that about the first 200 aa could be sufficient toensure an arginine-dependent binding of the complex to DNA.

To determine the minimal domain of ArgRII required forthe formation of the arginine-dependent DNA-protein com-plex, we expressed the 128 and 180 N-terminal aa under thecontrol of the GAL10 promoter from plasmids pNA44 andpNA53 (see Materials and Methods). After growth onM.galactose or M.glucose of strain 02463dII (ura3 leu2 argRII::KanMX4) transformed with pNA44 or pNA53, proteins wereextracted and semipurified on heparin-Sepharose as describedby Dubois and Messenguy (6). Gel shift assays performed withthe ARG5,6 promoter showed that the first 180 aa, but not thefirst 128 aa of ArgRII, were sufficient for the formation ofArgR-Mcm1 complexes (Fig. 2, lanes 2 and 4). This bindingwas strongly enhanced with the extract from the strain over-expressing ArgRII1-180 (lanes 3 and 4) and was arginine de-pendent (lanes 5 and 6). To determine whether this truncatedprotein is able to fulfill the ArgRII functions in vivo (repres-sion of anabolism and induction of catabolism), we measuredthe activities of the anabolic enzyme OTCase and the catabolicenzyme arginase, in the presence and absence of arginine inthe growth medium. Therefore, the argRII deletion strain02463dII (ura3 leu2 argRII::KanMX4) was transformed with

VOL. 20, 2000 ROLE OF ArgRII N-TERMINAL END IN ARGININE REGULATION 2089


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

plasmids expressing different portions of ArgRII under thecontrol of the GAL10 promoter: pYeFRII1-880 (pME50),pYeFRII1-128 (pNA44), pYeFRII1-180 (pNA53), andpYeFRII1-180-ADGal4 (pNA54). The transformed strains inwhich ARGRII expression is dependent on the GAL10 pro-moter were grown on galactose as the carbon source, with orwithout L-arginine (1 mg/ml). Measurements of OTCase andarginase specific activities showed that the first 180 aa ofArgRII repressed partially the synthesis of OTCase but did notinduce the synthesis of arginase (Table 2). The recovery ofinduction of arginase required the addition of the Gal4 acti-vation domain at the C end of the 180 aa of ArgRII (Table 2).This hybrid protein had two effects on expression of the ARG3gene, encoding OTCase. The basal enzyme level on M.ammo-

nia was enhanced, probably resulting from the presence of theGal4 activation domain, but when arginine was added to thegrowth medium, a twofold repression was observed.

All of these data suggest that the first 180 aa of ArgRII areable to bind the arginine boxes in vitro as well as in vivo. TheN-terminal end of ArgRII contains thus a region contactingDNA (presumably the Zn2C6 cluster), a domain interactingwith ArgRI and Mcm1, and a sequence binding the effector,arginine.

To determine the amino acids responsible for these differentinteractions, we tested the interaction of the N-terminal end ofArgRII with ArgRI and Mcm1 using the two-hybrid systemand created a series of mutations in the Zn2C6 cluster and inthe putative arginine binding domain.

The first 180 aa of ArgRII interact with ArgRI and Mcm1 invivo and in vitro. Using the two-hybrid system, we have shownthat the full-length ArgRII interacts with ArgRI and Mcm1(9). To determine the domains of ArgRII interacting with thetwo MADS-box proteins, we fused different portions of ArgRIIto GAD (see Materials and Methods) and determined theirinteraction with GBD-ArgRI and GBD-Mcm1. Strain HY wastransformed with plasmid pME46 (pGBD-ARGRI TRP1 2mm)and the different GAD-ARGRII plasmids (pGAD-ARGRIILEU2 2mm) (Fig. 3). Expression of the lacZ reporter gene wasmonitored by b-galactosidase activity assays. The first 180 aa ofArgRII interacted with ArgRI with about the same efficiencyas the full-length ArgRII (Fig. 3, lines 1 and 2). In contrastwhen the first 128 aa or aa 60 to 180 of ArgRII were used, only20% of the interaction capacity was retained (Fig. 3, lines 2, 4,and 5). All other regions showed only a poor interaction, sincethe b-galactosidase levels were comparable to the level ob-tained in a strain expressing only GBD-ArgRI (lines 8 to 10compared to line 11). A strain transformed with only GAD-ArgRII exhibited no detectable b-galactosidase activity.

Similarly, the interactions between different portions ofArgRII and Mcm1 were measured by assaying b-galactosi-dase activity in HY strains transformed with plasmid pNA51(pGBD-MCM1 TRP1 2 mm) and the different GAD-ARGRIIplasmids (pGAD-ARGRII LEU2 2mm). As for ArgRI, the first180 aa of ArgRII proved to be sufficient to interact with Mcm1,but the region between aa 181 and 302 could also contribute toincrease the efficiency of the interaction (Fig. 3, lines 2 and 3compared to lines 6 and 7). All other regions showed only apoor interaction, since the b-galactosidase levels were compa-rable to the level obtained in a strain expressing only GBD-Mcm1 (lines 8 to 10 compared to line 11).

ArgRII thus interacts with ArgRI and Mcm1 through its first180 aa. However, we cannot exclude that another region of

FIG. 2. Arginine-dependent binding of ArgRII1-180, ArgRI, and Mcm1 toARG5,6 DNA. The end-labeled 160-bp AluI-AluI ARG5,6 DNA fragment (about1 ng) was incubated with 10 mg of yeast extracts prepared from strain 02463dII(ura3 leu2 argRII::KanMX4) transformed with plasmid pNA44 (pGAL10-argRII1-128 2mm, URA3) (lanes 1 and 2) and pNA53 (pGAL10-argRII1-180 2mm URA3)(lanes 3 to 6) grown on M.ammonia-glucose and 50 mg of L-leucine per ml (lanes1 and 3) or M.ammonia-galactose and 50 mg of L-leucine per ml (lanes 2, 4, 5, and6). In all in vitro assays, 5 mM L-arginine was added except in lane 5.

TABLE 2. Capacity of the N-terminal end of ArgRII1-180 to repress the expression of arginine anabolic genes andinduce the expression of arginine catabolic genesa

Strain 02463dII plus:

Sp act

Arginase (mmol of ureaformed/h/mg of protein)

OTCase (mmol of citrullineformed/h/mg of protein

M.ammonia M.ammonia 1 arginine M.ammonia M.ammonia 1 arginine

No plasmid 4 5 30 28pME50 (URA3 2mm GAL10-ArgRII1-880) 41 153 13 5.6pNA44 (URA3 2mm GAL10-ArgRII1-128) 8 9 22 21pNA53 (URA3 2mm GAL10-ArgRII1-180) 7 7 23 11pNA54 (URA3 2mm GAL10-ArgRII1-180-ADGal4) 14 55 51 27

a Arginase and OTCase activities were measured in strain 02463dII (ura3 leu2 argRII::KanMX4) transformed with various plasmids after growth on 2% galactose asthe carbon source. Specific activities are the means of three independent measurements that did not differ by more than 15%; 50 mg of L-leucine per ml was addedin the growth media; 25 mg of uracil was also added when no plasmid was present in the strain.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

ArgRII could contact the MADS-box proteins, since we haveno proof of the stability of the GAD-ArgRII hybrid proteins;none of the GAD-ArgRII proteins could be detected by West-ern blotting using antibodies raised against GAD or GST-ArgRII2-180.

To provide biochemical evidence for interaction betweenthe N-terminal end of ArgRII and the two MADS-box pro-teins, we performed GST pull-down experiments using bacte-rially expressed GST-ArgRII2-180 and semipurified yeast ex-tracts overexpressing ArgRI or Mcm1 (see Materials andMethods). Equivalent amounts of GST-ArgRII2-180 and GSTproteins immobilized on glutathione-Sepharose 4B beads wereincubated with yeast extracts containing ArgRI or Mcm1. Afterextensive washes, bound proteins were visualized by Westernblotting with antibodies raised against GST-Mcm1, allowing usto detect GST, GST fusion proteins, and Mcm1. GST alone didnot retain Mcm1 (Fig. 4A, lane 2), whereas Mcm1 bound toimmobilized GST-ArgRII2-180 (lane 4). Figures 4B and Cshow the results obtained for ArgRI. Since GST and ArgRImigrate at the same position, we did not use antibodies raisedagainst GST-ArgRI but instead used two antibodies, oneraised against GST to identify GST and GST fusion proteinsand a second raised against an ArgRI C-terminal peptide todetect ArgRI. Therefore, two identical gels were transferred toHybond membranes and hybridized with each antibody. GSTalone did not interact with ArgRI (Fig. 4B, lane 2). In contrast,a significant amount of ArgRI bound to GST-ArgRII2-180(Fig. 4C, lane 4).

Analysis of mutations created in the N-terminal end ofArgRII (aa 1 to 180). To further analyze the region of theprotein sufficient to form a complex with ArgRI and Mcm1able to interact with DNA in an arginine-dependent fashion,

we created a series of mutations in the Zn2C6 cluster and in theputative arginine binding domain. The mutations were ana-lyzed for their effect on binding of the ArgR-Mcm1 complex toDNA in vitro as a function of the arginine concentration, forthe ability to interact with ArgRI and Mcm1, and for thecapacity to repress the expression of anabolic genes and toinduce the catabolic genes.

In the Zn2C6 cluster, we mutated by in vitro mutagenesis(see Materials and Methods) some residues among the Zn2C6regulatory proteins, thus creating the substitutions C31L,C38L, C41L, D32N, P36L, and G50D. The D32N and G50Dsubstitutions, which corresponded to mutations selected invivo, were recreated by in vitro mutagenesis. Even at higharginine concentrations, all of the mutations impaired thebinding of the ArgR-Mcm1 complex to DNA, as expectedfor this type of protein (data not shown).

In the putative arginine binding domain, from aa 89 to 114,we replaced by alanine a series of acidic residues and some ofthe amino acids that were shown to contact arginine in theE. coli ArgR repressor. Most of the single or combined alaninereplacements of residues Q89, D96, D101, E102, E103, E108,D109, D111, and D112 had no significant effect in vitro, al-though some changes partially impaired the ArgRII function invivo, since the repression of OTCase and induction of arginasewere reduced (see Table 4 and comments in the next section).In contrast, the multiple substitutions D101A,E102A,E103A,E108A,D109A introduced in ArgRII1-180 (pNA137) abol-ished formation of the protein-DNA complexes, whereas thecombined substitutions D101A,E102A,E103A,D111A,D112A(pNA138) and the substitution R99P (pNA76), which corre-sponds to a mutation isolated in vivo, reduced the binding

FIG. 3. Determination of the region of ArgRII interacting with ArgRI and Mcm1 in vivo. The full-length ArgRII and different portions of ArgRII were fused inframe with the activation domain of Gal4 (GAD-ArgRII), and full-length ArgRI and Mcm1 were fused in frame with the DNA binding domain of Gal4 (GBD).Transcription activation of the lacZ reporter gene was determined by b-galactosidase activity assays, performed at 30°C on extracts of at least three independenttransformants containing both plasmids. The standard error was 15% of the mean. Specific activity is expressed in nanomoles of o-nitrophenyl-b-D-galactopyranosidehydrolyzed per minute per milligram of protein. Hatched boxes correspond to the GAD, black boxes represent portions of ArgRII, and grey boxes represent the Zn2C6zinc cluster (aa 21 to 48).



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

efficiency. As shown by Western blot, the various ArgRII1-180mutated proteins were present in all extracts (Fig. 5A and B).

It is worth noting that the mutated ArgRII1-180 proteinproduced from plasmid pNA138 (D101A, E102A, E103A,

D111A, D112A) required at least a 10- to 20-fold-higher argi-nine concentration than the wild-type protein to obtain 50%binding efficiency of the ArgR-Mcm1 complex to DNA, asshown by densitometric analysis of autoradiographs of the dif-ferent DNA-protein complexes obtained in gel shift experi-ments performed with different arginine concentrations (Fig.5C and D). The R99P substitution also impaired the DNAbinding capacity and to a lesser extent the requirement forarginine. In contrast to mutations in the zinc cluster whichcannot be rescued by arginine, some mutations in the region ofArgRII showing sequence identity with bacterial repressors ledto an apparent reduced affinity for arginine, suggesting thatthis region could contain an arginine binding site.

To determine whether the lack of formation of an ArgR-Mcm1-DNA complex observed in the argRII mutants de-scribed above resulted from the loss of interaction of ArgRIIwith ArgRI or Mcm1, we fused the coding sequence of the first180 aa containing the different mutations to the GAD (seeMaterials and Methods). Strain HY was transformed with apGBD-ARGRI (pME46) or pGBD-MCM1 (pNA51) plasmidand plasmids pGAD-ArgRII2-180 (pNA47), pGAD-argRII2-180C31L (pNA65), pGAD-argRII2-180C38L,C41L (pNA66),pGAD-argRII2-180D32N (pNA74), pGAD-argRII2-180P36L(pNA75), pGAD-argRII2-180G50D (pNA73), pGAD-argRII2-180R99D (pNA72), pGAD-argRII2-180D101A,E102A,E103A,E108A,D109A(pNA146), and pGAD-argRII2-180D101A,E102A,E103A,D111A,D112A(pNA161). As shown in Table 3, b-galactosidase assays fromthe different transformed strains revealed that none of thesemutations led to the loss of interaction between the mutatedargRII proteins and the two MADS-box proteins, although theefficiency of interaction was reduced in some mutants. Thus,these mutations do not affect primarily the formation of theArgRI-ArgRII-Mcm1 complex but rather its interaction withthe arginine boxes or with the effector, arginine.

Effects of mutations created in the full-length ArgRII pro-tein on its ability to regulate the expression of arginine genes.The effects of mutations analyzed above were studied using theoverexpressed N-terminal portion of ArgRII protein. To fur-ther investigate the involvement of some amino acids locatedin the zinc cluster or in the putative arginine binding site, wecreated a series of nucleotide substitutions in the full-lengthARGRII gene, expressed from its own promoter and thus inphysiological conditions (Table 4).

All mutations created in the zinc cluster impaired, as ex-pected, both the induction of arginase (CAR1 gene product)and the repression of OTCase (ARG3 gene product) by argi-nine (data not shown). In the putative arginine binding do-main, only the combined alanine substitutions of five aminoacids (D101,E102,E103,E108,D109) led to a complete loss ofArgRII function (Table 4) and impaired binding to the argi-nine boxes even at high arginine concentrations (data notshown), as observed with the N-terminal end of ArgRII con-taining the same substitutions (Fig. 5A, lanes 13 to 16). Someother combinations and the substitution R99P reduced signif-icantly induction of arginase and repression of OTCase (Table4). Most of the mutations affected more readily the repressionof anabolic genes than the induction of catabolic genes.

Reconstitution of the arginine-dependent binding activity toarginine boxes from recombinant GST-ArgRI, GST-ArgRII2-180 and GST-Mcm1. Although previous results demonstratedthat ArgRI, Mcm1, and ArgRII were required for the assemblyof a heteromeric complex at the arginine boxes, they did notprove that they were the only proteins required for assemblyand arginine-dependent DNA binding. To address this point,we performed mobility shift studies using various combinationsof purified recombinant GST-ArgRI, GST-Mcm1, and GST-

FIG. 4. In vitro association of the first 180 aa of ArgRII with ArgRI andMcm1. (A) In vitro interaction between ArgRII2-180 and Mcm1. Purified GST(lanes 1 and 2) and GST-ArgRII2-180 (lanes 3 and 4) were immobilized onglutathione-Sepharose 4B beads. About 100 mg of semipurified proteins (6) fromstrain 02463d (ura3 leu2) transformed with plasmid pED40 (overexpressing theMCM1 gene) was allowed to bind to the beads (lanes 2 and 4). Lane 5 contains10 mg of the yeast semipurified extract. After extensive washing, bound proteinswere separated on an SDS–10% polyacrylamide gel and detected by Westernblotting using polyclonal antibodies against GST-Mcm1. Size standards are in-dicated on the left. (B and C) In vitro interaction between ArgRII2-180 andArgRI. Purified GST (lanes 1 and 2) and GST-ArgRII2-180 (lanes 3 and 4) wereimmobilized on glutathione-Sepharose 4B beads. About 100 mg of semipurifiedproteins (6) from strain 02463d (ura3 leu2) transformed with plasmid pME51(overexpressing the ARGRI gene on galactose) was allowed to bind to the beads(lanes 2 and 4). Lane 5 contains 10 mg of the yeast semipurified extract. Afterextensive washing, bound proteins were separated on an SDS–10% polyacryl-amide gel and detected by Western blotting using polyclonal antibodies againstGST (B) or against a C-terminal peptide of ArgRI (C). Size standards are indi-cated on the left.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

FIG. 5. Effects of different mutations in the argRII1-180 protein on the formation of ArgR-Mcm1 complexes with ARG5,6 DNA as a function of different arginineconcentration. (A) Gel retardation assays. The end-labeled 160-bp AluI-AluI ARG5,6 DNA fragment (about 1 ng) was incubated with 10 mg of yeast extracts preparedfrom strain 02463dII (ura3 leu2 argRII::KanmX4) (lanes 1 to 4) and strain 02463dII transformed with plasmids pNA53 (pGAL10-argRII1-180 URA3 2mm; lanes 5 to8), pNA76 (R99P; lanes 9 to 12), pNA137 (D101A, E102A, E103A, E108A, D109A; lanes 13 to 16) and pNA138 (D101A, E102A, E103A, D111A, D112A; lanes 17to 20). All strains were grown on M.ammonia-galactose and 50 mg of L-leucine; 25 mg uracil was also added in the culture of strain 02463dII. The different amountsof L-arginine added in the in vitro binding assays are indicated. (B) Western blot. Proteins were extracted from aliquots from the cultures described above, separatedon an SDS–10% polyacrylamide gel, and electrotransferred to a Hybond membrane. Each lane contains about 50 mg of proteins. ArgRII proteins were visualized usinganti-GST-ArgRII2-180 antibodies as described in Materials and Methods. (C) Gel retardation assays. The end-labeled 160-bp AluI-AluI ARG5,6 DNA fragment (about1 ng) was incubated with 10 mg of yeast extracts prepared from strain 02463dII (ura3 leu2 argRII::KanMX4) transformed with plasmid pNA53 (pGAL10-argRII1-180URA3 2mm; lanes 1 to 7), pNA138 (D101A, E102A, E103A, D111A, D112A; lanes 8 to 14), or pNA76 (R99P; lanes 15 to 21). All strains were grown onM.ammonia-galactose and 50 mg of L-leucine. The different amounts of L-arginine added in the in vitro binding assays are indicated. (D) Quantification of theprotein-DNA binding activities presented in Fig. 6A. The images were captured using a Sharp scanner and quantified by Macintosh computer image analysissoftware. The saturation value for the wild-type ArgRII1-180 protein with 100 mM L-arginine was taken as 100%, and the values for the wild type (h) and mutants(argRII1-180D101A,E102A,E103A,D111A,D112A [■] and argRII1-180R99P [E]) were plotted accordingly.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

ArgRII2-180 proteins (see Materials and Methods and Fig. 6).The individual proteins were unable to bind to the arginineboxes, even in the presence of arginine (Fig. 6A, lanes 1 to3). In contrast, the combination of GST-ArgRII2-180 withGST-ArgRI or GST-Mcm1 could reconstitute an arginine-dependent binding activity, whereas GST-ArgRI and GST-Mcm1 were not able to bind to the arginine boxes (lanes 4to 9). Interestingly, there was no complex formation whenGST-Mcm1 was combined with the mutant GST-argRII2-180D101A,E102A,E103A,E108A,D109A (lane 13). The GST-ArgRII2-180 and GST-ArgRI combinations led consistently to a weakerbinding activity, with the formation of one complex with fastermobility. The combination of the three recombinant proteinsincreased significantly the amount of DNA-protein complexformed (lanes 10 and 11). When suboptimal concentrations ofGST-ArgRII2-180 and GST-Mcm1 were used in this assay,DNA binding activity was significantly reduced, and addition ofGST-ArgRI restored the formation of an ArgR-Mcm1-DNA

complex showing cooperativity between ArgRI and Mcm1(Fig. 6B, lanes 3 and 4).

Taken together, these data demonstrate that in vitro, thearginine box binding activity requires at least arginine, theN-terminal end of ArgRII, and one of the two MADS-boxproteins when used at nonphysiological concentrations. Invivo, the two MADS-box proteins could cooperate to recruitArgRII. The binding of arginine to the first 180 aa of ArgRIIwould stabilize the interaction of the ArgR-Mcm1 complexwith DNA.

Reconstitution of the arginine-dependent binding activity toCAR1 promoter containing PPAL sequence replacing argininebox B. Mcm1 and ArgRI are able to interact with PPAL DNA,although the affinity of ArgRI for this sequence is muchweaker (data not shown and reference 31). However, as shownabove, the two MADS-box proteins did not bind alone or incombination with the arginine boxes, sharing homology withthe PBox sequence (20). Their binding to DNA required theN-terminal end of ArgRII and arginine. To determine if therequirement for ArgRII could be bypassed by recruiting moreefficiently Mcm1 to a promoter containing the arginine boxes,we replaced arginine box B of the CAR1 promoter by theperfectly palindromic PPAL (Fig. 7B) (7). It is worth notingthat this box B is absolutely required for CAR1 induction byarginine. In Fig. 7A we show the binding of GST-Mcm1, aloneor in combination with wild-type or mutated GST-ArgRII2-180, to the wild-type arginine boxes (DNA fragment frompCV7; lanes 1 to 6) and to a DNA fragment in which the PPALsequence replaces box B (upstream PPAL [UPPAL] frag-ment from pFV72; lanes 7 to 15) (see Materials and Meth-ods for construction of modified CAR1 promoter). As forthe ARG5,6 promoter, the formation of a complex with thewild-type CAR1 promoter required the presence of GST-Mcm1, GST-ArgRII2-180, and arginine (lanes 4 and 5).No complex was obtained with the mutated GST-argRII2-180D101A,E102A,E103A,E108A,D109A (lane 6), although this pro-tein still interacts with Mcm1 in vivo (Table 2). In contrast,GST-Mcm1 was able to bind the DNA fragment from pFV72independently of arginine (lanes 7 and 8), but in the presenceof GST-ArgRII2-180 we observed the formation of a complexof slower mobility only with arginine (lanes 9 and 10); thislatter complex was absent when the mutated GST-argRII2-180D101A,E102A,E103A,E108A,D109A protein was used (lane 15).

TABLE 3. Ability of mutated argRII2-180 proteins tointeract with ArgRI and Mcm1

Hybrid

b-Galactosidase sp act(nmol of o-nitrophenyl-b-D-

galactopyranoside hydro-lyzed/min/mg of protein)

GBD-ArgRI(pME46)

GBD-McmI(pNA51)

None ,1 4GAD-ArgRII2-180 (pNA47) 95 56GAD-argRII2-180C31L (pNA65) 66.5 40GAD-argRII2-180C38L,C41L (pNA66) 45 23GAD-argRII2-180D32N (pNA74) 46 38GAD-argRII2-180P36L (pNA75) 56 22GAD-argRII2-180G50D (pNA73) 69 18GAD-argRII2-180R99P (pNA72) 43 30.5GAD-argRII2-180D101A,E102A,E103A,E108A,D109A

(pNA146)46 27

GAD-argRII2-180D101A,E102A,E103A,D111A,D112A(pNA161)

37 23

a Transcription activation of the lacZ gene was estimated by determination ofb-galactosidase activity in strain HY cotransformed with plasmids expressingGBD-ArgRI (pME46) or GBD-Mcm1 (pNA51) and the different wild-type ormutated GAD-argRII2-180 fusions. Specific activities are the means of threeindependent measurements with variation was less than 15%.

TABLE 4. Effect of mutations in different regions of the full-length ArgRII protein on expression of arginine anabolic and catabolic genesa

Strain 02463dII plus:

Arginase (CAR1) sp act (mmol ofurea formed/ h/mg of protein) Induction

factorb

OTCase (ARG3) sp act (mmol ofcitrulline formed/h/mg of protein) Repression

factorc

M.ammonia M.ammonia 1 arginine M.ammonia M.ammonia 1 arginine

No plasmid 3 3 1 43 42 1pNA109 (ArgRII1-880) 23 90 30 25 11 3.9pBJ211 (argRII1-880R99P) 6.5 32 11 47 33 1.3pNA114 (argRII1-880D101A,E102A,E103A) 14 40 13 31 21.5 2pNA115 (argRII1-880E108A,D109A) 10 40 13 32 19 2.3pNA125 (argRII1-880Q89A,D96A,D111A,D112A) 13 43 13 38 22 1.9pNA126 (argRII1-880D96A,D111A,D112A) 18 60 20 23 15 2.8pNA129 (argRII1-880D101A,E102A,E103A,E108A,D109A) 5 7 2 64 56 1pNA130 (argRII1-880D101A,E102A,E103A,D111A,D112A) 10.5 28.5 9 41.5 33 1.3pNA139 (argRII1-880Q89A,E108A,D109A) 9 36 12 50 28 1.5pNA140 (argRII1-880D96A,E108A,D109A) 12 29 10 47 26 1.7

a Arginase and OTCase activities were measured in strain 02463dII (ura3 leu2 argRII::KanMX4) transformed with various plasmids (in all experiments, thelow-copy-number plasmid pFL38 was used; see Materials and Methods). Specific activities are the means of three independent measurements that did not differ by morethan 15%; 50 mg of L-leucine per ml was added in the growth media; 25 mg of uracil was also added when no plasmid was present in the strain.

b Ratio between the level on M.ammonia plus arginine and the basal level of the mutant argRII strain.c Ratio between the level on M.ammonia plus arginine and the derepressed level of the mutated argRII strain.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

In contrast, GST-ArgRI interacted very poorly with the mod-ified CAR1 DNA sequences (data not shown) and did notchange the complex formed with GST-Mcm1 (lanes 11 and12). All of these data suggest that even when Mcm1 is artifi-cially recruited to the CAR1 promoter by insertion of a perfectpalindromic P sequence, ArgRII, but not ArgRI, is still re-quired to obtain an arginine-dependent response in vitro.

DISCUSSION

The first 180 aa of ArgRII are sufficient for conveying theformation of an arginine-dependent ArgR-Mcm1-DNA com-plex. Previous results had shown that at physiological con-centration, almost the entire ArgRII protein was required toensure its function in anabolic repression and in catabolicactivation. However, the only mutations that affected the for-mation of an arginine-dependent protein-DNA complex werelocated in the N-terminal end of ArgRII. The loss of functiondid not result from a reduced stability of the mutated argRIIproteins (27). Here we show that qualitatively the first 180 aaof ArgRII are sufficient for conveying interaction with its twopartners ArgRI and Mcm1 to form a regulatory complex re-quired for binding to DNA in an arginine-dependent manner.However, at physiological levels the C-terminal end of ArgRIIis essential for its function since most of the deletions createdalong the protein impaired its ability to repress the anabolicgenes and to induce the catabolic genes. This part of theprotein may be involved in conformation changes or in in-tramolecular or ArgRII-ArgRII interactions.

The N-terminal end of ArgRII contains two domains. Aminoacid alignment of the N-terminal end of ArgRII with yeast andbacterial regulatory proteins reveals the presence of a Zn2C6zinc cluster between amino acids 21 to 48, similar to findingsfor the other members of this family such as Gal4, Put3, andPpr1, and a region between aa 89 to 114 similar to the argininebinding domains of E. coli ArgR and B. subtilis AhrC repres-sors.

Modification of several conserved amino acids in the zinccluster led to total or partial loss of binding of the ArgR-Mcm1complex to DNA, although these changes did not impair sig-nificantly the interaction of ArgRII with ArgRI and Mcm1.This region seems thus to be involved in DNA recognition asit is in other regulatory proteins of this family.

The region between aa 89 to 114, which presents someidentity with the two bacterial arginine repressors, seems tobe the binding site of arginine. The combination of differentamino acid changes in this region impairs ArgRII function,especially the combined replacement by alanine of D101,E102,E103 with E108,D109 or with D111,D112. The first combina-tion of five changes leads to a total argR phenotype in vivo (nogrowth on arginine or ornithine as a nitrogen source) as wellas a total loss of DNA binding activity in vitro, whereas thesecond combination shows a strong arginine-dependent phe-notype in vivo and the requirement for high arginine concen-tration in vitro. The growth of such a mutant is strongly af-fected when ornithine but not when arginine serves as the solenitrogen source (data not shown), and binding of the ArgR-Mcm1 complex to DNA requires at least 10-fold more L-argi-

FIG. 6. Reconstitution of the arginine-dependent binding activity to the arginine boxes from recombinants GST-ArgRI, GST-ArgRII2-180, and GST-Mcm1. DNAmobility shift assays were performed with a radiolabeled AluI-AluI ARG5,6 fragment, incubated with about 3 mg of purified GST-ArgRI, wild-type GST-ArgRII2-180,mutated GST-argRII2-180D101A,E102A,E103A,D111A,D112A), and GST-Mcm1 recombinant proteins in the various combinations indicated. In lanes 1 to 5 of panel B,various concentrations of the different GST-recombinant proteins were used, as indicated; 5 mM L-arginine was added in the binding assay where indicated.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

nine than with the wild-type ArgRII protein, indicating astrong decrease in the apparent affinity of this modified proteinfor arginine. Our analysis shows the importance of acidic res-idues in this region, possibly because they interact with argi-nine. It is noteworthy that D111 and D112 correspond to thetwo aspartic residues 128 and 129 of the E. coli ArgR repres-sor. The double-mutant protein D128N and D129V shows anarginine-independent binding of the E. coli repressor to DNA(4). The R99P substitution, which corresponds to a mutationobtained by in vivo selection, also modifies the affinity of theprotein for arginine. This replacement could modify the con-formation of that region rather than impair directly the inter-action of that residue with arginine, whereas the acidic residuescould bind arginine. When these multiple changes of acidicresidues to alanine are created in the N-terminal end of thefull-length ArgRII, similar results are obtained, confirmingthat the second region of similarity with the bacterial argininerepressors (between aa 563 and 587 in ArgRII [Fig. 1]) doesnot compensate for the loss of function of the proximal region.Further biochemical experiments as well as structural studieswill be required to determine if the N-terminal end of ArgRIIdirectly binds arginine.

ArgRI, ArgRII, and Mcm1 are sufficient to interact with thearginine boxes in a cooperative fashion. Four proteins, ArgRI,ArgRII, Mcm1, and ArgRIII, are necessary for the regulationof arginine metabolism. Recent results showed that the role ofArgRIII was to stabilize the two MADS-box proteins ArgRIand Mcm1 (9). These two proteins and ArgRII are requiredfor an arginine-dependent DNA binding activity, and the re-constitution of this activity from recombinants GST-ArgRI,GST-ArgRII2-180, and GST-Mcm1 demonstrates that theseproteins are sufficient for the assembly of the heteromericcomplex at the arginine boxes when arginine is present. Noneof these purified recombinant proteins interact alone withDNA, whereas the combination of GST-ArgRII2-180 withGST-Mcm1 allows the formation of a protein-DNA complex,which is enhanced when GST-ArgRI is added. GST-ArgRII2-180 and GST-ArgRI bind very weakly to DNA to form a com-plex of faster mobility. All of these interactions require argi-nine and the N-terminal end of ArgRII, supporting the ideathat ArgRII is the sensor of arginine. This is confirmed by theexperiments in which Mcm1 is artificially recruited to theCAR1 promoter. Mcm1 bound to the PPAL sequence replac-ing box B (UPPAL) forms a complex of slower mobility onlywith wild-type GST-ArgRII2-180 and when arginine is present.

Since these in vitro experiments were performed with largeamounts of purified recombinant proteins compared to thephysiological concentrations, the in vivo situation could bequite different. ArgRI could facilitate the interaction of Mcm1-ArgRII-arginine with the arginine boxes, which contain imper-fect PBox sequences. It is worth noting that a strain in whichthe ARGRI gene is deleted is unable to grow on ornithine asthe sole nitrogen source but is only moderately impaired whenarginine is the sole nitrogen source. Similarly, MCM1 genemutants are partially impaired in their growth on arginine. The

FIG. 7. Reconstitution of the arginine-dependent binding activity to theCAR1 promoter with modified arginine boxes. (A1 and A2) Gel shift assays.DNA mobility shift assays were performed with about 1 ng radiolabeled wild-

type CAR1 probe (A1) or 0.05 ng of mutated CAR1 probe (A2). These probeswere incubated with about 3 mg (A1) or 1 mg (A2) of purified wild-type GST-ArgRII2-180 or mutated GST-argRII2-180D101A,E102A,E103A,D111A,D112A), GST-ArgRI, and GST-Mcm1 recombinant proteins in the various combinations indi-cated; 5 mM L-arginine was added in the binding assay where indicated. Positionsof the different protein-DNA complexes are indicated by arrows. (B) DifferentCAR1 probes were synthesized by PCR as described in Materials and Methodsfrom plasmids pCV7, containing the CAR1 wild-type promoter (6), or pFV72,containing the CAR1 promoter in which box B is replaced by the PPAL sequence(UPPAL means upstream location of PPAL).



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

absence of growth on this medium is observed only in a strainlacking the ARGRI gene and mutated in the MCM1 gene(unpublished result), suggesting that each MADS-box proteincan fulfill the function of the other protein, to a certain extent,when the arginine intracellular pool is high. In contrast, anargRII deletion strain is unable to grow on either arginine orornithine, in full agreement with the key role of ArgRII inmediating the cellular response to arginine.

ACKNOWLEDGMENTS

We thank S. Fields, S. Elledge, and O. Louvet for the gift of plasmidsand strains, and we thank P. Jacobs for providing antibodies againstthe different GST fusion proteins. We are thankful to F. Vierendeelsand E. Joris for skillful technical assistance. We are especially gratefulto D. Charlier for critical reading of the manuscript and to B. Scherensfor assistance in computer manipulation and figure editing.

M. El Bakkoury was supported by a grant from the Fonds Demeur-Francois and from the Government of Morocco.

REFERENCES

1. Bender, A., and G. F. Sprague. 1987. Mata1 protein, a yeast transcriptionactivator, binds synergistically with a second protein to a set of cell-typespecific genes. Cell 50:681–691.

2. Birmboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedurefor screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513–1523.

3. Bonneaud, N., O. Ozier-Kalogeropoulos, G. Li, M. Labouesse, L. Minvielle-Sebastia, and F. Lacroute. 1991. A family of low and high copy replicative,integrative and single stranded S. cerevisiae/E. coli shuttle vectors. Yeast 7:609–615.

4. Burke, M., A. F. Merican, and D. J. Sheratt. 1994. Mutant Escherichia coliarginine repressor proteins that fail to bind L-arginine, yet retain the abilityto bind their normal DNA-binding sites. Mol. Microbiol. 13:609–618.

5. Cullin, C., and L. Minvielle-Sebastia. 1993. Multipurpose vectors designedfor the fast generation of N- or C-terminal epitope-tagged protein. Yeast10:105–112.

6. Dubois, E., and F. Messenguy. 1991. In vitro studies of the binding of theARGR proteins to the ARG5,6 promoter. Mol. Cell. Biol. 11:2162–2168.

7. Dubois, E., and F. Messenguy. 1997. Integration of the multiple controlsregulating the expression of the arginase gene CAR1 of Saccharomyces cere-visiae in response to different nitrogen signals: role of Gln3p, ArgRp-Mcm1pand Ume6p. Mol. Gen. Genet. 253:568–580.

8. Durfee, T., K. Becherer, R.-L. Chen, S. H. Yeh, Y. Yang, A. E. Kilburn, W. H.Lee, and S. J. Elledge. 1993. The retinoblastoma protein associates with theprotein phosphatase type 1 catalytic subunit. Genes Dev. 7:555–569.

9. El Bakkoury, M., E. Dubois, and F. Messenguy. 2000. Recruitment of theyeast MADS-box proteins, ArgRI and Mcm1 by the pleiotropic factorArgRIII is required for their stability. Mol. Microbiol. 35:15–31.

10. Fields, S., and O. K. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature (London) 114:193–197.

11. Flynn, P. J., C. Reynolds, and R. J. Reece. 1999. Activation of transcription

by metabolic intermediates of the pyrimidine biosynthetic pathway. Mol.Cell. Biol. 19:882–888.

12. Holmes, D. S., and M. Quigley. 1981. A rapid boiling method for the prep-aration of bacterial plasmid. Anal. Biochem. 114:193–197.

13. Ito, H., Y. Fukura, K. Murata, and A. Timura. 1983. Transformation ofintact yeast cells treated with alkali cations. J. Bacteriol. 153:163–168.

14. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature (London) 217:680–685.

15. Louvet, O., F. Doignon, and M. Crouzet. 1997. Stable DNA-binding yeastvector allowing high-bait expression for use in the two-hybrid system. Bio-Techniques 23:816–817.

16. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.

17. Messenguy, F. 1976. Regulation of arginine biosynthesis in Saccharomycescerevisiae: isolation of a cis-dominant constitutive mutant for ornithine carbamoyltransferase synthesis. J. Bacteriol. 128:49–55.

18. Messenguy, F., and E. Dubois. 1988. The yeast ARGRII regulatory proteinhas homology with various RNAses and DNA binding proteins. Mol. Gen.Genet. 211:102–105.

19. Messenguy, F., and E. Dubois. 1993. Genetic evidence for a role for Mcm1in the regulation of arginine metabolism in Saccharomyces cerevisiae. Mol.Cell. Biol. 13:2586–2592.

20. Messenguy, F., E. Dubois, and C. Boonchird. 1991. Determination of theDNA-binding sequences of ARGR proteins to arginine anabolic and cata-bolic promoters. Mol. Cell. Biol. 11:2852–2863.

21. Messenguy, F., E. Dubois, and F. Descamps. 1986. Nucleotide sequence ofthe ARGRII regulatory gene and amino acid sequence homologies betweenARGRII, PPR1 and GAL4 regulatory proteins. Eur. J. Biochem. 157:77–81.

22. Messenguy, F., M. Penninck, and J.-M. Wiame. 1971. Interaction betweenarginase and ornithine carbamoyltransferase in Saccharomyces cerevisiae.Eur. J. Biochem. 22:277–286.

23. Messing, J. 1983. New M13 vectors for cloning. Methods Enzymol. 101:20–78.

24. Miller, J. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

25. Niersbach, H., R. Lin, G. D. Van Duyne, and W. K. Maas. 1998. A super-repressor mutant of the arginine repressor with a correctly predicted alter-ation of ligand binding specificity. J. Mol. Biol. 279:753–760.

26. North, A. K., M. C. M. Smith, and S. Baumberg. 1989. Nucleotide sequenceof a Bacillus subtilis arginine regulatory gene and homology of its product tothe Escherichia coli. Gene 80:29–38.

27. Qiu, H. F., E. Dubois, and F. Messenguy. 1991. Dissection of the bifunctionalARGRII protein involved in the regulation of arginine anabolic and cata-bolic pathways. Mol. Cell. Biol. 11:2169–2179.

28. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

29. Tian, G., and W. K. Maas. 1994. Mutational analysis of the arginine repres-sor of Escherichia coli. Mol. Microbiol. 13:599–608.

30. Van Duyne, G. D., G. Gosh, W. K. Maas, and P. B. Sigler. 1996. Structure ofthe oligomerization and L-arginine binding domain of the arginine repressorof Escherichia coli. J. Mol. Biol. 256:377–391.

31. West, A. G., and A. D. Sharrocks. 1999. MADS-box transcription factorsadopt alternative mechanisms for bending DNA. J. Mol. Biol. 286:1311–1323.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Documents

ArgRII, a Component of the ArgR-Mcm1 Complex Involved in the