Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 1 765-496-6252
RNA-SEQ WORKSHOP, APRIL 2015 – PREREQUISITES
This workshop assumes the user is comfortable operating in the UNIX environment. Without
having a working knowledge of UNIX, it will be very difficult to perform the tasks necessary to
conduct the analysis, and teaching such UNIX skills is beyond the scope of this particular
workshop. Additionally, each participant needs to have a temporary computing account to access
the Hansen cluster, which will be provided upon registration.
EXPERIMENTAL DESIGN
The Sequence Read Archive (SRA) is a database hosted by NCBI that provides a means for
researchers to deposit their primary sequencing data for published studies. One such study, SRA
ID# SRP017778, investigates the transcriptional changes of mouse murine embryonic stem cells
as they differentiate into glutamatergic cortical neurons. This workshop will determine the
differential gene expression (DGE) between two treatments, early neurogenesis sample t7 and
maturing glutamatergic neuron sample t21, with three replicates for each treatment. The analysis
will be limited to the short mouse chromosome 19 to ensure completion in a timely manner.
GETTING STARTED
Login to the Hansen cluster using the provided credentials and PuTTY:
PuTTY is a free program available for
Windows. Use "Host Name"
hansen.rcac.purdue.edu
If using OSX, open terminal and enter:
Today’s Hansen access is temporary and
meant for use with this workshop only
Limited access, free Hansen cluster
accounts are provided upon request –
contact [email protected]
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 2 765-496-6252
DOWNLOADING MATERIALS
After logging into the cluster, the current working directory will be /home/username. Make a new
directory in your scratch space, navigate into that directory, and download the workshop data
pack.
cd $RCAC_SCRATCH // Go to default scratch space
pwd // Display the current directory
< /scratch/hansen/letter/username >
mkdir 2015_RNA-Seq_Workshop // Create a new directory
cd 2015_RNA-Seq_Workshop // Enter the new directory
cp /scratch/hansen/b/bhide/Data.tar.gz . // Copy the package
The file Data.tar.gz is a compressed package containing all necessary files for the workshop.
Unpack and expand the package.
tar –zxvf Data.tar.gz // Decompress and unpack
Now that the files have been downloaded and expanded, enter the same directory as the data.
cd Data // Enter the data directory
Another method of moving/obtaining data is by downloading weblinks through UNIX. Use the
following command to download a copy of this guide.
wget http://web.ics.purdue.edu/~bhide/RNA-Seq2015_Guide.pdf //Download
STEP 1: PREPARING THE DATA
The raw data obtained from a sequencing center will typically be minimally processed and in the
.fastq format. This format preserves the most sequencing information as possible, including
quality scores for each sequenced base. A common .fastq example is as follows:
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 3 765-496-6252
cd Reads
head –n 12 t21rep1_1.fastq // View top few lines of fastq file
@HWI-ST1234:45:C1CELACXX:7:1101:2728:2165/1 1:N:0:GTCCGC //Line 1
CTGGACCAAACACAAACGGTTCCCAGTTTTTTATCTGCACTGCCAAGACTGAATGGCT//Line 2
+ // Line 3
<+1BDBDDD;DBDEE>311+<ADE9EDBEEDI<B?BDDEDI;?BDEDBDB3=@)8=@@// Line 4
Line 1 contains the sequence identifier, which is unique for each read
Line 2 is DNA sequence
Line 3 is usually unused and either has “+” or a repeat of the sequence ID
Line 4 is the Phred quality score in ASCII format, which is often specially formated
depending on the sequencing platform
The first step for any Next Generation Sequencing (NGS) analysis upon receiving data is to
visualize that data before proceeding.
GETTING WORKING SPACE READY
To begin, copy one of the replicates, t21rep1, and the appropriate submission file to the
“Working_space” directory.
cp STEP_1a_Reads_stats.sub Working_space // Copy the sub file
cd Reads // Enter the Reads directory
ls –la // See the available reads files
cp t21rep1_1.fastq ../Working_space // Move the R1 reads
cp t21rep1_2.fastq ../Working_space // Move the R2 reads
pwd // To check whether current directory is Reads
cd ../Working_space // Move into Working_space
ls –la // View directory’s contents
Start by getting a sense of the data metrics - use the following commands to explore the reads.
wc –l t21rep1_* // Count the number of lines in the read files
head –n 12 t21rep1_* // View the first 3 reads of R1 and R2
sed –n ‘2p’ t21rep1_1.fastq | wc –m // Finds the read length
// There are 50 bases, but this command also counts the newline
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 4 765-496-6252
CREATING COMPUTING JOBS
Next, use existing software to get quality statistics about the read files. When using
supercomputing clusters, computing tasks are bundled and made into “job” scripts. A central
scheduling program receives the job scripts from anyone with cluster access and runs them when
resources are available. These job scripts are simple text files with a few header lines to specify
cluster resources and the desired UNIX commands to be executed.
All job submission files needed to complete this analysis have already been written and are
labelled STEP_1 through STEP_4. Open STEP_1a and observe how submission files are
formatted.
vi STEP_1a_Reads_stats.sub // Open the job script using ‘vim’
This command will open STEP_1a_Reads_stats.sub for editing. If the file didn’t
already exist, the file will be created and then opened as blank text.
Vim is a powerful text editor with lots of power-user features. Note that mouse input is generally
not supported and the cursor is moved using the arrow keys.
Notice the header lines in the submission file. These lines are preceded by #PBS and pass
arguments to the scheduler.
#PBS –l walltime=4:00:00 // How much time to reserve
#PBS –q bioinf-c // Which queue (subscription) to use
#PBS –l nodes=1:ppn=1 // How many processing cores are needed
*** We have provided access to bioinf-c queue on hansen temporarily for the workshop. For
running your jobs later, you can either use standby queue (for jobs less than 4 hrs) or other
queues on clusters you have access to.
The next line tells the shell where to go after the job starts running. By default all shells start at the
home directory, /home/username. However, usually the files being analyzed will be in the same
directory as the submission file, so the shell needs to change its working directory. The variable
$PBS_O_WORKDIR will always point to the directory from which the job was submitted.
cd $PBS_O_WORKDIR // Go to the job’s working directory
The next several lines specify the software packages that should be available for use during the
job’s computation. Unlike Windows or OSX in which all software is ready to use after installation,
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 5 765-496-6252
computing clusters require users to manually specify which software packages (called modules) to
load.
module load bioinfo // Access these modules
module load fastqc // Load the fastqc module
module load fastx // Load the fastx module
More commands related to modules
module avail // Shows all available modules for use
module list // Shows all currently loaded modules
SUBMITTING FIRST JOB – READ STATISTICS
The first job to be submitted will use fastqc to determine read quality statistics information about
the read files has many useful tools, but this step is used for determining base quality statistics and
nucleotide distribution metrics. As with all bioinformatics packages, check the software’s website
for more usage documentation.
fastqc t21rep1_1.fastq
fastqc t21rep1_2.fastq
// Use input reads to determine fastqc
Fastqc for the original files takes longer to run using one core because of memory issue hence we
will use fastx to access quality of the sequences for this workshop.
fastx_quality_stats –Q33 –i t21rep1_1.fastq –o t21rep1_1.stats
// Input the file, calculate phred-33 quality stats, make output
fastq_quality_boxplot_graph.sh -i t21rep1_1.stats -o t21rep1_1.jpg
// Input stats, generate a boxplot, output jpeg image
These commands are done twice, once on the R1 reads and once on the R2 reads. Since no quality
trimming or filtering has been done, the resulting quality statistics graphs will provide a look into
the raw data. To exit the document and submit the job for processing on the super-computer
cluster, use the following commands.
Esc // Exit any mode, such as input mode, in vim
:q! // Quit without saving any changes
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 6 765-496-6252
ls –la // View the working directory’s contents
qsub STEP_1a_Reads_stats.sub // Submit the job to the scheduler
< JOB ID.hansen-adm.rcac.purdue.edu >
The resulting output displays the job identification number as well as the cluster that was used for
submission. There are several commands to determine the current status of running jobs, cluster
computer resources, and disk storage space.
qlist // Displays available queue resources
myquota // Displays available storage space
qstat –a –u username // Displays info on currently running jobs
Job ID: The unique numerical identifier given to each submitted job
Username: The owner of the job
Queue: The cluster resource queue being used
Jobname: The name of the submission file
SessID: Assigned after the job starts running by the scheduler
NDS: How many compute nodes are being utilized
TSK: How many total processing cores are being utilized
Req’d Memory: How much memory was reserved for this job
Req’d Time: How much walltime was reserved for this job
S: State of the job, can be:
Q = queued
R = running
C = complete
E = exit
Elap Time: How long the job has been in “Running” status
The best resource to learn more about how to interact with the community clusters can be found in
the RCAC user manuals.
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 7 765-496-6252
A final important note is that finished jobs create two files, an error and an output file. Once these
files are found in the working directory, the job must have been completed or exited due to an
error. Check the *.sub.e* file for error messages, and the *.sub.o* file for any output that
wasn’t saved in a different location.
ASSESSING FIRST JOB COMPLETION
After the first job is complete, the error and output files should be viewed to identify any errors or
concerns.
cat STEP_1a_Reads_stats.sub.eXXXXXXXX // View entire error file
cat STEP_1a_Reads_stats.sub.oXXXXXXXX // View entire output file
Since the commands in Step_1a were meant to generate boxplots and graphs to assess quality of
sequences, check to make sure FastQC results (.html) file exist in the working directory. The
UNIX shell currently being used cannot display images directly. We would transfer FastQC
results file (.html) using SecureFX to your Windows desktop to visualize results file (.html) file
for the workshop.
Other programs are also available called X server for Windows (Xming) which can be installed on
your computer and can be used to transfer images and GUI to user through SSH and visualize
results on Unix/Linux terminal.
TRIMMING THE READS
The reads are ready for trimming now that initial read quality was assessed. Copy the next step to
the working directory, view the working directory’s contents, and explore Step_1b.
cp ../STEP_1b_Reads_trim.sub . // Copy the file to this directory
ls –la // View contents of the working directory
vi STEP_1b_Reads_trim.sub // View the next submission file
Notice that the header information is identical to the previous submission file. This header
information can be reused for similar jobs while just changing the commands. Here a trimming
command is being used instead of the graphical commands of Step_1a.
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 8 765-496-6252
fastq_quality_trimmer –Q33 –t 30 –l 40 –i t21rep1_1.fastq –o
t21rep1_1_trimmed.fastq
// -t is the quality threshold, lower quality bases are trimmed
// -l is the minimum length post-trimming sequence to keep
// Similar command for t21rep1_2.fastq file in job script
Exit the Step_1b submission file and submit the job. Trimming is more computationally intensive
than processing the read statistics, so the job may take a few minutes more than Step_1a. Use the
following commands to submit the job.
Esc // Exit any mode, such as input mode, in vim
:q! // Quit without saving any changes
qsub STEP_1b_Reads_trim.sub // Submit the job to the scheduler
Compare the reads before and after the quality trimming and filtering.
wc -l t21rep1_1*.fastq // Shows line counts before and after
cat STEP_1b_Reads_trim.sub.oXXXXXXXX // View fastx metrics
ASSESSING THE TRIMMED READS
Now that the reads have been trimmed and filtered by length, final observations can be made
before moving on to mapping and the rest of the downstream processes. Copy the final segment of
the trimming stage, Step_1c, to the current working directory, view the submission file’s contents,
and submit the job. Notice that this job regenerates the statistics and images previously made with
fastqc, as well as utilizes another read statistics package called FastQC.
cp ../STEP_1c_Post_trim_stats.sub . // Get the job script
vi STEP_1c_Post_trim_stats.sub // Browse the job script
fastqc t21rep1_1_trimmed.fastq
// Use trimmed input reads to determine numerous metrics
qsub STEP_1c_Post_trim_stats.sub // Submit the job
After job completion, we will again transfer fastqc output file (.html) to the Windows using
SecureFX and explore FastQC’s output before and after trimming.
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 9 765-496-6252
STEP 2: MAPPING THE READS
At this stage in the analysis, all of the reads have been preprocessed and are ready to be aligned to
the Mouse reference genome. Such mapping is useful because it describes the genomic location of
each read, from which gene-specific data can be extrapolated (counts, etc).
BUILDING AN INDEXED REFERENCE
The first step when mapping reads is to prepare the genome reference for use. The short read
aligner Tophat requires a multi-fasta reference to be indexed before mapping. Copy Step_2a to the
working directory along with the required fasta file in the reference directory.
cp ../STEP_2a_Index_ref_genome.sub . // Get the script
cp ../References/Mus_chr19.fa . // Copy reference to working
directory
View the job file and notice some differences as compared with Step_1 jobs.
module load bowtie2 // Load Bowtie2 for indexing the ref
bowtie2-build Mus_chr19.fa Mus_chr19 // Create the Mus_chr19
index
qsub STEP_2a_Index_ref_genome.sub //Submit the job
Tophat uses Bowtie2 as its short-read aligner and so, index of reference sequence(s) is also done
using Bowtie2. Indexing a reference creates six additional files:
Mus_chr19.1.bt2
Mus_chr19.2.bt2
Mus_chr19.3.bt2
Mus_chr19.4.bt2
Mus_chr19.rev.1.bt2
Mus_chr19.rev.2.bt2
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 10 765-496-6252
MAPPING TO THE REFERENCE
The final mapping step is to align the reads to the indexed genome. This is often the most time
consuming step in an RNA-Seq analysis, but can be greatly expedited by using additional
processing cores. Computational time increases with genome size and number of reads. For this
workshop, we are using a limited number of reads and mapping only to Mouse chromosome 19 to
ensure timely completion.
Copy the Step_2b submission file to the working directory, observe its contents, and submit the
job. After several minutes, the job will finish and produce several new files.
cp ../STEP_2b_Map_ref.sub . // Get the job script
qsub STEP_2b_Map_ref.sub // Submit the job
vi STEP_2b_Map_ref.sub // Look through job script for some
additional commands
If we add few lines in beginning and end of any of job scripts, it will print the start time (display
time when job started) and end time (display time when job finished) and calculates total time
taken for job to complete. Such commands might be useful to know total time required to run job,
especially if you are running time consuming jobs like mapping reads to reference genome,
genome assembly etc.
starts=$(date +"%s") # %s saves time in seconds and
current date which is saved in starts variable
start=$(date +"%r, %m-%d-%Y") #%r 12-hour time, %m - month, %d
day of month and %Y - year.
ends=$(date +"%s")
end=$(date +"%r, %m-%d-%Y")
diff=$(($ends-$starts))
#diff variable saves difference between starts and ends values
hours=$(($diff / 3600)) #hours variable
dif=$(($diff % 3600)) #dif variable
minutes=$(($dif / 60)) #minutes variable
seconds=$(($dif % 60)) #seconds variable
cat STEP_2b_Map_ref.sub.eXXXXXX // View run messages
cd tophat_out // This is the standard output directory for
tophat
mv accepted_hits.bam t21rep1.bam // Rename the mapping file
mv t21rep1.bam ../ // Relocate the mapping file
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 11 765-496-6252
A good way to view mapping statistics from tophat runs is to check the mapping logs. From
within the \tophat_out directory, navigate to the logs sub-directory and browse metrics for the R1
(left) and R2 (right) reads.
cd logs // Enter the logs sub-directory
ls –la // See all of the various log files created
cat bowtie.left_kept_reads.log // Check the R1 mapping metrics
cat bowtie.right_kept_reads.log // Check the R2 mapping metrics
Example metrics:
754050 reads; of these:
754050 (100.00%) were unpaired; of these: o 215516 (28.58%) aligned 0 times
o 486843 (64.56%) aligned exactly 1 time
o 51691 (6.86%) aligned >1 times
71.42% overall alignment rate
cd ../ // Go back to the ‘tophat_out’ directory
// Look for ‘align_summary.txt’ to get an idea of alignment
statistics of paired reads
cd ../ // Go back to the ‘Working_space’ directory
STEP 3: USING CUFFLINKS TO IDENTIFY DGE
Cufflinks is a popular software package that uses Tophat output to assemble transcripts and
estimate transcript abundance. Cufflinks can be used to find de novo transcripts or read in known
transcripts from a reference .gtf file. Copy the Step_3a submission file into the working directory,
browse the job script, and submit.
cp ../References/Mus_chr19.gtf . // Get reference gtf file
cp ../STEP_3a_Cufflinks.sub . // Get the job script
cufflinks -G Mus_chr19.gtf t21rep1.bam
// View command in job script -G mode uses known genes only
qsub STEP_3a_Cufflinks.sub // Submit the job
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 12 765-496-6252
After the job is complete, check the error and output files to be sure there were no problems. The
file of interest that was created by this step is called transcripts.gtf.
cat STEP_3a_Cufflinks.sub.* // View both error and output at once
head –n 20 transcripts.gtf // See the cufflinks output
mv transcripts.gtf t21rep1.gtf // Rename the output as the
sample ID
Every step in the NGS analysis process needs to be done on all 6 replicates to create 6 different
cufflinks output .gtf files. Through this guide, a single replicate, t21rep1, has been completed. To
save time, copy the previously finished output for the remaining 5 sample into the working
directory.
cp ../Completed_files/STEP_3_supplementary_files/* .
// Copy .gtf files to ‘Working_space’ directory
MERGING CUFFLINKS OUTPUT WITH CUFFMERGE
The next step of the cufflinks pipeline is to use cuffmerge to combine annotation files. This is
necessary for comparing transcripts between samples. Copy Step_3b to the working directory, but
wait to submit, as some preparation is necessary. See the submission file:
cp ../STEP_3b_Cuffmerge.sub . // Get the job script
cuffmerge -g Mus_chr19.gtf assembly_list.txt
< assembly_list.txt is a text file that needs to be made >
ls | grep -Po "t.+rep..gtf" > assembly_list.txt
cat assembly_list.txt // See the necessary formatting of this file
// This file tells cuffmerge which .gtfs to use for analysis
Now that the assembly_list.txt file has been created, submit the job and browse the resulting files.
qsub STEP_3b_Cuffmerge.sub // Submit the job
ls –lta // List directory contents in order of creation
cd merged_asm // Enter the cuffmerge directory
head –n 15 merged.gtf // Browse the combined .gtf file
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 13 765-496-6252
mv merged.gtf ../ // Move merged.gtf into the working
directory
cd ../ // Return to the working directory
QUANTIFYING GENE/TRANSCRIPT EXPRESSION USING CUFFQUANT
Cuffquant computes gene and transcript expression profiles and saves these profiles such that it
can be analyzed in a timely manner by Cuffdiff (last step to determine DGE). Cuffquant reduces
the computational load of quantifying gene and transcript expression especially if there are more
than a handful of libraries. Cuffquant is able to take the .bam mapping files made from each of the
6 samples along with the merged.gtf file and generate .cxb (compressed binary file). Copy the
Step_3c submission file to the working directory.
cp ../STEP_3c_Cuffquant.sub . // Get the job script
cuffquant -o ./t21rep1_cfquant merged.gtf t21rep1.bam
// View the cuffquant command in job script
qsub STEP_3c_Cuffquant.sub // Submit the job
After cuffquant job is finished, let us check the output files generated in t21rep1_cfquant folder.
cd t21rep1_cfquant // Enter cuffquant output directory
mv abundances.cxb ../t21rep1.cxb
// Rename .cxb file and move to ‘Working_space’ directory
IDENTIFYING DGE USING CUFFDIFF
Cuffdiff is the last step of the three part cufflinks/cuffmerge/cuffdiff pipeline for determining
DGE. Cuffdiff is able to take the .cxb files made from each of the 6 samples using cuffquant along
with the merged.gtf file to locate and statistically compare genes. Copy the Step_3d submission
file to the working directory, as well as the mapping files for the other 5 samples.
cp ../STEP_3d_Cuffdiff.sub . // Get the job script
cp ../Completed_files/STEP_3_complete/cuffquant/t21rep2.cxb .
cp ../Completed_files/STEP_3_complete/cuffquant/t21rep3.cxb .
cp ../Completed_files/STEP_3_complete/cuffquant/t7rep*.cxb .
< View the cuffdiff command in the job script >
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 14 765-496-6252
cuffdiff -v merged.gtf -L t7,t21 t7rep1.cxb,t7rep2.cxb,t7rep3.cxb
t21rep1.cxb,t21rep2.cxb,t21rep3.cxb
// -v specifies the cuffmerge output file
// -L gives text labels to the treatments being compared
// The final list of .cxb files generated by Cuffquant:
// Within a treatment, replicates are separated by commas
// Treatment groups are separated by a space
To stay organized, make a new directory for running cuffdiff and place all necessary files inside
and run the job script.
mkdir cuffdiff_analysis // Create the directory
mv merged.gtf cuffdiff_analysis // Move the annotation file
mv *.cxb cuffdiff_analysis // Move all mapping files
mv STEP_3d_Cuffdiff.sub cuffdiff_analysis
// Move the submission file
Enter the directory and submit the job.
cd cuffdiff_analysis // Enter the cuffdiff directory
qsub STEP_3d_Cuffdiff.sub // Submit the job
UNDERSTANDING THE CUFFDIFF OUTPUT
Cuffdiff creates numerous files containing information regarding alternative splice junctions,
novel transcripts, etc. The file containing DGE information pertaining to known transcripts is
called gene_exp.diff. Browse this file to examine the RNA-Seq analysis results using the
following table.
Column Column name Example Description
1-2 Tested id / gene id
XLOC_000001 A unique identifier describing the transcipt, gene, primary transcript, or CDS being tested
3 gene Lypla1 The gene_name(s) or gene_id(s) being tested
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 15 765-496-6252
4 locus chr1:4797771-4835363
Genomic coordinates for easy browsing to the genes or transcripts being tested.
5 sample 1 Liver Label (or number if no labels provided) of the first sample being tested
6 sample 2 Brain Label (or number if no labels provided) of the second sample being tested
7 Test status NOTEST Can be one of OK (test successful), NOTEST (not enough alignments for testing), LOWDATA (too complex or shallowly sequenced), HIDATA (too many fragments in locus), or FAIL, when an ill-conditioned covariance matrix or other numerical exception prevents testing.
8 FPKMx 8.01089 FPKM of the gene in sample x
9 FPKMy 8.551545 FPKM of the gene in sample y
10 log2(y/x) 0.06531 The (base 2) log of the fold change y/x
11 test stat 0.860902 The value of the test statistic used to compute significance of the observed change in FPKM
12 p value 0.389292 The uncorrected p-value of the test statistic
13 q value 0.985216 The FDR-adjusted p-value of the test statistic
14 significant no Can be either "yes" or "no", depending on whether p is greater then the FDR after Benjamini-Hochberg correction for multiple-testing
STEP 4: MAKING THE COUNTS MATRIX
The previous mapping step resulted in a file, t21rep1.bam, which contains positions for aligning
each read onto the genome. Another reference file, Mus_chr19.gtf, contains positions defining
where each gene is located in the genome. By intersecting these two files it is possible to
determine which reads are mapping to particular genes. The number of reads mapping to a certain
gene are scored as ‘counts’ and used for downstream differential gene expression (DGE) analysis.
Annotation files (.gtf/.gff/.gff3) are tab-delimited text documents with specific formatting to
describe where certain features are located in a reference genome. See the Ensembl explanation of
this file type for more details.
Copy the Step_4 submission file to the working directory. Additionally, the Mouse .gtf file will
need to be copied to the working directory from the /References directory. Browse the job script
and see the commands used to make a counts file. Aggregating counts uses the HTSeq package.
cp ../STEP_4_Make_counts_matrix.sub . // Get the job script
cp ../References/Mus_chr19.gtf . // Get the .gtf file
vi STEP_4_Make_counts_matrix.sub // Open job script to have
a look at it
samtools sort -n t21rep1.bam t21rep1_sorted
// Sort the .bam file
samtools view t21rep1_sorted.bam > t21rep1.sam
// Convert to .sam file
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 16 765-496-6252
htseq-count -q -m union -s no -t exon -i gene_id t21rep1.sam
Mus_chr19.gtf > t21rep1.counts
// Follow the HTSeq link for an explanation of all
parameters
qsub STEP_4_Make_counts_matrix.sub // Submit the job
VIEWING THE COUNTS MATRIX
After the HTSeq job finishes there will be a single column of counts representing every gene in
Mouse chromosome 19. Each row is named after the gene ID as found in the Mus_chr19.gtf file,
and will be present even if no counts were found (which is very helpful for comparing between
samples).
head –n 30 t21rep1.counts // Observe the how the counts are
stored
tail –n 10 t21rep1.counts // See why counts were lost
no_feature 160506 // Aligned in non-gene region ambiguous 17416 // Aligned in region with 2 genes too_low_aQual 0 // Quality is too poor not_aligned 0 // No alignment found alignment_not_unique 616529 // Aligned to many places
The purpose of a counts matrix is to see changes across treatments for particular genes. Thus far,
counts were only generated for a single replicate of a single treatment (1 out of 6 different
samples). To generate the full counts matrix, copy the previously completed *.counts files into
the working directory and execute the following commands.
cp ../Completed_files/STEP_4_complete/t21rep2.counts .
// Copy to here
cp ../Completed_files/STEP_4_complete/t21rep3.counts .
// Copy to here
cp ../Completed_files/STEP_4_complete/t7rep*.counts .
// Copy to here
Bioinformatics Core
Jyothi Thimmapuram, Ph.D. [email protected]
Bioinformatics Core Director 17 765-496-6252
< The following commands generate the combined matrix >
echo -e "Genes\tt7r1\tt7r2\tt7r3\tt21r1\tt21r2\tt21r3" >
matrix.part1
paste t7rep*.counts t21rep*.counts > matrix.part2
cut -f 1,2,4,6,8,10,12 matrix.part2 > matrix.part3
cat matrix.part1 matrix.part3 > counts_matrix.txt
< The complete matrix is counts_matrix.txt >
head counts_matrix.txt // View the top of the matrix
wc –l counts_matrix.txt
// Count number of lines in file.971 lines are present
sed ‘967,971d’ < counts_matrix.txt > counts_matrix_final.txt
// Remove last 5 lines of HTSeq statistics information from
the file
Notice the trends between the samples – the counts in the t7 replicates group apart from the t21
replicates. Similarly, certain genes have no expression in any of the replicates. This matrix can
now be processed by a variety of statistical analysis tools for determining DGE, such as the
commonly used R packages edgeR, DESeq2, or limma. Instead of venturing into R for this
workshop, we determined DGE analysis using Cufflinks suite of programs.