Functional domains of the yeast transcription/replication factor MCM1

Functional domains of the yeast transcription/replication factor MCM1 Chantal Christ and Bik-Kwoon Tye

Section of Biochemistry, Molecular and Cell Biology, Comell University, Ithaca, New York 14853 USA

MCM1 is an essential yeast DNA-binding protein that affects both minichromosome maintenance, in a manner suggesting that it has DNA replication initiation function, and gene expression. It activates a-specific genes together with MATod, and represses a-specific genes together with MAToL2. Alone, MCMI can activate transcription. To determine whether different domains of the protein mediate these diverse functions, we constructed and analyzed several m c m l mutants. The gene expression and minichromosome maintenance phenotypes of these mutants suggest that the role of MCM1 in DNA replication initiation may not involve transcriptional activation. However, both transcription and replication activities require only the 80-amino-acid fragment of MCM1 homologous to the DNA-binding domain of the serum response factor (SRF). This small fragment is also sufficient for cell viability and repression of a-specific genes. A polyacidic amino acid stretch immediately adjacent to the SRF homologous domain of MCM1 was found to be important for activation of a-specific genes in ,v cells. Mutants lacking the acidic stretch confer higher expression from an a-specific UAS in a cells in addition to lower expression in oL cells, suggesting that negative regulation at this site occurs in a cells, in addition to the well-documented positive regulation in oL cells.

[Key Words: Replication factor MCM1; transcription activation; replication initiation; regulation]

Received January 15, 1991; revised version accepted February 15, 1991.

It has become increasingly clear that for many of the sequence-specific DNA-binding proteins, the same protein can have multiple, diverse activities. The Droso- phila homeo box proteins and the steroid hormone re- ceptors activate transcription at some promoters and repress transcription at others (Levine and Manley 1989). The NFI and NFIII proteins, which enhance replication initiation of adenoviruses, are also transcriptional acti- vators (Challberg and Kelly 1989). Two yeast proteins, RAP1 and ABF1, bind to silencers as well as upstream activating sequences (UASs), and may contribute either to repression or activation of transcription depending on the binding site context (Shore and Nasmyth 1987; Buchman et al. 1988). In addition, RAP1 binds to sequences found at telomeres, whereas ABF1 binds to several autonomously replicating sequences (ARSs) (Buch- man et al. 1988). Both proteins may be involved in multiple regulatory processes. The yeast MCM 1 protein is a transcription activator that also affects DNA replication and acts both as a corepressor and a coactivator in regulation of mating-type-specific genes (Passmore et al. 1988; 1989; Jarvis et al. 1989; Keleher et al. 1989; Am- meter 19901. The diverse activities, coupled with the small size, of MCM1 make it a particularly interesting protein for structure and function analysis. Analysis of MCM1 and other multifunctional proteins may reveal common mechanisms by which the activity of these proteins is regulated.

The activity of multifunctional DNA-binding proteins

at particular binding sites has been proposed to be modulated by binding site context and by interaction with other DNA-binding proteins. Genetic and biochemical evidence suggests that MCM1 activity at mating-type- specific genes is determined by cooperative binding with cofactors, either with MAT~I at c~-specific genes, which results in activation, or with MAT~2 at a-specific genes, which results in repression (Jarvis et al. 1989; Keleher et al. 1989; Passmore et al. 1989; Ammerer 1990). The com- bination of these activities allows ~ cells to express the gene set required for mating with a cells. The mecha- nism by which the different complexes act to either repress or activate and whether MCM1 activity at other sites is also modulated by cofactor interactions are unknown.

MCM1 was first identified as a putative replication factor. The rectal-1 allele was isolated in a screen for mutants defective in minichromosome maintenance (Maine et al. 1984). Stability of a minichromosome, which contains only one ARS, a centromere, and select- able markers, is extremely sensitive to mutations that affect chromosome replication or segregation. Minichro- mosomes carrying different ARSs, which have similar stability in wild-type strains, are affected differently in the rectal-1 mutant. The loss rate of a minichromosome varies >10-fold, depending on the ARS sequence used, suggesting that rectal-1 affects ARS function (Maine et al. 1984). Because ARSs have been shown to be the in vivo origins of DNA replication (Brewer and Fangman

GENES & DEVELOPMENT 5:751-763 © 1991 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/91 $3.00 751

Cold Spring Harbor Laboratory Press on February 12, 2018 - Published by genesdev.cshlp.orgDownloaded from

http://genesdev.cshlp.org/

http://www.cshlpress.com

Christ and Tye

1987; Huberman et al. 1987; 1988), the rectal-1 phenotype suggests that MCM1 is important for replication initiation. MCM1 may affect ARS function by binding to the origin as part of the replication initiation complex or it may act indirectly by affecting the expression of another protein that acts at ARSs. MCM1 is essential for cell division, although whether it is required for replication initiation or for regulation of other essential genes is unknown.

Although MCM1 is a small protein with only 286 amino acids (Passmore et al. 1988), it may be similar to other eukaryotic transcription factors in having separate DNA-binding, transcription activation, and regulatory domains. If so, different domains may be important for its different activities. MCM1 is a member of a gene fam- ily including the serum response factor (SRF)(Norman et al. 1988), another yeast gene, ARG80 (ARG RI) (DuBois et al. 1987; Passmore et al. 1988), and several plant homeotic genes (Sommer et al. 1990; Yanofsky et al. 1990). The proteins all share homology in a region that was identified as the DNA-binding domain of SRF. The amino-terminal portion of MCM1 {amino acids 18-98) is 70% identical to the portion of SRF that was shown to be essential for DNA binding and dimerization {Norman et al. 1988). The two proteins share similar DNA-binding specificity, each binding to the palindromic recognition sequence CC(A/T)6GG {Norman et al. 1988; Passmore et al. 1989). Therefore, the homologous domain is likely to be the DNA-binding domain of MCM 1 as well. Immedi- ately following the SRF homologous domain of MCM1 are 20 amino acids, of which 19 are either aspartate or glutamate. This region may be an acidic activation sequence, although the acidic residues are much more highly clustered than acidic activation domains of other transcription factors such as GAL4 and GCN4 (Hope and Struhl 1986; Keegan et al. 1986). The carboxy-terminal half of the protein is 50% glutamine and may behave like the glutamine-rich activation domains of Spl and AntP (Courey and Tjian 1988; Courey et al. 1989). Although truncated genes that lack much of the polyglutamine domain are functional (Passmore et al. 1988; Jarvis et al. 1989), the effect of removing the entire polyglutamine domain has not been tested previously.

In this study we specifically alter or delete portions of MCM1 which, as described above, may be separate functional domains. We analyze the effect of these mutations on the known activities of MCM1 in vivo: transcription activation, minichromosome maintenance, and regulation of mating-type-specific genes. This mutant analysis should reveal whether different functions of MCM1 require different domains, and provide insight into how MCM1 affects replication initiation and transcription activation and how it may interact with cofactors to mediate gene regulation.

R e s u l t s

The SRF-homologous domain of MCM1 is sufficient for viability.

The MCM1 mutant proteins constructed are missing the

acidic or polyglutamine domains, have substitutions of portions of other transcription factors, or have insertions into the putative DNA-binding domain, as shown in Fig- ure 1. We made mutations that alter the coding sequence with minimal changes in the transcript to avoid alterations that might affect transcript stability. The m c m l - A Q allele codes for a protein with no polyglutamine domain, m c m l - A D E removes only the acidic stretch, and m c m l - A D E Q codes for a protein lacking both acidic and polyglutamine domains. The m c m l - A N l z D E Q mutant has an additional deletion of amino acids 2-17, leaving only the SRF-homologous domain of MCM1. The mcml-SRF/DE and mcml -gcn4 / DE(Q) alleles were constructed to assay whether the acidic stretch could be replaced with a less acidic sequence or with a known acidic activating sequence. The portion of SRF immediately following the SRF/MCM1- homologous domain was inserted in place of the acidic stretch in mcm 1-SRF/DE, resulting in 7/34 acidic amino acids, as compared to 20/23 acidic amino acids in MCM1. A portion of GCN4 characterized previously as an acidic activation domain (Hope et al. 1988) was sub- stituted for the acidic stretch and part of the polyglutamine region of MCM1 in mcml-gcn4/DE(Q) (see leg- end to Fig. 1). The m c m l - X h o 9 2 and rectal-Barn92 alleles have four amino acids (either AlaArgAlaAla or ArgIleArgAla) inserted in-frame after amino acid 92, in the region of MCM1 homologous to SRF.

Because MCM1 is an essential gene, we tested whether yeast with each of the mutant genes alone is viable, using the plasmid shuffle assay (Boeke et al. 1987)in a strain with a chromosomal deletion of MCM1. We found that all of the mutants except m c m l - X h o 9 2 and recta l - Barn92 provide sufficient MCM1 function for viability. This result localizes the essential domain of MCM1 to the 80 amino acids homologous to SRF.

Because m c m l - X h o 9 2 and rectal-Barn92 are unable to rescue lethality of an m c m l deletion, even in high copy, we tested whether these mutations affect the amount or the activity of the resulting mutant MGM1 protein. Immunoblot analysis of a wild-type strain containing these high-copy constructs shows that the mutant proteins are present at similar levels as wild-type MCM1 on a similar plasmid (Fig. 2), suggesting that these mutations do not affect the stability or expression of MCM1. Therefore, these mutations must affect MCM1 activity, perhaps by interfering with dimerization, by analogy to the role of the homologous region of SRF {Norman et al. 1988).

MCMl-dependent gene expression and minichromosome maintenance in mcml mutants are uncorrelated

Because MCM1 affects plasmid stability, we analyzed the phenotypes of the viable mutants by replacing the wild-type MCM1 gene on chromosome XIII with each of the mutated genes (as described in Materials and methods). We used a haploid MAT~ strain, into which we similarly introduced the mcml-1 point mutation. The

752 GENES & DEVELOPMENT




Functional domains of MCM1

Provides viability

MCM1 + i

17 97 120 I I I . i hN N x \ x x * X ~ x x x

SRF related ac id ~'polyglutamine

MCM 1-AQ + ~ r, ,-, . . . . . . . . ~ RIGRIR

286 [

MCM1-ADE + I

MCM1-ADEQ + ,

MCM 1-AN17DEQ +

MCMI-1 + ,

MCM1-SRF/DE + ,

MCM1-GCN4/DE(Q) + ,

MCM 1-Xho92 -

ixx- \ \ \ \ \ \ \ -~/A'l~

~\x~xxxxxxxx,Vy

~ . . . . . . . \--,VY

P97 ~ L

ARAA

RIRA

MCM 1-Bam92 - , ~.. ~ ~ ~ -, -, -, - ,~ '~

Figure 1. Schematic of mutant proteins. For MCM1 sequence, see Passmore et al. {19881]. The numbers above the MCM1 sequence refer to the last amino acid in the boxed section. MCM 1-AQ is altered after Gly 118, with the ArgIleGlyArgIleArg non- native sequence added followed by a stop codon. MCM1-ADE has amino acids 98- 120 replaced with ValAlaThr. MCM1- ADEQ introduces ValTyrSTOP after Pro97, whereas MCM1-ANxTDEQ has an additional deletion of amino acids 2-17. MCMI-1 is a change of Pro97 to Leu. MCM1-SRF/DE introduces Val after Pro97, followed by amino acids 223-251 of SRF {Norman et al. 19881, and then Asp- SerThr and amino acids 121-286 of MCM1. MCM1-GCN4/DE(Q) inserts ValAspAlaPro after Pro97, followed by amino acids 85-150 of GCN4 {Hope et al. 1988} and amino acids 153-286 of MCM1. MCM1-Xho92 and MCM1-Bam92 are both four amino acid in-frame insertions after amino acid 92 of MCM1, as shown.

final result is a set of isogenic strains differing only in the MCM1 allele. Growth curves showed that each mutan t has a doubling t ime of - 1 . 5 hr at 30°C, similar to wild type, and none of the mutan t s are heat or cold sensitive for growth (data not shown I. Therefore, even when the mu tan t genes are present in single copy, no growth defect is observed.

The abil i ty of each mu tan t MCM1 protein to activate transcription was moni tored using the DSEI4-1acZ reporter gene shown in Figure 3, integrated in single copy on chromosome III. Expression of []-galactosidase is ab- solutely dependent on MCM1 (R. Elble, in prep.I and is not cell type specific. The level of B-galactosidase in wild-type a or ~ cells is 40-fold higher from the reporter containing the MCMl-b ind ing site than from an other- wise identical construct lacking it. The mcml mutants have varying effects on expression from this promoter (Table 11. Removal of only the polyglutamine domain (mcml-AQ} results in a decrease in ~-galactosidase expression to 40% of wild-type levels, whereas removal of the acidic domain (mcml-ADE} results in wild-type expression levels. Removal of both acidic and polyglutamine domains {mcml-ADEQI results in a further drop in B-galactosidase activity to 18% of wild-type levels. Addit ional removal of amino acids 2-17 has no effects activity in mcml-ANlzDEQ is 20% wild type. The

mcml-1 mut a n t has the lowest expression of ~- galactosidase at 6% wild-type levels, whereas the SRF subst i tu t ion for the acidic domain has greater act ivi ty than wild-type MCM1 and the GCN4 subst i tu t ion reduces act ivi ty to in termediate levels (22% of wild typel. These results suggest that the acidic stretch is not required for t ranscript ion activation, because its deletion has no effect, whereas the polyglutamine domain may contr ibute to activation, because expression is reduced twofold in this mutant . The even lower act ivi ty in mutants lacking both domains may be due to instabi l i ty of these t runcated proteins, which will be addressed below.

Because the mutan t s vary widely in expression level from an MCMl-dependen t promotor, we tested them for min ich romosome main tenance (Mcm), to determine whether the two phenotypes are equally affected in each mutant . We transformed each strain wi th YCpl01 (ARS1, CENS, LEU21 and calculated the loss rate of the min ich romosome per cell per generat ion of nonselect ive growth. The loss rates are also shown in Table 1. Al- though the two smallest mu t a n t proteins, M C M 1 - ADEQ and MCM1-AN 17DEQ, confer a somewhat higher loss rate than wild-type (cf. 0.07 and 0.06 wi th 0.02}, only rectal-1 and mcml-gcn4/DE(Q) have severe Mcm defects Iloss rates of 0.30 and 0.21, respectively).

There is no correlation between the gene expression

GENES & DEVELOPMENT 753




Christ and Tye

o o

[ . v , o

45 ld)

29kD -- o

Figure 2. MCM1-Xho92 and MCM1-Bam92 are present at wild-type levels. Immunoblot using anti-f3-gal-MCMll_92 is shown of strain BJ2168 transformed with high-copy YEp351- based plasmids. Transformants were grown in SC-uracil media to OD6oo 1.5. Equal volumes of yeast crude extracts were loaded in each lane; however, staining of the gel reveals that the YEp351-mcml-Bam92 lane had approximately twice the protein as the others. MCM1 runs at -40 kD on this gel and is not visible in the YEp351 lane, which has extract from the strain with only the single-copy chromosomal MCMI gene.

and min ich romosome main tenance defects: Although the mutan t s wi th high levels of expression from DSE14 also ma in ta in min ichromosomes well, the mutants that affect both phenotypes affect them with different severity. For example, mcml-ADEQ, mcml-AN~TDEQ, and mcml-gcn4/DE(Q) have s imilar levels of 13-galactosidase expression from DSE~4-1acZ ( -20% wild type), yet the deletion mutants main ta in min ichromosomes m u c h better than the GCN4 subsi tut ion mutan t (loss rate of YCpl01 is 0.07 vs. 0.21). Furthermore, because mcml-1 is temperature sensit ive for expression of a-specific genes (C. Christ, unpubl.), we tested gene expression and min ichromosome main tenance at room temperature as well as at 30°C. At the lower temperature, expression of DSE14-1acZ in mcml-1 improves to a level s imilar to that in mcml-ADEQ (16% and 19% wild type), but the two mutan ts are still very different in their abil i ty to main ta in min ichromosomes (loss rate of YCpl01 is 0.23 for mcml-1 and 0.08 for mcml-ADEQ). These results suggest that the min ich romosome maintenance defect of mcml mutants is not s imply due to reduced gene expression by the mutan t MCM1 protein.

Restoration of MCMt activity by overproduction of mutant proteins

The preceding experiments suggest that the mutat ions

do not all merely affect MCM1 protein stability, because the two phenotypes show different severity in the same mutant . We confirmed this prediction by testing whether any of the mutat ions result in lower levels of the mutan t protein. Immunoblo t analysis of a wild-type strain in which the mutan t proteins are expressed from high-copy 2-micron plasmids is shown in Figure 4. The MCM1-1 protein is present at greater than wild-type levels, and MCM1-ADE, MCM1-SRF/DE, and MCM1-GCN4/DE(Q) are present at sl ightly lower levels. MCM1-AQ appears less abundant, whereas MCM1-ADEQ is not detectable under these conditions. These small mutan t proteins may be less abundant or may have different transfer properties than the larger mutants . MCM1-AN17DEQ was not tested because mcml-AN~ 7DEQ and mcml-ADEQ have identical phenotypes, and our antiserum, which was generated against a fusion protein wi th the first 92 amino acids of MCM1, may not bind quanti ta t ively to the smaller fragment . The apparently low level of MCM1-ADEQ protein is consistent with the previous result that mcml-ADEQ has a more severe phenotype than mcml-AQ, even though deletion of the acidic stretch alone, in mcml-ADE, has no effect.

To dist inguish whether the muta t ions primari ly affect binding affinity or the activity of the protein once bound to DNA, we tested the effect of overproducing the mutant proteins on expression from DSEIa-lacZ. DSE14 is a high-affinity binding site for MCM1. Overproduction of wild-type protein, by expression from a 2-micron vector, results in at least fivefold more MCM1 protein (Fig. 4) but only 1- to 1.7-fold higher levels of 13-galactosidase from a DSE14-1acZ reporter (Passmore et al. 1989), suggesting that this binding site is saturated at single-copy gene dosage of MCM1. If transcription activation is reduced in a mutan t because of reduced occupancy of the DSE14-binding site, due to either reduced DNA-binding affinity or lower protein level, overproduction of the mutant protein should result in increased B-galactosidase activity. Conversely, if the mutan t protein is less active but binds well, J3-galactosidase expression should remain low, regardless of overproduction of the mutan t protein.

Three of the mutants tested show increased activity when overproduced on 2-micron plasmid (Table 2). The largest increase occurs wi th overproduction of MCMI-1 protein in the mcml-1 strain. Expression from DSE14 is increased over eightfold, nearing wild-type levels. This result is consistent with an observation by Keleher et al. (1988) that mcml-1 mutan t extracts bind the STE2 operator in DNA band-shift assays approximately fivefold less efficiently than wild-type extracts and suggests that the mcml-1 mutat ion affects binding affinity. J3-Galactosidase expression in the mcml-ADEQ strain increases fourfold when MCM1-ADEQ is overproduced, reaching 58% of wild-type expression levels, consistent wi th the previous result that this t runcation affects MCM1 protein level. Activity also increases threefold in the GCN4-subst i tuted mutan t wi th overproduction of that construct, to even higher levels than wild-type MCM1, suggesting that the insert ion of the GCN4 acti-






Non-cell-type-specific: DSE14-1acZ

Hind I11 STE2-1acZ

TCGATI'TCCTAATTAGGAAAAGCT

c~-specific: MFct 1PQ-lacZ

SalI HindIII STE2-1acZ ! ,

GTCGACGGAACACC'IWCCTAATTAGGI~ATI~AACGACAGTAAATrCCCAAGCTT P Q

a-specific: STE2-1acZ

Sal I HindlII HindlII STE2-1acZ

~ URS ~

0.3kb...ACCATGTAAATrTCCTAATTGGGTAAQTACATGATGAAACACATATGAAGAAAAAAGCIT ~x2 o~2

Figure 3. Tester genes for measuring MCMl-dependent transcription. The binding sites DSEt4 and MF~IPQ are described in Passmore et al. (1989), and STE2-1acZ is described in Smith (1986). MCMl-binding sites are shown in bold, and c,1 or ~2 recognition elements are un- derlined. All constructs are cloned into the SalI site downstream of LEU2 and integrated in single copy on chromosome III.

vation domain into MCM1 has two opposing effects on gene expression from an MCMl-b ind ing site: It apparently lowers the DNA-binding affinity while increasing the transcription activation potential of the mutan t protein. f~-Galactosidase activity remains approximately the same regardless of overproduction of the mutan t MCM 1 protein in the remaining strain that showed reduced activity, mcml-AQ, as well as wi th the fully active alleles, MCM1, mcml-ADE, and mcml-SRF/DE, showing that in these strains, DSE14 is fully bound by the MCM1 protein in single-copy gene dosage.

These results demonstrate that the polyglutamine doma in contributes to the activity of MCM1, because its removal reduces MCMl-dependen t gene expression twofold, regardless of overproduction of the mutan t protein. In contrast, the acidic stretch is not important for MCM1 funct ion at the DSE14 site by two criteria: First, mcml-ADE has wild-type or very near wild-type activity; second, overproduction of MCM1-ADEQ or MCM1-AQ yields the same activity from DSE~4 (Table 2); both give approximately half wild-type levels of f~-galactosidase. The abil i ty of the MCM1-ADEQ and MCM1-AN~TDEQ proteins to activate transcription equally well (Table 1) localizes the remaining transcriptional activation activity to the SRF-homologous domain of MCM1. These results suggest that the 80- amino-acid SRF-homologous domain of MCM1 is capa- ble of transcription activation as well as D N A binding,

whereas the polyglutamine domain also contributes to the full activity of the protein.

The effect of MCM1 mutan t protein overproduction on gene expression showed that the same mutan t s that have a min ich romosome main tenance defect are the ones that reduce DSE14-binding site occupancy. If the min ich romosome main tenance defect is also due to reduced D N A binding, then overproduction of the mutan t protein should suppress this defect as well. Mutant strains containing YCpl01 and either the high-copy vector YEp24 (2~ ARS, URA3) or YEp24 bearing the mutan t mcml gene were tested for main tenance of the YCpl01 plasmid. Cells were grown in synthet ic complete (SC) m e d i u m lacking uracil to retain the YEp24 derivative whi le allowing loss of the YCpl01 tester plasmid. The loss rates of YCpl01 (Table 3) show that in all three Mcm-defective mutan t s tested, min ich romosome maintenance is restored to near wild type when the mutan t gene is present on the YEp24 ptasmid. These results suggest that in each mutant , the M c m defect is also due to reduced rather than altered funct ion of the mu tan t protein.

The acidic domain is important for activation of a-specific genes in a cells

We anticipated that because m a n y of these muta t ions affect expression from a non-cell-type-specific MCM1-





Christ and Tye

Table 1. MCMl-dependent transcription activation and Mcm phenotype of mcml mutants

Allele

Expression Minichromosome from DSE14 maintenance (% wild-type loss rate of activity) YCpl01

MCM1 100 0.02 m cm 1-A Q 40 0.02 mcm I-ADE 100 0.02 mcml-ADEQ 18 (191 0.07 (0.08) m cm 1-AN17DiEQ 20 0.06 rectal-1 6 (16) 0.30 (0.23) m cm I-SRF/DE 144 0.03 mcml-gcn4/DE(Q) 22 0.21

Expression from the integrated DSEI4-1acZ tester gene was measured by [3-galactosidase activity assay of two separate cultures from each strain. Assays were done with 1 ml of each culture, grown in YPD at 30°C to OD6o o 1.0, as described in Guarante (1983). Activity varied by 10% or less between duplicate cultures. Results shown are from one experiment, normalized to percent wild-type activity. Similar experiments gave the same pattern of activity. Wild-type cells generally had 12 Miller units of [3-galactosidase. Activities in parentheses are those of cells grown at 23°C. Minichromosome maintenance assays were done at 30°C, using YPD as the nonselective growth medium. Loss rates were calculated for two independent transformants from each strain; the average is shown here. Variation in loss rate within a strain was <20%. A similar experiment using YCpl as the tester plasmid gave identical loss rates. Loss rates in parentheses are from cells grown at 23°C.

dependent promoter, they would also affect expression of a-specific genes, which are activated by MCM1 in con- junct ion wi th M A T a l . The two types of promoters might be affected differently in the different mutants because of involvement of this cofactor in a-specific gene activation. In vitro-binding studies have shown that a l increases the binding affinity of MCM1 to the "PQ" sites of a-specific genes (Passmore et al. 1989). Therefore, we tested the effect of each mutan t on a-specific expression using the same lacZ reporter gene as before, but wi th an a-specific upstream sequence, as shown in Fig- ure 3. This reporter, MFa lPQ- l acZ , contains a 60-mer oligonucleotide corresponding to the most proximal M C M 1 / a l - b i n d i n g site of the MFal promoter (Inokuchi et al. 1987) in place of the DSE14. The reporter gene was again integrated into each mutan t strain in single copy at the LE U2 locus on chromosome III. Expression from this a-specific reporter gene was 17-fold higher in wild-type a cells than in isogenic a cells, demonstrat ing that it be- haves as expected in the two cell types.

Results of [3-galactosidase assays in the M A T a m c m l mutan t strains (Fig. 5A) show that the mutan ts affect a-specific expression differently than they do nonspecific expression. Expression from the two promoters is compared in Figure 5B. All mutan t s lacking the acidic stretch show greatly reduced activi ty from the a-specific promoter compared to DSE14. In particular, m c m l - A D E , which lacks only the acidic stretch, expresses the

a-specific construct poorly (13% wild type) whi le being a good activator of the same reporter wi th the DSE14-binding site instead (100% wild type). The mutan ts containing the acidic stretch, m c m l - A Q and m c m l - 1 , activate transcription from the a-specific promoter to the same level relative to wild type as they do the nonspecific promoter wi th DSE14 ( -50% for m c m l - A Q and 5% for mcml-1) . These results suggest that in contrast to expression from the nonspecific promoter, the acidic stretch of MCM1 is important for expression from an a-specific promoter.

MCM1 DNA-b ind ing domain is sufficient for repression of a-specific genes in a cells

MCM1 has been implicated not only in activation of a-specific genes but in repression of a-specific genes in a cells. The cooperative binding of MCM1 and MATa2 at the operators of a-specific genes is believed to be respon- sible for their repression in a cells. We tested whether these m c m l mutants affect repression. We again studied expression from an integrated STE2-1acZ reporter gene, now containing 700 nucleotides upstream of STE2 (Fig. 3). This region contains the MCM1/a2 operator as well as UASs and is sufficient for a-specific expression (Smith 1986). Expression from this promoter is 80-fold higher in a cells than in isogenic a cells (Fig. 6).

Results of [3-galactosidase assays in the M A T a m c m l mutant strains (Fig. 6) show that most of the mutants are able to repress the a-specific gene. Only m c m l - g c n 4 / DE(Q) shows substantial derepression, wi th 28% of wild-type MATa activity, whereas rectal-1 has a slight effect, wi th approximately threefold higher [3-galactosidase levels than wild-type a cells, consistent wi th the reduced DNA-binding affinity of the MCMI-1 protein. The derepression observed in the m c m l - g c n 4 / D E ( Q ) mutant is most l ikely due to structural alterations that affect the abil i ty of the hybrid protein to bind to DNA with the a2 protein, because no portion of MCM1 is missing from this mutan t that is important for DNA binding or corepression wi th a2 (cf. wi th m c m l - A D E Q ) .

The m c m l - A D E , m c m l - A Q , and m c m l - A D E Q mutants show no derepression of a-specific genes, suggesting that nei ther the acidic nor the polyglutamine domain is required for their repression. However, if an m c m l mutan t were unable to activate transcription of STE2- lacZ in this genetic background, no conclusion could be reached concerning the abil i ty of the mutan t protein to repress transcription of a-specific genes. Therefore, we tested expression of STE2-1acZ in isogenic MATa cells derived from two of the m c m l mutants . We found no difference in 13-galactosidase expression from this promotor in m c m l - A D E or m c m l - A D E Q a strains compared to wild-type a strains: Each strain expresses - 1 0 0 Miller uni ts of f~-galactosidase (Fig. 6). The low level of f~-galactosidase in the a strains is therefore due to corepression wi th a2, which mus t only require the amino- terminal portion of MCM1.

The dramatic effects of these m c m l mutan ts on expression of mating-type-specific genes in a cells should





Functional domains o| MCMI

A

45 kD

29kD

B

45kD-

29 kD --

18kD--

14kD --

71- -!

Figure 4. Effect of the m c m l mutations on the level of the resulting protein. Im- munoblots using anti-B-gal-MCMll_92 are shown. Transformants of strain BJ2168 were grown in SC-uracil media to OD6oo 1.5, and crude extracts were loaded onto a 10% gel (A) or a 15% gel (B). (A) Approxi- mately 3 ~g of total protein was loaded in each lane. A 2-min exposure is shown. The wild-type MCM1 protein from the chromosomal MCM1 gene runs as the ~40-kD band of approximately equal intensity in each lane. (B) Approximately 1.5 ~g of total protein was loaded in each lane. A 5- min exposure is shown. Lanes 1 and 2 were loaded with the same extracts as in A. With overexposure, bands of the expected size of MCM1 (~40 kD) and MCM1-ADEQ (~ l l kD) appear in the YEp24--mcml-ADEQ lane, with the smaller band having lower intensity than the band from the chromosomal MCM1 gene.

result in mat ing defective phenotypes. We assayed the ability of each of the M A T a m c m l mutan t strains to mate wi th wild-type tester strains, as shown in Figure 7. The mat ing defects correspond well wi th the observed defects in mating-type-specific gene expression. Only the m c m l - A Q and m c m l - S R F / D E mutants are able to mate at all temperatures, consis tent wi th the finding that only these mutan t s have at least 25 % wild-type expression from the a-specific reporter gene. Only the m c m l - g c n 4 / D E ( Q ) mutan t mates wi th other a cells rather than wi th a cells, an a-like faker phenotype similar to that of m a t ~ l m a t ~ 2 double mutan ts (Strathem et al. 1981), which is consistent wi th the high level of a- specific gene expression and low level of a-specific gene expression in this mutant . Mating is improved and expression from M F a l P Q - l a c Z increases 3- to 10-fold wi th overproduction of wild-type or mu tan t proteins in their respective strains. However, m c m l - g c n 4 / D E ( Q ) be- comes a weak bi-mater, rather than mat ing only wi th a cells, and expression from STE2-1acZ suggests that core° pression wi th a2 is not restored wi th overproduction of the MCM1-GCN4/DE(Q) protein (data not shown).

The acidic d o m a i n reduces M C M 1 ac t i v i t y at an a-specific U A S in a ceils

The current model for a-specific gene regulation is that only positive regulation occurs, by cooperative binding of MCM1 and M A T a l in a cells and that binding of MCM1 alone to the upstream elements of these genes is too weak to allow their expression in a cells. However, MCM1 can bind to PQ elements of M F a l and STE3 in vitro wi th high affinity in the absence of a l (Tan et al. 1988; Passmore et al. 1989; Ammerer 1990). Therefore, we wondered whether a-specific gene expression is regulated in a cells, as well as in a cells, in this case to decrease MCM1 binding or act ivi ty at PQ elements. If so,

some of the MCM1 muta t ions may affect this regulation. We tested this hypothesis by assaying expression of the a-specific reporter gene, MFa lPQ- lacZ , in a wild-

Table 2. Effect of MCM1 mutant protein overproduction on expression from DSE14-1acZ

Expression from DSE14 {% wild-type Fold

Allele activity) difference

MCM1 + YEp24 100 + YEp24 MCM1 98

m c m l - A Q + YEp24 46 + YEp24 m c m l - A Q 59

m cm 1-ADE + YEp24 71 + YEp24 m cm 1-ADE 80

m cm 1-ADE Q + YEp24 15 + YEp24 m c m l - A D E Q 58

rectal-1 + YEp24 10 + YEp24 rectal-1 84

m cm 1-SRF/DE + YEp24 82 + YEp24 mcml-SRF/DE 102

m cm 1-gcn4/DE(Q) + YEp24 60 + YEp24 mcml-gcn4/DE(Q) 193

1.0

1.3

1.1

3.9

8.4

1.2

3.2

Duplicate cultures of each strain were grown at 30°C in SC-uracil media to OD6o o 1.5, and f~-galactosidase activity was assayed by using 1 ml of each culture as described {Guarante 1983). Activity varied by 20% or less between the duplicates. The experiment was repeated yielding similar results to those shown.





Christ and Tye

Table 3. Effect of MCM1 mutant protein overproduction on minichromosome stability

Loss rate of Allele YCpl01

m c m l - A D E Q + YEp24 0.25 + YEp24 m c m l - A D E Q 0.04

m c m l - 1 + YEp24 0.38 + YEp24 m c m l - 1 0.03

mcrn I-gcn4/DE(Q) + YEp24 0.16 + YEp24 rncrn 1-gcn4/DE(Q) 0.05

Minichromosome maintenance assays were done at 30°C in SC + leucine media, lacking uracil. Dilutions from initial and final cultures were plated on YPD and replicated to SC-uracil and SC/uracil/leucine. Loss rate of YCpl01 was calculated by using the percentage of cells containing YEp24 (-+ mcmlJ that also contain YCpl01. Loss rates shown are averages from testing two independent transformants, whose loss rates varied by <20%.

type a strain overproducing MCM1 proteins, and asking whether activity is increased more when a mutan t rather than a wild-type protein is overproduced. This experiment was possible because expression of MF~ 1PQ-lacZ, unlike DSE14-1acZ , is low in wild-type a cells and increases wi th overproduction of MCM1. We used an a strain isogenic to the ot strain used in the previous experiments, containing the integrated M F a l P Q - l a c Z tester. We transformed this strain with YEp24 or YEp24 bearing either a wild-type or mutan t M C M 1 gene and assayed for f~-galactosidase expression.

Surprisingly, only proteins missing the acidic

s t re tch- -MCM1-ADE, MCM1-SRF/DE, and M C M 1 - GCN4/DE(Q)--s ignif icant ly increase expression from the a-specific UAS in a cells when overproduced, as shown in Figure 8. Expression from the PQ site increases five- to eightfold wi th overproducion of any of these mutant proteins, whereas activity only increases twofold or less when wild-type MCM1 or M C M 1 - A Q is overproduced. This result is unl ikely to be due to differences in the amount of MCM1, because immunoblo ts indicate that MCM1 wild-type protein is present at a similar, perhaps even higher, level than these m u t a n t proteins when expressed from a YEp24 plasmid in a wild-type strain (Fig. 4A). Therefore, the acidic domain of MCM1 appears to be important not only for activation at the a-specific UAS in ~ cells but also for mainta ining a low level of expression from this site in a cells. These results suggest that MCMl-dependen t expression of ~-specific genes may be regulated in a cells as well as in ~ cells.

D i s c u s s i o n

Funct ional d o m a i n s of M C M 1

D N A - b i n d i n g doma in This study revealed that the three domains of MCM 1 identified by similari ty to other proteins do provide different functions, as summarized in Figure 9. However, the 80-amino-acid region homologous to SRF was found to be sufficient for most MCM1 functions, including cell viability, minichromosome maintenance, transcription activation from a non-cell- type-specific MCMl-dependen t promoter, and corepression with ~2 of a-specific genes. MCM1 is therefore unlike most previously studied eukaryotic transcription factors, which have separate DNA-binding and activation domains (for review, see Mitchell and Tjian 1989),

A. B. Allele MFc~I PQ-lacZ expression

(% activitu in a MCPll)

MA To MCM I 10 0

mcm I-AQ 5 1

rncm ! -,4DE 13

mcm I-.4DEO 4

mcm I - I 5

mcm I -SRFIDE 25

mcm l -gcn41DE(O) 6

MA Ta MCM l 6

200 ir o. • " -

[] DSEI4 [] MF~IPQ

Figure 5. Transcriptional activation from MFc~IPQ-lacZ and comparison with activation from the non-cell-type-specific DSE14-1acZ reporter gene in M A T s m c m l mutants. (A) Duplicate cultures of each strain were grown at 30°C in YPD media to OD6o o 1.5, and ~3-galactosidase activity from the integrated MFedPQ-lacZ reporter gene was assayed by using 1 ml of each culture as described. Activity varied by 20% or less between the duplicates and is expressed as a percentage of the activity in wild-type MATs cells. The same experiment was repeated several times yielding similar results. B-Galactosidase activity was usually 6 Miller units from the MFctlPQ promoter in wild-type ct cells. (B) Light crosshatching indicates DSE14-1acZ expression relative to wild type (from Table 1); dark crosshatching indicates MFcdPQ-lacZ expression relative to wild type.





Funct ional d o m a i n s of M C M 1

120 "

IOO

BO

~ 6o

~ ,40

I:: 20

MATo~ MATa

Figure 6. Repression of an a-specific reporter gene in m c m l mutant strains. Duplicate cultures of each strain were grown at 30°C in YPD media to OD6o o 1.S, and B-galactosidase activity was assayed using 1 ml of each culture as described. Activity varied by 20% or less between the duplicates. The experiment was repeated twice yielding similar results. Results are shown as percent activity in wild-type a cells. B-Galactosidase activity was usually 100 Miller units in a cells.

suggesting that transcriptional activation by MCM1 may occur by a different mechan i sm from that of most other transcription factors. Further experiments will be required to determine whether transcriptional activation requires an activity of MCM1 beyond DNA binding, such as making specific contacts wi th other proteins or possibly affecting the DNA or chromat in structure. The M C M 1 / a 2 / D N A complex may be s imilar to the ternary complex of SRF, p62TCF, and DNA, which was sug- gested to require only the DNA-binding domain of SRF (Schr6ter et al. 1990). It wil l be interesting to determine whether the cooperativity of D N A binding by MCM1 and a2 involves specific protein-protein interactions or

whether it is mediated by interact ion of each protein wi th the DNA.

In light of our finding that the DNA-binding domain of MCM1 is sufficient for its function, it is interest ing that ARGS0 (ARG RII, which has 70% ident i ty to MCM1 in these 80 amino acids {Passmore et al. 1988), cannot subst i tute for MCM1. Even overproduction of ARG RI cannot rescue the lethal i ty of an m c m l deletion {R. Elble, unpubl.1. ARG RI has not been demonstrated to bind D N A and has no apparent transcription activation abil- i ty (Qiu et al. 19901, suggesting that ARG RI and MCM1 may differ in amino acids that are important for DNA- binding affinity or transcriptional activation. Interest- ingly, the m c m l - 1 point mu tan t at Progz has the most severe phenotype of all the viable mutan t s we examined, suggesting that Pro97 is important for MCM1 function. SRF also has a proline at the homologous position, whereas ARG RI does not.

Acid ic doma in The acidic domain of MCM1 is important for regulation of a-specific genes. All mutan t s lacking the acidic domain show low expression of an oL-specific reporter gene in oL cells, even if they have no defect in expressing a non-cell-type-specific gene. When a mutan t protein lacking the acidic domain is overproduced in a cells, the a-specific reporter gene is expressed at an abnormal ly high level compared to the level wi th overproduction of MCM1 proteins containing an acidic domain. These results suggest that the acidic domain is important for both positive and negative regulation of MCM1 activity at a-specific promoters. Nei ther substi- tut ion of a portion of SRF or of an acidic activation doma in of GCN4 could replace the funct ion of the MCM1 acidic stretch in either cell type.

In a cells, the acidic stretch may be necessary to form a ternary complex of MCM1, oL1, and the PQ DNA. Tan and Richmond (19901 showed that only the smallest pro-

Figure 7. M a t i n g of M A T a m c m l m u t a n t s . S t r a ins w e r e p a t c h e d o n t o Y P D p l a t e s c o v e r e d with a lawn of either the MATa met4 or MATa met4 mating-type tester strain. Plates were incubated overnight at 23, 30, or 37°C and replica-plated to SD (media containing no added amino acidsl, so that only the diploids could grow. The SD plates were incubated at 30°C ovemight. The density of growth gives a relative indication of the mating efficiency of the mutant strains. As a reference, quantita- tive mating tests had shown previously that mcml-1 mates at 1% wild-type efficiency at 30°C (Passmore et al. 1988].





Christ and "rye

50 x t (,4

la.I

20 I..-..

o

-, |0 >

0

~ . ~-- .~,~,- y,-- ~

Figure 8. Expression of an a-specific gene in an a strain overproducing MCM1 mutant proteins. Two transformants of each plasmid into the MATa MCM1 strain with the integrated MFalPQ-lacZ reporter gene were grown at 30°C in SC-uracil media to OD6o o 1.5. [3-Galactosidase activity was assayed by using 1 ml of each culture as described (Guarante 1983) and is expressed as a percentage of the activity of an isogenic MATer strain containing YEp24, tested simultaneously. Activity varied by 20% or less between the two transformants.

teolytic fragments of MCM1 that are still able to bind D N A are unable to form a ternary complex wi th ~ 1, suggesting that the portion of MCM1 required for oL1 interaction is close to, but not within, the m i n i m a l DNA- binding domain. Their results, combined wi th the functional analysis presented here, suggest that the acidic stretch of MCM1 is l ikely to be the site of interaction wi th od. We are currently testing whether or not proteins lacking the acidic stretch are able to bind cooperatively wi th od to the PQ site.

Although negative regulation at the a-specific UAS in a cells has not been reported previously, results of an earlier study support this hypothesis. Jarvis et al. (1989) found that activity from a reporter gene wi th the STE3 PQ e lement in a cells was half that from the same promoter wi th only the P element. When they overproduced MGM1, activi ty from the P e lement increased to 560 units, whereas activity from the PQ element increased only to 150 units. This result suggests that the Q element negatively modulates the abil i ty of MCM1 to either bind or activate transcription at the neighboring P e lement in a cells. With these data and our observation that removal of the acidic stretch increases MCM1 ac- t ivity at PQ in a cells, and by analogy wi th regulation in oL cells, it seems l ikely that regulation of MCMl-dependent transcriptional activation of (x-specific genes in a cells m a y also be mediated by protein(s) binding at the Q element. An alternative possibil i ty is that the PQ site is normal ly not bound wi th protein in a cells and that deletion of the acidic stretch could increase MCMl-b ind- ing affinity to PQ in the absence of cofactors, resulting in a level of e~-specific gene expression intermediate to that of wild-type a cells and the od-induced level of oL cells. In vitro-binding studies wi th the wild-type and

MCM1-ADE proteins should dist inguish these possibil- ities.

Polyglutamine domain The polyglutamine domain was found to be dispensable for all MCM1 functions. However, mutan ts lacking the polyglutamine domain had at most 60% of wild-type MCM1 transcriptional ac- t ivation activity, on both a nonspecific and a-specific promoter. The reduced activity at the nonspecific promoter was shown not to result from an effect on DNA- binding site occupancy. The polyglutamine domain therefore contributes to the transcription activity of MCM 1. In addition, the polyglutamine domain may contribute to the stabili ty of the MCM1 protein, because MCM1-AQ and MCM1-ADEQ appear less abundant by Western blots. Unl ike the polyglutamine domains of Spl, which were shown by Courey and Tjian (1988) to be required for its transcription activation abil i ty in Droso- phila cells, the MCM1 polyglutamine domain contributes only weakly to its total activity. Polyglutamine domains are common among yeast proteins but have not yet been demonstrated to be important for any function. It is not clear, therefore, whether the MCM1 polyglutamine domain could be acting s imilar ly to that of Sp 1 in transcriptional activation.

Role of transcription factors in yeast DNA replication initiation

In yeast, both MCM1 and another transcription factor, ABF1, have been implicated in replication initiation. ABF1 was identified as a factor that binds D N A within several ARSs {Buchman et al. 1988; Diffley and Sti l lman 1988), and ABFI-binding sites were shown to increase the efficiency of ARS function in a min ich romosome maintenance assay (Walker et al. 1990). The identif ication of these transcription factors as potential DNA replication ini t iat ion factors in yeast suggests that chromosomal replication ini t ia t ion may be s imilar to that of the eukaryotic viruses. Viral replication ini t ia t ion is enhanced by the direct binding of m a m m a l i a n transcription factors to the replication origin. This enhancement was shown recently to require only the DNA-binding domain of the transcription factor (Mermod et al. 1989; Verrijzer et al. 1990).

Although both transcription and replication activity of MCM1 are contained in an 80-amino-acid domain, the phenotypes of the m c m l mutants described in this study

17 97 120 286 I I I I

MCM1 . . . . . . . . . . . . . \DNA binding4 ~ ti°n activati°n ' ' ' ' /

Transcription activation u-specific gene regulation Repression of a-specific genes Minichromosome maintenance

Cell viability

Figure 9. Functional domains of MCM1. A summary of the activities attributed to the different parts of the protein is shown. The boxed regions correspond to those in Fig. 1.






suggest that the role of MCM1 in replication in i t ia t ion is probably not indirectly mediated through affecting transcription of another gene. Comparison of the phenotypes of those mutan t s wi th a min ichromosome main tenance (Mcm) defect, rec ta l - l , m c m l - g c n 4 / D E ( Q ) , and m c m l - h D E Q , wi th those that are wild type for Mcm ( m c m l - A D E , m c m l - A Q , and m c m l - S R F / D E ) shows that the only phenotype yet found that differentiates these two groups is DSE14 DNA-binding site occupancy. The Mcm-defective class showed lower occupancy of DSE14 , whereas the Mcm-proficient class showed full occupancy of DSE14. All other phenotypes, that is, protein level, gene expression from DSE14 , coact ivat ion wi th ~1, and corepression with ~2, varied wi th in these groups. Therefore, the Mcm phenotype correlates wi th DNA-binding site occupancy but not wi th gene expression or binding wi th cofactors. These results, together wi th the discovery of MCMl-b ind ing sites in ARSs (V. Chang and S. Passmore, unpubl.), are most consistent wi th the direct model for the action of MCM1 in replication, that MGM1 affects min ichromosome maintenance and DNA replication by binding to replication origins. Clearly, however, they do not rule out the possi- bilities that MCM1 acts indirectly to affect replication, perhaps in combinat ion wi th cofactors that interact wi th it in ways unl ike etl or et2, or by affecting expression of a number of genes, or even that the total effect of m c m l muta t ions on min ichromosome main tenance may result from both direct and indirect activities. Further study of m c m l mutants , combined wi th muta t iona l analysis of the ARS elements will be impor tant in resolving this issue.

M a t e r i a l s a n d m e t h o d s

Strains

Escherichia coli strains used were DHSe* (BRL) for routine cloning, GM2163 (hsdR2 mcrB1 daml3::Tn9 dcm61 from New En- gland Biolabs, for preparation of DNA that can be cut at the StuI site in MCM1, and CJ236 [dut ung thi relA pCJ105 (Cmr)] for oligonucleotide-directed mutagenesis. Yeast strains 8534-8C {MATe, his4A34, leu2-3,112, ura3-521 and an isogenic MATa strain made by transient transformation with HO and sporula- tion of the resultant diploid, were used for constructing and analyzing mcml mutants; 6697/1 (MATa met4) and 6697/3 (MATe* met4) were used for mating tests; BJ2168 (MATa leu2 trp ura3-52 prbl-1122 prcl-407 pep4-3), from David Shore, was used in the Western blot analyses; and C2/501 [MATe* mcml&Xho/Bam his4 1eu2-3,112 ura3-52 trpl-289 YCp501 (MCM1 ARS1 CEN5 URA3}] was used in the plasmid shuffle experiments.

Construction of mcml mutants and tester plasmids

The mcml -AQ and mcml-1 alleles were derived from previously cloned mutations on XhoI-EcoRI fragments containing part of MCM1 in YIp5 (Passmore et al. 1988). mcml -AQ was derived from YIp5 B453 {Maine 1984), which had a BamHI linker that mapped near the acidic stretch of MCM1. We sequenced through the linker insertion site by double-strand dideoxy sequencing using primers within the MCM1 gene at

+ 185 to +200 and +468 to +450 from the ATG. The deduced amino acid sequence, altered following Gly~ s, is shown in Fig- ure 1.

The mcml-ADE, mcml-hDEQ, mcml-SRF/DE, rncml- gcn4/DE(Q), and rectal-AN 17DEQ mutations are derived from the same oligonucleotide mutagenesis experiment. The SphI- EcoRI fragment with part of MCM1 (Passmore et al. 1988) was cloned into KS - {Stratagene), which had the SalI site destroyed. Oligonucleotide mutagenesis was performed by using the Bio- Rad reagents and the mutagenic oligonucleotide 5'-GTCTTAA- CGCCCCTGTCGACTATGCAACAGC-3', which replaces 60 nucleotides coding for the acid stretch with a SalI-HincII-AccI site. mcml-aDE was derived by cutting with AccI, filling in the ends, and religating, mcml-ADEQ was derived by cutting with HincII and cloning in an XbaI linker with stop codons in all three open reading frames, 5'-TACTAGTCTAGACTAGTA-3'. mcml-SRF/DE was derived by cutting with AccI, filling in the ends, and ligating in an 80-nucleotide Hinfl fragment of the SRF gene from pG3.5 (Norman et al. 1988; from R. Treisman). mcml-gcn4/DE(Q) was derived by cutting with SalI and KpnI and inserting a 195-nucleotide SalI-KpnI fragment from the GCN4 derivative YCp88-1exA-gcn4-D 19 {Hope et al. 1988; from K. Struhl). The resulting construct was put back into flame by cutting with SalI, filling in, and religating. Each construct was verified to have the expected junction sequence by restriction mapping and double-stranded dideoxy sequencing, using a primer from + 185 to +200 of MCM1. mcml-ANlzDEQ was derived from mcml-ADEQ by oligonucleotide-mediated mutagenesis, using 5'-CACCCAGCAAAAATGAGAAGAAA- GATAGAA-3', which loops out amino acids 2-17. Transfor- mants were screened by sequencing with a primer from -47 to -27 of the MCM1 gene.

All of the mutated fragments were subcloned into the yeast shuttle vectors YIp5 and YEp24 containing the entire MCM1 gene on a 3.4-kb XhoI-BamHI fragment, by replacing the 1.2-kb SphI-KpnI wild-type fragment with the mutagenized fragment. Correct constructs were confirmed by restriction mapping, and for mcrnl-1 and mcml-ANlzDEQ by sequencing. YEp351 (Hill et al. 1986) constructs containing a mutant gene were made by using the SphI-BamHI fragment from the YIp5 constructs. mcml-Xho92 and rectal-Barn92 were made by cutting a YEp351 plasmid containing the wild-type MCM1 gene with StuI and ligating in either an XhoI or BamHI 12-nucleotide linker. DNA from resulting transformants was sequenced by using the + 185 to + 200 primer and determined to have only one linker inserted in each case.

Tester plasmids were derived from pCDH or pCDH-DSE~4 (Passmore et al. 1989). DSE14-1acZ was made by cutting pCDH- DSE14 with BamHI and BglII and religating to remove the centromere so that the plasmid could be integrated into a yeast chromosome. The control plasmid with no MCMl-binding site was made by cutting pCDH with SalI and HindIII, filling in, and religating. MFulPQ-lacZ was made by cloning MFe*lp60 (Pass- more et al. 1989) into pCDH at the SalI and HindIII sites. STE2-- lacZ was constructed by replacing the SalI-SacI fragment of pCDH with the corresponding fragment of pCD14 (Smith 1986). Centromeres were removed from all plasmids to allow integration, as described for DSE14 -lacZ.

Yeast methods

Plasmid shuffle assays were done as described (Boeke et al. 1987}. In each case, strain C2/501 was transformed with a positive control plasmid {the vector containing MCM1 ), a negative control plasmid (the vector alone), and the vector containing the mutated mcml gene. Ability of the mutant to provide MCM1





Christ and l y e

function was analyzed by growth on 5-fluoro-orotic acid (5- FOA), which selects for cells that have lost YCpS01. The exper- imenta l sample and positive and negative controls were streaked on the same 5-FOA plate to ensure that growth re- flected the ability of the mutan t gene to complement the m c m l deletion, rather than variation in 5-FOA concentration.

The MCM1 gene was replaced with each of the mu tan t alleles, using a two-step method. YIp5 containing the muta ted m c m l gene was digested wi th SphI to target plasmid integration to the MCM1 locus. Transformants of 8534-8C were selected on SC-uracil media, and recombinants retaining only one copy of the MCM1 gene were selected on 5-FOA (Boeke et al. 1984). These isolates were tested for retent ion of the wild-type or mutant allele by genomic Southern blots, except for m c m l - 1 . Yeast genomic DNA was digested wi th appropriate restriction en- zymes to differentiate mutan t from wild type [ m c m l - A Q has a BamHI site, m c m l - A D E has an NruI site, m c m l - h D E Q and m c m l - A N z D E Q have an XbaI site, m c m I - S R F / D E has a SalI site, and m c m l - g c n 4 / D E ( Q ) has a PvuI site at the mutation). D N A was separated on agarose gels, blotted to nylon membranes, and probed wi th random-prime labeled MCM1 fragment - 1 4 to +274. Replacement of wild type with m c m l - 1 was screened by the sterile phenotype and confirmed by the minichromosome main tenance defect, which were both identical to those of the previously described isolate of m c m l - 1 (Passmore et al. 1988).

Tester plasmids DSE14-1acZ, MFet 1PQ-lacZ, and STE2-1acZ were integrated into each mutan t strain at LEU2 by cutt ing wi th BstEII. Transformants were tested for having a single copy of the tester plasmid by Southern blot. Yeast genomic DNA was cut wi th PstI, which cuts once in the vector and again 5 kb upstream of LE U2. DNA was separated on agarose gels, blotted to nylon membranes, and probed wi th a random-prime-labeled fragment of lacZ. Transformants wi th only the expected 13-kb band, lacking a plasmid-sized fragment, were chosen for B-galactosidase assays.

13-Galactosidase activity was measured according to Guarante { 1983). Units were calculated as (1000 x OD42o)/[time (min) x vol (ml) x OD6oo) ] (Miller 1972). Cultures were grown to the same OD6o o (ranging from 1-1.5 in different sets of assays), and activity was normalized to the activity of the wild- type strain, measured simultaneously. Cultures were grown in ei ther YPD or SC media, as stated in the table footnotes.

Minichromosome main tenance assays were done as follows: A colony grown on selective media was suspended in 0.2 ml of water. A 0.1-ml aliquot was used to inoculate 5 ml of nonselective media (either YPD or SC --+ uracil), and cultures were grown wi th aeration unti l saturated ( -10 generations). Dilutions of the initial suspension were plated on YPD plates, and colonies were counted to determine the initial concentrat ion of viable cells; these plates were then replica-plated to SC-leucine to determine the initial percentage of plasmid-bearing cells. Final sam- ples were treated similarly. The number of generations of nonselective growth (n) was calculated as log(final concentrat ion/ initial concentration)/log2. The loss rate per cell per generation was calculated as 1 - (final % plasmid-bearing cells/initial % plasmid-bearing cells) lm. Each assay set was done simultaneously to e l iminate variations due to temperature or media. Loss rates were found to be twofold higher in synthetic compared to YPD media for all strains except for m c m l - 1 and rncm 1-gcn4/DE(Q).

An t i s e rum preparation and immunolog ica l techniques

Ant iserum was generated against a [3-gal-MCM1 fusion protein containing only the amino-terminal 92 amino acids of MCM1.

A 0.3-kb BamHI-S tu I fragment from pETMCMl(1-188) (Pass- more et al. 1989) was inserted into pUR278 (Rfither and Miiller- Hill 1983). E. coli strain DHSa containing this plasmid was induced wi th IPTG to express the 13-gal-MCM1 fusion protein. Cells were lysed by boiling in SDS sample buffer (Laemmli 1970), and total protein was separated on preparative 6% acrylamide SDS-PAGE. The [3-gal-MCM1 fusion protein was cut out, electroeluted, and used to immunize rabbits. The rabbits were boosted twice, and ant iserum was collected 2 weeks after the final boost.

Immunoblots were performed by standard methods. Yeast extracts were made by pelleting log phase yeast (OD6o o 1.5) and resuspending in SDS sample buffer wi th glass beads, followed by repeated boiling and vortexing. Protein concentrat ion in the extracts was estimated by using the Bio-Rad assay on diluted extracts, wi th protein standards to which we added similar amounts of sample buffer. Proteins were separated by SDS- PAGE on 10% or 15% acrylamide gels and transferred to nitrocellulose by using a semidry blotter (Hoefer) and the three- buffer system (Kyhse-Anderson 1984), adding SDS to 0.1% to all buffers. Nonfat dry mi lk (5%) was used to block the membranes, and primary antibody was diluted 1 : 1000 and detected by using horseradish peroxidase-conjugated goat anti-rabbit IgG (BRL, 1 : 6000). Visualization was by enhanced chemilumines- cence (Amersham).

Acknowledgments

We thank Kevin Struhl for the gift of the GCN4 derivative YCp88-1exA--gcn4--D 19, which we used to make m cm 1-gcn4/ DE(Q), and Tom Fox, for critical reading of the manuscript. This work was supported by a National Science Foundation Graduate Fellowship to C.C. and by National Institutes of Health grant GM 34190.

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "adver t isement" in accordance wi th 18 USC section 1734 solely to indicate this fact.

References

Ammerer, G. 1990. Identification, purification, and cloning of a polypeptide (PRTF/GRM) that binds to mating-specific promoter elements in yeast. Genes & Dev. 4: 299-312.

Boeke, J.D., F. LaCroute, and G.R. Fink. 1984. A positive selec- tion for mutants lacking orotidine-5'-phosphate decarboxyl- ase in yeast: 5-Fluoro-orotic acid resistance. Mol. Gen. Genet. 197: 345-346.

Boeke J.D., J. Trueheart, G. Natsoulis, and G.R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154: 164--175.

Brewer, B.J. and W.L. Fangman. 1987. The localization of replication origins on A R S plasmids in S. cerevisiae. Cell 51: 463-471.

Buchman, A.R., W.J. Kimmerly, J. Rine, and R. D. Komberg. 1988. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharo- myces cerevisiae. Mol. Cell. Biol. 8: 210--225.

Challberg, M.D. and T.J. Kelly. 1989. Animal virus DNA replication. Annu. Rev. Biochem. 58: 671-717.

Courey, A.J. and R. Tjian. 1988. Analysis of Spl in vivo reveals mult iple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55: 887-898.

Courey, A.J., D.A. Holtzman, S.P. Jackson, and R. Tjian. I989.






Synergistic activation by the glutamine-rich domains of hu- man transcription factor Spl. Cell 59: 827-836.

Diffley J.F.X. and B. Stillman. 1988. Purification of a yeast protein that binds to origins of DNA replication and a transcriptional silencer. Proc. Natl. Acad. Sci. 85: 2120-2124.

Dubois, E., J. Bercy, and F. Messenguy. 1987. Characterization of two genes, A R G R I and ARGRIl I required for specific regulation of arginine metabolism in yeast. Mol. Gen. Genet. 207: 142-148.

Guarante, L. 1983. Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzy- mol. 101: 181-187.

Hill J.E., A.M. Myers, T.J. Koemer, and A. Tzagoloff. 1986. Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2: 163-167.

Hope, I.A. and K. Struhl. 1986. Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast. Cell 46: 885-894.

Hope, I.A., S. Mahadevan, and K. Struhl. 1988. Structural and functional characterization of the short acidic transcriptional activation region of yeast GCN4 protein. Nature 333: 635-640.

Huberman, J.A., L.D. Spotila, K.A. Nawotka, S. M. E1-Assouli, and L.R. Davis. 1987. The in vivo replication origin of the yeast 2~xm plasmid. Cell 51: 473-481.

Huberman, J.A., J. Zhu, L.R. Davis, and C.S. Newlon. 1988. Close association of a DNA replication origin and an ARS element on chromosome III of the yeast Saccharomyces cerevisiae. Nucleic Acids Res. 16: 6373-6384.

Inokuchi, K., A. Nakayama, and F. Hishinuma. 1987. Identifi- cation of sequence elements that confer cell-type-specific control of MFal gene expression in Saccharomyces cerevisiae. Mol. Cell. Biol. 7: 3185-3193.

Jarvis, E.E., D.C. Hagen, and G.F. Sprague, Jr. 1988. Identifica- tion of a DNA segment that is necessary and sufficient for a-specific gene control in Saccharomyces cerevisiae: Impli- cations for regulation of a-specific and a-specific genes. Mol. Cell. Biol. 8: 309-320.

Jarvis, E.E., K.L. Clark, and G.F. Sprague Jr. 1989. The yeast transcription activator PRTF, a homolog of the mammalian serum response factor, is encoded by the MCM1 gene. Genes & Dev. 3: 936-945.

Keegan, L., G. Gill, and M. Ptashne. 1986. Separation of DNA binding from the transcription-activating function of a eukaryotic regulatory protein. Science 231: 699-704.

Keleher, C.A., C. Goutte, and A.D. Johnson. 1988. The yeast cell-type-specific repressor a2 acts cooperatively with a non- cell-type-specific protein. Cell 53: 927-936.

Keleher, C.A., S. Passmore, and A.D. Johnson. 1989. Yeast repressor a2 binds to its operator cooperatively with yeast protein Mcml. Mol. Cell. Biol. 9: 5228-5230.

Kyhse-Anderson, J. 1984. Electroblotting of multiple gels: A simple apparatus without buffer tank for rapid transfer of proteins from polyacrylamide gels to nitrocellulose membranes. ]. Biophys. Biochem. Methodol. 10: 203-209.

Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277: 680- 685.

Levine, M. and J.L. Manley. 1989. Transcriptional repression of eukaryotic promoters. Cell 59: 405-408.

Maine, G.T. 1984. Mutants of Saccharomyces cerevisiae defective in the maintenance of minichromosomes. Ph.D. Thesis. Cornell University, Ithaca, New York.

Maine, G.T., P. Sinha, and B.K. Tye. 1984. Mutants of S. cerevisiae defective in the maintenance of minichromosomes. Genetics 106: 365-385.

Mermod, N., E.A. O'Neill, T.J. Kelly, and R. Tjian. 1989. The proline-rich transcriptional activator of CTF/NF-I is distinct from the replication and DNA binding domain. Cell 5 8 : 7 4 1 - 7 5 3

Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Mitchell, P.J., and R. Tjian. 1989. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245: 371-378.

Norman, C., M. Runswick, R. Pollock, and R. Treisman. 1988. Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-los serum response element. Cell 55: 989-1003.

Passmore, S., G.T. Maine, R. Elble, C. Christ, and B.K. Tye. 1988. Saccharomyces cerevisiae protein involved in plasmid maintenance is necessary for mating of MATot cells. ]. Mol. Biol. 204: 593-606.

Passmore, S., R. Elble, and B.K. Tye. 1989. A protein involved in minichromosome maintenance in yeast binds a transcriptional enhancer conserved in eukaryotes. Genes & Dev. 3: 921-935.

Qiu, H., E. Dubois, P. Bro6n, and F. Messenguy. 1990. Func- tional analysis of ARGRI and ARGRIII regulatory proteins involved in the regulation of arginine metabolism in Saccha- romyces cerevisiae. Mol. Cen. Cenet. 222: 192-200.

Rfither, U. and B. Mfiller-Hill. 1983. Easy identification of cDNA clones. EMBO ]. 2:1790-1794.

Schr6ter, H., C.G.F. Mueller, K. Meese, and A. Nordheim. 1990. Synergism in ternary complex formation between the dimeric glycoprotein p67 sRr, polypeptide p62 TcF and the c- fos serum response element. EMBO L 9:1123-1130.

Shore, D. and K. Nasmyth. 1987. Purification and cloning of a DNA binding protein from yeast that binds to both silencer and activator elements. Cell 51: 721-732.

Smith, P.P. 1986. The control of the a specific gene for the alpha factor receptor in Saccharomyces cerevisiae: Studies on a lacZ fusion. Ph.D. thesis. Cornell University, Ithaca, New York.

Sommer, H., J.-P. Beltran, P. Huijser, H. Pape, W.-E. L6nnig, H. Saedler, and Z. Schwarz-Sommer. 1990. Deficiens, a homeotic gene involved in the control of flower morphogenesis in Antirrhinum majus: The protein shows homology to transcription factors. EMBO ]. 9: 605--613.

Strathem, J., J. Hicks, and I. Herskowitz. 1981. Control of cell type in yeast by the mating type locus: the a l -a2 hypothesis. ]. Mol. Biol. 147: 357-372.

Tan, S. and T.I. Richmond. 1990. DNA binding-induced confor- mational change of the yeast transcriptional activator PRTF. Cell 62: 367-377.

Tan, S., G. Ammerer, and T.J. Richmond. 1988. Interactions of purified transcription factors: binding of yeast MATal and PRTF to cell-type-specific, upstream activating sequences. EMBO ]. 7: 4255-4264.

Verrijzer, C.P., A.J. Kal, and P. C. Van der Vliet. 1990. The DNA binding domain {POU domain) of transcription factor oct-1 suffices for stimulation of DNA replication. EMBO ]. 9: 1883-1888.

Walker, S.S., S.C. Francesconi, and S. Eisenberg. 1990. A DNA replication enhancer in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. 87: 4665-4669.

Yanofsky, M.F., H. Ma, J.L. Bowman, G.N. Drews, K.A. Feld- mann, and E.M. Meyerowitz. 1990. The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 346: 35-39.





10.1101/gad.5.5.751Access the most recent version at doi: 5:1991, Genes Dev.

C Christ and B K Tye MCM1.Functional domains of the yeast transcription/replication factor

References

http://genesdev.cshlp.org/content/5/5/751.full.html#ref-list-1

This article cites 42 articles, 11 of which can be accessed free at:

License

ServiceEmail Alerting

click here.right corner of the article or

Receive free email alerts when new articles cite this article - sign up in the box at the top

Copyright © Cold Spring Harbor Laboratory Press


http://genesdev.cshlp.org/lookup/doi/10.1101/gad.5.5.751

http://genesdev.cshlp.org/content/5/5/751.full.html#ref-list-1

http://genesdev.cshlp.org/cgi/alerts/ctalert?alertType=citedby&addAlert=cited_by&saveAlert=no&cited_by_criteria_resid=protocols;10.1101/gad.5.5.751&return_type=article&return_url=http://genesdev.cshlp.org/content/10.1101/gad.5.5.751.full.pdf

http://genesdev.cshlp.org/cgi/adclick/?ad=41173&adclick=true&url=https%3A%2F%2Fipaper.ipapercms.dk%2FEXIQON%2FMarketing%2Ftechnote%2FNGS-comparison-of-methods-for-microrna-profiling-from-plasma-and-plasma-derived-exosomes%3Futm_source%3DCSHL%26utm_medium



Documents

Functional domains of the yeast transcription/replication factor MCM1