Upload
prasath
View
150
Download
11
Tags:
Embed Size (px)
DESCRIPTION
CELL 101124
Citation preview
Volume 143Volume 143
www.cell.comwww.cell.com
Number Number 55
November 24, 2010November 24, 2010
Volume 143
www.cell.com
Number 5
November 24, 2010
Muscle Aging Cues Systemic AgingMuscle Aging Cues Systemic Aging
Reviews: Posttranslational ModifiReviews: Posttranslational Modificationscations
Muscle Aging Cues Systemic Aging
Reviews: Posttranslational Modifications
VVoluolumm
ee 114343 N Nuumm
bberer 5 5 PPaaggees s 653–848
653–848 NNoovveem
bm
ber er 224,4, 22001100
Volum
e 143 Num
ber 5 Pages 653–848 N
ovember 24, 2010
INSERT ADVERT
cell143_5.c1.indd 1cell143_5.c1.indd 1 11/19/2010 11:00:53 AM11/19/2010 11:00:53 AM
B: 218 mm
CLIENT: Santa Cruz Biotechnology, Inc. PROJECT: 2010 ChemCruz Biochemicals Ad VERSION: Size “B” DATE: 04.08.10
PUBLICATION: CELL (MASTER/DIGITAL DOWNLOAD w/MATCH PROOF)
BLEED: 218mm W x 282mm H TRIM: 212mm W x 276mm H LIVE: 200mm W x 264mm H
SAN TA CRUZ B I OT ECH N O LO GY, I N C . SANTA CRUZ
B I O T E C H N O L O G Y
The Power to Question
®
Leading (#1 worldwide) supplier of specialty biochemicals for proteomics research.
ChemCruz™
HEADQUARTERS
TOLL FREE: 800.457.3801 TEL: 831.457.3800FAX: 831.457.3801 E-MAIL: [email protected]
EUROPEAN SUPPORT
TOLL FREE: +00800.4573.8000 PHONE: +49.6221.4503.0 FAX: +49.6221.4503.45 E-MAIL: [email protected]
ASIAN SUPPORT
JAPAN TOLL FREE: (010) 800.40402026 S. KOREA TOLL FREE: 00798.1.1.002.0297 N. CHINA TOLL FREE: 10.800.711.0752 S. CHINA TOLL FREE: 10.800.110.0694 FAX: 831.457.3801 E-MAIL: [email protected]
Products include over 71,300 unique biochemicals sorted alphabetically, by CAS number, by formula and on the basis of functional activity.
See our web site for product details and ordering information.
www.scbt.com
150 linescreenmp
H2O2 sterilization system acessory, plus BD labware consumables kit. Limited time upgrade offer with purchase of the Sterisonic™ GxP MCO 19AICUVH. ($900 Value)
BD stem cell starter kit with Sterisonic™ GxP quote. No purchase necessary! Act now. Supplies are limited. ($150 Value)
FREE! FREE! !FREE
OFFER[ DETAILS ONLINE ]
!FREEOFFER[ DETAILS ONLINE ]
NEW.
H2O2 sterilization system acessory, plus BD labware consumables kit. Limited time upgrade offer with purchase of the Sterisonic™ GxP MCO 19AICUVH. ($900 Value) FREE! !FREE
OFFER
NEW.
Spot on results.
Intelligent design
inCuSaFe™ copper enriched stainless steel interior
Single-beam, dual capture infrared CO2 sensor
SafeCell UV protection in situ
Hydrogen peroxide vapor sterilization in situ
Good laboratory technique Good laboratory technique Good laboratory technique1
vapor sterilization vapor sterilization vapor sterilization
Good laboratory technique Good laboratory technique Good laboratory technique Good laboratory technique
+
protection protection protection
Hydrogen peroxide Hydrogen peroxide Hydrogen peroxide Hydrogen peroxide +
+
Single-beam, dual capture infrared CO infrared CO infrared CO
SafeCell UV SafeCell UV SafeCell UV SafeCell UV SafeCell UV SafeCell UV +
+
inCuSaFe inCuSaFe inCuSaFe stainless steel interior stainless steel interior stainless steel interior
Single-beam, dual capture Single-beam, dual capture Single-beam, dual capture Single-beam, dual capture Single-beam, dual capture Single-beam, dual capture +
+
©2009 Sanyo Biomedical OWS 1015 05/09
Spot on results.The industry’s fi rst in situ H2O2 sterilization with the fastest turnaround.
For maximum productivity in clinical, general purpose or the most highly compliant GMP applications, the new SANYO Sterisonic™ GxP CO2 incubator offers an impressive return on investment. With multiple contamination control safeguards, exclusive on-board H2O2 sterilization, FDA-21CFR data capture and graphical LCD display, the Sterisonic™ GxP rewards good laboratory technique with performance you can trust. Learn more, visit www.sterisonic.com or call 800-858-8442.
pictured above: Sterisonic™ GxP MCO-19AICUVH with rapid H2O2 vapor sterilization system.
www.sterisonic.com
The rapid in situ H2O2 sequence returns the fully sterilized Sterisonic™ GxP to normal use quicker
than any competitive incubator in the world.
Sterisonic™ GxP Performance and Productivity Delivers Best Effi ciency Value:
2 Hours 14 Hours
SANYOSterisonic™
Brand X
H2O2 sterilization vs. high heat sterilization = Uptime (Hours) = Downtime (Hours)
years of leadership in human genetics research,
education and service.
1948–2008www.ashg.org
60
Do A 180
Turn to a world of true CO2 incubator sterilization.
Binder CO2 incubators offer:
4�A 180°C hot-air sterilization cycle that eliminates contamination.
4�� A hot-air jacket that delivers consistent, uniform temperatures.
4�� Drift-free real-time CO2 measurement that ensures stable pH values.
4�� Condensation-free humidification that maintains dry interior walls.
4�� A one-piece weld-free interior with rounded corners and integrated shelf supports.
Get directions at www.true-sterilization.com or 866-885-9794.
BINDER Inc. | Toll Free 866 885 [email protected] | www.binder-world.us
Binder_Cell Press_Full Pg.indd 1 10/15/10 2:48 PM
Roche Diagnostics GmbHRoche Applied Science82372 Penzberg, Germany
Real-Time Cell Analysis in a Whole New Light
For more information please visit: www.xcelligence.roche.com
xCELLigence System: E-Plate VIEW 96
Figure 1: Combine impedance-based, real-time monitoring with microscopic optical detection. Cell proliferation and cell death were continuously monitored using the xCELLigence System. The optimal time point for visual inspection was determined and images were taken 24 hours after compound treatment using a Z16 Apo Microscope with light base (Leica Micro systems).
PaclitaxelControl
1.7
1.5
1.3
1.1
0.9
0.7
0.5
0.3
0.1
-0.1
Time [h]
Nor
mal
ized
Cel
l Ind
ex
0 11 22 33 44 55 66 77
For life science research only. Not for use in diagnostic procedures.XCELLIGENCE is a trademark of Roche.
E-PLATE and ACEA BIOSCIENCES are registered trademarks
of ACEA Biosciences, Inc. in the US.
© 2010 Roche Diagnostics GmbH. All rights reserved.
Combine real-time impedance-based monitoring of cell behavior with visual inspection in a single 96-well plate. The new E-Plate VIEW 96 for xCELLigence RTCA SP and MP Instruments is an upgraded device that features both measuring electrodes and a clear inspection window on the well bottoms, enabling you to get the most out of your cell analysis experiments.
Monitor cell activity continuously in real-time ��Observe measured changes using microscopes and the Cellavista System, or other automated ��cell-imaging systems
Precisely identify the best time points for further experiments (see Figure 1)��
Editor
Emilie Marcus
Senior Deputy Editor
Elena Porro
Deputy Editors
Robert Kruger
Connie M. Lee
Scientific Editors
Karen Carniol
Michaeleen Doucleff
Fabiola Rivas
Niki Scaplehorn
Lara Szewczak
Senior Managing Editor
Meredith Adinolfi
Deputy Managing Editor
Andy Smith
Lead Illustrator
Andrew A. Tang
Illustrators
Yvonne Blanco
Kate Mahan
Production Staff
Reyna Clancy
Editorial Assistant
Mary Beth O’Leary
Editorial Board
Abul Abbas
C. David Allis
Genevieve Almouzni
Uri Alon
Angelika Amon
Johan Auwerx
Richard Axel
Cori Bargmann
Konrad Basler
Bonnie Bassler
David Baulcombe
Jeffrey Benovic
Carolyn Bertozzi
Wendy Bickmore
Elizabeth Blackburn
Joan Brugge
Lewis Cantley
Joanne Chory
David Clapham
Andrew Clark
Hans Clevers
Stephen Cohen
Pascale Cossart
Jeff Dangl
Ted Dawson
Pier Paolo di Fiore
Marileen Dogterom
Julian Downward
Bruce Edgar
Steve Elledge
Anne Ephrussi
Ronald Evans
Witold Filipowicz
Marco Foiani
Elaine Fuchs
Yukiko Goda
Stephen Goff
Joe Goldstein
Douglas Green
Leonard Guarente
Taekjip Ha
Daniel Haber
Ulrike Heberlein
Nobutaka Hirokawa
Mark Hochstrasser
Arthur Horwich
Tony Hunter
James Hurley
Richard Hynes
Thomas Jessell
Narry Kim
Mary-Claire King
David Kingsley
Frank Kirchhoff
Richard Kolodner
John Kuriyan
Robert Lamb
Mark Lemmon
Beth Levine
Wendell Lim
Jennifer Lippincott-Schwartz
Dan Littman
Richard Losick
Scott Lowe
Tom Maniatis
Matthias Mann
Kelsey Martin
Joan Massague
Iain Mattaj
Satyajit Mayor
Ruslan Medzhitov
Craig Mello
Tom Misteli
Tim Mitchison
Alex Mogilner
Paul Nurse
Roy Parker
Dana Pe’er
Kathrin Plath
Carol Prives
Klaus Rajewsky
Venki Ramakrishnan
Rama Ranganathan
Anne Ridley
James Roberts
Alexander Rudensky
Helen Saibil
Joshua Sanes
Randy Schekman
Ueli Schibler
Joseph Schlessinger
Hans Scholer
Trina Schroer
Geraldine Seydoux
Kevan Shokat
Pamela Sklar
Nahum Sonenberg
James Spudich
Paul Sternberg
Bruce Stillman
Azim Surani
Keiji Tanaka
Craig Thompson
Robert Tjian
Jurg Tschopp
Ulrich von Andrian
Gerhard Wagner
Detlef Weigel
Alan Weiner
Jonathan Weissman
Matthew Welch
Tian Xu
Shinya Yamanaka
Marino Zerial
Xiaowei Zhuang
Huda Zoghbi
Cell Office
Cell, Cell Press, 600 Technology Square, 5th Floor, Cambridge, Massachusetts 02139
Phone: (+1) 617 661 7057, Fax: (+1) 617 661 7061, E-mail: [email protected]
Online Publication: http://www.cell.com
Cell (ISSN0092-8674) is published biweeklybyCell Press, 600TechnologySquare, 5th Floor,Cambridge, Massachusetts02139.The institutional subscription rate for
2010 is $1,360 (US and Canada) or $1,532 (elsewhere). The individual subscription rate is $202 (US and Canada) or $305 (elsewhere). The individual copy price is $50.
Periodicals postage paid at Boston, Massachusetts and additional mailing offices. Postmaster: send address changes to Elsevier Customer Service Americas,
Cell Press Journals, 11830 Westline Industrial Drive, St. Louis, MO 63146, USA.
The paper used in this publication meets the requirments of ANSI/NISO Z39.48-1992 (Permanence of Paper). Printed by Dartmouth Printing Company, Hanover, NH.
F I N E S U R G I C A L
I N S T R U M E N T S
F O R R E S E A R C H ™
SHIPPING GLOBALLYSINCE 1974
Request a catalog at finescience.com or call 1-800-521-2109.
Naturally beautiful.
XenoWorksTM Microinjection WorkstationSmooth, responsive, precise. Always.
ONE DIGITAL DRIVE, NOVATO, CA. 94949 PHONE: 415.883.0128 | FAX: 415.883.0572
EMAIL: [email protected] | WWW.SUTTER.COM
MicromanipulatorHighly ergonomic inverted joystickOne-touch coarse and fine controlSuperior mechanical stability
Digital MicroinjectorDual channel pneumatic microinjectorHolds, transfers and injects - all from a single remote keypad
Analog MicroinjectorUse with oil, water, or airInterchangeable syringes
Cell Press
President & CEO
Lynne Herndon
Editor in Chief, Vice President of Content Development
Emilie Marcus
Vice President of Marketing and Publishing
Els Bosma
Vice President of Web Development and Operations
Keith Wollman
Director of Marketing
Jonathan Atkinson
Production Manager
Meredith Adinolfi
Press Officer
Cathleen Genova
Display Advertising
Northeast/Mid-Atlantic: Victoria Macomber, ph: 508 928
1255; fax: 508 928 1256; e-mail: [email protected]
Midwest/Southeast/Eastern Canada: Inez Herrero-Redman,
ph: 585 678 4395; fax: 585 678 4722; e-mail: i.herrero@elsevier.
com
Northwest/Southwest/Western Canada: Lori Young, ph: 646
370 6312; fax: 212 462 1915; e-mail: [email protected]
California: Elizabeth Loennborn, ph: 714 655 1877; fax: 214 452
9627; e-mail: [email protected]
UK/Europe: James Kenney, ph: +44 20 7424 4216; fax: +44 18
6585 3136; e-mail: [email protected]
Asia: Wendy Xie, ph: +86 10 8520 8827; e-mail: w.xie@
elsevier.com
Classified Advertising
United States and Canada:
Gordon Sheffield, Key Account Manager, ph: 617 386 2189; fax:
617 397 2805; e-mail: [email protected]
UK, Europe, and Asia:
Sabrina Dodge, Key Account Manager, ph: +44 20 7424 4997;
fax: +44 18 6585 3136; e-mail: [email protected]
ª2010 Elsevier Inc. All rights reserved.
This journal and the individual contributions contained in it are protected
under copyright by Elsevier Inc., and the following terms and conditions
apply to their use:
Photocopying:
Single photocopies of single articles may be made for personal use as al-
lowed by national copyright laws. Permission of the Publisher and payment
of a fee arerequired forall otherphotocopying, including multipleorsystem-
atic copying, copying for advertising or promotional purposes, resale, and
all forms of document delivery. Special rates are available for educational
institutions that wish to make photocopies for nonprofit educational class-
room use. For information on how to seek permission, visit www.elsevier.
com/permissions or call (+44) 1865 843830 (UK) / (+1) 215 239 3804 (US).
Permissions:
For information on how to seek permission, visit www.elsevier.com/
permissions or call (+44) 1865 843830 (UK) / (+1) 215 239 3804 (US).
Derivative Works:
Subscribers may reproduce tables of contents or prepare lists of articles
including summaries for internal circulation within their institutions.
Permission of the Publisher is required for resale or distribution outside
the institution. Permission of the Publisher is required for all other deriv-
ative works, including compilations and translations (please consult
www.elsevier.com/permissions).
Electronic Storage or Usage:
Permission of the Publisher is required to store or use electronically any
material contained in this journal, including any article or part of an article
(please consult www.elsevier.com/permissions). Except as outlined
above, no part of this publication may be reproduced, stored in a retrieval
system, or transmitted in any form or by any means, electronic, mechan-
ical, photocopying, recording, or otherwise, without prior written permis-
sion of the Publisher.
Notice:No responsibility is assumed by the Publisher for any injury and/or dam-
age to persons or property as a matter of products liability, negligence,
or otherwise, or from any use or operation of any methods, products,
instructions, or ideas contained in the material herein. Because of rapid
advances in the medical sciences, in particular, independent verification
of diagnoses and drug dosages should be made. Although all advertis-
ing material is expected to conform to ethical (medical) standards, inclu-
sion in this publication does not constitute a guarantee or endorsement
of the quality or value of such product or of the claims made of it by its
manufacturer.
Reprints:
Article reprints are available through Cell’s reprint service; for informa-
tion, contact Nicholas Pavlow (e-mail: [email protected]; ph: (+1)
212 633 3960).
Subscription Orders and Inquiries:
Mail, fax, or e-mail address changes to Elsevier Customer Service Amer-
icas, allowing 4–6 weeks for processing. Lost or damaged issues will be
replaced, subject to availability, if Cell Press is notified within the claim
period (US and airmail delivery: 3 months from issue date; surface deliv-
ery: 4 months from issue date). Periodical delivery in the US can take up
to 3 weeks. Airmail delivery can take 2–4 weeks.
The price of a single copy of Cell is $50 (excluding special issues).
All orders must be prepaid and in writing. Please include the volume
and issue number, payment (check or credit card, MasterCard, Visa,
or American Express only), and a delivery address. Allow 4–6 weeks
for delivery.
Mailing address: Elsevier Customer Service Americas, Cell Press
Journals, 11830 Westline Industrial Drive, St. Louis, MO 63146,
USA. Toll-free phone within USA/Canada: 866 314 2355; phone for
outside US/Canada: (+1) 314 453 7038; fax: (+1) 314 523 5170; e-mail:
[email protected]; internet: www.cellpress.com or <www.cell.com>.
Funding Body Agreements and Policies:
Elsevier has established agreements and developed policies to allow au-
thors whose articles appear in journals published by Elsevier to comply
with potential manuscript archiving requirements as specified as condi-
tions of their grant awards. To learn more about existing agreements and
policies, visit http://www.cell.com/cellpress/FundingBodyAgreements.
Guide for Authors:
For a full and complete guide for authors, please go to www.cell.com/
authors.
www.neb.com
CLONING & MAPPING DNA AMPLIFICATION& PCR RNA ANALYSIS PROTEIN EXPRESSION
& ANALYSISGENE EXPRESSION
& CELLULAR ANALYSIS
UNDERSTANDING CHANGE
New tools to advance epigenetics researchFor over 35 years, New England Biolabs has been committed to understanding the mechanisms of restriction and
methylation of DNA. This expertise in enzymology has recently led to the development of a suite of validated
products for epigenetics research. These unique solutions to study DNA methylation are designed to address some
of the challenges of the current methods. EpiMark™ validated reagents simplify epigenetics research and expand the
potential for biomarker discovery.
EpiMark™ validated products include:
• Newly discovered methylation-dependent restriction enzymes
• A novel kit for 5-hmC and 5-mC analysis and quantitation
• Methyltransferases
• Histones
• Genomic DNAs
To learn how these products can help you to better understand epigenetic changes, visit neb.com/epigenetics.
Simplify DNA methylation analysis with MspJI
MspJI recognizes methylated and hydroxymethylated DNA and cleaves out 32 bp fragments for downstream sequencing analysis. Overnight digestion of 1 µg of genomic DNA from various sources with or without MspJI is shown. Note: Yeast DNA does not contain methylated DNA, therefore no 32-mer is detected.
Plant Hela (Maize) Yeast – + – + – + MspJI
32 bp
Leading EdgeCell Volume 143 Number 5, November 24, 2010
IN THIS ISSUE
SELECT
657 Cell Cycle
PREVIEWS
665 ER Sheets Get Roughed Up C. Barlowe
667 SIRT3 in Calorie Restriction:Can You Hear Me Now?
C. Sebastian and R. Mostoslavsky
669 ATP Consumption PromotesCancer Metabolism
W.J. Israelsen and M.G. Vander Heiden
ESSAYS
672 Glycomics Hits the Big Time G.W. Hart and R.J. Copeland
677 What Determines the Specificityand Outcomes of Ubiquitin Signaling?
F. Ikeda, N. Crosetto, and I. Dikic
MINIREVIEW
682 Ubiquitin: Same Molecule,Different Degradation Pathways
M.J. Clague and S. Urb�e
PERSPECTIVE
686 Will the Ubiquitin System Furnish asMany Drug Targets as Protein Kinases?
P. Cohen and M. Tcherpakov
REVIEWS
694 Pathogen-Mediated PosttranslationalModifications: A Re-emerging Field
D. Ribet and P. Cossart
703 Modifications of Small RNAsand Their Associated Proteins
Y.-K. Kim, I. Heo, and V.N. Kim
SNAPSHOT
848 The SUMO System S. Creton and S. Jentsch
Orders (toll-free) 1-877-616-2355 | Technical support (toll-free) 1-877-678-8324 [email protected] | Inquiries [email protected] | Environmental Commitment eco.cellsignal.com
www.cellsignal.comfor quality products you can trust...
Antibodies and Related Reagents for Signal Transduction Research
The highest quality antibodies for the study of
DNA Damage from Cell Signaling Technology
Unparalleled product quality, validation, and technical support
:: Innovative products from Cell Signaling Technology offer unsurpassed sensitivity, specificity, reproducibility, and performance.
:: Extensive in-house validation means optimization is not left up to you.
:: Technical support provided by the same scientists who produce and validate the products translates into a thorough, fast, and accurate response.
© 2010 Cell Signaling Technology, Inc.
Cell Signaling Technology® is a tradem
ark of Cell Signaling Technology, Inc. DRAQ5® is a registered tradem
ark of Biostatus Limited. Selected rabbit m
ono-clonal antibodies are produced under license (granting certain rights including those under U.S. Patents No. 5,675,063 and 7,429,487).
TOP IMAGE: To the right, the nuclear pore complex is located in the nuclear double bilayer. To the left, nuclear proteins are interspersed between DNA and nucleosomes in various levels of compact-ness. Red = histone H2A.X; blue = histones H2B, H3, H4; green = p53 (with nearby ATM below); purple = Rb (with a nearby E2F dimer on the right); orange = damage/repair MRN complex, loaded onto a DNA double strand break. Please visit www.cellsignal.com for the complete story.
Confocal IF analysis of HeLa (upper) and HT-29 cells (lower), untreated (left) or UV-treated (right), using Phospho-Histone H2A.X (Ser139) (20E3) Rabbit mAb #9718 (green, upper) or Phospho-p53 (Ser15) (16G8) Mouse mAb #9286 (green, lower). Actin filaments were labeled with DY-554 phalloidin (red).
untreated +UV
HT-2
9He
La
phospho-histone H2A.Xphospho-p53
ArticlesCell Volume 143 Number 5, November 24, 2010
711 The ER UDPase ENTPD5 Promotes ProteinN-Glycosylation, the Warburg Effect,and Proliferation in the PTEN Pathway
M. Fang, Z. Shen, S. Huang, L. Zhao, S. Chen,T.W. Mak, and X. Wang
725 Stepwise Histone Replacement by SWR1Requires Dual Activation with HistoneH2A.Z and Canonical Nucleosome
E. Luk, A. Ranjan, P.C. FitzGerald, G. Mizuguchi,Y. Huang, D. Wei, and C. Wu
737 Sororin Mediates Sister ChromatidCohesion by Antagonizing Wapl
T. Nishiyama, R. Ladurner, J. Schmitz, E. Kreidl,A. Schleiffer, V. Bhaskara, M. Bando, K. Shirahige,A.A. Hyman, K. Mechtler, and J.-M. Peters
750 Nonenzymatic Rapid Controlof GIRK Channel Functionby a G Protein-Coupled Receptor Kinase
A. Raveh, A. Cooper, L. Guy-David, and E. Reuveny
761 Sequence-Dependent Sortingof Recycling Proteins by Actin-StabilizedEndosomal Microdomains
M.A. Puthenveedu, B. Lauffer, P. Temkin, R. Vistein,P. Carlton, K. Thorn, J. Taunton, O.D. Weiner,R.G. Parton, and M. von Zastrow
774 Mechanisms Determining the Morphologyof the Peripheral ER
Y. Shibata, T. Shemesh, W.A. Prinz, A.F. Palazzo,M.M. Kozlov, and T.A. Rapoport
789 Abortive HIV Infection MediatesCD4 T Cell Depletion and Inflammationin Human Lymphoid Tissue
G. Doitsh, M. Cavrois, K.G. Lassen, O. Zepeda,Z. Yang, M.L. Santiago, A.M. Hebbeler,and W.C. Greene
802 Sirt3 Mediates Reduction of OxidativeDamage and Prevention of Age-RelatedHearing Loss under Caloric Restriction
S. Someya, W. Yu, W.C. Hallows, J. Xu,J.M. Vann, C. Leeuwenburgh, M. Tanokura,J.M. Denu, and T.A. Prolla
813 FOXO/4E-BP Signaling in DrosophilaMuscles Regulates Organism-wideProteostasis during Aging
F. Demontis and N. Perrimon
(continued)
to read the latest issue of any Cell Press journal.BE THE FIRST
Register for Cell Press Email Alerts and get the complete table of contents as soon as the issue publishes online — FREE!
Cell Press Email Alerts deliver the news, research, and commentaries featured in eachjournal’s latest issue, including the full title of every article, direct links to the articles, and the complete author list. Plus, to save you time, each research article has a brief summary highlighting its significant findings.
You don’t have to be a subscriber to sign up for Cell Press Email Alerts. While subscribers have instant access to the full text of all articles listed in the Email Alerts, non-subscribers can read the abstracts of all articles as well as the full text of the issue’s Featured Article.
www.cellpress.com
C
M
Y
CM
MY
CY
CMY
K
AD7.pdf 7/24/2008 12:07:29 PM
826 Reelin and Stk25 Have OpposingRoles in Neuronal Polarizationand Dendritic Golgi Deployment
T. Matsuki, R.T. Matthews, J.A. Cooper,M.P. van der Brug, M.R. Cookson, J.A. Hardy,E.C. Olson, and B.W. Howell
RESOURCE
837 A Human Genome Structural VariationSequencing Resource Reveals Insightsinto Mutational Mechanisms
J.M. Kidd, T. Graves, T.L. Newman, R. Fulton,H.S. Hayden, M. Malig, J. Kallicki, R. Kaul,R.K. Wilson, and E.E. Eichler
POSITIONS AVAILABLE
CONFERENCES AND COURSES
On the cover: The progressive decrease of muscle strength in the elderly is one of the first
signs of aging in many organisms. Here, Demontis and Perrimon (pp. 813–825) demonstrate
that FOXO/4E-BP activity in Drosophila muscles is essential for maintaining protein homeo-
stasis and muscle function and is beneficial for systemic aging by extending life span. The
image is a view of old Drosophila flight muscles with highlighted nuclei (white), myofibrils
(blue), protein aggregates (red), and mitochondria (green).
Visit www.semrock.com for a complete list of exclusively hard-coated fi lters.
A Unit of Corporation
We invite you to experience the difference at no risk. All Semrock fi lters have a 30 day, no questions asked return policy. We’ll even help you make the evaluation. Give us a call at 866-736-7625 for details.
Laser-based FluorescenceImaging: What you need to knowLasers are replacing conventional broadband light sources for fl uorescence imaging applications due to desirable laser properties like high brightness, stability, long lifetime, and narrow spectral bandwidth. These features enable higher sensitivity, better image fi delity, and superior axial resolution in a variety of imaging applications using laser-scanning and spinning-disk confocal microscopes and total-internal-refl ection fl uorescence (TIRF) microscopes. The narrow beam divergence, high spatial and temporal coherence, and well-defi ned polarization properties of lasers have enabled new fl uorescence imaging techniques, such as super-resolution.
The use of lasers as fl uorescence light sources imposes new constraints on imaging systems and their components. For example, all optical fi lter wavelengths should be precisely keyed to the important laser lines and the spectra should offer steep transitions from the laser wavelength to fl uorescence transmission. And exceptionally high transmission is critical to maximize system throughput, thus reducing acquisition time.
Excitation fi lters act as “clean-up” fi lters, minimizing noise background resulting from the light away from the laser line, including spontaneous emission observed in solid-state lasers and the plasma lines of gas lasers. They should be hard-coated to withstand the high intensity of the laser beam. Emission fi lters should have deep blocking (optical density > 6) at all possible laser wavelengths to eliminate the intense stray laser light at the detector and very high transmission (> 97%) especially for low-light-level applications like single-molecule imaging. Emitters should also have low autofl uorescence glass and excellent wavefront performance for minimal beam deviation and aberrations.
Dichroic beamsplitters for laser applications must be anti-refl ection (AR) coated to maximize transmission and eliminate coherent interference artifacts. They should also have high optical damage ratings like the exciters and low autofl uorescence glass like the emitters. And it is critical for laser dichroics to exhibit suffi cient fl atness to eliminate axial focal shift and transverse aberrations associated with refl ected laser light.
Download our free white paper on this subject at: www.semrock.com
Advances in thin-fi lm fi lter technology pioneered by Semrock and embodied in all BrightLine® fl uorescence fi lters permit the highest-performance fl uorescence imaging, while resolving the longevity and handling issues that plague older, soft-coating technology.
350 375 5500
10
20
30
40
50
60
70
80
90
100
Tran
smis
sion
(%)
Wavelength (nm)400 425 475 525450 500
Laser BandsEmitterDichroicExciter
405 nm375 nm
Typical Spectra:
Long-pass fi lter set for laser microscopy - LF405/LP-A
Leading Edge
In This Issue
An EnERgy Boost for CancerPAGE 711
Rapidly growing cancer cells increase their rate of aerobic glycolysis in a meta-bolic shift known as the Warburg effect. Their proliferation also demands highprotein folding capacity in the endoplasmic reticulum (ER). Fang et al. identifyan ER-localized enzyme, ENTPD5, that is responsible for both of these featuresof tumor cells. Inhibition of ENTPD5, which is commonly upregulated in humancancers, blocked tumor growth in mice. Thus, ENTPD5 inhibition could poten-tially become an anticancer therapy.
A Nudge and a Kick for Histone ReplacementPAGE 725
Most promoters in eukaryotes are marked with nucleosomes carrying a specialhistone H2A.Z, which is important for gene regulation. SWR1 incorporates
H2A.Z into nucleosomes in a histone replacement reaction. Luk et al. now report a mechanism that ensures that only nucle-osomes containing the canonical histone H2A are targeted for replacement. SWR1’s ATPase activity is sequentially stimu-lated by H2A-containing nucleosomes and free H2A.Z-H2B dimers, leading to eviction of nucleosomal H2A-H2B and depo-sition of H2A.Z-H2B. These stepwise events ensure the specificity of the nucleosome replacement reaction.
Locking Chromosome Cohesion during ReplicationPAGE 737
In eukaryotic cells, sister chromatids remain physically connected from the time of theirsynthesis during DNA replication until their separation during mitosis. Sister chromatidcohesion depends on the stable association of cohesin with DNA. Nishiyama et al.now show that Sororin binds cohesin during replication and stabilizes the cohesin-DNA complex by displacing the cohesin ‘‘unloading’’ protein Wapl. Distant orthologsof Sororin exist in many species, implying that this may be a widespread mechanismfor the maintenance of sister chromatid cohesion.
G Protein Lockdown for ChannelsPAGE 750
G protein-coupled potassium channels need to be turned off quickly, on a timescale faster than that afforded by either ligandclearance or receptor endocytosis. Raveh et al. now show that the GPCR kinase, GRK2, achieves rapid desensitization of theGIRK potassium channel by sequestering the G protein subunits required for GIRK activity. This kinase-independent functionof GRK2 thus allows rapid control of ligand-stimulated channel function.
Actin Cherry Picks Recycling ReceptorsPAGE 761
Signaling receptors recycle efficiently during endocytosis in a manner that differs from bulk membrane recycling. Puthen-veedu et al. use live cell imaging to show that distinct endosomal subdomains mediate active recycling of signaling receptors.The actin cytoskeleton binds in a sequence-dependent manner to the receptors, further concentrating and stabilizing thesedomains for recycling.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 653
R&D Systems, Inc. www.RnDSystems.com
R&D Systems Europe, Ltd. www.RnDSystems.co.uk
R&D Systems China Co., Ltd. www.RnDSystemsChina.com.cn
For research use only. Not for use in diagnostic procedures.
Cancer
Development
Endocrinology
Glycobiology
Immunology
Neuroscience
Proteases
Signal Transduction
Stem Cells
For more information visit our website at www.RnDSystems.com/go/Neuroscience
R&D Systems o� ers a wide range of high quality products for neuroscience research. In addition to high performance antibodies, we o� er the most referenced collection of premium quality proteins and ELISA kits in the industry. Our catalog also includes primary rat and mouse cortical stem cells, and kits for the expansion, di� erentiation, and identi� cation of neural stem cells.
Neuroscience ResearchR&D Systems Products for
R&D Systems Tools for Cell Biology Research™
Performance.Results.
Progress.
Plexin-B2 Notch-2 O4
RGM-B HSPH1
GFAP BSRP-A Vanilloid R1
AD111_CellPress.indd 1 8/31/10 4:53 PM
Shapewear for the ERPAGE 774
The endoplasmic reticulum (ER) consists of the nuclear envelope and an exten-sive peripheral network of tubules and membrane sheets. Shibata et al. demon-strate that ER sheets are formed through stabilization of their highly curvededges by the reticulon/DP1/Yop1 p proteins. The membrane protein Climp63further shapes the sheets, acting as a spacer to regulate their area and luminalwidth.
HIV Pushes the T Cell Self-Destruct ButtonPAGE 789
The depletion of CD4 T cells during HIV infection is a hallmark of AIDS. Doitshet al. show that abortive infection of CD4 T cells elicits cell death. Incompletereverse transcripts of the virus accumulate in these cells and activate suicidalinnate antiviral and inflammatory responses. Thus, T cell death is not triggered
by new virus production but, rather, by a suicide mechanism, which likely evolved to protect the host but in fact contributes toimmunodeficiency.
Hungry but Still HearingPAGE 802
Caloric restriction (CR) extends the life span of many species and slows the progression of age-related hearing loss (AHL).Here, Someya et al. report that mitochondrial Sirt3 mediates the prevention of AHL and reduces oxidative damage incalorie-restricted mice. In response to CR, Sirt3 deacetylates and activates isocitrate dehydrogenase 2, leading to anenhanced glutathione antioxidant defense system in mitochondria. These results suggest that Sirt3-dependent mitochondrialadaptations may be a central mechanism to delay aging in mammals.
Outfoxing AgingPAGE 813
Loss of muscle strength is one of the most obvious changes that we experienceas we age, but how this connects with systemic aging is unclear. Demontis andPerrimon report that accumulation of protein aggregates in aging Drosophilamuscle is reduced by FOXO/4E-BP signaling, delaying muscle senescence.This pathway in muscle prevents overall aging and protein aggregation in othertissues. These results provide a framework to understand the coordination oftissue and organismal aging.
Golgi Decides, Axon or DendritePAGE 826
Neuronal cells polarize to develop an axon at one pole and dendrites at theother. Matsuki et al. identify two signaling pathways that influence Golgimorphogenesis to regulate this polarization. The Stk25 kinase acts throughthe Golgi protein GM130 to promote a condensed Golgi morphology and axon development. The Reelin-Dab1 signalingpathway, previously known to regulate other aspects of nervous system development, antagonizes the Stk25 pathway topromote Golgi extension and dendrite development. Thus, Golgi distribution is a central factor in neuronal development.
Structural Fingerprints of the Human GenomePAGE 837
Genomic structural variation—insertions, duplications, and deletions—are important contributors to human disease andgenetic diversity. The precise molecular characteristics of these variants have been difficult to ascertain by standard high-throughput genome sequencing. Kidd et al. now report a resource of fosmid clones obtained from the genomes of 17 indi-viduals. The authors characterize the breakpoints of more than a thousand structural variants, allowing inference of the molec-ular pathways that generated them and offering an in-depth view of the characteristics of human genomic variation.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 655
Biopotential.Unlock extraordinary potential with stem cell technologies from Sigma®.
Stem cell biology offers astonishing research potential; Sigma® Life Science has the innovations you need to discover the promise it holds. Access a world of RNAi with the MISSION® RNAi Library, efficiently edit genes of interest using advanced CompoZr® ZFN technology, and characterize your stem cells with our Prestige Antibodies®, powered by Atlas Antibodies. The applications are endless—and so are the possibilities.
bioreprogramming
wherebiobegins.com/bioreprogramming
Sigma, MISSION, CompoZr and Prestige Antibodies are registered trademarks of Sigma-Aldrich and its affiliate Sigma-Aldrich Biotechnology, L.P.
Biopotential_locklady ad_Cell Press.indd 1 8/5/2010 3:10:38 PM
Leading Edge
Select: Cell Cycle
The phases of the cell cycle must be exquisitely timed and tightly regulated in order to ensure properchromosome replication and segregation and cell division. New findings described in this issue’s Selectaddress key regulatory events in the cell cycle and reveal potential clinical outcomes of errors in theseprocesses.
An Epigenetic License to ReplicateChromosome replication needs to occur once and only once during the cell cycleto produce daughter cells with accurate genetic content. Licensing of replicationorigins is one form of DNA synthesis regulation, in which origins are loaded withpre-replication complex (RC) proteins during the end of M phase and throughoutG1. Without this licensing event, replication origins cannot be activated. Newfindings from Tardat et al. identify the methyltransferase PR-Set7—and thehistone modification that it catalyzes, methylation of histone H4 lysine 20(H4K20me1)—as a key regulator of the onset of licensing in mammalian cells.The authors show that PR-Set7 and H4K20me1 levels are cell cycle regu-lated—both are high during M and G1 phases, dropping in S when synthesisbegins—and that proteasomal degradation of PR-Set7 is needed to preventDNA re-replication. The authors also show that silencing PR-Set7 leads todecreased chromatin loading of pre-RC proteins and reduced origin firing duringS phase, whereas targeting PR-Set7 to nonorigin sites on the chromatin is suffi-cient to induce H4K20me1 and the assembly of pre-RC proteins. Future studies
are needed to investigate how H4K20me1 facilitates chromatin loading of pre-RC proteins.M. Tardat et al. (2010). Nat. Cell Biol. Published online October 17, 2010. 10.1038/ncb2113.
Getting a Toehold on MicrotubulesThe ability of the kinetochore to maintain an attachment between chromo-somes and microtubules is necessary for proper chromosomal segregationduring anaphase. The Ndc80 complex is known to be a key regulatory sitefor microtubule attachment, but, given the highly dynamic process of micro-tubule assembly and disassembly occurring during segregation, it has beena challenge to identify how the Ndc80 complex physically holds on to sucha rapidly changing structure. Alushin et al. address this using cryo-electronmicroscopy to better reveal the metazoan Ndc80 complex bound to micro-tubules. The authors find that the Ndc80 complex binds both a- andb-tubulin monomers and identify a ‘‘toe’’—a short section of the NDC80protein that recognizes a site between two tubulin monomers, a hinge pointfor tubulin bending. The toe appears to prefer binding straight tubulin, sug-gesting that it could act as a sensor for tubulin conformation. At the sametime, the N terminus of NDC80 allows high-affinity microtubule binding andappears to mediate self-assembly of Ndc80 complexes in a manner that ismodulated via phosphorylation by Aurora B kinase. The authors proposea model in which phosphorylated Ndc80 complexes bind a microtubuleand spindle forces then pull the bound complex out of the Aurora B kinasephosphorylation zone. The resulting dephosphorylation of NDC80 results inhigh-affinity clusters forming in linear arrays along the microtubule. Thiscluster arrangement is consistent with a biased diffusion model of kineto-chore attachment and movement. On a shrinking microtubule, the Ndc80-microtubule interaction would be reduced due to conformational changesin tubulin at the disassembling or depolymerizing end, and the cluster would diffuse along the microtubules towardthe pole, thereby moving the chromosome in that direction.G.M. Alushin et al. (2010). Nature 467, 805–810.
Re-replicating G2 cells (cyclin B1, red;
EdU, green). Image courtesy of E. Julien.
Two Ndc80 molecules (blue and yellow;
N terminus, magenta) binding tubulin
(green; C terminus, red). Image courtesy of
E. Nogales.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 657
Announcing an innovative new textbook from Academic Cell Primer to The Immune Response, Academic Cell Update Edition
By Tak W. Mak and Mary Saunders
Facebook.com/academiccell Twitter.com/academiccell
Primer to The Immune ResponseAcademic Cell Update Edition
Tak W. MakThe Campbell Family Institute for Breast Cancer Research, Ontario, Canada
Mary SaundersThe Campbell Family Institute for Breast Cancer Research, Ontario, Canada
Paperback/456 pagesISBN: 9780123847430$79.95/£54.99/€64.95
Primer to The Immune Response, Academic Cell UpdateEdition, is an invaluable resource for students whoneed a concise but complete and understandableintroduction to immunology.
Academic Cell textbooks contain premium journal content from Cell Press and are part of a new cutting-edge textbook/journal collaboration designed to help today’s instructors teach students to “think like a scientist.”
academiccell.com
Academic Cell is a dynamic textbook publishing partnership between Academic Press and Cell Press, two market-leading publishers bringing scientific advances from the world of life science research into the classroom.
Order online now from: elsevierdirect.com/9780123847430Request and examination copy from textbooks.elsevier.com
Mounting Tension in Lead-Up to Fateful DecisionAsymmetric cell division, which generates daughter cells with different developmental fates, is often achieved throughasymmetric positioning of the mitotic spindle. However, some dividing cells start out with a centered spindle thatbecomes displaced during anaphase. This progressive asymmetry has been postulated to arise from greater elonga-tion of microtubules on one side of the spindle. New findings from Ou et al. suggest that nonmuscle myosin II might alsoplay a role. The authors show that in the QR.a neuroblast of Caenorhabditis elegans, myosin II becomes asymmetricallydistributed during anaphase, concentrating at the anterior side of the cleavage furrow. Consequently, the anteriormembrane becomes less dynamic and shrinks inward, whereas the posterior membrane expands like a balloon, sug-gesting that cortical tension and contractile forces driven by myosin II could be a factor in developing asymmetry. Theauthors also used CALI (chromophore-assisted laser inactivation) to specifically inactivate myosin II at the anteriormembrane and find that this increases the size of the anterior daughter cell and can alter its fate from apoptosis todifferentiation into a neuron-like cell. Future work is needed to better understand the respective contributions of micro-tubule elongation, myosin polarization, and perhaps other unknown mechanisms to the regulation of asymmetric divi-sion and cell fate.G. Ou et al. (2010). Science. Published online September 30, 2010. 10.1126/science.1196112.
Spindle Position, a Neuronal Mover and MakerHuman microcephaly is a neurodevelopmental disorder characterized by a small brain,fewer surface ridges, and reduced cortical neuron numbers. Two recent papers usedlinkage analysis and genome capture in affected families to identify WDR62 asa common cause of genetic microcephaly and characterized the WDR62 protein asa spindle pole protein expressed in mitotic neural precursors. After sequencingaffected individuals to identify specific disease-causing mutations, Nicholas et al. ex-pressed mutant WDR62 in HeLa cells and showed that the normal accumulation of theprotein at the spindle poles during mitosis is disrupted. Given the phenotype ofreduced neuron numbers and small brain seen in microcephaly, one possibility theauthors suggest is that WDR62 could be involved in proper positioning of the mitoticspindle and cleavage furrow, such that mutant WDR62 results in insufficient symmetricdivisions—needed to produce neural precursors—early in cortical development. Inagreement, Yu et al. show that the brain of an affected individual has profound corticaldefects, with thin sparse cortical layers and aberrant repositioning of neurons tosubcortical regions, suggesting deficits in neurogenesis and migration. Further
description of the specific role of WDR62 at the spindle will clarify how it is involved in cerebral development andaid in our understanding of the etiology of microcephaly.A.K. Nicholas et al. (2010). Nat. Genet. Published online October 3, 2010. 10.1038/ng.682.T.W. Yu et al. (2010). Nat. Genet. Published online October 3, 2010. 10.1038/ng.683.
Rebecca Alvania
Photograph of human microce-
phalic brain. Image courtesy of
C. Walsh.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 659
Expand your stem cell library and save today on the latest books on stem cells
and regenerative medicine
Cell Stem Cell subscribers save 25% on their book orderSecure ordering online at elsevierdirect.comEnter promo code 28024 at check outPrices and publication dates subject to change without notice.
Stem Cells Scientific Facts and FictionChristine Mummery, Ian Wilmut, Anja Van de Stolpe and Bernard RoelenNovember 2010 | 400 pages | Paperback | $79.95 | €57.95 | £48.99 | ISBN: 9780123815354
Principles of Regenerative Medicine, 2nd EditionAnthony Atala and Robert LanzaNovember 2010 | 1400 pages | Hardback | $199.95 | €143.00 | £125.00 | ISBN: 9780123814227
Heart Development and Regeneration, 2-Volume SetNadia Rosenthal and Richard P. HarveyJune 2010 | 1072 pp. | Hardback | $199.95 | €143.00 | £125.00 | AU$296.00 | ISBN: 9780123813329
Essentials of Stem Cell Biology, 2nd EditionRobert Lanza, Roger Pedersen, John Gearhart, E. Donnall Thomas, Brigid Hogan, James Thomson, Douglas Melton and Sir Ian WilmutJune 2009 | 600 pp. | Hardback | $199.95 | €134.00 | £125.00 | AU$302.00 | ISBN: 9780123747297
Foundations of Regenerative Medicine Clinical and Therapeutic ApplicationsAnthony Atala, Robert Lanza, James Thomson and Robert NeremSeptember 2009 | 750 pp. | Hardback | $99.95 | €66.95 | £60.99|AU$148.00 | ISBN: 9780123750853
Stem Cell Anthology From Stem Cell Biology, Tissue Engineering, Regenerative Medicine, Cloning and Stem Cell MethodsBruce M. CarlsonOctober 2009 | 450 pp. | Hardback | $150.00 | €100.00 | £95.00 |AU$222.00 | ISBN: 9780123756824
Essential Stem Cell Methods A Volume in the Reliable Lab Solutions SeriesRobert Lanza and Irina KlimanskayaApril 2009 | 628 pp. | Paperback | $75.00 | €50.95 | £45.99 |AU$111.00 | ISBN: 9780123750617
Tissue EngineeringClemens van Blitterswijk, Peter Thomsen, Jeffrey Hubbell, Ranieri Cancedda, Anders Lindahl Sahlgrenska,Jerome Sohier and David F. WilliamsMarch 2008 | 760 pp. | Hardback | $115.00 | €76.95 | £69.99 |AU$170.00 | ISBN: 9780123708694
Human Stem Cell Manual A Laboratory GuideJeanne F. Loring, Robin L. Wesselschmidt and Philip H. SchwartzJune 2007 | 488 pp. | Spiral bound | $88.95 | €59.95 | £53.99 |AU$132.00 | ISBN: 9780123704658
Handbook of Stem Cells 2-Volume Set with CD-ROM Vol. 1–2Vol. 1 – Embryonic Stem CellsVol. 2 – Adult & Fetal Stem CellsRobert Lanza, Roger Pedersen, Helen Blau, E. Donnall Thomas, John Gearhart, James Thomson, Brigid Hogan, Catherine Verfaillie, Douglas Melton, Irving Weissman, Malcolm Moore and Michael WestSeptember 2004 | 1,760 pp. | Hardback | $566.00 | €380.00 | £345.00 | AU$817.00 | ISBN: 9780124366435
Germany (Main offi ce): Greiner Bio-One GmbH, [email protected] l Austria: Greiner Bio-One GmbH, offi [email protected]: Greiner Bio-One BVBA/SPRL, [email protected] l Brazil: Greiner Bio-One Brasil, offi [email protected] l China: Greiner Bio-One GmbH, [email protected] France: Greiner Bio-One SAS, [email protected] l Japan: Greiner Bio-One Co. Ltd., [email protected] l Netherlands: Greiner Bio-One B.V., [email protected]: Greiner Bio-One Ltd., [email protected] l USA: Greiner Bio-One North America Inc., [email protected]
Challenging Experiments?Advanced TC™ cell culture vessels from Greiner Bio-One
www.gbo.com/bioscience
Your Power for Health
Innovative polymer modifi cation improves cellular adhesion
Positive effects on cell functionality and performance
Enhanced propagation of fastidious cells
Improved cell expansion under limited growth conditions
Better assay consistency
Long-term stability and storage at room temperature
017.
A1.0
115.
A ©
201
0 E
pp
end
orf A
G
� Joystick provides intuitive control
� Patented axial injection movement of the capillary
� Semi-Automatic microinjection into adherent cells
� Pre-pull capillaries for reproducible injection of adherent cells
CB
A
search level
injection level
carrier
microinjection
InjectManNI 2
www.eppendorf.com • Email: [email protected]
In the U.S.: Eppendorf North America, Inc. 800-645-3050 • In Canada: Eppendorf Canada Ltd. 800-263-8715
Microinjection is one of the core methods to introduce foreign DNA and other non-permeable molecules into cells. Nuclear injection of plasmid DNA enables rapid expression of proteins in specific cells within a population.
The menu-controlled, programmable micromanipulator InjectMan NI 2 is ideally suited for microinjection of adherent cells. Connection with the FemtoJet and the axial mounting allows injections at 45˚ angle reducing cell damage during injection and increases cell viability. This guarantees a very rapid, safe and reproducible microinjection process.
Eppendorf InjectMan NI 2 microinjector has it all:� Motorized X-Y-Z movements provide precise movement� Pre-setting and storage of up to 2 locations in X-Y-Z,
saves time in returning to pre-set work locations� Automated Home function for rapid capillary exchange� Joystick-controlled provides overall ergonomic manipulator� Fine adjustment of work speed made easy with
positioning wheel� Can be adapted to all common microscopes
For more information visit www.eppendorf.com
Microinjection simplified!
experience [ constant contamination control ]
M i c ro b i o l o g i c a l C O 2 I n c u b a to rs
Closed Loop HEPA Filtration
NuAire's closed loop HEPA fi ltration system creates a mini ISO Class 5 cleanroom inside
the growth chamber. Air and gas pass through 99.99% HEPA fi lters to create Class 100 air.
All fi lters are kept out of the growth chamber ensuring a true contaminate free work zone.
The chamber is maintained at positive pressure to prevent potential contaminates from
entering the growth chamber.
Sensitivity and Accuracy of Gas Control
A microprocessor-based, non-dispersive, digital solid-state infrared [IR] CO2 sensor
provides a stable drift-free output requiring less calibrations.
Precision of Electronic Microprocessor Controls
Run by a programmable micro-controller, AutoFlow™ samples input sensors, sets control
outputs, and makes necessary corrections to the chamber environment.
Dual Sterilization Cycles - Self Cleaning System
The DHD AutoFlow™ NU-5510 features dual sterilization cycles to eradicated contamination
in the growth chamber. The chamber heats up to 95°C Humidifi ed or 145°C Dry for a
constant uniform high temperature on chamber walls, brackets, shelves, and water pan.
experience [ constant contamination control ]
2100 Fernbrook Lane | Plymouth, MN 55447 | U.S.A. | 763.553.1270 | WWW.NUAIRE.COM
ASCB booth 622®
Follow, Find, Enjoy:
Leading Edge
Previews
ER Sheets Get Roughed UpCharles Barlowe1,*1Department of Biochemistry, Dartmouth Medical School, Hanover, NH 03755, USA
*Correspondence: [email protected] 10.1016/j.cell.2010.11.011
The molecular machinery that shapes the endoplasmic reticulum’s (ER’s) membrane into orderednetworks of ‘‘smooth’’ tubules and ‘‘rough’’ sheets is poorly defined. Shibata et al. (2010) now reportthat sheet-inducing proteins, such as Climp-63, are enriched in the ‘‘rough’’ ER by their associationwith membrane-bound ribosomes, whereas curvature-inducing proteins localize at highly bentedges of membrane sheets.
The elaborate morphologies of the endo-
plasmic reticulum have fascinated cell
biologists for years. Compartments of the
endoplasmic reticulum (ER) membrane
form the nuclear envelope and then
extend throughout the cell periphery in
an interconnected network of mem-
brane tubules and flattened discs called
cisternae. How do these ordered arrays
of membranes form, and how are their
structures connected to their cellular
function? In this issue of Cell, Shibata
and coworkers define a class of sheet-
inducing membrane proteins that are en-
riched in the ribosome-studded ‘‘rough’’
ER. These proteins cooperate with
membrane curvature-stabilizing factors
to govern the relative level of sheets
and tubules of the ER, providing a molec-
ular basis for the longstanding morpho-
logical descriptions of ‘‘rough’’ and
‘‘smooth’’ ER.
ER morphologies vary greatly across
different species and cell types. For
example, highly active secretory cells,
such as pancreatic exocrine cells and
plasma B cells, are packed full of flattened
cisternae of rough ER. Live cell imaging
also reveals that ER membranes are
highly dynamic networks, undergoing
constant remodeling often in response to
physiological conditions.
Previous studies focusing on the
smooth ER found that tubule formation
depends on a class of integral membrane
proteins belonging to the reticulon and
DP1 families (Voeltz et al., 2006). Reticu-
lon and DP1 proteins are highly enriched
in tubular ER elements, and they contain
transmembrane segments with a double
hairpin structure that induces positive
membrane curvature by inserting like
a wedge into ER membranes (Figure 1).
Indeed, reconstitution of purified reticulon
and DP1 proteins into synthetic lipo-
somes (i.e., artificial vesicles with a lipid
bilayer) was sufficient to generate mem-
brane tubules with a high degree of curva-
ture (Hu et al., 2008). Thus, intrinsic
properties of the reticulon and DP1 pro-
teins are sufficient to induce membrane
tubulation.
However, ER tubules also form
branched, reticular morphologies. Gener-
ation of these net-like structures requires
additional factors, specifically atlastin
GTPases, which drive fusion of ER
tubules into branched networks (Hu
et al., 2009; Orso et al., 2009). Of interest,
atlastin isoforms were detected in associ-
ation with the reticulon proteins, sug-
gesting that the formation of tubules and
branching are coordinated processes
(Hu et al., 2009).
In contrast to our understanding of
ER tubules, the molecular mechanisms
underlying the formation of ER sheets
have been elusive. Now, Shibata et al.
(2010) uncover an unexpected connec-
tion between the sheet-inducing factor
Climp-63 and the reticulon and DP1
proteins. Their discovery begins with
a key observation regarding the translo-
con complex, a large multisubunit chan-
nel that transports, or ‘‘translocates,’’
nascent polypeptides across ER mem-
brane into the interior of the ER.
Shibata and colleagues observe that
components of the translocon complex
are not only highly enriched in ER sheets,
but they also form a specialized subdo-
main within ER membranes. Moreover,
when the authors treat cells with the anti-
biotic puromycin, which disassembles
groups of ribosomes bound to the ER
membranes (i.e., polysomes), proteins
of the translocon complex redistribute
between ER sheets and tubules. This
finding suggests that actively translating
polysomes concentrate translocon com-
plexes into sheet subdomains of the ER.
To identify the structural components
of these ER sheet domains, Shibata and
colleagues then perform a proteomic
analysis of rough ER membranes from
pancreatic secretory cells. Indeed, the
most abundant protein constituents in
ER sheets are components of the translo-
con complex and Climp-63. Moreover,
microarray experiments reveal that
Climp-63 messenger RNA (mRNA) levels
are among the most highly induced
messages during proliferation of ER sheet
structures during the differentiation of
immature B cells into IgG secreting
plasma cells. Climp-63 is an ER trans-
membrane protein that contains an
extended coiled-coil domain in the interior
of the ER (i.e., the ER lumen). Previous
studies suggested that this coiled-coil
domain contributes to ER morphology
by forming a scaffold in the ER lumen
(Klopfenstein et al., 2001).
To test the functional role of Climp-63
in ER sheet formation, Shibata and
colleagues then overexpress Climp-63 in
cultured cells, which causes a dramatic
proliferation of ER sheets. Moreover, the
distance between the sheets is �50 nm,
the standard distance between ER sheets
in mammalian cells (Figure 1). In contrast,
decreasing the expression of Climp-63
does not deplete cells of ER sheets, but
instead, it causes a marked reduction in
the distance between cisternal sheets.
Further, these sheets are spread diffusely
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 665
throughout the cytoplasm,
a similar phenotype as the
authors observe when they
treat cells with puromycin.
Finally, Climp-63 and the
reticulon protein Rtn4 have
opposing effects on ER mor-
phology. Increased expres-
sion of Rtn4 reduces the
number of ER sheets,
whereas co-overexpression
with Climp-63 restores sheet
structures in these cells.
Importantly, reticulon pro-
teins strikingly localize to the
highly curved edges of ER
sheets, and this occurs
when reticulon genes are
expressed at endogenous
levels or when both Climp-63
and reticulon genes were
overexpressed together.
The authors then propose
the most basic mechanism
for sheet formation that is
also consistent with their find-
ings. In this model, reticulons
and DP1 proteins partition
into the edges of sheets, where they
induce a high degree of curvature at the
edges of closely apposed membrane bila-
yers (Figure 1). However, assembling the
ordered array of rough ER membranes in
active secretory cells also depends on
the coiled-coil domain of Climp-63, which
serves as a spacer between the sheets
in the ER lumen (Figure 1). Lastly, the
authors propose that Climp-63, together
with translocon complexes, partition into
sheet domains with membrane-bound
polysomes to generate the rough ER.
This model proposed by Shibata and
colleagues is also supported by previous
studies showing that the coiled-coil
domain of Climp-63 assembles into
a-helical rods that are required to restrict
the lateral mobility of Climp-63 (Klopfen-
stein et al., 2001; Nikonov et al., 2007)
(Figure 1). Moreover, Climp-63 is known
to bind microtubules (Klopfenstein et al.,
1998), suggesting an additional level of
ER organization that is connected to the
cell’s overall structure.
Although reticulon and DP1 proteins
partition into sheet edges in vivo and ex-
pressing Climp-63 drives ER sheet prolif-
eration, it is still unknown whether these
factors are sufficient for sheet formation
or whether other factors contribute to
this process. A minimally reconstituted
liposome system successfully demon-
strated that reticulon and DP1 proteins
drive tubule formation in vitro (Hu et al.,
2008). This system should provide a
powerful tool for determining whether
adding purified Climp-63 is sufficient
for sheet formation. Furthermore, varying
the ratio of curvature- and sheet- inducing
proteins in liposomes of defined lipid
compositions could provide insights into
the role that specific lipids play in gener-
ating observed ER morphology.
Finally, sheets and tubules
are not the only morphologies
of ER membranes. For
example, specialized struc-
tural domains of the ER are
involved in metabolism of
hydrophobic compounds,
formation of ER-mitochon-
drial junctions, transport of
Ca2+, formation of lipid drop-
lets, and protein export from
ER subdomains called transi-
tional ER sites. The molecular
machinery that generates
these ER structures awaits
elucidation. Although the
components that sculpt ER
sheets and tubules might
also contribute to the mor-
phology of these other struc-
tures, it seems likely that
novel mechanisms will also
be discovered.
REFERENCES
Hu, J., Shibata, Y., Voss, C., She-
mesh, T., Li, Z., Coughlin, M.,
Kozlov, M.M., Rapoport, T.A., and Prinz, W.A.
(2008). Science 319, 1247–1250.
Hu, J., Shibata, Y., Zhu, P.-P., Voss, C., Rismanchi,
N., Prinz, W.A., Rapoport, T.A., and Blackstone, C.
(2009). Cell 138, 549–561.
Klopfenstein, D.R., Kappeler, F., and Hauri, H.P.
(1998). EMBO J. 17, 6168–6177.
Klopfenstein, D.R., Klumperman, J., Lustig, A.,
Kammerer, R.A., Oorschot, V., and Hauri, H.P.
(2001). J. Cell Biol. 153, 1287–1300.
Nikonov, A.V., Hauri, H.P., Lauring, B., and Krei-
bich, G. (2007). J. Cell Sci. 120, 2248–2258.
Orso, G., Pendin, D., Liu, S., Tosetto, J., Moss,
T.J., Faust, J.E., Micaroni, M., Egorova, A., Marti-
nuzzi, A., McNew, J.A., and Daga, A. (2009). Nature
460, 978–983.
Shibata, Y., Shemesh, T., Prinz, W.A., Palazzo,
A.F., Kozlov, M.M., and Rapoport, T.A. (2010).
Cell 143, this issue, 774–788.
Voeltz, G.K., Prinz, W.A., Shibata, Y., Rist, J.M.,
and Rapoport, T.A. (2006). Cell 124,
573–586.
Figure 1. Molecular Model for the Generation of ER Membrane
Sheets and TubulesCross-section of an endoplasmic reticulum (ER) cisterna showing the curva-ture-inducing proteins reticulons and DP1 (purple) enriched in highly bentmembrane tubules and edges of the sheet. In contrast, the sheet-inducingprotein Climp-63 (blue) is excluded from tubules and, instead, partitions intosheet domains with translocon complexes. Climp-63 could assemble intoparallel coiled-coil arrangements to flatten membranes and to serve as luminalER spacers that keep individual sheets a specific distance apart (�50 nm inmammalian cells).
666 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
Leading Edge
Previews
SIRT3 in Calorie Restriction:Can You Hear Me Now?Carlos Sebastian1 and Raul Mostoslavsky1,*1The Massachusetts General Hospital Cancer Center, Harvard Medical School, Boston, MA 02114, USA*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.11.009
Caloric restriction decreases oxidative damage and extends life span in many organisms. Someyaet al. (2010) show that the sirtuin SIRT3mediates the protective effects of caloric restriction on age-related hearing loss by promoting the mitochondrial antioxidant system through the regulation ofisocitrate dehydrogenase 2 (Idh2).
Despite two decades of effort, caloric
restriction remains the only treatment
demonstrated to extend life span and to
delay the progression of several diseases
normally associated with aging, such as
cancer, diabetes, and neurological disor-
ders. Early experiments in yeast showed
that the life span extension mediated by
caloric restriction involves Sir2, the found-
ing member of the sirtuin family of histone
deacetylases. However, later experi-
ments have questioned this association
(Longo and Kennedy, 2006), and the role
of mammalian sirtuins in life span exten-
sion by caloric restriction is still under
study. In this context, although SIRT1
appears to be the major mammalian sir-
tuin involved in the metabolic effects of
caloric restriction (Haigis and Guarente,
2006), the precise role of sirtuins in the
longevity response remains unclear. In
this issue of Cell, Someya et al. (2010)
bring some light to the field by describing
a new function for the mitochondrial
SIRT3 protein in the prevention of hearing
loss mediated by caloric restriction during
aging. These tantalizing results suggest
that SIRT3 might play an important role
in slowing the aging process in mammals.
Age-related hearing loss is a hallmark of
mammalian aging and the most common
sensory disorder in the elderly (Liu and
Yan, 2007). It is characterized by a gradual
loss of spiral ganglion neurons and
sensory hair cells in the cochlea of the
inner ear (Liu and Yan, 2007). Given that
the affected cells are postmitotic and do
not regenerate, their loss leads to an
age-associated decline in hearing func-
tion. Several groups have studied hearing
loss as an example of age-related degen-
eration in mouse models. Remarkably,
early work demonstrated that caloric
restriction slows age-related hearing loss
in animal models (Sweet et al., 1988).
Moreover, in their previous work, Prolla
and colleagues demonstrated that caloric
restriction induces expression of the
SIRT3 gene in the cochlea (Someya et al.,
2007). They now elegantly follow up on
these results, proving a role for this sirtuin
in the delay in hearing loss due to caloric
restriction and elucidating the molecular
mechanisms underlying this effect.
Someya et al. use wild-type and SIRT3-
deficient mice fed a diet in which caloric
intake is reduced to 75% and compare
them to control mice fed with a regular
diet. The authors first look at the hearing
response of the animals and find that, as
expected, aging leads to hearing loss in
both wild-type and SIRT3-deficient mice.
However, whereas caloric restriction
delays the progression of hearing loss in
wild-type mice, this effect is completely
abolished in SIRT3-deficient animals.
These results are consistent with the
effects of caloric restriction on spiral
ganglion neurons and hair cells in these
mice. In wild-type animals, a calorie
restricted diet reduces the age-related
loss of neurons and hair cells, whereas
this effect is abrogated in SIRT3-deficient
mice. Together, these results clearly pin-
point SIRT3 as a critical molecular determi-
nant regulating the response to caloric
restriction in age-related hearing loss.
The authors next study the metabolic
effects induced by caloric restriction in
SIRT3-deficient mice. With a normal diet,
SIRT3-deficient animals appear pheno-
typically normal, in accordance with
previous studies (Schwer et al., 2009).
However, whereas wild-type mice display
lower levels of serum insulin and triglycer-
ides when fed a calorie-restricted diet,
SIRT3-deficient mice do not show this
response. Based on these results, the
authors argue that SIRT3 plays a role in
metabolic adaptations to caloric restric-
tion. It remains unclear, however, whether
SIRT3 can also mediate the effects of
calorie restriction in other tissues or
whether it does so specifically in the
context of hearing loss.
The authors then investigate the molec-
ular mechanisms involved in this process.
Given that caloric restriction reduces age-
associated oxidative damage to macro-
molecules (Sohal and Weindruch, 1996),
Someya et al. analyze levels of oxidative
damage to DNA in several tissues. They
find that a calorie-restricted diet reduces
this type of damage in wild-type mice,
but not in SIRT3-deficient animals. Impor-
tantly, this is the first evidence that
a mammalian sirtuin regulates levels of
oxidative stress in response to caloric
restriction.
But how does SIRT3 regulate oxidative
damage during caloric restriction? Given
that SIRT3 localizes to the mitochondria,
the authors hypothesize that SIRT3 could
regulate the antioxidant systems present
in this organelle. Using a combination of
cellular and biochemical experiments,
they discover that SIRT3 regulates the
mitochondrial glutathione antioxidant
defense system. Glutathione is the main
small molecule antioxidant in cells and is
generated by glutathione reductase in
a reaction dependent on NADPH. The
authors show that SIRT3 modulates the
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 667
conversion of oxidized gluta-
thione to reduced glutathione
in response to caloric restric-
tion. They find that, under
these conditions, SIRT3
binds and deacetylates the
mitochondrial isocitrate de-
hydrogenase 2 enzyme
(Idh2), the enzyme that gener-
ates NADPH, increasing the
enzyme’s activity. In agree-
ment with these results, Idh2
deacetylation and activity, as
well as NADPH levels, in-
crease during caloric restric-
tion in all wild-type tissues
tested, whereas SIRT3 defi-
ciency impairs this response.
Finally, overexpressing SIRT3
and Idh2 promotes cell
viability upon oxidative dam-
age. Together, these data
lead the authors to propose
a model in which caloric
restriction promotes SIRT3
expression, leading to the de-
acetylation and activation of
Idh2, thus providing resis-
tance to oxidative stress and
inhibiting the age-related
loss of spiral ganglion neu-
rons and hair cells (Figure 1).
Although Someya et al.
provide enough data to
prove that the effects of
caloric restriction on age-
related hearing loss are
dependent on SIRT3, key
questions remain. First, does SIRT3
mediate the effects of caloric restriction
in other tissues? And if so, what are its
substrates? Multiple mitochondrial
proteins are deacetylated upon caloric
restriction in a SIRT3-dependent manner
(Schwer et al., 2009). It is therefore
important to determine whether Idh2 is
the main SIRT3 target in preventing
oxidative stress or whether other SIRT3
substrates contribute as well. Second,
what is the relationship between the
effect of SIRT3 on Idh2 and the recently
described role for SIRT3 in fatty acid
oxidation during nutrient stress (Hirschey
et al., 2010)? Are these functions coordi-
nated? If they are not, how is specificity
achieved? Third, can we mimic the
effects of caloric restriction using SIRT3
activators? If so, such reagents would
have significant therapeutic potential.
Finally, because other sirtuins also have
prominent roles in metabolic regulation
(Finkel et al., 2009), can we extend
some of these findings to other sirtuins?
SIRT1, for example, has been linked to
the response of mammals to caloric
restriction (Haigis and Guarente, 2006),
and it is therefore possible that the
activity of this and other sirtuins may be
regulated in a coordinated fashion
following nutrient starvation.
Regardless of the utopian dream of life
span extension, answering some of these
questions may provide a step forward for
treating age-related pathologies, bringing
us closer to a healthier life
span. In the words of Francois
Jacob, ‘‘In a world of unlimited
imagination, we are continu-
ally inventing a possible world
or a piece of a world, and then
comparing it with the real
world.’’ In the context of sir-
tuins, it seems we are starting
to put some of these pieces
together.
ACKNOWLEDGMENTS
We would like to thank all of the
members of the Mostoslavsky lab
for helpful comments. C.S. is the
recipient of a Beatriu de Pinos Post-
doctoral Fellowship (Generalitat de
Catalunya). R.M. is a Sidney Kimmel
Scholar, a Massachusetts Life
Science Center New Investigator
Scholar, and the recipient of an
AFAR Award. Work in the Mosto-
slavsky lab is funded, in part, by
National Institutes of Health.
REFERENCES
Finkel, T., Deng, C.X., and Mosto-
slavsky, R. (2009). Nature 460,
587–591.
Haigis, M.C., and Guarente, L.P.
(2006). Genes Dev. 20, 2913–2921.
Hirschey, M.D., Shimazu, T., Goetz-
man, E., Jing, E., Schwer, B.,
Lombard, D.B., Grueter, C.A., Har-
ris, C., Biddinger, S., Ilkayeva, O.R.,
et al. (2010). Nature 464, 121–125.
Liu, X.Z., and Yan, D. (2007). J. Pathol. 211,
188–197.
Longo, V.D., and Kennedy, B.K. (2006). Cell 126,
257–268.
Schwer, B., Eckersdorff, M., Li, Y., Silva, J.C., Fer-
min, D., Kurtev, M.V., Giallourakis, C., Comb, M.J.,
Alt, F.W., and Lombard, D.B. (2009). Aging Cell 8,
604–606.
Sohal, R.S., and Weindruch, R. (1996). Science
273, 59–63.
Someya, S., Yamasoba, T., Weindruch, R., Prolla,
T.A., and Tanokura, M. (2007). Neurobiol. Aging
28, 1613–1622.
Someya, S., Yu, W., Hallows, W.C., Xu, J., Vann,
J.M., Leeuwenburg, C., Tanokura, M., Denu,
J.M., and Prolla, T.A. (2010). Cell 143, this issue,
802–812.
Sweet, R.J., Price, J.M., and Henry, K.R. (1988).
Audiology 27, 305–312.
Figure 1. Caloric Restriction, SIRT3, and Age-Related Hearing LossDuring aging (left), oxidative damage (ROS, reactive oxygen species) leads tothe loss of spiral ganglion neurons and sensory hair cells in the ear, leading toage-related hearing loss. Caloric restriction (right) prevents the age-associ-ated loss of spiral ganglion neurons and sensory hair cells. Someya et al.(2010) show that caloric restriction leads to an increase in SIRT3 levels inthe mitochondria. By promoting the deacetylation of isocitrate dehydrogenase2 (Idh2), SIRT3 promotes the accumulation of NADPH, hence activating gluta-thione reductase (GSR), which generates reduced glutathione (GSH), a cellularantioxidant.
668 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
Leading Edge
Previews
ATP Consumption PromotesCancer MetabolismWilliam J. Israelsen1 and Matthew G. Vander Heiden1,*1Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.11.010
Cancer cells metabolize glucose by aerobic glycolysis, a phenomenon known as the Warburgeffect. Fang et al. (2010) show that the endoplasmic reticulum enzyme ENTPD5 promotes ATPconsumption and favors aerobic glycolysis. The findings suggest that nutrient uptake in cancercells is limited by ATP and satisfies energy requirements other than ATP production.
Mounting evidence suggests that cancer
cells engage in a unique metabolic pro-
gram that allows for rapid cell prolifera-
tion. Nonproliferating cells can use glycol-
ysis products to generate ATP for their
energy needs. Such cells generally have
low rates of glycolysis followed by
oxidation of pyruvate in the mitochondria,
leading to efficient generation of ATP.
Dividing cells, in contrast, also use glycol-
ysis intermediates for the synthesis of
macromolecules and must therefore
balance their ATP requirements and
biosynthetic needs (Vander Heiden et al.,
2009). Metabolism of glucose by aerobic
glycolysis, a phenomenon known as the
Warburg effect, may help dividing cells
strike this balance.
The phosphoinositide 3-kinase (PI3K)
signaling pathway, which is activated in
many cancers, regulates cell growth and
survival. PI3K signaling has been impli-
cated in the altered glucose metabolism
of cancer cells, and the serine/threonine
kinase AKT, a major PI3K effector,
promotes glucose uptake and increases
the activity of glycolytic enzymes (DeBer-
ardinis et al., 2008). In this issue of Cell,
Fang et al. (2010) report an important
mechanism by which AKT signaling leads
to increased aerobic glycolysis. They
showthat AKT activation promotesprotein
glycosylation in the endoplasmic retic-
ulum, which elevates ATP consumption
and derepresses a rate-limiting enzyme
in glycolysis that is otherwise inhibited by
an elevated ratio of ATP to AMP. This
work suggests how proliferating cells
may integrate growth signals with energy
status to enable increased glucose uptake
to support cell proliferation.
Activation of the PI3K pathway in
cancer can occur via genetic alterations
that allow growth factor-independent
kinase activation or via the loss of PTEN,
a lipid phosphatase that attenuates PI3K
signaling. Fang et al. now find that cell
extracts from PTEN-deficient cells have
an enhanced ability to generate AMP
from ATP. Subsequent purification and
biochemical characterization of this
activity led to the identification of ectonu-
cleoside triphosphate diphosphohydro-
lase 5 (ENTPD5) as the enzyme associ-
ated with the ATP hydrolysis activity.
PI3K signaling leads to upregulation of
ENTPD5, a UDPase that promotes the
N-glycosylation and folding of glycopro-
teins in the ER by hydrolyzing UDP to
UMP (Trombetta and Helenius, 1999)
(Figure 1). UDP hydrolysis in the ER is
a reaction necessary to promote protein
folding via the calnexin/calreticulin
pathway. It is linked to ATP hydrolysis in
the cytosol by a cycle of glucose and
phosphate transfer reactions. As part
of this cycle, the UDP-glucose/UMP anti-
porter exports UMP out of the ER in
exchange for importing UDP-glucose
into the ER (Hirschberg et al., 1998). The
UGGT enzyme then uses UDP-glucose
to transfer glucose to proteins in the ER
(Vembar and Brodsky, 2008). This
glucose addition to nascent glycoproteins
is necessary for their calnexin/calreticulin-
mediated protein folding. Thus, disruption
of ENTPD5 in PTEN-deficient cells results
in decreased protein N-glycosylation and
causes ER stress.
Cell surface proteins, including many
growth factor receptors, are N-glycosy-
lated. Fang et al. show that disruption of
ENTPD5 leads to decreased levels of
several growth factor receptors, including
epidermal growth factor receptor (EGFR),
insulin-like growth factor receptor
b (IGFR-b), and Her2/ErbB2. Given that
growth factor signaling plays an important
role in increasing nutrient metabolism in
rapidly proliferating cells (DeBerardinis
et al., 2008), these new findings suggest
that cellular ATP levels can influence the
folding and expression of growth factor
receptors, perhaps ensuring that cells do
not attempt to grow when ATP is limiting.
Furthermore, because glucose metabo-
lism by the hexosamine biosynthesis
pathway provides the carbon for these
receptor glycosylation events, the avail-
ability of glucose may provide a means
to couple nutrient levels with growth
factor receptor expression. These feed-
backs may exist to prevent a metabolic
catastrophe caused by activation of the
cell growth machinery when the supply
of nutrients or ATP is limiting.
How does ENTPD5 regulate ATP
levels? Fang et al. find that reconstitution
of the ATP consuming activity also
requires the presence of UMP/CMP
kinase-1 and adenylate kinase-1. UMP/
CMP kinase-1 catalyzes the rephosphor-
ylation of the UMP generated by ENTPD5
into UDP (Figure 1), in the process con-
verting ATP to ADP. Adenylate kinase-1
then converts ADP molecules into ATP
and AMP, thus allowing the cycle to
continue. Surprisingly, this cycle involving
ENTPD5 is a major source of ATP
consumption in PTEN-deficient cells.
Furthermore, these reactions directly
affect the cell’s glycolytic rate. Whereas
increased ENTPD5 expression has no
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 669
effect on cellular respiration, it increases
lactate production, suggesting a link
between ATP consumption and in-
creased glycolytic flux. In a series of
experiments to determine how ENTPD5
increases glucose entry into glycolysis,
Fang et al. find that the ratio of fructose-
6-phosphate to fructose-1-6-bisphos-
phate increases in cells following ENTPD5
knockdown, consistent with inhibition of
this step in glycolysis. Phosphofructoki-
nase (PFK), the enzyme that catalyzes
this reaction, is the major enzyme control-
ling glucose commitment to the glycolytic
pathway (Dunaway, 1983). A high ATP/
AMP ratio in the cell inhibits both PFK
activity and glucose metabolism by
glycolysis. In fact, the authors conclude
that increased ATP consumption by
ENTPD5 increases glycolysis by lowering
the ATP/AMP ratio and relieving allosteric
inhibition of PFK.
ATP is likely not the growth-limiting
resource for most cells (Vander Heiden
et al., 2009). The concept that glucose
utilization by tumor cells may be limited
by ATP consumption to prevent feedback
inhibition of PFK has been suggested
previously (Scholnick et al., 1973). This
study finally provides a mechanism by
which cells can increase ATP consump-
tion to drive glucose uptake. An additional
mechanism has also recently been
described in which glucose incorporation
into biosynthetic pathways occurs
without producing excess ATP (Vander
Heiden et al., 2010). Together, these
studies support the notion that altered
metabolism in cancer is not adapted to
support ATP production.
Fang et al. show that ENTPD5 expres-
sion correlates with PI3K activation in
human prostate cancer cell lines and
tumor tissue samples. Not all cancer cells
are dependent on activated PI3K, sug-
gesting that increased ENTPD5 activity
may not be a universal mechanism for
lowering ATP levels in tumors. However,
other enzymes involved in regulating
nucleotide pools in cells have also been
linked to cancer (Hartsough and Steeg,
2000), and there are additional homologs
of ENTPD5 whose functions are not well
understood. These enzymes may be
involved in analogous cycles of ATP con-
sumption, leading to enhanced glucose
metabolism in other genetic contexts.
Fang et al. also show that decreased
ENTPD5 expression inhibits tumor
growth, possibly via pleiotropic effects
involving induction of ER stress and
altered glucose metabolism. Consider-
ation of ENTPD5 as a potential thera-
peutic target in PI3K-driven cancer is
interesting given that pharmacological
inhibition of ENTPD5 is predicted to
decrease tumor ATP consumption.
Although counterintuitive, the resulting
increase in ATP/AMP ratio might reduce
the entry of glucose into glycolysis and
starve the cells of precursors necessary
for biosynthesis. Successful efforts to
target cancer metabolism will likely arise
from understanding the feedbacks and
complex regulation that are required for
anabolic metabolism. The study by Fang
et al. provides new insight by demon-
strating that ATP consumption serves to
increase glucose flux to satisfy the ener-
getic and biosynthetic demands of
a rapidly proliferating cell.
ACKNOWLEDGMENTS
We thank Brooke Bevis for her help preparing the
figure and editing the manuscript. M.G.V.H. is
a consultant to Agios Pharmaceuticals regarding
development of compounds targeting cancer
metabolism and is a member of its Scientific Advi-
sory Board.
REFERENCES
DeBerardinis, R.J., Lum, J.J., Hatzivassiliou, G.,
and Thompson, C.B. (2008). Cell Metab. 7, 11–20.
Dunaway, G.A. (1983). Mol. Cell. Biochem. 52,
75–91.
Fang, M., Shen, Z., Huang, S., Zhao, L., Chen, S.,
Mak, T.M., and Wang, X. (2010). Cell 143, this
issue, 711–724.
Hartsough, M.T., and Steeg, P.S. (2000). J. Bioen-
erg. Biomembr. 32, 301–308.
Hirschberg, C.B., Robbins, P.W., and Abeijon, C.
(1998). Annu. Rev. Biochem. 67, 49–69.
Figure 1. ENTPD5 Promotes Glycolysis in Proliferating CellsFang et al. (2010) show that the endoplasmic reticulum (ER) UDPase ectonucleoside triphosphatediphosphohydrolase 5 (ENTPD5) is expressed in response to phosphoinositide 3-kinase (PI3K) signaling.Activation of PI3K results in FOXO phosphorylation by AKT and loss of ENTPD5 transcriptional repres-sion. This leads to increased ENTPD5 enzyme activity in the ER, promoting protein folding. ENTPD5activity promotes the import of UDP-glucose into the ER, where UGGT transfers glucose to an unfoldedN-glycoprotein and produces UDP. Properly folded N-glycoproteins, such as growth factor receptors,exit the cycle, whereas unfolded proteins undergo further folding attempts or are degraded. ENTPD5activity enables this process by hydrolyzing UDP to provide the UMP necessary for exchange withUDP-glucose in the cytosol. The activities of UMP/CMP kinase-1 and adenylate kinase-1 couple theenergetic requirements of this cycle to the net conversion of ATP to AMP. Thus, increased ENTPD5activity leads to a decrease in the cellular ATP/AMP ratio. Because this ratio is the major determinantof glucose flux through the phosphofructokinase (PFK) step in glycolysis, a lowered ATP/AMP ratioincreases glycolysis, elevates lactate production, and provides glycolytic intermediates for biomassproduction.
670 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
Scholnick, P., Lang, D., and Racker, E. (1973).
J. Biol. Chem. 248, 5175.
Trombetta, E.S., and Helenius, A. (1999). EMBO J.
18, 3282–3292.
Vander Heiden, M.G., Cantley, L.C., and Thomp-
son, C.B. (2009). Science 324, 1029–1033.
Vander Heiden, M.G., Locasale, J.W., Swanson,
K.D., Sharfi, H., Heffron, G.J., Amador-Noguez,
D., Christofk, H.R., Wagner, G., Rabinowitz, J.D.,
Asara, J.M., and Cantley, L.C. (2010). Science
329, 1492–1499.
Vembar, S.S., and Brodsky, J.L. (2008). Nat. Rev.
Mol. Cell Biol. 9, 944–957.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 671
Leading Edge
Essay
Glycomics Hits the Big TimeGerald W. Hart1,* and Ronald J. Copeland1
1Department of Biological Chemistry, School of Medicine, Johns Hopkins University, 725 North Wolfe Street, Baltimore, MD 21205-2185, USA
*Correspondence: [email protected] 10.1016/j.cell.2010.11.008
Cells run on carbohydrates. Glycans, sequences of carbohydrates conjugated to proteins andlipids, are arguably themost abundant and structurally diverse class of molecules in nature. Recentadvances in glycomics reveal the scope and scale of their functional roles and their impact onhuman disease.
By analogy to the genome, transcriptome,
or proteome, the ‘‘glycome’’ is the
complete set of glycans and glycoconju-
gates that are made by a cell or organism
under specific conditions. Therefore,
‘‘glycomics’’ refers to studies that attempt
to define or quantify the glycome of a cell,
tissue, or organism (Bertozzi and Sasise-
kharan, 2009). In eukaryotes, protein
glycosylation generally involves the cova-
lent attachment of glycans to serine,
threonine, or asparagine residues. Glyco-
proteins occur in all cellular compart-
ments. Glycans are also attached to
lipids, often ceramide, which is comprised
of sphingosine, a hydrocarbon amino
alcohol and a fatty acid. Complex glycans
are mainly attached to secreted or cell
surface proteins, and they do not cycle
on and off of the polypeptide. In contrast,
the monosaccharide O-linked N-acetyl-
glucosamine (O-GlcNAc) cycles rapidly
on serine or threonine residues of many
nuclear and cytoplasmic proteins. Identi-
fying the number, structure, and function
of glycans in cellular biology is a daunting
task but one that has been made easier in
recent years by advances in technology
and by our growing appreciation of how
integral glycans are to biology (Varki
et al., 2009).
The scope of the glycomics challenge is
immense. The covalent addition of
glycans to proteins and lipids represents
not only the most abundant posttransla-
tional modification (PTM), but also by far
the most structurally diverse. Although it
is commonly stated that more than 50%
of all polypeptides are covalently modified
by glycans (Apweiler et al., 1999), even
this estimate is far too low because it fails
to include that myriad nuclear and
cytoplasmic proteins are modified by
O-GlcNAc (Hart et al., 2007). Even though
the generic term ‘‘glycosylation’’ is often
used to categorize and lump all glycan
modifications of proteins into one bin,
side by side with other posttranslational
modifications such as phosphorylation,
acetylation, ubiquitination, or methylation,
such a view is not only inaccurate, but
also is completely misleading. If one only
considers the linkage of the first glycan
to the polypeptide in both prokaryotic
and eukaryotic organisms, there are at
least 13 different monosaccharides and
8 different amino acids involved in glyco-
protein linkages, with a total of at least
41 different chemical bonds known to be
linking the glycan to the protein (Spiro,
2002). Importantly, each one of these
unique glycan:protein linkages is surely
as different in both structure and function
as protein methylation is from acetylation.
Of course, this modification is not only
about a single linkage. When structural
diversity of the additional oligosaccharide
branches of glycans and the added diver-
sity of complex terminal saccharides on
glycans, such as fucose or sialic acids
(about 50 different sialic acids are known
[Schauer, 2009]), are taken into account,
the molecular diversity and varied func-
tions of protein-bound glycans rapidly
increase exponentially. Just the ‘‘sia-
lome’’ (Cohen and Varki, 2010) rivals or
exceeds many other posttranslational
modifications in abundance and struc-
tural/functional diversity. In addition,
chemical modifications, such as phos-
phorylation, sulfation, and acetylation,
increase the glycan structural/functional
diversity even more. Thus, categorizing
glycosylation as a single type of post-
translational modification is neither useful
nor at all reflective of reality.
Dynamic Structural ComplexityUnderlies Glycan FunctionsGlycoconjugates provide dynamic struc-
tural diversity to proteins and lipids that
is responsive to cellular phenotype, to
metabolic state, and to the developmental
stage of cells. Complex glycans play crit-
ical roles in intercellular and intracellular
processes, which are fundamentally
important to the development of multicel-
lularity (Figure 1). Unlike nucleic acids and
proteins, glycan structures are not hard-
wired into the genome, depending upon
a template for their synthesis. Rather,
the glycan structures that end up on
a polypeptide or lipid result from the
concerted actions of highly specific gly-
cosyltransferases (Lairson et al., 2008),
which in turn are dependent upon the
concentrations and localization of high-
energy nucleotide sugar donors, such as
UDP-N-acetylglucosamine, the endpoint
of the hexosamine biosynthetic pathway.
Therefore, the glycoforms of a glycopro-
tein depend upon many factors directly
tied to both gene expression and cellular
metabolism.
There are at-least 250 glycosyltrans-
ferases in the human genome, and it has
been estimated that about 2% of the
human genome encodes proteins
involved in glycan biosynthesis, degrada-
tion, or transport (Schachter and Freeze,
2009). Biosynthesis of the nucleotide
sugar donors is directly regulated by nu-
cleic acid, glucose, and energy metabo-
lism, and the compartmentalization of
these nucleotide sugar donors is highly
regulated by specific transporters. Protein
glycosylation is therefore controlled by
rates of polypeptide translation and
protein folding, localization of and compe-
tition between glycosyltransferases,
672 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
cellular concentration and localization of
nucleotide sugars, the localization of
glycosidases, and membrane trafficking.
Thus, individual glycosylation sites on the
same polypeptide can contain different
glycan structures that reflect both the
type and status of the cell in which they
are synthesized. For example, the glyco-
forms of the membrane protein Thy-1 are
very different in lymphocytes than they
are in brain, despite having the same poly-
peptide sequence (Rudd and Dwek,
1997). Conversely, even small changes in
polypeptide sequence or structure will
alter the types of glycan structures
attached to a polypeptide. For example,
histocompatibility antigen polypeptides
with more than 90% sequence homology
contain different N-linked glycan profiles
at individual sites, reflective of their
allelic type, even when they are synthe-
sized within the same cells (Swiedler
et al., 1985). Thus, site-specific protein
glycosylation is highly regulated by
gene expression of glycan-processing
enzymes, by polypeptide structure at all
levels, and by cellular metabolism.
Technology of GlycomicsA detailed understanding of cellular
processes will require a detailed appreci-
ation of the glycans modulating proteins
and pathways. Although this ultimate
goal of glycomics is laudable, we are
a very long way from having the tech-
nology to completely characterize the gly-
come of even a simple cell or tissue. Not
only is the glycome much more complex
than the genome, transcriptome, or pro-
teome, as noted above, it is also much
more dynamic, varying considerably not
only with cell type, but also with the
developmental stage and metabolic state
of a cell. Even very conservative esti-
mates indicate that there are well over
a million different glycan structures in
a mammalian cell’s glycome. However,
upon considering ‘‘functional glycomics,’’
it is estimated that the binding sites of
glycan-binding proteins (GBPs), such as
antibodies, lectins, receptors, toxins, mi-
crobial adhesions, or enzymes (Figure 1),
can accommodate only up to two to six
monosaccharides within a glycan struc-
ture (Cummings, 2009). Therefore, the
number of specific glycan substructures
that bind to biologically important GBPs
in a cell may be fewer than 10,000,
a number that is within the realm of
current analytical and, if targeted, chemi-
cal or enzymatic synthetic capabilities.
Until recently, the lack of tools and the
inherent complexity of glycans have
been major barriers preventing most biol-
ogists from embracing the importance of
glycans in biology. Recent technological
advances have significantly lowered these
barriers. Indeed, the tools of glycomics
and the subfields of glycoproteomics, gly-
colipidomics, and proteoglycomics have
all progressed substantially in recent
years (Krishnamoorthy and Mahal, 2009;
Laremore et al., 2010). Major technolog-
ical advances, many of which are shared
with proteomics, have recently allowed
semiquantitative profiling of glycans and
glycoproteins (Krishnamoorthy and
Mahal, 2009; Vanderschaeghe et al.,
2010). Some of these advances are the
result of the National Institute of General
Medical Science’s (NIGMS) support of
the Consortium for Functional Glycomics
(CFG), which has served to focus and
assist more than 500 researchers on
issues related to glycomics (Paulson
et al., 2006; Raman et al., 2006).
Kobata and colleagues were among the
first to profile N-glycans, well before the
current concepts of glycomics were
conceived. Despite the lack of many
modern methods, their pioneering work
was characterized by a high level of rigor
in defining the arrays of N-glycan struc-
tures present in cells and tissues and on
specific proteins (Endo, 2010). Currently,
a wide variety of high-resolution and
highly sensitive methods are available,
including capillary electrophoresis (CE),
high-performance liquid chromatography
(HPLC), and lectin microarrays.
Glycans are often profiled after their
release from polypeptides, which results in
the loss of any information about proteins
and sites to which they were attached.
Even though it is much more difficult, it is
also much preferable to perform
Figure 1. Glycans Permeate Cellular BiologyComplex glycans at the cell surface are targets of microbes and viruses, regulate cell adhesion and devel-opment, influence metastasis of cancer cells, and regulate myriad receptor:ligand interactions. Glycanswithin the secretory pathway regulate protein quality control, turnover, and trafficking of molecules toorganelles. Nucleocytoplasmic O-linked N-acetylglucosamine (O-GlcNAc) has extensive crosstalk withphosphorylation to regulate signaling, cytoskeletal functions, and gene expression in response to nutrientsand stress.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 673
glycopeptide profiling (glycoproteomics) to
first identify attachment sites prior to
detailed profiling or structural analysis of
the glycans present on a polypeptide. The
ultimate goal of glycoproteomics, which is
todefine all of the molecular species (glyco-
forms) of glycoproteins in a cell or tissue,
has not yet been realized for any glycopro-
tein with more than one glycan attachment
site. N-glycans are generally released from
proteins by peptide-N-glycosidase F
(PNGase F), which cleaves most, but not
all, N-glycans. Unfortunately, no such
broadly specific enzyme exists for
O-glycans, which are generally released
by chemical methods, such as alkali-
induced b elimination, or by hydrazinolysis.
However, for relatively pure glycoproteins,
so called ‘‘top-down’’ mass spectrometric
methods, which do not involve prior release
of the glycans, may eventually prove useful,
as instrumentation and methods improve
(Reid et al., 2002).
Due to the small sample sizes involved,
most CE or HPLC separation methods
require chemical modification of released
glycans with fluorescent compounds. CE
and HPLC methods provide high-resolu-
tion separation of glycans, and when
combined with laser-induced fluorescent
detection (LIF), tagged glycans can be de-
tected in the low femtomole range. High
pH anion-exchange chromatography
(HPAEC) with pulsed-amperometric
detection separates glycans with high
resolution and detects them with high
sensitivity without chemical modification,
but the high alkalinity employed can be
problematic for some labile structures.
Lectins, which are defined as carbohy-
drate-binding proteins that are neither
antibodies nor enzymes, have a wide
range of glycan binding specificities, suit-
able for partial characterization of a gly-
come. Lectin microarrays use methods
and equipment similar to that employed
for nucleic acid arrays. Given the large
number of different lectins available, lectin
microarrays can provide information
about the glycome in a high-throughput
fashion, which is particularly useful in
profiling glycans produced by infectious
organisms (Hsu et al., 2006). In the future,
it is highly likely that glycomics will play
a central role in combating infectious
disease. However, many technical issues
remain to be resolved, such as standard-
ization required for clinical use, the
development of purified recombinant lec-
tins, and better definition of the specific-
ities of many lectins (Gupta et al., 2010).
Both matrix-assisted laser desorption
ionization (MALDI) and electrospray
mass spectrometry have played a key
role in glycan profiling and in glycoproteo-
mics (An et al., 2009; North et al., 2010;
Zaia, 2010). For biomarker discovery,
affinity enrichment approaches, based
upon chemical modification and solid-
phase extraction of N-linked glycopro-
teins, have proven useful in profiling
N-linked glycoprotein sites from serum-
or even from paraffin-embedded tissues
(Tian et al., 2009). Recently, using lectin
binding combined with advanced mass
spectrometric methods, thousands of
N-glycan attachment sites have been
mapped, a prerequisite for understanding
their functions (Zielinska et al., 2010).
Given the structural diversity of
glycans, all of these glycomic approaches
generate vast amounts of data. Glycan bi-
oinformatics has made great strides
within recent years with major efforts
from several laboratories (Aoki-Kinoshita,
2008). At least four major publicly
available carbohydrate databases (Glyco-
sciences.de, KEGG GLYCAN, Euro-
carbDB, and CFG) are now maintained,
and efforts to structure them in a uniform
format have been in progress for quite
some time. In addition, the Carbohy-
drate-Active EnZyme database (CAZy)
has played a key role in providing a global
understanding of carbohydrate active
enzymes, documenting their evolutionary
relationships, providing a framework for
elucidating common mechanisms, and
establishing the relationship between gly-
cogenomics and glycomes expressed by
cells (Cantarel et al., 2009). Moreover,
recent advances in bioinformatic analysis
tools for complex glycomic mass spec-
trometry data sets have allowed complex
data to be presented in formats useful to
nonexperts in all fields of biology (Ceroni
et al., 2008; Goldberg et al., 2005).
Perhaps one of the most important
contributions to the field of functional
glycomics has been the development of
well-defined glycan microarrays, which
currently display more than 500 different
glycan structures (Smith et al., 2010).
The NIGMS-supported Consortium for
Functional Glycomics (CFG) has gener-
ated and made publicly available
custom-made DNA microarrays that
represent glycosyltransferases and
glycan-binding proteins. The CFG also
has developed databases that present
phenotypic and biochemical data on gly-
cosyltransferase knockout mice. Even
though knocking out a single glycosyl-
transferase gene often affects hundreds
of glycoconjugates and myriad biological
processes, these mutant mice have
proven valuable in revealing the funda-
mental biological importance of glycans.
The microarrays and the databases
produced by the CFG member community
at large are publically available on the CFG
website (http://www.functionalglycomics.
org) and have resulted in a profound
increase in our understanding of the
binding specificities of GBPs, including
lectins key to inflammation and immunity,
and on infectious microbes or viruses.
However, a major barrier preventing
glycan biology from being incorporated
more into the mainstream is the continued
failure by the community to adopt a univer-
sally standard glycan structural format
and database that are easily accessed
worldwide. Most importantly, glycan data-
bases must eventually be incorporated
into standard interactive databases that
are supported by public agencies (such
as NCBI or EMBL) before glycan biology
can be fully integrated into the wider
research community.
From Glycomics to BiologyGlycans are directly involved in almost
every biological process and certainly
play a major role in nearly every human
disease (Figure 1). Genetic studies in
tissue culture cells indicate that specific
complex glycan structures are generally
not essential to a cell growing in culture,
indicating that most of the functions of
complex glycans are at the multicellular
level. In contrast, the cycling monosac-
charide, O-GlcNAc, on nuclear and cyto-
plasmic proteins, is essential even at the
single cell level in mammals (Hart et al.,
2007).
The critical roles of glycans in mammals
are now well established not only by the
dearth of mutations in glycan biosynthetic
enzymes that survive development, but
also by the severe phenotypes generated
when such mutations are not lethal.
These severe phenotypes are clearly illus-
trated by the congenital disorders of
674 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
glycosylation (CDGs) (Schachter and
Freeze, 2009), which are associated with
severe mental and developmental abnor-
malities. Also, the severe muscular
dystrophy that results from defective
O-glycosylation of a-dystroglycan (Yosh-
ida-Moriguchi et al., 2010) further
illustrates how a mutation in a glycan
biosynthetic enzyme results in a devas-
tating disease. The interplay between
O-GlcNAcylation and phosphorylation on
nuclear and cytoplasmic proteins plays
a key role in the etiology of diabetes,
neurodegenerative disease, and cancer
(Hart et al., 2007; Zeidan and Hart, 2010).
It has long been appreciated that alter-
ations in cell surface glycans contribute to
the metastatic and neoplastic properties
of tumor cells (Taniguchi, 2008). The func-
tions of many receptors are modulated by
their glycans, such as modulation of
Notch receptors by the action of specific
glycosyltransferases (Moloney et al.,
2000), which regulate Notch’s activation
by its ligands, affecting many develop-
mental events. Selectins, which specifi-
cally bind to a subset of fucosylated and
sialylated glycans, play a critical role in
leukocyte homing to sites of inflamma-
tion. Indeed, a selectin inhibitor is
currently in phase two clinical trials for
vaso-occlusive sickle cell disease (Chang
et al., 2010). Siglecs, which are a family of
cell surface sialic acid-binding lectins,
play a fundamental role in regulating
lymphocyte functions and activation.
Recent studies on galectins, a family of
b-galactoside-binding lectins, have
shown that they play a critical role in the
organization of receptors on the cell
surface and play important roles in immu-
nity, infections, development, and inflam-
mation (Lajoie et al., 2009). Proteoglycans
and glycosaminoglycans play a key role in
the regulation of growth factors, in micro-
bial binding, in tissue morphogenesis, and
in the etiology of cardiovascular disease.
Proteoglycans are perhaps the most
complicated and information-rich mole-
cules in biology, and progress in proteo-
glycomics has begun to accelerate
(Ly et al., 2010). Nearly all microbes and
viruses that infect humans bind to cells
by attaching to specific cell surface
glycans. Glycomics and glycan arrays
will have a substantial impact upon future
research toward both diagnosing and
preventing infectious disease.
Some of the most important drugs on the
market are already the result of glycomics.
The anti-flu virus drugs Relenza and Tami-
flu are structural analogs of sialic acids that
inhibit the flu virus neuraminidase and the
transmission of the virus. Natural heparin,
a sulfated glycosaminoglycan, and chemi-
cally defined synthetic heparin oligosac-
charides have long been widely used in
the clinic as anticoagulants and for many
other clinical uses. Hyaluronic acid, a non-
sulfated glycosaminoglycan, is used in the
treatment of arthritis. Many recombinant
pharmaceuticals, including therapeutic
monoclonal antibodies, are glycoproteins,
and their specific glycoforms are key to
their bioactivity and half lives in circulation
and to their possible induction of delete-
rious immune responses when they do
not contain the correct glycans. Given this
landscape, the pharmaceutical industry
and the US Food and Drug Administration
are rapidly realizing the critical importance,
in terms of both bioactivity and safety, of
carefully defining the glycoforms of any
therapeutics derived from glycoconju-
gates.
Glycoproteomics, Glycolipidomics,and BiomarkersClinical cancer diagnostic markers are
often glycoproteins, but most current
diagnostic tests only measure the expres-
sion of the polypeptide. Clearly, given the
long known alterations in glycans associ-
ated with cancer, it is highly likely that
cancer markers that detect specific glyco-
forms of a protein will have much higher
sensitivity and specificity for early
detection of cancer (Packer et al., 2008;
Taniguchi, 2008). Thus, the convergence
of glycomics and glycoproteomics is key
to the discovery of biomarkers for the early
detection of cancer (Taylor et al., 2009).
Recently, the Food and Drug Administra-
tion has approved fucosylated a-fetopro-
tein as a diagnostic marker of primary
hepatocarcinoma. In addition, fucosy-
lated haptoglobin may be a much better
marker of pancreatic cancer than simply
monitoring the expression of the hapto-
globin polypeptide. Indeed, The National
Cancer Institute has begun an initiative to
discover, develop, and clinically validate
glycan biomarkers for cancer (http://
glycomics.cancer.gov/). System biology
analyses of the glycome to identify
biomarkers of human disease will, by
necessity, also employ many of the same
methods used by genomics, proteomics,
metabolomics, and lipidomics (Figure 2)
(Packer et al., 2008). Due to the critical
roles of glycans in cardiovascular disease
and lung disease and in the functions of
blood cells, the National Heart Lung and
Blood Institute (NHLBI) has recognized
an acute need to train more researchers
in the area of glycosciences by creating
a ‘‘Program of Excellence in Glycoscien-
ces,’’ which will not only support collabo-
rative research, but will also provide
hands-on laboratory training in the
methods of glycosciences to fellows.
Thus, though our knowledge about the
biology of glycans and glycomics
continues to lag behind more mainstream
fields of genomics and proteomics, tech-
nological advances in glycomics in the
Figure 2. Glycomic Complexity Reflects Cellular ComplexityGiven that glycan structures are regulated by metabolism and glyco-enzyme expression and glycansmodify both proteins and lipids, functional glycomics also requires the tools of genomics, proteomics, lip-idomics, and metabolomics (modified after Packer et al., 2008).
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 675
last 5 years have begun to accelerate the
integration of glycobiology into the other
major fields of biomedical research. A
complete mechanistic understanding of
the etiology of almost any disease will
depend upon the elucidation of the func-
tions of all posttranslational modifications
but will especially depend upon our
understanding the many roles of glycans,
the most abundant and structurally
diverse type of posttranslational modifi-
cation.
ACKNOWLEDGMENTS
We thank Dr. Chad Slawson for helpful sugges-
tions. Original research in the author’s laboratory
was supported by NIH grants R01CA42486, R01
DK61671, and R24 DK084949.
REFERENCES
An, H.J., Froehlich, J.W., and Lebrilla, C.B. (2009).
Curr. Opin. Chem. Biol. 13, 421–426.
Aoki-Kinoshita, K.F. (2008). PLoS Comput. Biol. 4,
e1000075.
Apweiler, R., Hermjakob, H., and Sharon, N.
(1999). Biochim. Biophys. Acta 1473, 4–8.
Bertozzi, C.R., and Sasisekharan, R. (2009). Glyco-
mics. In Essentials of Glycobiology, Second
Edition, A. Varki, R.D. Cummings, J.D. Esko, H.H.
Freeze, P. Stanley, C.R. Bertozzi, G.W. Hart, and
M.E. Etzler, eds. (Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press).
Cantarel, B.L., Coutinho, P.M., Rancurel, C.,
Bernard, T., Lombard, V., and Henrissat, B.
(2009). Nucleic Acids Res. 37(Database issue),
D233–D238.
Ceroni, A., Maass, K., Geyer, H., Geyer, R., Dell, A.,
and Haslam, S.M. (2008). J. Proteome Res. 7,
1650–1659.
Chang, J., Patton, J.T., Sarkar, A., Ernst, B., Mag-
nani, J.L., and Frenette, P.S. (2010). Blood 116,
1779–1786.
Cohen, M., and Varki, A. (2010). OMICS 14,
455–464.
Cummings, R.D. (2009). Mol. Biosyst. 5, 1087–
1104.
Endo, T. (2010). J. Biochem. 147, 9–17.
Goldberg, D., Sutton-Smith, M., Paulson, J., and
Dell, A. (2005). Proteomics 5, 865–875.
Gupta, G., Surolia, A., and Sampathkumar, S.G.
(2010). OMICS 14, 419–436.
Hart, G.W., Housley, M.P., and Slawson, C. (2007).
Nature 446, 1017–1022.
Hsu, K.L., Pilobello, K.T., and Mahal, L.K. (2006).
Nat. Chem. Biol. 2, 153–157.
Krishnamoorthy, L., and Mahal, L.K. (2009). ACS
Chem. Biol. 4, 715–732.
Lairson, L.L., Henrissat, B., Davies, G.J., and
Withers, S.G. (2008). Annu. Rev. Biochem. 77,
521–555.
Lajoie, P., Goetz, J.G., Dennis, J.W., and Nabi, I.R.
(2009). J. Cell Biol. 185, 381–385.
Laremore, T.N., Leach, F.E., III, Solakyildirim, K.,
Amster, I.J., and Linhardt, R.J. (2010). Methods
Enzymol. 478, 79–108.
Ly, M., Laremore, T.N., and Linhardt, R.J. (2010).
OMICS 14, 389–399.
Moloney, D.J., Panin, V.M., Johnston, S.H., Chen,
J., Shao, L., Wilson, R., Wang, Y., Stanley, P.,
Irvine, K.D., Haltiwanger, R.S., and Vogt, T.F.
(2000). Nature 406, 369–375.
North, S.J., Jang-Lee, J., Harrison, R., Canis, K.,
Ismail, M.N., Trollope, A., Antonopoulos, A.,
Pang, P.C., Grassi, P., Al-Chalabi, S., et al.
(2010). Methods Enzymol. 478, 27–77.
Packer, N.H., von der Lieth, C.W., Aoki-Kinoshita,
K.F., Lebrilla, C.B., Paulson, J.C., Raman, R.,
Rudd, P., Sasisekharan, R., Taniguchi, N., and
York, W.S. (2008). Proteomics 8, 8–20.
Paulson, J.C., Blixt, O., and Collins, B.E. (2006).
Nat. Chem. Biol. 2, 238–248.
Raman, R., Venkataraman, M., Ramakrishnan, S.,
Lang, W., Raguram, S., and Sasisekharan, R.
(2006). Glycobiology 16, 82R–90R.
Reid, G.E., Stephenson, J.L., Jr., and McLuckey,
S.A. (2002). Anal. Chem. 74, 577–583.
Rudd, P.M., and Dwek, R.A. (1997). Crit. Rev. Bio-
chem. Mol. Biol. 32, 1–100.
Schachter, H., and Freeze, H.H. (2009). Biochim.
Biophys. Acta 1792, 925–930.
Schauer, R. (2009). Curr. Opin. Struct. Biol. 19,
507–514.
Smith, D.F., Song, X., and Cummings, R.D. (2010).
Methods Enzymol. 480, 417–444.
Spiro, R.G. (2002). Glycobiology 12, 43R–56R.
Swiedler, S.J., Freed, J.H., Tarentino, A.L.,
Plummer, T.H., Jr., and Hart, G.W. (1985). J. Biol.
Chem. 260, 4046–4054.
Taniguchi, N. (2008). Mol. Cell. Proteomics 7,
626–627.
Taylor, A.D., Hancock, W.S., Hincapie, M., Tanigu-
chi, N., and Hanash, S.M. (2009). Genome Med 1,
57.
Tian, Y., Gurley, K., Meany, D.L., Kemp, C.J., and
Zhang, H. (2009). J. Proteome Res. 8, 1657–1662.
Vanderschaeghe, D., Festjens, N., Delanghe, J.,
and Callewaert, N. (2010). Biol. Chem. 391,
149–161.
Varki, A., Cummings, R.D., Esko, J.D., Freeze,
H.H., Stanley, P., Bertozzi, C.R., Hart, G.W., and
Etzler, M.E. (2009). Essentials of Glycobiology,
Second Edition (Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press).
Yoshida-Moriguchi, T., Yu, L., Stalnaker, S.H.,
Davis, S., Kunz, S., Madson, M., Oldstone, M.B.,
Schachter, H., Wells, L., and Campbell, K.P.
(2010). Science 327, 88–92.
Zaia, J. (2010). OMICS 14, 401–418.
Zeidan, Q., and Hart, G.W. (2010). J. Cell Sci. 123,
13–22.
Zielinska, D.F., Gnad, F., Wi�sniewski, J.R., and
Mann, M. (2010). Cell 141, 897–907.
676 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
Leading Edge
Essay
What Determines the Specificityand Outcomes of Ubiquitin Signaling?Fumiyo Ikeda,1 Nicola Crosetto,1 and Ivan Dikic1,*1Frankfurt Institute for Molecular Life Sciences and Institute of Biochemistry II, Goethe University School of Medicine, Theodor-Stern-Kai 7,
D-60590 Frankfurt (Main), Germany*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.10.026
Ubiquitin signals and ubiquitin-binding domains are implicated in almost every cellular process, buthow is their functionality achieved in cells? We assess recent advances in monitoring the dynamicsand specificity of ubiquitin networks in vivo and discuss challenges ahead.
IntroductionA small protein modifier, ubiquitin, is the
building block of a repertoire of molecular
signals spanning from single ubiquitin
to ubiquitin chains of different linkage
used for posttranslational modification of
dozens of cellular proteins (Hershko and
Ciechanover, 1998). The seven lysines
(K) of ubiquitin (K6, K11, K27, K29, K33,
K48, and K63) and the amino-terminal
methionine (M1) are connected to the
C-terminal glycine for chain assembly,
generating polymers (Ikeda and Dikic,
2008; Iwai and Tokunaga, 2009). Ubiquitin
signals are recognized and processed
by specialized ubiquitin-binding domains
(UBDs) that form transient, noncovalent
interactions either with ubiquitin moieties
or with the linkage region in their chains.
So far, roughly 200 intracellular proteins
have been recognized to contain one
or more UBDs (Dikic et al., 2009). Ubiqui-
tin-UBD interactions regulate almost
every aspect of cellular physiology,
including protein degradation, receptor
trafficking, DNA repair, cell-cycle pro-
gression, gene transcription, autophagy,
and apoptosis (recently reviewed in
Deshaies and Joazeiro, 2009; Kirkin
et al., 2009; Raiborg and Stenmark,
2009; Ulrich and Walden, 2010; Wickliffe
et al., 2009; Winget and Mayor, 2010).
Yet, very little is known about the nature
of ubiquitin signals and the dynamics
of their interpretation by UBDs in the
highly crowded molecular environment
of the cell. In particular, it remains unclear
how a relatively limited pool of signals
(ubiquitin chains and UBDs) with partially
overlapping biochemical properties can
orchestrate the localization and function
of thousands of proteins involved in very
different cellular processes. Here we
summarize the most recent advances in
understanding specificity determinants
in ubiquitin signaling and discuss future
challenges in the development of sensi-
tive and reliable methods for monitoring
spatial and temporal patterns of ubiquiti-
nation in vivo.
Diversity of Ubiquitin SignalsDespite its relatively rigid globular struc-
ture, ubiquitin is one of the most versatile
signaling molecules in the cell. Although
the surface of ubiquitin is mostly com-
posed of polar residues, it is through its
few hydrophobic patches that it interacts
with most UBDs (Dikic et al., 2009; Winget
and Mayor, 2010). Moreover, the pres-
ence of seven lysine residues and the
N-terminal methionine within ubiquitin
that can be fused to the C-terminal di-
glycine motif of another ubiquitin allows
the formation of polymeric chains en-
dowed with flexibility, as in the case of
K63-linked or M1-linked chains (often
referred to as linear) (Ikeda and Dikic,
2008; Iwai and Tokunaga, 2009). K48-
linked and K11-linked chains adopt
a more rigid conformation, in which ubiq-
uitin monomers are tightly packed against
each other. This creates unique modules
composed of aligned ubiquitin moieties
in which the hydrophobic patch contain-
ing isoleucine 44 is either embedded or
facing out toward the surface (Pickart
and Fushman, 2004; Bremm et al., 2010;
Matsumoto et al., 2010). Conversely,
K6-linked chains form an asymmetric
compact conformation distinct from any
other known type of ubiquitin chain
(Virdee et al., 2010). The possibility of
heterotypic ubiquitin chains (that is, with
mixed linkages) has been shown in vitro,
but their presence and biological func-
tions in vivo remain to be confirmed. Alto-
gether, monoubiquitin and homotypic
polyubiquitin chains comprise no more
than ten signal types. However, the ability
to synthesize homotypic chains of various
lengths indicates that the repertoire of
ubiquitin signals in the cell may be larger
than expected.
Signals Decoders:Ubiquitin-Binding DomainsUbiquitin signals are read and processed
by UBDs that bind noncovalently to
mono- or polyubiquitin chains. To date,
five structural folds are known with
more than 20 UBDs identified overall
(Dikic et al., 2009). UBDs are commonly
a-helical structures, zinc fingers, pleck-
strin homology (PH) folds, or similar to
the ubiquitin-conjugating (Ubc) domain
present in E2 enzymes (Dikic et al.,
2009). In the majority of cases, isolated
UBDs preferentially bind to monoubiquitin
via a conserved hydrophobic patch sur-
rounding isoleucine 44. The measured
affinity of isolated UBDs for monoubiqui-
tin typically falls in the micromolar range
(Dikic et al., 2009; Winget and Mayor,
2010). In certain cases, monoubiquitin-
UBD interactions have also been demon-
strated in the context of endogenous full-
size proteins. For example, UBDs present
in Y family polymerases performing DNA
translesion synthesis bind the monoubi-
quitinated sliding clamp PCNA (Bienko
et al., 2005), and monoubiquitinated
transmembrane receptors are recognized
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 677
by endocytic sorting proteins containing
diverse UBDs (Hicke and Dunn, 2003).
The affinity of UBD-containing proteins
for their monoubiquitinated targets in the
cellular environment, however, may be
different from that inferred from in vitro
studies. In fact, the way ubiquitin signals
are decoded in cells may be influenced
by multiple factors, including the pres-
ence of tandem copies of one UBD in
the same protein, oligomerization, and
protein compartmentalization (reviewed
in Dikic et al., 2009; Winget and Mayor,
2010).
In addition to monoubiquitin, many
UBDs display either relative or absolute
selectivity for certain types of chains
(Ikeda and Dikic, 2008; Dikic et al., 2009;
Winget and Mayor, 2010). For instance,
the Pru (Plextrin receptor for ubiquitin)
domain in the proteasome receptor
Rpn13 preferentially interacts with K48-
linked diubiquitin (Husnjak et al., 2008),
and the NZF (Npl4 zinc finger) domain in
TAK1-binding protein 2 (TAB2) binds
specifically to K63-linked ubiquitin (Kula-
thu et al., 2009; Sato et al., 2009). In con-
trast, UBDs in NEMO and ABIN proteins
(UBAN) bind linear diubiquitin chains
with approximately 100-fold higher affinity
than K63 or K48 chains, and binding to
monoubiqutitin could not be detected
(Rahighi et al., 2009; Lo et al., 2009). The
selectivity of UBAN for linear chains has
been explained by the observation that
a NEMO dimer binds symmetrically to
linear diubiquitin, involving direct interac-
tions with residues exposed in the
glycine-methionine linkages (Rahighi
et al., 2009). In addition, the crystal struc-
tures of the NZF domain of TAB2 and
TAB3 in complex with K63-linked diubi-
quitin have shown a two-sided ubiquitin-
binding surface thanks to a flexible
K-linkage positioned away from the
interaction surface (Kulathu et al., 2009;
Sato et al., 2009). Linkage selectivity can
also result from multivalent interaction
between tandem UBD arrays in a given
protein and ubiquitin monomers or link-
ages in a polyubiquitin chain. Tandem
ubiquitin-interacting motifs (UIMs) in the
DNA double-strand break response pro-
tein Rap80 are positioned to cross two
K63-linked monomers, whereas Ataxin-3
UIMs display K48 avidity (Sims and
Cohen, 2009). The proteasome receptor
S5a has two UIMs separated by linker
regions and shows a 10-fold higher
affinity for diubiquitin over monoubiquitin
(Zhang et al., 2009). These observations
suggest that the function of tandem UBD
arrays is to increase the affinity for a given
ubiquitinated substrate rather than simul-
taneously binding multiple substrates.
Specificity and Plasticityof Ubiquitin SignalingHistorically, distinct ubiquitin signals have
been linked to specific cellular functions.
For example, K48-linked chains, also
known as ‘‘classical’’ ubiquitin chains,
were originally described as the signal
that targets substrates for proteasomal
degradation (Hershko and Ciechanover,
1998). Nonclassical linkage types, such
as K63-, K11-, or M1-linked chains are
instead associated with DNA repair
regulation, cell-cycle progression, innate
immunity, and inflammation (Ikeda and
Dikic, 2008; Iwai and Tokunaga, 2009;
Matsumoto et al., 2010; Wickliffe et al.,
2009). Recent reports, however, have
challenged the notion that distinct chain
types exclusively regulate specific pro-
cesses in the cell. For instance, nonclas-
sical ubiquitin signals, such as K11
chains generated by the anaphase-
promoting complex (APC/C), can also
target selected substrates for proteaso-
mal degradation (Jin et al., 2008). In yeast,
cyclin B1 is modified by a mix of K48-,
K63-, and K11-linked chains rather than
by K48 chains alone (Kirkpatrick et al.,
2006). This heterogeneous pool is suffi-
cient to bind to proteasomal ubiquitin
receptors and drive cyclin B1 degradation
(Kirkpatrick et al., 2006). Furthermore,
linear chains, initially discovered as acti-
vators of the NF-kB pathway (Tokunaga
et al., 2009), can also trigger proteasomal
degradation when fused to artificial sub-
strates (Zhao and Ulrich, 2010).
So, how is functional specificity of ubiq-
uitin signaling achieved in vivo? Even
though evidence indicates that specific
chain types control distinct molecular
processes, as clearly exemplified by
NF-kB signaling, we speculate that addi-
tional signals (monoubiquitin and chains
with different linkage and length) can
control the same molecular process with
different kinetics and spatial constraints.
It has also been speculated that unan-
chored ubiquitin chains can regulate
NF-kB activation (Xia et al., 2009).
However, the importance of this regula-
tory mechanism in vivo remains to be
further investigated. Therefore, the de-
coding of ubiquitin signals might be per-
formed in vivo by different UBDs (not
necessarily endowed with absolute selec-
tivity toward monoubiquitin or a particular
chain type) embedded in key proteins
controlling a particular process. Although
this scenario could allow a certain degree
of plasticity in ubiquitin signaling, speci-
ficity might be determined by the localiza-
tion and assembly of UBD-containing
proteins and enzymes catalyzing ubiquiti-
nation reactions.
Catching Ubiquitin Signalingin the ActThe huge discrepancy between our
current understanding of the ubiquitin
system from in vitro studies compared to
in vivo models stems from the fact that
ubiquitination and its recognition and
cleavage occur in milliseconds (Pierce
et al., 2009), therefore making it chal-
lenging to analyze these events in living
systems. The first attempts to study ubiq-
uitin signaling in vivo have used anti-
bodies against monoubiquitin, polyubi-
quitin chains, or, more recently, selective
linkages, including K11, K48, K63, and
linear chains (Matsumoto et al., 2010;
Newton et al., 2008; Wang et al., 2008;
Tokunaga et al., 2009) (Figure 1A). Raising
linkage-selective antibodies is not easy,
despite being urgently needed to provide
tools to discriminate between different
chain types in the cell. These antibodies
were produced either by synthesizing
peptides resembling specific linkage
bonds (Wang et al., 2008; Tokunaga
et al., 2009) or by using the phage-display
method (Matsumoto et al., 2010; Newton
et al., 2008). Although chain-selective
antibodies have been used to demon-
strate specific chain formation in several
biological settings (such as the NF-kB
pathway and cell-cycle progression), their
ability to monitor substrates with low
abundance and the dynamics of chain
(de)conjugation as well as their distribu-
tion in vivo are still very limited.
Monoclonal antibodies recognizing di-
glycine-modified lysines have been used
in combination with mass spectrometry
in efforts to increase the sensitivity of
immune-based techniques (Xu et al.,
2010) (Figure 1B). These antibodies enrich
678 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
for the C-terminal di-glycine
motif of ubiquitin attached to
the acceptor lysine following
proteolysis of ubiquitinated
proteins by trypsin (Fig-
ure 1B). This method revealed
more than 200 ubiquitinated
proteins from human embry-
onic kidney 293 cells, the
majority of which were previ-
ously unknown targets (Xu
et al., 2010). This strategy
can be coupled to stable
isotope labeling with amino
acids in cell culture (SILAC)
to quantitatively explore pro-
tein ubiquitination in diverse
biological settings. However,
it needs to be noted that
this approach can neither
detect short-lived proteins
nor distinguish lysine modifi-
cation by NEDD8.
The AQUA (absolute quan-
tification) method developed
in the Gygi laboratory is
another promising approach
to measure the dynamics of
ubiquitin signaling in cells
(Kirkpatrick et al., 2005).
AQUA relies on the use of
stable isotope-labeled inter-
nal standard peptides that
mimic those produced during
tryptic digestion of ubiquiti-
nated proteins of interest.
In case of mono- or polyubi-
quitinated proteins, tryptic
digestion produces a series
of unbranched and di-glycine-
branched peptides. Initial analysis of
such mixtures allows identification of
ubiquitination sites in the substrate and
the type of ubiquitin chain linkage (such
as monoubiquitination or K63- or K48-
ubiquitin chains). Based on this informa-
tion, substrate-, site-, and linkage-specific
reference peptides are synthesized and
used as quantitative internal standards,
allowing for precise quantification of
monoubiquitin and polyubiquitin chains
by targeted proteomics approaches such
as selective reaction monitoring. With
this methodology, the stoichiometry of
ubiquitin moieties on a protein of interest
can be determined (Figure 2A). Its
simplicity and sensitivity, coupled with
the current widespread availability of
tandem mass spectrometers, makes
AQUA the tool of choice for quantitatively
measuring ubiquitin modifications directly
in cell lysates (Kirkpatrick et al., 2006).
What Is Known about UbiquitinChain Length In Vivo?The methods described above are pre-
dicted to provide quantitative information
on the repertoire of ubiquitin signals and
ubiquitinated proteins generated in dif-
ferent biological settings. However, these
methods cannot monitor the length of
ubiquitin chains in vivo. At present, all
our knowledge on their length in vivo
relies on nonquantitative analysis of
immunoblots. Several procedures have
been designed to cause ubiquitin chains
and polyubiquitinated substrates to accu-
mulate in the cell to facilitate
their detection, including the
use of inhibitors of the pro-
teasome and of deubiquiti-
nating enzymes (DUBs). This
has often led to the conclu-
sion that high-mobility ubiqui-
tin-positive smears observed
on immunoblots represent
the natural modification of
substrates by very long ubiq-
uitin chains. This, however,
can be misleading because
the combination of different
ubiquitin signals (monoubi-
quitin or ubiquitin chains) on
the same type of substrate
can also yield high-mobility
smears (Haglund et al.,
2003; Huang et al., 2006),
and inhibition of DUBs and
the proteasome may cause
an overrepresentation of
long ubiquitin chains that
might not naturally occur in
the cell.
The question of chain
length is important given that
chains with different topology
and length may regulate dif-
ferent cellular functions. For
instance, the length of K48-
linked tetraubiquitin chains
is optimized for interaction
with proteasomal receptors
(Pickart and Fushman, 2004),
as a ternary complex can
be formed between the ubiq-
uitin chains and proteasomal
receptors Rpn13 and S5a (Zhang et al.,
2009). Moreover, given that trimming
of ubiquitinated substrates occurs from
the distal end of the chains, it seems
that the length of K48-linked chains
dictates the duration of proteasomal
degradation (Lee et al., 2010).
Monoubiquitination can also drive pro-
teins to proteasomal degradation (Shabek
et al., 2009). These observations collec-
tively suggest that the ubiquitin chain
length required for proteasomal degrada-
tion is determined by the substrate’s
affinity for the proteasome and must be
just high enough to allow processivity of
the proteolytic process. This kind of
adjustment is most likely controlled by
a proteasome-associated complex,
which is equipped with both ubiquitin
Figure 1. Antibodies for Ubiquitin Signals(A) Linkage-specific antibodies, such as a-lysine 11(K11)-, a-K48-, a-K63-linked ubiquitin chains and a-linear ubiquitin chains, can be applied for thedetection of endogenous ubiquitination of a specific linkage type.(B) After trypsin digestion of total cell extracts, immunoprecipitation of thesamples by a specific antibody against glycine-glycine-lysine peptides(a-GGK Ab) can enrich fragments with ubiquitinated K residues from bothsubstrates and ubiquitin chains. Analysis by mass spectrometry enables theidentification of new target proteins as well as sites of ubiquitination.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 679
ligase (HUL5) and deubiquiti-
nating (UBP6) activities (Cro-
sas et al., 2006).
In the case of the NF-kB
pathway, distinct activation
steps involve K63, linear,
and K48 chains (Bianchi and
Meier, 2009), which are
further edited (in length and
topology) by ligases and
DUBs (Wertz et al., 2004;
Newton et al., 2008). An initial
mechanism proposed for NF-
kB activation implicated long
K63-linked chains in the
recruitment of TAK1 and IKK
kinases via their respective
adaptor proteins TAB2 and
NEMO (reviewed in Bianchi
and Meier, 2009). This model
has been challenged by the
demonstration that cells ex-
pressing ubiquitin lacking
K63 have intact NF-kB
signaling via tumor necrosis
factor-a receptors (Xu et al.,
2009). Interestingly, based
on available structures it
appears that chain-selective
UBDs in TAB2 and NEMO
interact with K63-linked or
linear diubiquitin chains,
respectively (Kulathu et al.,
2009; Rahighi et al., 2009;
Sato et al., 2009). Given that
no data are available on the
precise length of ubiquitin
chains in the NF-kB pathway,
it is tempting to speculate
that diubiquitin chains are
the fundamental units recog-
nized by selective UBDs.
However, UBDs also show
promiscuous binding with
lower affinities to other types
of chains. Examples include
the NZF domain of TAB2,
which also binds K48 chains
in solution (Kulathu et al.,
2009), and the UBAN domain
in NEMO, which interacts
with K63- and K48-linked
chains longer than diubiquitin
(Rahighi et al., 2009). We
speculate that diubiquitin
units in longer chains may
amplify signals that can be
recognized by nonselective
UBDs. In such a scenario,
short ubiquitin chains added
to substrates will be preferen-
tially decoded by linkage-
selective UBDs, whereas
long chains may be promis-
cuously read by different
UBDs, possibly placing chain
length next to chain linkage
type in determining ubiquitin-
UBD selectivity.
Development of SensorsUsing Selective UBDsIn order to measure the
dynamics of ubiquitin chain
formation/disassembly and
their length in vivo, functional
ubiquitin sensors are needed
(Figure 2B). A recently engi-
neered sensor (TUBE, tan-
dem repeated ubiquitin enti-
ties) possesses four tandem
UBA domains of either HR23
or ubiquitin 1 (Hjerpe et al.,
2009). The ubiquitin-binding
capacity of TUBE is markedly
higher for ubiquitin tetramers
in comparison to monoubi-
quitin. In addition, the affinity
of the interaction of TUBE
with either K63- or K48-tet-
raubiquitin chains is much
greater than that of a single
UBA domain (Hjerpe et al.,
2009). An intriguing feature
of TUBE is its ability to pro-
tect ubiquitin chains from
cleavage by blocking acces-
sibility to DUBs.
The design principle of
TUBE could be easily adap-
ted to other UBDs: for ex-
ample, a K63 chain-specific
sensor could be created by
fusing multiple NZF domains
of TAB2 in tandem, a K48-
specific sensor by merging
multiple Pru domains of
Rpn13, and a linear-specific
sensor by arraying several
copies of the UBAN domain
of NEMO or ABINs. These
UBD-derived ubiquitin sen-
sors could be used to protect
and purify substrates deco-
rated with endogenous ubiq-
uitin chains. They could also
Figure 2. Quantification and Detection of Ubiquitin Chains In Vivo(A) The workflow for the AQUA (absolute quantification) method of quantitativemass spectrometry is depicted. First, a representative tryptic peptide is selectedbased on initial proteomic sequencing experiments and then synthesized witha stable isotope at one residue for identification. The tryptic peptide sequencefor lysine48 (K48)-linkedubiquitinchains is indicated (upper panel).AQUApeptidestandards are added to the sample (cell lysates or immunocomplexes) prior totrypsin digestion and targeted proteomic analysis is performed using selectivereaction monitoring. The amount of total protein and the extent of ubiquitinationat that particular site can be determined by comparing the precise amounts ofthe unmodified and ubiquitinated versions of the peptide (lower panel).(B) Schematic models of ubiquitin sensors are shown. By using different ubiq-uitin-binding domains (UBDs), the sensor can be applied for specific linkagetype of ubiquitin chains (left), such as K48, K63, and linear chains. TandemUBDs may be used to determine the chain length (right). One UBD recognizes1 unit of diubiquitin. The tag chosen depends on the experimental purposes.
680 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
be used to determine the predominant
linkage type within these chains by
competition experiments and for
measuring the length of ubiquitin poly-
mers in their natural environment.
A further critical challenge will be to
evaluate chain-specific ubiquitin sensors
using advanced (high-throughput) single-
cell or -molecule microscopy. This might
permit the qualitative and quantitative
assessment of ubiquitin chain formation
and the interplay between different chain
types in vivo. Analyzing additional proper-
ties, such as the spatial and temporal
regulation of conjugation and deconjuga-
tion of ubiquitin chains as well as their
length in vivo, could enable a high-
resolution, systems-level analysis of the
‘‘ubiquitinome.’’
PerspectiveEven though we have attained a sophisti-
cated mechanistic understanding of the
ubiquitin system, it has been more difficult
to analyze the orchestration of its func-
tions in vivo. Within the cellular environ-
ment, ubiquitin signals must select the
correct binding partner at the right place
and time, ensuring accurate signaling.
To understand the specificity and
dynamics of the ubiquitin system in its
biological context, it is critical that highly
sensitive methods, such as mass spec-
trometry and advanced microscopy, are
deployed to measure key parameters,
such as the amount of different ubiquitin
signals, the kinetics of UBD-ubiquitin
recognition, and the type and length of
ubiquitin chains attached onto substrates
in vivo. By shedding light onto these prop-
erties, we will gain a deeper under-
standing of one of the most important
and widely used regulatory systems of
cell physiology.
ACKNOWLEDGMENTS
We are grateful to C. Behrends, A. Ciechanover, K.
Rittinger, and S. van Wijk for comments and
discussions. Research in the I.D. laboratory is sup-
ported by the Deutsche Forschungsgemeinschaft,
the Cluster of Excellence ‘‘Macromolecular
Complexes’’ of the Goethe University Frankfurt
(EXC115), and the European Research Council
under the European Union’s Seventh Framework
Programme (FP7/2007-2013)/ERC grant agree-
ment n� [250241-LineUb].
REFERENCES
Bianchi, K., and Meier, P. (2009). Mol. Cell 36,
736–742.
Bienko, M., Green, C.M., Crosetto, N., Rudolf, F.,
Zapart, G., Coull, B., Kannouche, P., Wider, G.,
Peter, M., Lehmann, A.R., et al. (2005). Science
310, 1821–1824.
Bremm, A., Freund, S.M., and Komander, D.
(2010). Nat. Struct. Mol. Biol. 17, 939–947.
Crosas, B., Hanna, J., Kirkpatrick, D.S., Zhang,
D.P., Tone, Y., Hathaway, N.A., Buecker, C., Leg-
gett, D.S., Schmidt, M., King, R.W., et al. (2006).
Cell 127, 1401–1413.
Deshaies, R.J., and Joazeiro, C.A. (2009). Annu.
Rev. Biochem. 78, 399–434.
Dikic, I., Wakatsuki, S., and Walters, K.J. (2009).
Nat. Rev. Mol. Cell Biol. 10, 659–671.
Haglund, K., Sigismund, S., Polo, S., Szymkiewicz,
I., Di Fiore, P.P., and Dikic, I. (2003). Nat. Cell Biol.
5, 461–466.
Hershko, A., and Ciechanover, A. (1998). Annu.
Rev. Biochem. 67, 425–479.
Hicke, L., and Dunn, R. (2003). Annu. Rev. Cell Dev.
Biol. 19, 141–172.
Hjerpe, R., Aillet, F., Lopitz-Otsoa, F., Lang, V.,
England, P., and Rodriguez, M.S. (2009). EMBO
Rep. 10, 1250–1258.
Huang, F., Kirkpatrick, D., Jiang, X., Gygi, S., and
Sorkin, A. (2006). Mol. Cell 21, 737–748.
Husnjak, K., Elsasser, S., Zhang, N., Chen, X., Ran-
dles, L., Shi, Y., Hofmann, K., Walters, K.J., Finley,
D., and Dikic, I. (2008). Nature 453, 481–488.
Ikeda, F., and Dikic, I. (2008). EMBO Rep. 9,
536–542.
Iwai, K., and Tokunaga, F. (2009). EMBO Rep. 10,
706–713.
Jin, L., Williamson, A., Banerjee, S., Philipp, I., and
Rape, M. (2008). Cell 133, 653–665.
Kirkin, V., McEwan, D.G., Novak, I., and Dikic, I.
(2009). Mol. Cell 34, 259–269.
Kirkpatrick, D.S., Weldon, S.F., Tsaprailis, G., Lie-
bler, D.C., and Gandolfi, A.J. (2005). Proteomics
5, 2104–2111.
Kirkpatrick, D.S., Hathaway, N.A., Hanna, J.,
Elsasser, S., Rush, J., Finley, D., King, R.W.,
and Gygi, S.P. (2006). Nat. Cell Biol. 8, 700–710.
Kulathu, Y., Akutsu, M., Bremm, A., Hofmann, K.,
and Komander, D. (2009). Nat. Struct. Mol. Biol.
16, 1328–1330.
Lee, M.J., Lee, B.H., Hanna, J., King, R.W., and
Finley, D. (2010). Mol. Cell. Proteomics 2010, 8.
Lo, Y.C., Lin, S.C., Rospigliosi, C.C., Conze, D.B.,
Wu, C.J., Ashwell, J.D., Eliezer, D., and Wu, H.
(2009). Mol. Cell 33, 602–615.
Matsumoto, M.L., Wickliffe, K.E., Dong, K.C., Yu,
C., Bosanac, I., Bustos, D., Phu, L., Kirkpatrick,
D.S., Hymowitz, S.G., Rape, M., et al. (2010).
Mol. Cell 39, 477–484.
Newton, K., Matsumoto, M.L., Wertz, I.E., Kirkpa-
trick, D.S., Lill, J.R., Tan, J., Dugger, D., Gordon,
N., Sidhu, S.S., Fellouse, F.A., et al. (2008). Cell
134, 668–678.
Pickart, C.M., and Fushman, D. (2004). Curr. Opin.
Chem. Biol. 8, 610–616.
Pierce, N.W., Kleiger, G., Shan, S.O., and
Deshaies, R.J. (2009). Nature 462, 615–619.
Rahighi, S., Ikeda, F., Kawasaki, M., Akutsu, M.,
Suzuki, N., Kato, R., Kensche, T., Uejima, T., Bloor,
S., Komander, D., et al. (2009). Cell 136, 1098–
1109.
Raiborg, C., and Stenmark, H. (2009). Nature 458,
445–452.
Sato, Y., Yoshikawa, A., Yamashita, M., Yamagata,
A., and Fukai, S. (2009). EMBO J. 28, 3903–3909.
Shabek, N., Herman-Bachinsky, Y., and Ciechan-
over, A. (2009). Proc. Natl. Acad. Sci. USA 106,
11907–11912.
Sims, J.J., and Cohen, R.E. (2009). Mol. Cell 33,
775–783.
Tokunaga, F., Sakata, S., Saeki, Y., Satomi, Y., Kir-
isako, T., Kamei, K., Nakagawa, T., Kato, M., Mur-
ata, S., Yamaoka, S., et al. (2009). Nat. Cell Biol. 11,
123–132.
Ulrich, H.D., and Walden, H. (2010). Nat. Rev. Mol.
Cell Biol. 11, 479–489.
Virdee, S., Ye, Y., Nguyen, D.P., Komander, D.,
and Chin, J.W. (2010). Nat. Chem. Biol. 6, 750–757.
Wang, H., Matsuzawa, A., Brown, S.A., Zhou, J.,
Guy, C.S., Tseng, P.H., Forbes, K., Nicholson,
T.P., Sheppard, P.W., Hacker, H., et al. (2008).
Proc. Natl. Acad. Sci. USA 105, 20197–20202.
Wertz, I.E., O’Rourke, K.M., Zhou, H., Eby, M., Ara-
vind, L., Seshagiri, S., Wu, P., Wiesmann, C.,
Baker, R., Boone, D.L., et al. (2004). Nature 430,
694–699.
Wickliffe, K., Williamson, A., Jin, L., and Rape, M.
(2009). Chem. Rev. 109, 1537–1548.
Winget, J.M., and Mayor, T. (2010). Mol. Cell 38,
627–635.
Xia, Z.P., Sun, L., Chen, X., Pineda, G., Jiang, X.,
Adhikari, A., Zeng, W., and Chen, Z.J. (2009).
Nature 461, 114–119.
Xu, G., Paige, J.S., and Jaffrey, S.R. (2010). Nat.
Biotechnol. 28, 868–873.
Xu, M., Skaug, B., Zeng, W., and Chen, Z.J. (2009).
Mol. Cell 36, 302–314.
Zhang, N., Wang, Q., Ehlinger, A., Randles, L.,
Lary, J.W., Kang, Y., Haririnia, A., Storaska, A.J.,
Cole, J.L., Fushman, D., et al. (2009). Mol. Cell
35, 280–290.
Zhao, S., and Ulrich, H.D. (2010). Proc. Natl. Acad.
Sci. USA 107, 7704–7709.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 681
Leading Edge
Minireview
Ubiquitin: Same Molecule,Different Degradation PathwaysMichael J. Clague1,* and Sylvie Urbe1,*1Cellular and Molecular Physiology, Institute of Translational Medicine, University of Liverpool, Crown Street, Liverpool L69 3BX, UK
*Correspondence: [email protected] (M.J.C.), [email protected] (S.U.)DOI 10.1016/j.cell.2010.11.012
Ubiquitin is a common demoninator in the targeting of substrates to all three major protein degra-dation pathways in mammalian cells: the proteasome, the lysosome, and the autophagosome. Thefactors that direct a substrate toward a particular route of degradation likely include ubiquitin chainlength and linkage type, which may favor interaction with particular receptors or confer differentialsusceptibility to deubiquitinase activities associated with each pathway.
The dynamic state of bodily proteins was established by
analyzing the fate of stable isotope-labeled amino acids that
had been fed to mice. These classic experiments, conducted
by Rudolf Schoenheimer in the late 1930s, presage modern
stable isotope labeling techniques (such as SILAC), which allow
determination of the turnover rate of hundreds to thousands of
individual proteins in a single mass spectrometry experiment
(Kristensen et al., 2008). After its discovery, the lysosomal
compartment was considered the principal site of degradation
of cellular proteins, through the action of resident acid-depen-
dent proteases. However, this view perished with the demon-
stration that the half-lives of most cellular proteins are insensitive
to alkalinization of the lysosomes. The subsequent discovery of
the ubiquitin-proteasome degradation system as the major route
to protein degradation generated a new orthodoxy. Central to
this model is the idea that covalent modification of substrate
proteins with a polypeptide ubiquitin tag targets them to the large
(26S) proteolytic complex known as the proteasome.
It came then as a surprise to discover that ubiquitin tagging also
provides a signal to route endocytosed receptors to the lyso-
somal degradation pathway and more recently to mark organ-
elles for disposal by the third major cellular degradative pathway
of autophagocytosis. The role of ubiquitin in protein degradation
is more ubiquitous than once thought (Figure 1). In this Minire-
view, we consider how a ubiquitin tag selects for specific degra-
dation pathways and also highlight the interplay between these
pathways that a shared dependence on ubiquitin engenders.
General ConsiderationsSubstrate proteins are selected for modification of lysine resi-
dues by ubiquitin through interaction with an E3 ligase protein
that recruits an E2-enzyme charged with ubiquitin. This can
result in transfer of a single ubiquitin molecule (monoubiquitina-
tion) or coupling of further ubiquitin molecules, through integral
lysine residues, to form a chain. The seven lysines of ubiquitin
provide for the formation of different isopeptide chain linkages,
which adopt different three-dimensional structures, and all of
which are represented in eukaryotic cells (Xu et al., 2009). The
specific combination of E2 and E3 enzymes recruited to
a substrate dictates the chain linkage type. The human genome
encodes more than 20 different types of ubiquitin-binding
domains, and proof of principle for linkage specificity of binding
has been established (see Essay by F. Ikeda, N. Crosetto, and
I. Dikic on page 677 of this issue). One means to achieve this is
through the spatial arrangement of tandem ubiquitin-binding
domains (UBDs) either encoded in a single protein or by
combining domains within a multimolecular complex, such that
simultaneous occupancy of two binding sites is restricted to
particular chain configurations.
Proteasomal DegradationEarly work suggested that proteasomal targeting requires
a lysine 48 (K48)-linked ubiquitin chain consisting of at least
four conjoined ubiquitin molecules. This was based first upon
the biochemical analysis of chains formed on a model substrate,
b-galactosidase, in a reticulocyte lysate system and second
upon studies showing that unique among lysine mutant versions
of ubiquitin, K48R cannot serve as the sole source of ubiquitin in
yeast (Finley, 2009; Xu et al., 2009). The affinity of unanchored
K48 polyubiquitin chains for the proteasome increases more
than 100-fold from di- to tetraubiquitin (�170 nM) and less
steeply thereafter (Thrower et al., 2000).
A body of work now suggests that in fact the proteasome
happily accepts other ubiquitin chain types. Indirect evidence
for this comes from the observation that acute proteasome inhi-
bition does not lead to the selective accumulation of K48 chains.
Rather, all chain types with the exception of K63 are increased
(Jacobson et al., 2009; Xu et al., 2009). During cell division, the
human anaphase-promoting complex (APC/C) recruits two E2
ligases (UbcH10 and Ube2S), which combine to exclusively
generate K11-linked chains on substrates. Loss of this unit leads
to strong defects in mitotic progression due to failure of the
necessary degradation processes (Song and Rape, 2010).
In vitro studies have even shown that K63-modified dihydrofo-
late reductase provides an efficient proteasome substrate
(Hofmann and Pickart, 1999).
The proteasome is composed of a core (20S) particle contain-
ing multiple proteolytic sites and a 19S regulatory particle that
682 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
governs access to the core. To enter the core, substrates must
be amenable to unfolding by a hexamer of ATPases associated
with the base of the regulatory particle. Other constituents of the
regulatory particle are implicated in the recruitment of substrates
(Finley, 2009). Rpn10 and Rpn13 interact with ubiquitinated
substrates through UIM (ubiquitin-interacting motif) domains
and a Pru (pleckstrin-like receptor for ubiquitin) domain, respec-
tively. The UBL/UBA family of proteins are substoichiometric
components of purified proteasomes that bind ubiquitin via their
UBA (ubiquitin-associated) domain and the proteasome regula-
tory particle through its UBL (ubiquitin-like) domain. They are
proposed to remotely scavenge ubiquitinated substrates and
present them to the proteasome (Figure 2). Particular protea-
some-associated ubiquitin receptors have been linked with the
degradation of specific substrates (reviewed in Finley, 2009).
The mammalian regulatory particle has three associated deu-
biquitinating enzymes (DUBs), POH1/PSMD14, USP14, and
UCH37 (Rpn11 and Ubp6 in budding yeast), which have distinct
specificities for different chain linkages (Finley, 2009). What is the
function of these DUB activities? One important function is to
salvage ubiquitin in order to maintain the cellular ubiquitin pool.
The JAMM/MPN+ metalloprotease POH1 is thought to specifi-
cally disassemble K63-linked chains, as well as cleave the
isopeptide bond that links the substrate and the proximal ubiqui-
tin, allowing for en bloc removal of an ubiquitin chain. It also
governs entry into the central proteolytic chamber, thereby
coupling substrate degradation to recycling of ubiquitin (Yao
and Cohen, 2002). Ubiquitin-aldehyde-sensitive cysteine
protease activities (that is, USP14 and UCH37) account for all
activity directed toward K48-linked chains and also contribute
to K63-linked chain disassembly (Jacobson et al., 2009). One
attractive notion is that the integration of these DUB activities
may provide for a proof-reading mechanism, facilitating release
from the proteasome if commitment to degradation is not
accomplished within a given time window. For example, prefer-
ential proteasomal DUB activity against K63-linked chains has
been proposed to select against these substrates for degrada-
tion (Jacobson et al., 2009). Also in line with this principal,
Figure 1. Ubiquitin Is a Common Denominator of Protein Degrada-
tion PathwaysSpecific ubiquitin receptors are associated with each degradation pathway.Autophagosomal and multivesicular body (MVB) pathways merge at the lyso-some and share a dependence on v-ATPase activity (inhibited by bafilomycin).Both pathways also share sensitivity to inhibitors of phosphoinositide 3-kinaseactivity, such as wortmannin or 3-methyladenine, as the family memberhVPS34 is required both for recruitment of ESCRT (endosomal sortingcomplex required for transport) components to MVBs and for expansion ofthe double-membrane preautophagosomal structure. Proteasomal inhibitorsinclude lactacystin and epoxomicin.
Figure 2. Ubiquitin Recognition by the Major Degradative PathwaysDepiction of the ‘‘ubiquitin receptors’’ associated with each degradativepathway. The domain structures shown are for the human representatives ofeach protein family, except for yeast Ddi1, the human ortholog of whichdoes not contain a UBA domain. CB: clathrin-binding motif; CC: coiled coil;ESCRT: endosomal sorting complex required for transport; GGA: golgi-asso-ciated, gamma adaptin ear containing, ARF-binding protein; GAE: gammaadaptin ear; GAT: GGA and TOM1; GLUE: GRAM-like ubiquitin-binding inEap45; HRS: HGF receptor tyrosine kinase substrate; LIR: LC3-interactingregion; PB1: Phox and Bem1; PRU: Pleckstrin-like receptor for ubiquitin;SH3: Src homology domain 3; STAM: signal transducing adaptor molecule;TOM1: target of myb1; TSG101: tumor susceptibility gene 101; UBA: ubiqui-tin-associated domain; UBL: ubiquitin-like domain; UEV: ubiquitin E2 variantdomain; UIM: ubiquitin-interacting motif; VHS: Vps27, HRS, and STAM;VPS36: vacuolar protein sorting 36; vWFA: von Willebrand Factor type A;ZZ: zinc finger. Note the following gene names and commonly used alternativenames also apply: p62; SQSTM1 (sequestosome), NDP52; CALCOCO2,UBQLN1; PLIC1; DSK2. Domain annotation based on PFAM and UNIPROT.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 683
a specific chemical inhibitor of USP14 has recently been shown
to enhance the rate of protein degradation (Lee et al., 2010).
In yeast, a ubiquitin ligase, Hul5 (mammalian ortholog is
KIAA10/E3a), that is associated with proteasomes can oppose
Ubp6 activity through chain elongation (E4) (Crosas et al.,
2006). Thus a balance between proteasome-associated ubiqui-
tin ligase and DUB activity may determine receptor fate.
Endolysosomal DegradationThe lysosomal degradation pathway is the principle means by
which a cell turns over plasma membrane proteins, such as recep-
tors or channels. Its defining characteristic is a requirement for
organelle acidification, mediated by the v-ATPase. Endocytosed
proteins are either recycled to the plasma membrane or captured
into lumenal vesicles of the multivesicular body (MVB) as it
matures from the sorting endosome, before fusing directly with
lysosomes. Some receptors use ubiquitin as an internalization
signal, but for other ubiquitinated receptors, such as epidermal
growth factor receptor, this is secondary to, or redundant with,
other adaptor-binding motifs. Ubiquitination directs internalized
proteins toward lysosomal degradation by engagement with en-
dosomal sorting complexes required for transport (ESCRTs) (re-
viewed in Clague and Urbe, 2006). Monoubiquitination, in the
form of an irreversible linear fusion appended to various receptors,
is a sufficient signal for this sorting step. However, evidence
suggests K63 as the primary ubiquitin chain type involved in endo-
somal sorting. Early studies in yeast cells, which suggested that
appendage of K63-linked diubiquitin enhances vacuolar sorting,
have been recently elaborated on with a detailed analysis of the
downregulation of the Gap1 permease. These studies conclude
that monoubiquitination is sufficient for initial internalization (at
least so long as it is an irreversible linear fusion) but that efficient
sorting at the endosome by the ESCRT machinery requires K63-
linked polyubiquitin (Lauwers et al., 2009). Concordantly, studies
of the mammalian TrkA and MHC class I proteins reveal their utili-
zation of K63-linked polyubiquitination for routing to the lysosome
(Duncan et al., 2006; Geetha and Wooten, 2008).
The first point of engagement of ubiquitinated cargo with the
MVB sorting machinery is proposed to be the ESCRT-0 complex,
comprising HRS and STAM, both of which possess UIM and VHS
(Vps27, HRS, and STAM) domains, which can bind ubiquitin
(Figure 2). Intact ESCRT-0 binds 50 times more tightly to K63-
linked tetraubiquitin than to monoubiquitin, but only 2-fold more
tightly than to K48-tetraubiquitin (Ren and Hurley, 2010).
ESCRT-0 is recruited to endosomes through binding to phospha-
tidylinositol 3-phosphate but also binds to clathrin and the down-
stream ESCRT-I complex. An alternative ESCRT-0 complex
comprising TOM1, Tollip, and Endofin possesses all these salient
features of the HRS-STAM complex. It is currently unclear
whether these two complexes are redundant or used to receive
different cargoes. In a further striking parallel to the proteasomal
system, the ESCRT machinery has known associations with at
least two DUB activities, AMSH and USP8 (UBPY), drawn from
the JAMM/MPN+ and USP families, respectively. In yeast, the
dominant endocytic E3 ligase activity Rsp5 can also associate
with the STAM ortholog Hse1, providing a counterbalance to
Ubp2 and Ubp7 (Ren et al., 2007), while a third ESCRT-associ-
ated DUB Doa4 is required for ubiquitin recycling of receptors
that are committed to degradation. Although deubiquitination is
not an obligate step for MVB sorting, proof-reading and ubiquitin
recycling roles akin to those suggested for proteasomal DUBs
are consistent with available data (Clague and Urbe, 2006).
AutophagyThe signature of autophagy is the capture of cytosol and organ-
elles through envelopment within a double-membrane compart-
ment derived from the preautophagosomal structure. In
common with the MVB, the autophagosome can then directly
fuse with late endosomes or lysosomes to form the autolyso-
some, wherein the double-membrane structure is digested. It
is well suited for the digestion of cytosolic entities, which are
incompatible with unfolding by the proteasome, such as organ-
elles or protein aggregates.
Identification of autophagy (Atg) genes and subsequent
biochemical characterization revealed two essential posttransla-
tional modification pathways, which resemble ubiquitination.
In one case, Atg12 is stably conjugated to Atg5 in a constitutive
fashion. In the second case, Atg8 is conjugated to the lipid phos-
phatidylethanolamine by transfer from an E2 enzyme following the
onset of autophagy (for example, as induced by amino acid depra-
vation). This is a prerequisite for the expansion of the preautopha-
gosomal structure, perhaps by facilitating fusion between
membranes. Inmammalian cells,Atg8 is known as LC3and its lipi-
dated form as LC3-II. In fact, there are six Atg8 homologs in the
human genome collectively known as the LC3/GABARAP family.
Whereas autophagy is generally thought of as a nonselective
degradation process, certain structures and organelles are selec-
tively removed by this pathway. For example, mitochondria are
lost during reticulocyte maturation and as a consequence of un-
coupling (disconnecting the electron transport chain from ATP
production) in cultured cells. Ribosomes, peroxisomes, and path-
ophysiological protein aggregates can also be degraded by
autophagy. Recent studies have led to the proposal of a common
principle involved in ‘‘selective autophagies’’ and once againubiq-
uitin plays a critical role (Kirkin et al., 2009). In general if the body to
be cleared is ubiquitinated, then an adaptor molecule is required
to couple this to the preautophagosomal membrane rich in
Atg8/LC3. The prototypical adaptor of this class is p62/sequesto-
some 1, which contains both a ubiquitin-interacting domain (UBA)
and a LIR motif (LC3-interacting region), a domain structure
shared with Neighbor of BRCA1 gene 1 (NBR1) (Figure 2) (Pankiv
et al., 2007). p62 has been previously implicated in the clearing of
protein aggregates, which are known to be concentrated in ubiq-
uitin. Recent data have indicated an essential role for ubiquitin
(K63 and K27 polyubiquitin chain linkages have been implicated)
in the selective autophagy of depolarized mitochondria, which
become ubiquitinated following recruitment of the E3 ubiquitin
ligase Parkin (Geisler et al., 2010). Using a lysine-less mutant of
ubiquitin fused with red fluorescent protein, Kim et al. established
that irreversible monoubiquitination is sufficient to concentrate
a soluble protein within autophagosomal structures in a p62-
dependent manner (Kim et al., 2008).
A selective pathway requiring the Ubp3:Bre5 DUB complex in
Saccharomycescerevisiaeoperates in the removal of mature ribo-
somes (Kraft and Peter, 2008). In cells deficient in Ubp3, ribosomal
fractions are enriched with ubiquitin. Although an intimate
684 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
connection has been established, the exact role of ubiquitin in ri-
bophagy is unclear. One model posits that ubiquitin may be pro-
tecting ribosomes from autophagy, which is then promoted by
Ubp3 activity. Alternatively, a dynamic modification with ubiquitin
may be required, perhaps as an engulfment signal similar to that of
mitochondria. In support of this notion, a temperature-sensitive
defect in the E3 ligase Rsp5 shows a synthetic ribophagy defect
with loss of Ubp3 ascompared withcells lacking Ubp3alone (Kraft
and Peter, 2008). If correct, then the principle of ensuring ubiquitin
homeostasis through deubiquitination may be conserved by each
of the selective degradation pathways we have discussed.
The Interdependence of Degradation PathwaysThe relative contribution of degradation pathways may vary
greatly between cell types. In most cases of cells cultured under
stress-free conditions, proteasomal degradation predominates,
but in muscle cells, lysosomal pathways (principally autophagy)
can account for 40% of degradation of long-lived proteins. In
atrophying muscle cells, both pathways are proposed to be
co-ordinately upregulated under the transcriptional control of
FOXO3 (Zhao et al., 2007). However, the proteasome is itself
degraded by starvation-induced bulk autophagy (Kristensen
et al., 2008).
The reliance of three major cellular degradation pathways
upon ubiquitination suggests that specific inhibition of any one
pathway may perturb the ubiquitin economy of the cell and
hence indirectly affect other degradation events (Figure 1).
A clear example of this is the activated Met receptor, for which
its lysosomal degradation is exquisitely sensitive to the depletion
in free ubiquitin caused by proteasomal inhibition (Carter et al.,
2004). Proteasome inhibition may also induce autophagy as
a compensatory response. The autophagy adaptor protein p62
has also been implicated in proteasomal degradation, whereas
the E3 ligase Parkin generates an autophagy tag on mitochon-
dria but elsewhere can target proteins to the proteasome.
VCP/p97 co-ordinates a number of ubiquitin-dependent
processes that include the proteasome-dependent ERAD (endo-
plasmic reticulum-associated degradation) pathway but inter-
estingly has recently been identified as a necessary factor for
autophagosome maturation under basal conditions and
following proteasome inhibition (Tresse et al., 2010).
The MVB and autophagy pathways merge at the late endo-
some/lysosome and are both sensitive to proton pump and
phosphoinositide 3-kinase inhibitors. Autophagosome formation
is inherently sensitive to perturbations earlier in the endocytic
pathway, which change the character of later endosomal
compartments (such as the composition of SNARE proteins).
Occasionally, teleological distinctions between these systems
blur, such that some ubiquitinated cytosolic proteins may be
degraded in the lysosome and cytoplasm-exposed domains of
receptors may be nibbled by the proteasome. Mounting
evidence suggests that there is a proteasome pool associated
with endosomes that influences receptor sorting (Geetha and
Wooten, 2008; Gorbea et al., 2010).
Concluding RemarksUbiquitin tagging is common to the three major cellular pathways
for protein degradation. Herein lies a conundrum: how is a given
substrate targeted to a particular pathway? Variable parameters
include location, chain length, and linkage type. A clear bias of
the endosomal pathway toward K63-linked chains has emerged.
This may simply reflect the subcellular localization of specific
E3 ligases in combination with a high local concentration of ubiq-
uitin-binding proteins, which couple to the ESCRT-machinery
rather than the proteasome. New techniques allow for the deter-
mination of individual protein turnover on a global scale (Kristen-
sen et al., 2008). This will enable the generation of a comprehen-
sive annotation of turnover rates as a function of experimental
perturbations or disease states, opening the door to
a systems-level understanding of protein degradation.
ACKNOWLEDGMENTS
S.U. is a Cancer Research UK Senior Research Fellow.
REFERENCES
Carter, S., Urbe, S., and Clague, M.J. (2004). J. Biol. Chem. 279, 52835–52839.
Clague, M.J., and Urbe, S. (2006). Trends Cell Biol. 16, 551–559.
Crosas, B., Hanna, J., Kirkpatrick, D.S., Zhang, D.P., Tone, Y., Hathaway, N.A.,
Buecker, C., Leggett, D.S., Schmidt, M., King, R.W., et al. (2006). Cell 127,
1401–1413.
Duncan, L.M., Piper, S., Dodd, R.B., Saville, M.K., Sanderson, C.M., Luzio,
J.P., and Lehner, P.J. (2006). EMBO J. 25, 1635–1645.
Finley, D. (2009). Annu. Rev. Biochem. 78, 477–513.
Geetha, T., and Wooten, M.W. (2008). Traffic 9, 1146–1156.
Geisler, S., Holmstrom, K.M., Skujat, D., Fiesel, F.C., Rothfuss, O.C., Kahle,
P.J., and Springer, W. (2010). Nat. Cell Biol. 12, 119–131.
Gorbea, C., Pratt, G., Ustrell, V., Bell, R., Sahasrabudhe, S., Hughes, R.E., and
Rechsteiner, M. (2010). J. Biol. Chem. 285, 31616–31633.
Hofmann, R.M., and Pickart, C.M. (1999). Cell 96, 645–653.
Jacobson, A.D., Zhang, N.Y., Xu, P., Han, K.J., Noone, S., Peng, J., and Liu,
C.W. (2009). J. Biol. Chem. 284, 35485–35494.
Kim, P.K., Hailey, D.W., Mullen, R.T., and Lippincott-Schwartz, J. (2008). Proc.
Natl. Acad. Sci. USA 105, 20567–20574.
Kirkin, V., McEwan, D.G., Novak, I., and Dikic, I. (2009). Mol. Cell 34, 259–269.
Kraft, C., and Peter, M. (2008). Autophagy 4, 838–840.
Kristensen, A.R., Schandorff, S., Høyer-Hansen, M., Nielsen, M.O., Jaattela,
M., Dengjel, J., and Andersen, J.S. (2008). Mol. Cell. Proteomics 7, 2419–2428.
Lauwers, E., Jacob, C., and Andre, B. (2009). J. Cell Biol. 185, 493–502.
Lee, B.H., Lee, M.J., Park, S., Oh, D.C., Elsasser, S., Chen, P.C., Gartner, C.,
Dimova, N., Hanna, J., Gygi, S.P., et al. (2010). Nature 467, 179–184.
Pankiv, S., Clausen, T.H., Lamark, T., Brech, A., Bruun, J.A., Outzen, H., Øver-
vatn, A., Bjørkøy, G., and Johansen, T. (2007). J. Biol. Chem. 282, 24131–
24145.
Ren, J., Kee, Y., Huibregtse, J.M., and Piper, R.C. (2007). Mol. Biol. Cell 18,
324–335.
Ren, X., and Hurley, J.H. (2010). EMBO J. 29, 1045–1054.
Song, L., and Rape, M. (2010). Mol. Cell 38, 369–382.
Thrower, J.S., Hoffman, L., Rechsteiner, M., and Pickart, C.M. (2000). EMBO J.
19, 94–102.
Tresse, E., Salomons, F.A., Vesa, J., Bott, L.C., Kimonis, V., Yao, T.P.,
Dantuma, N.P., and Taylor, J.P. (2010). Autophagy 6, 217–227.
Xu, P., Duong, D.M., Seyfried, N.T., Cheng, D., Xie, Y., Robert, J., Rush, J.,
Hochstrasser, M., Finley, D., and Peng, J. (2009). Cell 137, 133–145.
Yao, T., and Cohen, R.E. (2002). Nature 419, 403–407.
Zhao, J., Brault, J.J., Schild, A., Cao, P., Sandri, M., Schiaffino, S., Lecker,
S.H., and Goldberg, A.L. (2007). Cell Metab. 6, 472–483.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 685
Leading Edge
Perspective
Will the Ubiquitin System Furnish asMany Drug Targets as Protein Kinases?Philip Cohen1,2,* and Marianna Tcherpakov31MRC Protein Phosphorylation Unit2Scottish Institute for Cell SignallingSir James Black Centre, Dow Street, Dundee DD1 5EH, Scotland, UK3BCC Research, 40 Washington Street, Suite 110, Wellesley, MA 02481, USA
*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.11.016
Protein phosphorylation and protein ubiquitination regulate most aspects of cell life, and defects inthese control mechanisms cause cancer and many other diseases. In the past decade, proteinkinases have become one of the most important classes of drug targets for the pharmaceuticalindustry. In contrast, drug discovery programs that target components of the ubiquitin systemhave lagged behind. In this Perspective, we discuss the reasons for the delay in this pipeline, thedrugs targeting the ubiquitin system that have been developed, and new approaches that maypopularize this area of drug discovery in the future.
Protein Phosphorylation Drug DiscoveryIt can take years, even decades, before a field of research rea-
ches the stage of maturity at which its discoveries can obviously
be exploited for the improvement of health. An excellent example
of this paradigm is the regulation of protein function by reversible
phosphorylation. Phosphorylation was identified in the mid
1950s as a mechanism for controlling glycogenolysis. Twenty-
five years later, it was still largely thought of simply as a control
switch for metabolism. Indeed, researchers finally realized that
protein phosphorylation regulates most aspects of cell life only
after many advances made throughout the 1980s and early
1990s (Cohen, 2002a).
Surprisingly, the idea that it would be possible to treat diseases
with drugs targeting protein kinases was even slower to take
root. Indeed, as late as 1998, the Head of Research and Develop-
ment at one major pharmaceutical company (which no longer
exists) told one of the authors that ‘‘there was absolutely no
future in kinase drug discovery.’’ Later that same year,
researchers revealed the remarkable clinical efficacy of a tyrosine
kinase inhibitor, called Gleevec, for treating chronic myeloge-
nous leukemia. Quite quickly, protein kinases then became one
of the most popular classes of drug targets for the pharmaceu-
tical industry, especially in the field of cancer treatment.
Over the past decade, 16 drugs targeting one or more protein
kinases have been approved for clinical use in cancer, 12 taken
orally as pills and 4 that are injected. As of 2009, 153 other
protein kinase inhibitors were undergoing clinical trials, and 23
of these drugs were in the most advanced stage of development,
termed Phase III (Table 1) (Lawler, 2009). The current global
market for kinase therapies is about US$15 billion per annum,
and this value is forecasted to double by 2020. Research on
protein kinases currently accounts for �30% of the drug
discovery programs in the pharmaceutical industry and over
50% of cancer research and development. The kinase inhibitors
undergoing Phase III clinical trials include Pfizer’s JAK3 inhibitor
for rheumatoid arthritis (CP-690550) and Incyte Pharmaceuti-
cal’s JAK1/JAK2 inhibitor (INCB18424) for treating inflammatory
diseases. If these drugs are approved, it will likely spark a new
wave of interest in developing kinase inhibitors for the treatment
of diseases other than cancer.
Even by the late 1970s and early 1980s researchers had shown
that oncogenes, such as Src (sarcoma), are protein kinases;
phorbol esters, which promote tumors, are kinase activators;
and, growth factor receptors, which have kinase domains, are
overexpressed or mutated in human cancer (reviewed in Cohen,
2002b). So why did it take so long for most pharmaceutical
companies to capitalize on the therapeutic potential of kinase
inhibitors? In retrospect, one realizes that many researchers
believed that kinase inhibitors were bad drug targets because
they thought that it would be difficult to achieve the requisite
specificity and potency. Most protein kinase inhibitors target
the ATP-binding pockets of these enzymes, and the structural
similarities of this site among many different kinases raised the
suspicion that it would be impossible to develop drugs that in-
hibited only one type of protein kinase. Furthermore, the concen-
tration of ATP in the cell is extremely high (i.e., millimolar), leading
researchers to doubt whether compounds could be developed
with the potency needed to compete successfully with intracel-
lular ATP. These were, and indeed still are, challenging problems
for many developing kinase inhibitors, but they have proven to be
quite surmountable.
Indeed, considerable potency and specificity have been
achieved by developing compounds that target not only the
ATP-binding site but also small hydrophobic pockets located
proximal to the ATP-binding site. Moreover, researchers are
identifying an increasing number of ‘‘allosteric’’ inhibitors that
bind to other regions of a kinase. These compounds induce
conformational changes in the kinase, which either suppress
686 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
the enzyme’s activity directly or block its activation by another
kinase in the same signaling cascade.
Furthermore, far from being a disadvantage, lack of specificity
can actually be an advantage. For example, Gleevec was devel-
oped as an Abelson kinase inhibitor for the treatment of a specific
type of leukemia. However, it is also an effective treatment for
gastrointestinal stromal cancers because it inhibits the c-Kit
receptor and the platelet-derived growth factor (PDGF) receptor
tyrosine kinases, which are overexpressed or mutated in gastro-
intestinal cancers (Demetri et al., 2006). In addition, the efficacy
of several anticancer drugs depends on their combined inhibition
of several different kinases, and these drugs may be less prone
to the development of drug resistance than ones that act on only
one specific kinase. Thus, some of the original prejudices against
protein kinases as drug targets have subsequently turned out to
have little substance.
The beauty of targeting protein kinases for therapeutics and
the basis for their popularity is that the same technologies and
small-molecule libraries can be used to develop inhibitors of
many types of protein kinases in almost every therapeutic
area. However, the vast amount of medicinal chemistry that
has been carried out in recent years has meant that novel patent
space is becoming quite difficult to find. Plus, there is a growing,
but probably unfounded, concern that the most important drug
targets in this area have been fully exploited. Therefore, the phar-
maceutical industry has begun to wonder where they may find
the next large set of drug targets that can be tackled in a manner
analogous to protein kinases. In this Perspective, we discuss the
premise that components of the ubiquitin system are prime
candidates for these new targets.
Ubiquitination More Versatile than Phosphorylation?Ubiquitination is the covalent attachment of a small protein,
ubiquitin (�8.5 kDa), to other proteins. In the first step, a thioester
bond is formed between the C-terminal carboxylate group of
ubiquitin and the thiol or sulfhydryl group of a cysteine residue
on an E1-activating enzyme. Next, the ubiquitin is transferred
to a cysteine on an E2-conjugating enzyme. In the third step,
the E2 interacts with an E3 ligase, and the ubiquitin is then trans-
ferred from the E2 enzyme to substrates, which also interact with
the E3 ligase. This last step can occur directly, as in the RING E3
ligases, or it can occur indirectly with the ubiquitin first trans-
ferred to a cysteine residue on the E3 ligase before being linked
to the substrate, as in the HECT family of E3 ligases. Chains of
ubiquitin are created by the same enzymatic process.
Similar to phosphorylation, ubiquitin can be linked covalently
to only one or several amino acid residues on the same protein
(Figure 1). However, in contrast to protein phosphorylation, ubiq-
uitin can also form polyubiquitin chains. Ubiquitin has seven
lysine residues and an a-amino group; thus eight different types
of polyubiquitin chains can form (and probably more because
chains with ‘‘mixed’’ linkages are also present in cells).
Even greater versatility is provided by ubiquitin-like proteins,
such as Nedd8, SUMO (1, 2, and 3), FAT10, and ISG15, which
are also attached covalently to proteins in processes called ned-
dylation, SUMOylation, tenylation, and ISGylation, respectively.
The formation of polyubiquitin chains and the existence of these
‘‘ubiquitin-like modifiers’’ make the ubiquitin system a more
complex and potentially more versatile control mechanism
than phosphorylation.
Like phosphorylation, ubiquitination is reversible. Isopepti-
dases, called deubiquitinases or DUBs, catalyze the cleavage
of the ubiquitin from proteins or ‘‘deubiquitination’’ (Figure 1).
Interestingly, the number of deubiquitinases is comparable to
the number of protein phosphatases, but taken together, the
number of E1-activating enzymes, E2-conjugating enzymes,
and E3 ligases encoded by the human genome exceeds the
number of protein kinases.
Ubiquitination and Phosphorylation: Analogous ControlMechanismsFor many years, the sole function of the ubiquitin system was
thought to be the regulation of protein turnover inside the cell. At-
taching a chain of ubiquitins linked at lysine 48 (K48-linked poly-
ubiquitination) to a protein directs it to the 26S proteasome for
destruction, and indeed, this is one of the key functions of the
Table 1. Phosphorylation, Ubiquitination, and Drug Discovery
Phosphorylation Ubiquitination
First publication 1955a First publication 1978b
>500 protein kinasesc 10 E1sf, �40 E2sf, >600 E3 ligasesf
140 protein phosphatasesc �90 deubiquitinasesc
Nobel Prize awarded 1992d Nobel Prize awarded 2004e
First drug approved in 2001 (Gleevec) First drug approved in 2003 (Bortezomib)
16 drugs approved, over 150 undergoing clinical trials One drug approved, 16 undergoing clinical trials
Current sales �US$15 billion per year Current sales �US$1.4 billion per year
�30% of pharmaceutical research and development <1% of pharmaceutical research and developmenta Fischer and Krebs, 1955.b Ciechanover et al., 1978.c Encoded by the human genome.d Nobel Prize for Physiology or Medicine awarded to Edmond Fischer and Edwin Krebs.e Nobel Prize for Chemistry awarded to Aaron Ciechanover, Avram Hershko, and Irwin Rose.f Includes the E1s and E2s for ubiquitin-related modifiers such as Nedd8, SUMO, FAT10, and ISG15.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 687
ubiquitin system. However, other types of ubiquitination play
distinct roles in the cell and regulate diverse areas of biology,
as discussed in another article in this issue (Ikeda et al., 2010).
For example, K63-linked polyubiquitination (Bhoj and Chen,
2009; Zeng et al., 2010) and linear polyubiquitin chains
(Tokunaga et al., 2009) regulate innate immunity; K11-linked pol-
yubiquitin chains, which are formed by the anaphase-promoting
complex (APC/C) and the E2-conjugating enzyme UbcH10,
are critical for the regulation of mitosis (Garnett et al., 2009;
Jin et al., 2008); and K29/33-linked polyubiquitination inhibits
certain members of a protein kinase subfamily (Al-Hakim et al.,
2008).
Like phosphorylation, ubiquitination can also induce confor-
mational changes that alter biological function. For example,
the response to the proinflammatory cytokine interleukin-1 (IL-
1) generates K63-linked polyubiquitin chains that interact with
a component of the TAK1 complex, inducing a conformational
change that allows this protein kinase to autoactivate (Xia
et al., 2009). Similarly, monoubiquitination of the deubiquitinase
Ataxin 3 (Todi et al., 2009) and dihydrofolate reductase (Maguire
et al., 2008) enhances and suppresses their enzymatic activities,
respectively. In contrast, monoubiquitination of the tumor
suppressor p53 induces a conformational change that exposes
a nuclear export signal. This leads to the translocation of p53
to the cytosol where it may promote apoptotic events (Carter
et al., 2007). Neddylation of the Cullin RING E3 ligases (CRLs)
also induces conformational changes that bring the E2 active
site adjacent to the substrate, permitting the efficient ubiquitina-
tion of the substrate by CRLs (Saha and Deshaies, 2008).
Like phosphorylation, many effects of ubiquitination are medi-
ated by interactions with ubiquitin-binding proteins. Different
polyubiquitin chains adopt distinct three-dimensional structures
and hence interact with different polyubiquitin-binding proteins
to regulate distinct processes. For example, proteins tagged
with K48-linked polyubiquitin chains are targeted for destruction
because these ubiquitin chains bind to particular components of
the 26S proteasome. More than 20 different families of polyubi-
quitin-binding proteins have been identified, and this area has
become a large topic of research in its own right.
Interactions through ubiquitin are also critical for DNA-damage
signaling and for certain DNA-repair pathways. For example, the
monoubiquitinated form of FANCD2, a component of the Fanconi
Anemia Complex, interacts with the UBZ domain of the DNA
nuclease FAN1, and this interaction through ubiquitin is essential
for repair of DNA interstrand crosslinks (MacKay et al., 2010).
K63-linked polyubiquitin chains attached to histone 2A and
histone 2AX by the E3 ligase RNF8 and the E2 -conjugating
enzyme Ubc13 (Kolas et al., 2007) recruit and assemble factors
that are essential for DNA repair, such as BRCA1 (breast cancer
1), RAP80, and other proteins (Bennett and Harper, 2008).
It is important to emphasize that protein phosphorylation and
protein ubiquitination are not distinct and separate control mech-
anisms because the interplay between them is critical for the
regulation of many cellular processes. For example, phosphoryla-
tion regulates a number of E3 ubiquitin ligases and deubiquiti-
nases. Further, the E3 ligase Skp1-Cullin-F box (SCF) and some
other E3 ligases contain an additional component bTRCP
(b-transducin repeat-containing protein), which recognizes partic-
ular phosphorylated sequence motifs that direct the SCFbTRCP
complex to ubiquitinate these substrates. Finally, a number of
kinases can be activated or inhibited by interactions with polyubi-
quitin chains or by polyubiquitination. Given the omnipresence of
protein phosphorylation and ubiquitination inside the cell, under-
standing the interplay between these two systems is likely to
become increasingly more important over the next decade.
Developing Drugs that Target the Ubiquitin SystemThe Proteasome Inhibitor Bortezomib
The protease inhibitor Bortezomib, originally called PS341 and
then Velcade (Adams, 2002), was the first drug that targets
a component of the ubiquitin system to be approved for clinical
use in the United States. Developed by ProScript Inc in 1995,
Bortezomib entered clinical trials in 1997 and was approved by
the Federal Drug Administration in 2003. In 1999 ProScript was
acquired by Leukosite, which in turn was acquired by Millenium
Pharmaceuticals later that same year. Bortezomib has been
quite successful, with worldwide sales in 2009 of US$1.4 billion,
and this achievement led Takeda to acquire Millenium in 2008.
Bortezomib was approved as a front-line treatment for B cell
lymphoma found primarily in the bone marrow. It is also used
for the treatment of mantle cell lymphoma in patients who have
already received other treatments. It is in Phase III clinical trials
for follicular non-Hodgkin’s lymphoma, Phase II trials for diffuse
large B cell lymphoma, and a great many other clinical trials (re-
viewed in Tcherpakov, 2010).
Bortezomib, which is given by intravenous injection, has
remarkable efficacy against multiple myeloma, but the molecular
mechanism underlying its effect is still unclear. Nevertheless, the
multiple myeloma cells that are particularly sensitive to protea-
some inhibitors express lower levels of proteasome particles
Figure 1. Phosphorylation and Ubiquitina-
tion Regulate Most Aspects of Cell LifePhosphorylation involves the covalent attachmentof phosphate to proteins, mainly to serine, threo-nine, and tyrosine residues. Phosphorylation iscatalyzed by protein kinases and reversed byprotein phosphatases. Protein ubiquitinationinvolves the covalent attachment of ubiquitin,a small protein with 76 amino acids, to otherproteins, predominantly to lysine residues. Thisreaction is mediated by an E1-activating enzyme,an E2-conjugating enzyme, and an E3 ligase; thisreaction is reversed by deubiquitinases.
688 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
and have a higher proteasome workload than multiple myeloma
cells that are relatively resistant to these drugs. Thus, the balance
between proteasome workload and degradative capacity may be
an important determinant of the sensitivity of a cancer cell to
Bortezomib and other proteasome inhibitors (Bianchi et al.,
2009).
A dipeptidyl boronic acid, Bortezomib binds noncovalently to
the 20S proteasome and primarily inhibits its chymotrypsin-like
activity (Kisselev et al., 2006). Its success has led to considerable
interest in developing improved ‘‘second generation’’ inhibitors,
and Millenium/Takeda has another proteasome inhibitor,
MLN9708, which can be taken orally, in Phase 1 clinical trials.
Onyx Pharmaceuticals also has several orally active proteasome
inhibitors in clinical trials, which they obtained through the acqui-
sition of Proteolix. These inhibitors include Carfilzomib, which
has recently entered Phase III trials according to the website
http://clinicaltrials.gov. Other proteasome inhibitors that are
currently undergoing clinical development are listed in Table 2.
An Inhibitor of the E1 Enzyme for Neddylation
The Nedd8 protein shares �60% sequence identity with ubiqui-
tin, and it is conjugated to its target proteins in a similar manner
to ubiquitin, with a specific E1-activating enzyme (NAE-E1) and
the E2-conjugating enzymes Ube2M and/or Ube2F. The primary
target for neddylation appears to be the Cullin components of
Cullin RING E3 ubiquitin ligases. The Cullin RING ligases are
the largest family of E3 ligases in the human genome with more
than 100 members (Rabut and Peter, 2008). Neddylation permits
efficient ubiquitination by Cullin RING ligases; neddylation
induces a conformational change in the Cullin component to
bring the E2 active site adjacent to the lysine residue of its protein
target substrates (Duda et al., 2008; Saha and Deshaies, 2008).
Millenium/Takeda has developed a relatively specific inhibitor
of the NAE-E1 enzyme (Table 3). This compound, MLN4924,
showed promise in mouse models of cancer and has entered
Phase I clinical trials for the treatment of multiple myeloma and
non-Hodgkin’s lymphoma. MLN4924 seems to exert its effect
on these cancers by deregulating DNA synthesis during the S
phase of the cell division cycle. MLN4924 appears to stabilize
Cdt1, a DNA replication licensing factor normally ubiquitinated
by a Cullin RING E3 ligase and then degraded by the proteasome
(Soucy et al., 2009).
Inhibitors of Deubiquitinases
Deubiquitinases comprise five separate gene families. Four
families are cysteine proteinases (the USP, OTU, UCH, and
MJD deubiquitinases), and the other one consists of metallo-
proteinases (the JAMM/MPN domain family). The E3 ligase
HDM2 targets the tumor suppressor p53 for degradation. One
of the cysteine protease deubiquitinases, USP7 (ubiquitin-spe-
cific protease 7), deubiquitinates HDM2, leading to increased
levels of HDM2 and decreased levels of p53. Therefore, two
companies, Progenra and Hybrigenics, have developed inhibi-
tors of USP7 (i.e., P5091 and HBX 41108, respectively) (Colland
et al., 2009), with the hope of promoting the proteasomal degra-
dation of HDM2 by enhancing its polyubiquitination. Reduced
expression of HDM2 would then be expected to increase the
level of p53.
Progenra is also developing inhibitors targeting USP20, and
they are showing interest in agents for USP2a, USP33, and
Table 2. Proteasome Inhibitors Approved or in Clinical Trials
Company Inhibitor Development Stage Disease
Millenium/Takeda Bortezomib/Velcade Approved Multiple myeloma and mantle cell lymphoma
Millenium/Takeda MLN9708 Phase I Multiple myeloma and other cancers
ONYX (Proteolix) Carfilzomib/PR171 Phase III Multiple myeloma and other cancers
ONYX (Proteolix) Onx 0912/PR047 Phase I Multiple myeloma and other cancers
Cephalon CEP18770 Phase I Multiple myeloma and other cancers
Nereus Pharmaceuticals Salinosporamid A/NPI0052 Phase I Multiple myeloma and leukemia
Table 3. Inhibitors of E1-Activating Enzymes and E3 Ubiquitin Ligases Undergoing Clinical Trials
Company Inhibitor Target Stage Disease
Millenium/Takeda MLN4924 NAE-E1b Phase II Multiple myeloma and Hodgkin’s lymphoma
Roche Nutlin/R7112 E3-Hdm2 Phase I Blood cancers
and solid tumors
Johnson & Johnson JNJ26854165 E3-Hdm2 Phase I Multiple myeloma and solid tumors
Genentech/Roche GDC-0152 E3-IAP Phase I Metastatic malignancies
Novartis LCL161 E3-IAP Phase I Solid tumors
Ascenta Therapeutics AT-406 E3-IAP Phase I Solid tumors and lymphoma
Aegera Therapeutics AEG 35156a E3-IAP Phase II AML and liver cancer
Aegera Therapeutics AEG 40826 E3-IAP Phase I Lymphoid tumors
Tetralogics Pharma TL 32711 E3-IAP Phase I Solid tumors and lymphoma
Astellas Pharma YM155 E3-IAP Phase II Lung cancera Antisense oligonucleotide.b The E1-activating enzyme for neddylation.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 689
AMSH (associated molecule with the SH3 domain of STAM)
(http://www.progenra.com/scientist.html, 2009). USP20, also
called VDU2 (von Hippel-Lindau deubiquitinating enzyme 2),
deubiquitinates and stabilizes hypoxia-inducible factor 1a (HIF-
1a) (Li et al., 2005). HIF-1a is expressed at high levels in many
human cancers because it is stabilized at the low concentration
of dissolved oxygen inside the tumor by high cytokine levels and
by specific genetic alterations. For example, in von Hippel-Lin-
dau disease, in which individuals develop a variety of tumors,
mutations in the VHL gene compromise the ubiquitination and
degradation of HIF-1a, leading to the accumulation and overex-
pression of HIF-1a and its target genes. Therefore, inhibitors of
USP20 (VDU2) and/or USP33 (VDU1) may reduce levels of HIF-
1a by enhancing its polyubiquitination.
Novartis has patented compounds that inhibit the deubiquiti-
nases USP2 and UCH-L3 (ubiquitin C-terminal hydrolase).
USP2 is another deubiquitinase reported to target MDM2, the
mouse ortholog of HDM2 (Stevenson et al., 2007), whereas
UCH-L3 probably plays a role in neurodegenerative disorders,
such as Parkinson’s disease. Recently, researchers identified
a small-molecule inhibitor of USP14, called IU1, which did not
inhibit eight other deubiquitylases tested, demonstrating the
feasibility of developing relatively specific inhibitors of these
enzymes (Lee et al., 2010). USP14 is associated with the protea-
some, and treating cells with IU1 enhanced the degradation of
several proteasomal substrates that have been implicated in
neurodegenerative diseases, such as Tau. Drugs that target
USP14 could, therefore, have a potential use in reducing or elim-
inating misfolded and aggregated proteins that accumulate in
neurodegenerative and other diseases.
Developing pharmaceutical agents that target deubiquitinases
is still in its infancy, and to our knowledge, no deubiquitinase
inhibitor has yet entered clinical trials. However, as this field
progresses, it is clearly going to be essential to assess the
specificities of these inhibitors. Therefore, assembling compre-
hensive panels of deubiquitinases for testing specificity will be
critical, similar to how large panels of protein kinases have
been of immense value in assessing the selectivity of kinase
inhibitors.
As with kinases, there are certainly going to be deubiquitinases
for which inhibition needs to be avoided. For example, mutating
or deleting the A20 deubiquitinase causes or predisposes indi-
viduals to inflammatory and autoimmune diseases (Musone
et al., 2008; Turer et al., 2008). Similarly, inactivating mutations
in the deubiquitinase CYLD cause cylindromatosis, a type of
skin cancer (Kovalenko et al., 2003; Trompouki et al., 2003).
Targeting E3 Ubiquitin Ligases
The human genome encodes more E3 ubiquitin ligases than
protein kinases (Table 1). Furthermore, the E3 ligase confers
specificity to ubiquitination when it transfers ubiquitin from an
E2 to a particular substrate. For these reasons, E3 ubiquitin
ligases are attractive candidates as drug targets. In some cases,
identifying compounds that disrupt the interaction of an E3 ligase
with its substrates has proven a frustrating experience for
several companies, and a number of programs have been
unsuccessful. For example, we understand that several compa-
nies have tried and failed to develop inhibitors of MuRF1, an E3
ligase involved in degrading myosin as a therapy for preventing
muscle wasting. Nevertheless, several programs have made
good progress and a number of E3 ligase inhibitors have
advanced to clinical trials (Table 3) (reviewed in Tcherpakov,
2010). Moreover, several recent and unexpected developments
in this area are likely to enhance future pharmaceutical interest in
developing E3 ligase inhibitors.
Several companies have discovered compounds that disrupt
the interaction of the E3 ligase HDM2 and its substrate, the tumor
suppressor p53, with the aim of elevating p53 expression. One
such compound, Nutlin 3/R7112, has entered clinical trials
(Table 3). A second class of E3 ligases actively targeted by
a number of companies is the Inhibitors of Apoptosis Proteins
(IAPs), and seven antagonists of IAPs have even entered clinical
trials (Table 3). These drugs are small-molecule mimetics of
Smac (also known as Diablo), a protein that antagonizes IAPs
by interacting with their BIR domains. Smac mimetics appear
to induce the autoubiquitination and degradation of the IAPs,
which then leads to the death of cancer cells by stimulating the
TNF-a pathway (Wu et al., 2007). Destruction of IAPs through
the Smac mimetics also suppresses the production of proinflam-
matory cytokines by Toll-like receptor agonists, suggesting that
these drugs may be worth exploring as possible treatments for
chronic inflammatory diseases (Tseng et al., 2010).
Recently, Ito et al. (2010) surprisingly discovered that the drug
thalidomide binds to cereblon (CRBN), a component of the Cullin
RING E3 ligase that is important for limb outgrowth and the
expression of a fibroblast growth factor (FGF8) during embryonic
development (Ito et al., 2010). This finding explained why thalid-
omide, originally prescribed as a sedative, caused multiple birth
defects in pregnant women. Thalidomide is still used for the
treatment of numerous conditions, including leprosy, skin sores,
and myelofibrosis. Therefore, pinpointing the molecular mecha-
nism of the drug’s devastating side effects may facilitate the
development of new thalidomide derivatives that are free from
this problem.
Arsenic is another drug that unexpectedly regulates an E3
ligase. Arsenic is an effective and specific treatment for acute pro-
myelocytic leukemia. In this cancer, the promyelocytic leukemia
(PML) protein becomes fused to the retinoic acid receptor (RAR).
Arsenic triggers the degradation of the PML-RAR fusion protein
by inducing the SUMOylation of PML. This modified version of
PML recruits the SUMO-binding E3 ubiquitin ligase RNF4, which
catalyzes the polyubiquitination (K48-linked) and proteasomal
degradation of the PML-RAR complex (Tatham et al., 2008).
Small-molecule inhibitors of several Cullin RING E3 ligases
have also been identified. SCFskp2 is a Cullin RING E3 ligase
that is highly expressed in some human cancers. Decreased
levels of p27kip1 are a poor prognosis factor in many malignan-
cies, and SCFskp2 ubiquitinates p27kip1, targeting it for protea-
somal destruction (Cardozo and Pagano, 2007; Merlet et al.,
2009). Researchers have identified one compound that prevents
the incorporation of Skp2 into the SCFskp2 complex, which trig-
gers cell death (i.e., autophagy) by stabilizing p27kip1 and
inducing G1/S cell-cycle arrest. This inhibitor synergizes with
Bortezomib and overcomes resistance to Bortezomib in models
of multiple myeloma. Moreover, the compound was active
against aggressive leukemia cells (i.e., leukemia blasts) and
plasma cells derived from patients (Chen et al., 2008).
690 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
SCFbTrCP1 isa CullinRINGE3 ligase that triggers the degradation
of IkBa, the inhibitory component of the proinflammatory tran-
scription factor NF-kB. Therefore, drugs that target SCFbTrCP1
may have potential as anti-inflammatory agents, and it is of great
interest that an inhibitor of SCFbTrCP1 has been identified, which
prevents the polyubiquitination and degradation of IkBa (Nakajima
et al., 2008).
Researchers have also identified a small-molecule inhibitor of
Cdc4, the yeast ortholog of the mammalian Cullin RING E3 ligase
Fbw7 (F box and WD repeat domain-containing 7). A recent
X-ray crystal structure (Orlicky et al., 2010) revealed that the
inhibitor inserts between two of the b strands of the WD40
propeller domain of Cdc4, which are remote from the
substrate-binding site. Binding of the inhibitor induces a long-
range conformational change that distorts the substrate-binding
pocket and impedes recognition of the substrate. Thus, this
compound is one of the first allosteric inhibitors of an E3 ligase
to be identified and raises the possibility that other Cullin RING
E3 ligases with WD40 domains may possess analogous pockets
that could be targeted by inhibitors. A small-molecule inhibitor of
the SCFMet30 ligase was recently identified in a screen for small-
molecule enhancers of the drug rapamycin (Aghajan et al., 2010).
To our knowledge, none of these compounds has yet entered
clinical development, but they are proof-of-principle, demon-
strating that there is no particular fundamental barrier to identi-
fying inhibitors of the Cullin RING family of E3 ubiquitin ligases.
The Future of Ubiquitin Drug DiscoveryThere are striking parallels between the histories of protein phos-
phorylation and protein ubiquitination and their exploitation for
the development of drugs to treat diseases (Table 1). Both bio-
logical control mechanisms were identified many years ago,
but interest in targeting them for drug discovery only started to
take off in the 1990s. Indeed, the first compounds inhibiting
components of these systems entered clinical trials at around
the same time (Bortezomib—1997, Gleevec—1998), and these
drugs were among the fastest ever approved for clinical use
(Gleevec—2001, Bortezomib—2003). Both Gleevec and Borte-
zomib subsequently achieved ‘‘blockbuster’’ status with current
sales of about US$3 billion (Gleevec) and US$1.4 billion (Borte-
zomib) per annum.
However, that is where their similarities end. Since the devel-
opment of Gleevec, 15 other drugs targeting a specific protein
kinase have been approved for clinical use, but no other drug tar-
geting a particular component of the ubiquitin system has yet
been approved. In addition, kinase inhibitors currently under-
going clinical trials also outnumber the inhibitors of the ubiquitin
system by more than ten to one (Table 1).
Why has drug discovery in the ubiquitin system lagged so far
behind that of protein kinases, and what is needed to change
this state of affairs in the future? In retrospect, one factor driving
the kinase field forward at such a rapid pace is the ease with
which large and varied chemical libraries can be synthesized
and exploited to develop inhibitors of many protein kinases.
Further, receptor tyrosine kinases have extracellular domains
that can also be targeted with therapeutic antibodies. In
contrast, although E3 ubiquitin ligases outnumber protein
kinases, researchers still have not developed a general approach
for identifying inhibitors of many E3 ubiquitin ligases. This is
because, thus far, researchers have focused primarily on dis-
rupting the interaction between E3 ligases and their substrates,
which is specific to particular E3 ligase-substrate pairs. More-
over, finding compounds to disrupt the interface of two proteins
can be intrinsically more difficult to achieve than searching for
small molecules that block catalytic activity.
Surprisingly, little effort has been devoted to developing
compounds that disrupt the interactions between E2-conjugating
enzymes and E3 ligases. E2-E3 interactions are usually relatively
weak (Ye and Rape, 2009) and may therefore be relatively easy
to disrupt. Moreover, compounds that disturb the interaction
between anE2-conjugatingenzyme and anE3 ligase could, inprin-
ciple, exert their effects by binding to the E2, the E3, or the E2-E3
interface, creating the potential to identify three types of inhibitors
from a single screen. There are �40 E2-conjugating enzymes en-
coded by the human genome; therefore, on average, each E2
must interact productively with �15 E3 ligases. Compounds that
disrupt E2-E3 interactions by binding specifically to the E3 ligase
could be identified by counterscreening with another E3 ligase
that also forms a productive interaction with the same E2. Indeed,
focusing efforts on large families of E3 ligases, such as the Cullin
RING ligases, may lead to the development of chemical libraries
with the capability of disrupting many E2-E3 interactions.
By analogy with kinases, perhaps the key to developing inhib-
itors of specific E2-E3 interactions is to find compounds that
bind to small hydrophobic pockets on E3 ligases located
proximal to the E2-E3 interface itself or to identify allosteric inhib-
itors that disrupt the E2-E3 interaction by inducing long-range
conformational changes. The three-dimensional structure of an
E2-ubiquitin thiol ester-E3 ligase complex has yet to be reported,
but such a structure might be extremely helpful in understanding
how E2-E3 interactions could be disrupted. To crystallize such
a complex, it might be necessary to stabilize the E2-ubiquitin
thiol ester-E3 interactions by including a small molecule that
inactivates E3 ligase function without affecting its ability to
bind to the E2-conjugating enzyme.
Another area where more effort will probably be fruitful is the
production of chemical libraries that target the different families
of deubiquitinases. Although inhibitors of a few deubiquitinases
are under development, such as Usp2a, Usp7, Usp20, and
Uch-L3, other deubiquitinases are also potentially rewarding
drug targets but seem to have attracted little attention so far.
For example, Usp6 is an oncogene with transforming activity; re-
arrangements and fusions of this deubiquitinase are found in
a number of cancers (Oliveira et al., 2006). Moreover, the possi-
bility of developing drugs that increase the expression and/or
activity of deubiquitinases also should not be ignored. For
example, the deubiquitinase BAP1 interacts with BRCA1, an
E3 ligase frequently mutated in breast cancer. BAP1 enhances
BRCA1-mediated inhibition of breast cancer cell growth and
may be a tumor suppressor gene that functions in the BRCA1
growth control pathway (Jensen et al., 1998). Thus, drugs that
enhance the activity or expression of BAP1 could have thera-
peutic potential for treating cancer.
Experience with protein kinases has taught us that
compounds developed as inhibitors of one protein kinase
commonly turn out to inhibit other protein kinases even more
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 691
potently (Bain et al., 2007) and thus can become leads in
completely different drug discovery programs. Sorafenib (also
called Nexavar), an approved drug for the treatment of renal
cell carcinoma, was originally developed as an inhibitor of
a serine/threonine kinase Raf. However, now Sorafenib is
thought to exert its therapeutic benefit by inhibiting several tyro-
sine kinases, such as the PDGF receptor (Lierman et al., 2006).
Developing chemical libraries that target deubiquitinases is likely
to yield similar surprises and likely generate drug leads for
a number of these isopeptidases.
The success ofBortezomiband the advancement of the NAE-E1
inhibitor MLN4924 into clinical trials suggest that there is vast
potential to develop more drugs targeted to general components
of the ubiquitin system. Drugs that block the same target by
distinct mechanisms can have strikingly different efficacies
because their toxicities, half-lives in vivo, and pharmaco-dynamic
properties can vary substantially. Such targets might include other
E1-activating enzymes (e.g., the E1s for ubiquitination and SU-
MOylation) and other components of the proteasome. For
example, Bortezomib predominantly targets the chymotrypsin-
like activity of the proteasome, and drugs that inhibit the cas-
pase-like and trypsin-like activities of the proteasome may be
more potent inhibitors or have different effects than Bortezomib.
The 19S component of the proteasome is another underex-
plored target. The 19S possesses ATPase activity, a polyubiqui-
tin-binding site, and deubiquitinase activities, all of which could
be targeted for drug development. Another possible target is
p97/VCP, a protein that plays a key role in eliminating misfolded
proteins by the endoplasmic reticulum-associated degradation
pathway (ERAD). Indeed a small-molecule inhibitor of the
ATPase activity of p97/VCP has been discovered that blocks
proliferation of cancer cell lines (T.-F. Chou et al., 2008, FASEB
J., abstract). Novel proteasome inhibitors might also be useful in
transplantation as a therapy for antibody- and cell-mediated acute
rejection (Everly et al., 2008). For example, Bortezomib has shown
promise in reducing graft-versus-host disease and in reconstitut-
ing the immune system in some stem cell transplant patients.
Inflammatory and autoimmune disorders may be treated with
selective inhibitors to a distinct class of proteasome, called the
immunoproteasome. Expressed in monocytes and lympho-
cytes, the immunoproteasome regulates many facets of the
immune response, in part by shaping the antigenic repertoire
presented on class I major histocompatibility complexes. The
immunoproteasome contains orthologs of the proteolytic activi-
ties associated with the ‘‘constitutive’’ 26S proteasome,
including a component with chymotryptic-like activity, called
LMP7. Recently, researchers developed a relatively selective
inhibitor of LMP7, which prevents the production of interleukin-
2 and interferon-g by activated T cells and interleukin-23 by acti-
vated monocytes. Furthermore, this inhibitor showed promise in
treating arthritis in mouse models (Muchamuel et al., 2009).
Finally, it is also worth noting that Mycobacterium tuberculosis
is the only bacterial pathogen known to have a proteasome.
Recently, one compound, oxathiazol-2-one, was identified with
preferential inhibition of the bacterial proteasome over the
human proteasome (Lin et al., 2009). Indeed, a selective inhibitor
of this mycobacterial proteasome might be useful for treating
tuberculosis.
Predicting the future is notoriously difficult. However, given
the diverse approaches and avenues that remain unexplored
in developing drugs targeted at the ubiquitin system, the
authors of this article would be surprised if ubiquitin drug
discovery was not far more important in 10 years time than it
is today. Nevertheless, only time will tell if ubiquitin drug
discovery will eventually rival in its importance that of kinase
drug discovery.
ACKNOWLEDGMENTS
We are grateful to Ron Hay, Thimo Kurz, and the reviewers of this Perspective
for making suggestions that improved the article. P.C. is a Royal Society
Research Professor, and the work of his laboratory is supported by the UK
Medical Research Council, AstraZeneca, Boehringer Ingelheim, GlaxoSmithK-
line, Merck-Serono, and Pfizer.
REFERENCES
Adams, J. (2002). Development of the proteasome inhibitor PS-341. Oncolo-
gist 7, 9–16.
Aghajan, M., Jonai, N., Flick, K., Fu, F., Luo, M., Cai, X., Ouni, I., Pierce, N.,
Tang, X., Lomenick, B., et al. (2010). Chemical genetics screen for enhancers
of rapamycin identifies a specific inhibitor of an SCF family E3 ubiquitin ligase.
Nat. Biotechnol. 28, 738–742.
Al-Hakim, A.K., Zagorska, A., Chapman, L., Deak, M., Peggie, M., and Alessi,
D.R. (2008). Control of AMPK-related kinases by USP9X and atypical Lys(29)/
Lys(33)-linked polyubiquitin chains. Biochem. J. 411, 249–260.
Bain, J., Plater, L., Elliott, M., Shpiro, N., Hastie, C.J., McLauchlan, H., Kle-
vernic, I., Arthur, J.S., Alessi, D.R., and Cohen, P. (2007). The selectivity of
protein kinase inhibitors: a further update. Biochem. J. 408, 297–315.
Bennett, E.J., and Harper, J.W. (2008). DNA damage: ubiquitin marks the spot.
Nat. Struct. Mol. Biol. 15, 20–22.
Bhoj, V.G., and Chen, Z.J. (2009). Ubiquitylation in innate and adaptive immu-
nity. Nature 458, 430–437.
Bianchi, G., Oliva, L., Cascio, P., Pengo, N., Fontana, F., Cerruti, F., Orsi, A.,
Pasqualetto, E., Mezghrani, A., Calbi, V., et al. (2009). The proteasome load
versus capacity balance determines apoptotic sensitivity of multiple myeloma
cells to proteasome inhibition. Blood 113, 3040–3049.
Cardozo, T., and Pagano, M. (2007). Wrenches in the works: drug discovery
targeting the SCF ubiquitin ligase and APC/C complexes. BMC Biochem. 8
(Suppl 1), S9.
Carter, S., Bischof, O., Dejean, A., and Vousden, K.H. (2007). C-terminal modi-
fications regulate MDM2 dissociation and nuclear export of p53. Nat. Cell Biol.
9, 428–435.
Chen, Q., Xie, W., Kuhn, D.J., Voorhees, P.M., Lopez-Girona, A., Mendy, D.,
Corral, L.G., Krenitsky, V.P., Xu, W., Moutouh-de Parseval, L., et al. (2008).
Targeting the p27 E3 ligase SCF(Skp2) results in p27- and Skp2-mediated
cell-cycle arrest and activation of autophagy. Blood 111, 4690–4699.
Ciechanover, A., Hod, Y., and Hershko, A. (1978). A heat-stable polypeptide
component of an ATP-dependent proteolytic system from reticulocytes. Bio-
chem. Biophys. Res. Commun. 81, 1100–1105.
Cohen, P. (2002a). The origins of protein phosphorylation. Nat. Cell Biol. 4,
E127–E130.
Cohen, P. (2002b). Protein kinases—the major drug targets of the twenty-first
century? Nat. Rev. Drug Discov. 1, 309–315.
Colland, F., Formstecher, E., Jacq, X., Reverdy, C., Planquette, C., Conrath,
S., Trouplin, V., Bianchi, J., Aushev, V.N., Camonis, J., et al. (2009). Small-
molecule inhibitor of USP7/HAUSP ubiquitin protease stabilizes and activates
p53 in cells. Mol. Cancer Ther. 8, 2286–2295.
Demetri, G.D., van Oosterom, A.T., Garrett, C.R., Blackstein, M.E., Shah, M.H.,
Verweij, J., McArthur, G., Judson, I.R., Heinrich, M.C., Morgan, J.A., et al.
692 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
(2006). Efficacy and safety of sunitinib in patients with advanced gastrointes-
tinal stromal tumour after failure of imatinib: a randomised controlled trial.
Lancet 368, 1329–1338.
Duda, D.M., Borg, L.A., Scott, D.C., Hunt, H.W., Hammel, M., and Schulman,
B.A. (2008). Structural insights into NEDD8 activation of cullin-RING ligases:
Conformational control of conjugation. Cell 134, 995–1006.
Everly, M.J., Everly, J.J., Susskind, B., Brailey, P., Arend, L.J., Alloway, R.R.,
Roy-Chaudhury, P., Govil, A., Mogilishetty, G., Rike, A.H., et al. (2008). Borte-
zomib provides effective therapy for antibody- and cell-mediated acute rejec-
tion. Transplantation 86, 1754–1761.
Fischer, E.H., and Krebs, E.G. (1955). Conversion of phosphorylase b to phos-
phorylase a in muscle extracts. J. Biol. Chem. 216, 121–132.
Garnett, M.J., Mansfeld, J., Godwin, C., Matsusaka, T., Wu, J., Russell, P.,
Pines, J., and Venkitaraman, A.R. (2009). UBE2S elongates ubiquitin chains
on APC/C substrates to promote mitotic exit. Nat. Cell Biol. 11, 1363–1369.
Ikeda, F., Crosetto, N., and Dikic, I. (2010). What determines the specificity and
outcomes of ubiquitin signaling? Cell 143, this issue, 677–681.
Ito, T., Ando, H., Suzuki, T., Ogura, T., Hotta, K., Imamura, Y., Yamaguchi, Y.,
and Handa, H. (2010). Identification of a primary target of thalidomide terato-
genicity. Science 327, 1345–1350.
Jensen, D.E., Proctor, M., Marquis, S.T., Gardner, H.P., Ha, S.I., Chodosh, L.A.,
Ishov, A.M., Tommerup, N., Vissing, H., Sekido, Y., et al. (1998). BAP1: a novel
ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances
BRCA1-mediated cell growth suppression. Oncogene 16, 1097–1112.
Jin, L., Williamson, A., Banerjee, S., Philipp, I., and Rape, M. (2008). Mecha-
nism of ubiquitin-chain formation by the human anaphase-promoting
complex. Cell 133, 653–665.
Kisselev, A.F., Callard, A., and Goldberg, A.L. (2006). Importance of the
different proteolytic sites of the proteasome and the efficacy of inhibitors varies
with the protein substrate. J. Biol. Chem. 281, 8582–8590.
Kolas, N.K., Chapman, J.R., Nakada, S., Ylanko, J., Chahwan, R., Sweeney,
F.D., Panier, S., Mendez, M., Wildenhain, J., Thomson, T.M., et al. (2007).
Orchestration of the DNA-damage response by the RNF8 ubiquitin ligase.
Science 318, 1637–1640.
Kovalenko, A., Chable-Bessia, C., Cantarella, G., Israel, A., Wallach, D., and
Courtois, G. (2003). The tumour suppressor CYLD negatively regulates NF-
kappaB signalling by deubiquitination. Nature 424, 801–805.
Lawler, B. (2009). Kinase inhibitors. Global Markets BCC Market Research
Report BIO053B.
Lee, B.H., Lee, M.J., Park, S., Oh, D.C., Elsasser, S., Chen, P.C., Gartner, C.,
Dimova, N., Hanna, J., Gygi, S.P., et al. (2010). Enhancement of proteasome
activity by a small-molecule inhibitor of USP14. Nature 467, 179–184.
Li, Z., Wang, D., Messing, E.M., and Wu, G. (2005). VHL protein-interacting
deubiquitinating enzyme 2 deubiquitinates and stabilizes HIF-1alpha. EMBO
Rep. 6, 373–378.
Lierman, E., Folens, C., Stover, E.H., Mentens, N., Van Miegroet, H., Scheers,
W., Boogaerts, M., Vandenberghe, P., Marynen, P., and Cools, J. (2006). Sor-
afenib is a potent inhibitor of FIP1L1-PDGFRalpha and the imatinib-resistant
FIP1L1-PDGFRalpha T674I mutant. Blood 108, 1374–1376.
Lin, G., Li, D., de Carvalho, L.P., Deng, H., Tao, H., Vogt, G., Wu, K., Schneider,
J., Chidawanyika, T., Warren, J.D., et al. (2009). Inhibitors selective for myco-
bacterial versus human proteasomes. Nature 461, 621–626.
MacKay, C., Declais, A.C., Lundin, C., Agostinho, A., Deans, A.J., MacArtney,
T.J., Hofmann, K., Gartner, A., West, S.C., Helleday, T., et al. (2010). Identifica-
tion of KIAA1018/FAN1, a DNA repair nuclease recruited to DNA damage by
monoubiquitinated FANCD2. Cell 142, 65–76.
Maguire, M., Nield, P.C., Devling, T., Jenkins, R.E., Park, B.K., Pola�nski, R.,
Vlatkovi�c, N., and Boyd, M.T. (2008). MDM2 regulates dihydrofolate reductase
activity through monoubiquitination. Cancer Res. 68, 3232–3242.
Merlet, J., Burger, J., Gomes, J.E., and Pintard, L. (2009). Regulation of cullin-
RING E3 ubiquitin-ligases by neddylation and dimerization. Cell. Mol. Life Sci.
66, 1924–1938.
Muchamuel, T., Basler, M., Aujay, M.A., Suzuki, E., Kalim, K.W., Lauer, C., Syl-
vain, C., Ring, E.R., Shields, J., Jiang, J., et al. (2009). A selective inhibitor of
the immunoproteasome subunit LMP7 blocks cytokine production and atten-
uates progression of experimental arthritis. Nat. Med. 15, 781–787.
Musone, S.L., Taylor, K.E., Lu, T.T., Nititham, J., Ferreira, R.C., Ortmann, W.,
Shifrin, N., Petri, M.A., Kamboh, M.I., Manzi, S., et al. (2008). Multiple polymor-
phisms in the TNFAIP3 region are independently associated with systemic
lupus erythematosus. Nat. Genet. 40, 1062–1064.
Nakajima, H., Fujiwara, H., Furuichi, Y., Tanaka, K., and Shimbara, N. (2008). A
novel small-molecule inhibitor of NF-kappaB signaling. Biochem. Biophys.
Res. Commun. 368, 1007–1013.
Oliveira, A.M., Chou, M.M., Perez-Atayde, A.R., and Rosenberg, A.E. (2006).
Aneurysmal bone cyst: a neoplasm driven by upregulation of the USP6 onco-
gene. J. Clin. Oncol. 24, e1–author reply e2.
Orlicky, S., Tang, X., Neduva, V., Elowe, N., Brown, E.D., Sicheri, F., and Tyers,
M. (2010). An allosteric inhibitor of substrate recognition by the SCF(Cdc4)
ubiquitin ligase. Nat. Biotechnol. 28, 733–737.
Rabut, G., and Peter, M. (2008). Function and regulation of protein neddylation.
‘Protein modifications: beyond the usual suspects’ review series. EMBO Rep.
9, 969–976.
Saha, A., and Deshaies, R.J. (2008). Multimodal activation of the ubiquitin
ligase SCF by Nedd8 conjugation. Mol. Cell 32, 21–31.
Soucy, T.A., Smith, P.G., Milhollen, M.A., Berger, A.J., Gavin, J.M., Adhikari,
S., Brownell, J.E., Burke, K.E., Cardin, D.P., Critchley, S., et al. (2009). An inhib-
itor of NEDD8-activating enzyme as a new approach to treat cancer. Nature
458, 732–736.
Stevenson, L.F., Sparks, A., Allende-Vega, N., Xirodimas, D.P., Lane, D.P., and
Saville, M.K. (2007). The deubiquitinating enzyme USP2a regulates the p53
pathway by targeting Mdm2. EMBO J. 26, 976–986.
Tatham, M.H., Geoffroy, M.C., Shen, L., Plechanovova, A., Hattersley, N., Jaf-
fray, E.G., Palvimo, J.J., and Hay, R.T. (2008). RNF4 is a poly-SUMO-specific
E3 ubiquitin ligase required for arsenic-induced PML degradation. Nat. Cell
Biol. 10, 538–546.
Tcherpakov, M. (2010). Ubiquitin proteasome drug discovery (cancer and
other markets). BCC Research Report PHM066A.
Todi, S.V., Winborn, B.J., Scaglione, K.M., Blount, J.R., Travis, S.M., and Paul-
son, H.L. (2009). Ubiquitination directly enhances activity of the deubiquitinat-
ing enzyme ataxin-3. EMBO J. 28, 372–382.
Tokunaga, F., Sakata, S., Saeki, Y., Satomi, Y., Kirisako, T., Kamei, K., Naka-
gawa, T., Kato, M., Murata, S., Yamaoka, S., et al. (2009). Involvement of linear
polyubiquitylation of NEMO in NF-kappaB activation. Nat. Cell Biol. 11, 123–132.
Trompouki, E., Hatzivassiliou, E., Tsichritzis, T., Farmer, H., Ashworth, A., and
Mosialos, G. (2003). CYLD is a deubiquitinating enzyme that negatively regu-
lates NF-kappaB activation by TNFR family members. Nature 424, 793–796.
Tseng, P.H., Matsuzawa, A., Zhang, W., Mino, T., Vignali, D.A., and Karin, M.
(2010). Different modes of ubiquitination of the adaptor TRAF3 selectively acti-
vate the expression of type I interferons and proinflammatory cytokines. Nat.
Immunol. 11, 70–75.
Turer, E.E., Tavares, R.M., Mortier, E., Hitotsumatsu, O., Advincula, R., Lee, B.,
Shifrin, N., Malynn, B.A., and Ma, A. (2008). Homeostatic MyD88-dependent
signals cause lethal inflamMation in the absence of A20. J. Exp. Med. 205,
451–464.
Wu, H., Tschopp, J., and Lin, S.C. (2007). Smac mimetics and TNFalpha: A
dangerous liaison? Cell 131, 655–658.
Xia, Z.P., Sun, L., Chen, X., Pineda, G., Jiang, X., Adhikari, A., Zeng, W., and
Chen, Z.J. (2009). Direct activation of protein kinases by unanchored polyubi-
quitin chains. Nature 461, 114–119.
Ye, Y., and Rape, M. (2009). Building ubiquitin chains: E2 enzymes at work.
Nat. Rev. Mol. Cell Biol. 10, 755–764.
Zeng, W., Sun, L., Jiang, X., Chen, X., Hou, F., Adhikari, A., Xu, M., and Chen,
Z.J. (2010). Reconstitution of the RIG-I pathway reveals a signaling role of
unanchored polyubiquitin chains in innate immunity. Cell 141, 315–330.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 693
Leading Edge
Review
Pathogen-Mediated PosttranslationalModifications: A Re-emerging FieldDavid Ribet1,2,3 and Pascale Cossart1,2,3,*1Institut Pasteur, Unite des Interactions Bacteries-Cellules, Departement de Biologie Cellulaire et Infection, F-75015 Paris, France2INSERM, U604, F-75015 Paris, France3INRA, USC2020, F-75015 Paris, France
*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.11.019
Posttranslational modifications are increasingly recognized as key strategies used by bacterial andviral pathogens to modulate host factors critical for infection. A number of recent studies illustratehow pathogens use these posttranslational modifications to target central signaling pathways inthe host cell, such as the NF-kB andMAPkinase pathways, which are essential for pathogens’ repli-cation, propagation, and evasion from host immune responses. These discoveries open newavenues for investigating the fundamental mechanisms of pathogen infection and the developmentof new therapeutics.
Posttranslational modifications (PTMs) of proteins provide highly
versatile tools and tricks used by both prokaryotic and eukary-
otic cells to regulate the activity of key proteins. PTMs include
the addition of simple chemical groups, such as a phosphate,
acetyl, methyl, or hydroxyl groups; more complex groups,
such as AMP, ADP-ribose, sugars, or lipids; and small polypep-
tides, such as ubiquitin or ubiquitin-like proteins. They also
include modifications of specific amino acid side chains (e.g.,
deamidation of glutamine residues) and the cleavage of a peptide
bond (i.e., proteolysis).
PTMs represent efficient strategies to modify activities, half-
lives, or the intracellular localization of host proteins that are
critical for infection. The first report that a pathogen could
mediate a PTM occurred 40 years ago with the discovery that
diphtheria toxin, produced by Corynebacterium diphtheriae,
ADP-ribosylates and thus inhibits the host Elongation Factor-2
(EF-2) (Collier and Cole, 1969). This modification blocks transla-
tion in the intoxicated cells and thereby leads to cell death.
Since then, a considerable number of host PTMs mediated,
induced, or counteracted by different pathogen-encoded virulence
factors have been reported (for reviews, see Ribet and Cossart,
2010; Randow and Lehner, 2009). In this Review, we discuss new
discoveries in the modulation of PTMs by pathogens. In the first
part, we focus on ubiquitin and ubiquitin-like proteins, which have
emerged as central regulating modules targeted by both viral and
bacterial pathogens. We then discuss two recently identified
PTMs catalyzed by bacterial pathogens, AMPylation and eliminyla-
tion. In the third part, we describe how pathogens hijack certain
PTMs to preferentially target specific host pathways to promote
their replication,propagation, andescape from the immunesystem.
Ubiquitin and Ubiquitin-like Modifications Targetedby PathogensUbiquitination
Ubiquitination is the covalent attachment of ubiquitin, a small
polypeptide of 76 amino acids, to a target protein. Ubiquitin is
generally linked to the lysine residue of the target protein;
however, a cysteine, serine, threonine, or N-terminal amino
group of a protein can also be modified. This conjugation
requires the successive activities of an E1-activating enzyme,
an E2-conjugating enzyme, and then an E3 ligase. Ubiquitination
is a fundamental PTM involved in many different cellular func-
tions, including the trafficking of membrane proteins, endocy-
tosis, signal transduction, DNA repair, and transcription regula-
tion. Ubiquitin itself contains seven lysines, K6, K11, K27, K29,
K33, K48, and K63. Therefore, chains of ubiquitin can be formed
by attaching additional ubiquitin molecules to a lysine residue of
the previously attached ubiquitin.
K48-linked polyubiquitin chains play a fundamental role in
protein degradation by targeting proteins to the proteasome. In
contrast, K63-linked polyubiquitin chains are involved in nonpro-
teolytic processes, such as DNA repair and vesicular trafficking.
In addition to these ‘‘homotypic’’ K48- or K63-linked chains, in
which only one type of ubiquitin linkage is involved, mixed
K11/K63-linked chains have also recently been described
(Boname et al., 2010). The discovery of these ‘‘mixed’’ chains
highlights that ubiquitin chains are probably more diverse and
complex than appreciated until now.
Ubiquitination is reversible because eukaryotic cells encode
proteases that are specific for ubiquitin. These proteases, called
deubiquitinases (DUBs), remove ubiquitin from their targets or
cleave the bond between two linked ubiquitins.
Ubiquitination constitutes an attractive target for a wide range
of pathogens because it regulates many pathways in eukaryotic
cells. Indeed, viruses and pathogenic bacteria can modulate the
ubiquitination level of host proteins by inducing their monoubi-
quitination, their polyubiquitination with K48-linked chains
(which then triggers their degradation), their polyubiquitination
with other types of ubiquitin chains, or their deubiquitination (re-
viewed in Ribet and Cossart, 2010; Randow and Lehner, 2009).
Some pathogen-encoded effectors display E3 ubiquitin ligase
activities. An important fraction of these viral or bacterial E3
694 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
ligases shares structural homologies with eukaryotic E3 ligases,
which are classically divided into HECT and RING E3s depend-
ing on their structures and mechanistic properties (reviewed in
Kerscher et al., 2006). HECT E3 ligases transiently bind ubiquitin
before transferring it to the target protein. In contrast, RING E3
ligases do not link ubiquitin directly but rather facilitate ubiquiti-
nation by binding simultaneously to the charged E2 enzyme and
the protein target.
Recent studies have identified a new family of bacterial E3
ligases with a structural domain completely distinct from the
eukaryotic RING and HECT domains (Hicks and Galan, 2010).
Studies have also identified viral E3 ligases structurally distinct
from eukaryotic ones (Randow and Lehner, 2009). Whether
these new E3 ligases also exist in eukaryotes is still unknown.
Whereas pathogens may have acquired eukaryotic-like E3
ligases by horizontal transfer from diverse eukaryotic sources,
the noneukaryotic E3 ligases may represent novel structures
evolved by pathogens to mimic the function of these essential
enzymes of the host cell.
In addition to encoding their own E3 ligases, some pathogens
may encode adaptor proteins that bind host E3 enzymes and
redirect them to specific targets. For example, two decades
ago, a study found that this strategy is used by some human
papillomaviruses (HPVs), which are associated with the develop-
ment of uterine cervix cancer. The E6 oncoproteins of HPV sero-
type 16 and 18 recruit a host E3 ligase to induce the degradation
of the p53 tumor suppressor, thereby facilitating transformation
of the infected cells (Scheffner et al., 1990).
In addition to E3 ubiquitin ligases, pathogens also encode
DUB-like proteins. A few viral DUBs have been identified, but
their roles in vivo, as well as their host targets, are unknown.
In contrast, several DUB-like proteins have been characterized
in pathogenic bacteria. Salmonella enterica serovar Typhimu-
Figure 1. Posttranslational Modification of
Host Proteins during InfectionYersinia (blue) is an extracellular pathogen thatinjects effectors into the host cell’s cytoplasmusing a specialized type III secretion system(T3SS). Salmonella (red) triggers its own entryinto host cells and replicates in a remodeledvacuole. It also secretes T3SS-dependent effec-tors. After cell invasion, Listeria (green) escapesfrom vacuoles and resides free in the cytoplasm,where it replicates and starts moving using thehost cell’s actin. Interactions with host factorsare mediated by bacterial surface or secretedproteins. Effectors from all three of these bacteria(blue for Yersinia effectors, red for Salmonellaeffectors, and green for Listeria effectors) alterposttranslational modifications of host proteins(purple) to facilitate pathogens’ replication, propa-gation, and evasion from host immune responses .
rium (S. Typhimurium) is an invasive path-
ogen of the small intestine that, in mice,
causes a disease similar to human
typhoid fever. SseL, an effector secreted
by this bacterium, displays deubiquitinat-
ing activity in vitro. It suppresses ubiquiti-
nation and degradation of IkBa, a central
regulator of the NF-kB pathway (see below) (Figure 1) (Le Ne-
grate et al., 2008). Infection with a strain of S. Typhimurium lack-
ing sseL leads to the accumulation of ubiquitinated proteins at
the site of replicating intracellular bacteria (Rytkonen
et al., 2007). Strikingly, the decoration of intracytosolic bacteria
with polyubiquitinated proteins has recently been proposed as
a signal used by host cells to sense intracellular invaders
(Figure 1). This signal triggers cytosolic defense pathways,
such as autophagy, although the nature of ubiquitinated proteins
is unknown (Perrin et al., 2004; Thurston et al., 2009). Bacterial
DUBs may decrease this accumulation of polyubiquitinated
proteins and thus might represent a strategy developed by intra-
cellular bacteria to escape these specific host defense systems.
Interestingly, pathogen-encoded proteins can also be directly
ubiquitinated by the host cell machinery. A striking example in
which PTMs by the host cell strongly alter the behavior of bacte-
rial effectors is the Salmonella SopE and SptP proteins. These
two effectors contribute to the transient remodeling of the host
cell’s cytoskeleton during bacterial entry into the cell. SopE
acts as a GEF (guanine nucleotide exchange factor) and
activates host Rho-GTPases, resulting in actin cytoskeleton
rearrangement, membrane ruffling, and subsequent bacterial
uptake. In contrast, SptP acts as a GAP (GTPase-activating
protein) to deactivate Rho-GTPases and allow the recovery of
the actin cytoskeleton’s normal architecture a few hours after
infection. Although SopE and SptP are codelivered by Salmo-
nella, they exhibit different half-lives. SopE is rapidly polyubiqui-
tinated and degraded by the host proteasome, whereas SptP
exhibits much slower degradation kinetics (Kubori and Galan,
2003). Recent studies found that Salmonella also hijacks the
ubiquitination machinery to control one of its effectors, SopB,
which displays two different activities depending on whether
the protein is ubiquitinated or not (Patel et al., 2009; Knodler
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 695
et al., 2009). Thus, by actively co-opting the ubiquitination
machinery of the host cell, Salmonella regulates the half-lives
and activities of some of its key virulence factors.
SUMOylation
In addition to ubiquitin, other polypeptides can be covalently
linked to cellular proteins to modify their fate and functions.
These polypeptides, which belong to the ubiquitin-like protein
family, share high structural homology with ubiquitin, ranging
from �15% to 50% sequence similarity with it. SUMO (small
ubiquitin-like modifier) belongs to the ubiquitin-like protein family
and is ubiquitous in the eukaryotic kingdom. The human genome
encodes three functional SUMO isoforms that can be linked to
hundreds of different targets. Similar to the ubiquitin system,
the conjugation of SUMO onto the lysine of a target protein
requires an E1, an E2, and an E3 SUMO enzyme. In parallel,
deSUMOylases regulate the SUMOylation level of cellular
proteins by removing SUMO from its targets.
SUMOylation is a fundamental PTM involved in transcription
regulation, intracellular transport, stress responses, the mainte-
nance of genome integrity, and many other biological processes.
Although SUMOylation was first thought not to play a role in
protein degradation, recent findings show that SUMO can trigger
the recruitment of ubiquitin E3 ligases, such as RNF4 (RING
finger protein 4), leading to the ubiquitination and proteasomal
degradation of some SUMOylated proteins (Lallemand-Breiten-
bach et al., 2008; Tatham et al., 2008).
As with the ubiquitin system, several bacterial and viral factors
target or mimic components of the SUMOylation machinery,
thereby increasing or decreasing the SUMOylation level of host
proteins (reviewed in Boggio and Chiocca, 2006; Ribet and
Cossart, 2010). For example, KSHV (Kaposi’s sarcoma-associ-
ated herpes virus), a herpes virus responsible for Kaposi’s
sarcoma development, encodes an enzyme, K-bZip, which
displays E3 SUMO ligase activity. This protein directly partici-
pates in catalyzing SUMO conjugation to host targets, such as
p53 and Retinoblastoma (Rb) protein (Chang et al., 2010). These
modifications are proposed to play a role in modulating host
genes expression in the early stage of viral infection (Chang
et al., 2010).
VP35, a protein encoded by Ebola virus, does not display
E3-like activity, but it binds to the host E3 SUMO enzyme
PIAS1 (protein inhibitor of activated STAT 1) and increases the
SUMOylation level of IRF7 (interferon regulatory factor 7) (Chang
et al., 2009). This SUMOylation of IRF7 downregulates interferon
transcription and may contribute to the dampening of the anti-
viral response induced upon infection of Ebola virus (Chang
et al., 2009).
Gam1, a protein encoded by an avian adenovirus, has an
opposite effect on SUMOylation; it targets the host E1 SUMO
enzyme to proteasomal degradation, thereby inhibiting the
SUMOylation machinery and altering host transcription (Boggio
et al., 2004). Degradation of the SUMOylation machinery is
a strategy also used by Listeria monocytogenes, a food-borne
bacterial pathogen responsible for listeriosis. Indeed, infection
by L. monocytogenes leads to the degradation of Ubc9, the
human E2 SUMO enzyme (Ribet et al., 2010). Listeriolysin O is
a pore-forming toxin secreted by this bacterium, which plays
a fundamental role in bacterial virulence (Figure 1). Listeriolysin
O triggers the degradation of Ubc9, as well as the degradation
of some SUMOylated host proteins (Ribet et al., 2010). In
contrast to the ubiquitin system, which includes dozens of E2
enzymes in humans, the SUMO system has only one E2 enzyme.
Therefore, this degradation of Ubc9 leads to a blockade of the
SUMOylation machinery and to a global decrease in the level
of SUMO-conjugated host proteins in infected cells. Thus, by
decreasing SUMOylation in infected cells, Listeria may alter the
activities of host factors critical for infection (Ribet et al., 2010).
Pathogen-encoded deSUMOylasescan also cause a decrease
in the SUMOylation level of host proteins. Indeed, this is the case
for XopD, a protein injected by the plant pathogen Xanthomonas
campestris into the cytoplasm of plant cells. This protein is
a SUMO-specific protease, which induces deSUMOylation of
several host factors when it is expressed in plant cells (Hotson
et al., 2003). XopD is known to alter host transcription, to promote
pathogen multiplication, and to delay the onset of leaf chlorosis
and necrosis. However, the exact roles of deSUMOylation in
XopD’s effects are unknown (Kim et al., 2008).
In addition to the induction or inhibition of SUMOylation of host
proteins, viral proteins can be SUMOylated themselves.
However, the role that these modifications play in virulence is
unknown in most cases (Boggio and Chiocca, 2006). Surpris-
ingly, examples of bacterial factors directly SUMOylated by
host enzymes have not been identified. It is, however, likely
that future studies will unveil the existence of such modifications,
as well as their role in bacterial infection or in antibacterial
defenses.
Neddylation
Neddylation is another PTM that pathogens target during infec-
tion. Nedd8, which is a member of the ubiquitin-like protein
family, can be linked to cellular proteins in a fashion similar to
ubiquitin (reviewed in Rabut and Peter, 2008). The major class
of currently known Nedd8 substrates is Cullins. Cullins act as
scaffolding proteins in the assembly of multisubunit RING E3
ubiquitin enzymes, called Cullin RING ligases (CRLs). Neddyla-
tion of Cullins controls the activity of CRLs and thereby the ubiq-
uitination and degradation kinetics of CRLs substrates. As with
ubiquitin, Nedd8 can be deconjugated from its targets by dened-
dylases.
Bacterial and viral pathogens can interfere with the neddyla-
tion of host proteins. For example, the Epstein-Barr virus
encodes a protein BPLF1, which displays deneddylase activity
(Gastaldello et al., 2010). During infection, BPLF1 deneddylates
Cullins, thereby inhibiting the activity of CRLs and stabilizing
several CRL substrates. In particular, this leads to the deregula-
tion of the cell cycle and the establishment of an S-phase-like
cellular environment, which is required for efficient replication
of virus DNA (Gastaldello et al., 2010).
A recent study also reported that Cif (cycle-inhibiting factor),
a cyclomodulin translocated into cells by enteropathogenic
and enterohemorrhagic Escherichia coli, binds to Nedd8-conju-
gated CRLs of the host. This interaction inhibits the activity of the
CRLs, leading to a deregulation of the host cell cycle (Jubelin
et al., 2010). Proteins with in vitro deneddylase activity have
also been described in Chlamydia trachomatis, an obligate intra-
cellular bacterial pathogen. However, the role these deneddy-
lases play in infection remains unknown (Misaghi et al., 2006).
696 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
ISGylation
ISG15 (interferon stimulated gene 15) is an ubiquitin-like protein
with two ubiquitin domains. The expression of ISG15 is induced
in response to type I interferons (IFN), a family of cytokines
involved in the antiviral response. Consistent with this induction
in response to IFN, a growing number of studies are now high-
lighting the roles ISG15 plays in antiviral defense against several
types of viruses (reviewed in Skaug and Chen, 2010; Jeon et al.,
2010). Conjugation of ISG15 to target proteins requires the
activity of E1, E2, and E3 enzymes, which are also induced by
IFN. In contrast to the ubiquitin system, which includes hundreds
of E3 enzymes, one unique E3 ISG15 enzyme, namely HERC5,
modifies the vast majority of ISG15 substrates in human cells.
Like with other ubiquitin-like modifications, ISGylation is revers-
ible; specific proteases, called deISGylases, remove ISG15 from
its targets.
The antiviral activity of ISG15 can be due to either the
ISGylation of host proteins critical for infection or the direct
ISGylation of viral proteins (Skaug and Chen, 2010; Jeon et al.,
2010). This latter case has been described for the NS1 protein
of influenza A virus (NS1A), which is ISGylated during infection.
This modification of NS1A was linked to an impairment of influ-
enza replication, although the precise effect of the ISG15 addi-
tion on NS1A remains to be determined (Zhao et al., 2010;
Tang et al., 2010).
Interestingly, recent studies also proposed that the ISG15
conjugation system may modify broadly, and somehow nonspe-
cifically, newly synthesized proteins in a cotranslational manner
(Durfee et al., 2010). This implies that, in the context of an inter-
feron response, viral proteins, rather than cellular proteins, may
be the principal targets of ISGylation (Durfee et al., 2010).
Although only a small fraction of viral proteins might be
ISGylated, it was proposed that ISGylation of viruses’ structural
proteins, which precisely assemble into high-order structures,
might impair the production of infectious viral particles. Indeed,
this was demonstrated for the human papillomavirus HPV16.
ISGylation of a small proportion of its structural protein L1 was
sufficient to have a dominant-negative effect on virus infectivity
(Durfee et al., 2010). The authors postulated that the ISGylation
of host proteins could thus only be a side effect of the cell’s effort
to target viral proteins.
Consistent with the role of ISG15 in antiviral defense, several
viruses have evolved strategies to impair ISGylation (Skaug
and Chen, 2010; Jeon et al., 2010). In particular, studies
have identified several viral proteins that can either mimic
deISGylases or interfere with the ISGylation machinery of the
infected cell. Indeed, the papain-like protease of SARS corona-
virus and the ovarian tumor domain-containing proteases of
nairo- and arteriviruses all display ISG15-deconjugating activi-
ties (Lindner et al., 2005; Frias-Staheli et al., 2007). On the other
hand, NS1 protein of influenza B virus binds to ISG15 and inhibits
its conjugation to target proteins (Yuan and Krug, 2001). By
inhibiting ISG15 conjugation or increasing ISG15 deconjugation,
all these effector proteins were proposed to decrease the
potential antiviral effect of ISGylation.
The role of ISG15 in bacterial infections remains completely
unknown. According to the study by Durfee et al. (2010), the
participation of ISG15 in antibacterial defenses, if any, will prob-
ably rely on the ISGylation of cellular proteins rather than bacte-
rial proteins because the latter are not translated by the host cell
machinery. Nevertheless, investigating the role of ISG15 in infec-
tions by bacterial pathogens will undoubtedly provide exciting
insights into the field of host-pathogens interactions.
AMPylation and Eliminylation, New PTMs Mediatedby BacteriaAMPylation
AMPylation is the addition of an adenosine monophosphate
(AMP) group onto a threonine, tyrosine, or, possibly, serine
residue of a protein. The AMPylation of host proteins by bacterial
pathogens was recently detected in cells during an infection with
Vibrio parahaemolyticus, a human pathogen causing acute
gastroenteritis, and Histophilus somni, a pathogen responsible
for respiratory diseases and septicemia in cattle. Two virulence
factors produced by these extracellular bacteria, namely VopS
and IbpA, are able to reach the cytoplasm of host cells during
infection, where they use ATP to transfer an AMP moiety to
host Rho-GTPases (Figure 2) (Yarbrough et al., 2009; Worby
et al., 2009). This AMPylation alters the activity of Rho-GTPases,
which regulate the dynamics of the cell cytoskeleton.
The catalytic domain responsible for AMPylation was mapped
to the Fic domain (filamention induced by cAMP) of VopS and
IbpA. Fic domains are defined by a core sequence of nine amino
acids containing an invariant histidine residue that is essential for
the AMPylation (Yarbrough et al., 2009). Interestingly, proteins
containing Fic domains are found not only in prokaryotes but
also in eukaryotes, and the existence of eukaryotic proteins
able to catalyze AMPylation has been proposed (Worby et al.,
2009; Kinch et al., 2009). Thus, AMPylation might represent
a new and important posttranslational modification in eukaryotic
cells.
Legionella pneumophila is a human pathogen of the respira-
tory tract responsible for a severe form of pneumonia, called
Legionnaire’s disease. L. pneumophila encodes a factor, DrrA,
which AMPylates the host protein Rab1b, a small GTPase
involved in intracellular vesicular transport (Muller et al., 2010).
AMPylation of Rab1b leads to its constitutive activation, which
not only alters vesicular transport in infected cells but also
contributes to the formation of Legionella intracellular vacuoles
and aids bacterial replication.
Interestingly, the catalytic domain of DrrA is distinct from the
Fic domains observed in VopS and IbpA (Muller et al., 2010).
Thus, a wide diversity of both prokaryotic and eukaryotic
enzymes may catalyze AMPylation, a posttranslational modifica-
tion that might represent an unsuspected way of regulating
various signaling pathways in the cell.
Eliminylation
Phosphorylation was the first covalent protein modification
described. Since its discovery in the late 1950s, phosphorylation
has emerged as a common and fundamental PTM. Phosphory-
lation involves the reversible attachment of a phosphate group
to target proteins by forming a phosphoester bond. This addition
generally occurs on hydroxyl groups of serine, threonine, or tyro-
sine residues. Phosphorylation is reversible; phosphatases can
hydrolyze the phosphoester bond to release the phosphate
group and restore the amino acid in its unphosphorylated form.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 697
Interestingly, a previously unknown enzymatic activity, called
phosphothreonine lyase, was recently identified in three different
bacterial factors (Li et al., 2007; Mazurkiewicz et al., 2008; Zhang
et al., 2007). These enzymes remove the phosphate group from
a threonine residue but, in contrast to classical phosphatases,
do not regenerate the hydroxyl group. Instead, this reaction,
nicknamed eliminylation, modifies threonine into dehydrobutyr-
ine, a residue that can no longer be phosphorylated (Brennan
and Barford, 2009).
The first factor identified with such activity is OspF, a protein
produced by Shigella flexneri, the causative agent of bacillary
dysentery in humans (Li et al., 2007). During infection, bacteria
directly secrete OspF into the host cell cytoplasm, where OspF
helps to dampen the host immune responses by irreversibly
dephosphorylating host MAP (mitogen-activated protein)
kinases (Figure 3) (Li et al., 2007; Arbibe et al., 2007). Phospho-
threonine lyases have been described only inS. flexneri,S.Typhi-
murium, and the plant pathogen Pseudomonas syringae, and
MAP kinases are the only known targets of this PTM. However,
we can expect that, as with AMPylation, some eukaryotic
enzymes may also display this activity and that eliminylation
might regulate numerous signaling pathways in eukaryotic cells.
Signaling Pathways Preferentially Targeted byPathogens by Alteration of Host PTMsSome pathogens produce several effectors that modulate the
activity of host cell proteins by stimulating or counteracting their
Figure 2. Pathogen-Mediated PTMs Target
the Cytoskeleton and ImmunoreceptorsBacteria effector proteins (green) control thedynamics of the host cell’s actin cytoskeleton byposttranslationally modifying Rho-GTPases (left).Viral effector proteins (blue) regulate posttransla-tional modification of immunoreceptors, such asthe major histocompatibility complex class I(MHC I) and the CD4 (cluster of differentiation 4)molecules (right), thereby decreasing their expres-sion at the cell surface and dampening immuneresponses.
PTMs. In this section, we will focus on
several key cellular pathways that are
preferentially targeted by pathogens
through these PTMs.
Regulation of the Cytoskeleton
Dynamics by PTMs
The niches occupied by pathogens within
their hosts are quite diverse. Whereas
some bacterial pathogens remain strictly
extracellular, other bacteria, as well as
viruses, invade host cells and replicate
therein. For viruses, entry into host cell
is strictly required for the synthesis of viral
proteins and the production of new infec-
tious viral particles. Bacteria take refuge
inside host cells to escape humoral
immune response and to replicate in
a well-protected environment. To enter
the cell and create such niches requires extensive remodeling
of the host cell cytoskeleton, a multiprotein assembly of struc-
tural and regulatory elements. Indeed, many pathogen-induced
PTMs target structural or regulatory components of the host
cell’s cytoskeleton.
Listeria monocytogenes is a bacterium that can induce its own
entry into a wide range of cells that are normally nonphagocytic.
This internalization requires interactions between surface
proteins of Listeria and host receptors. After successive PTMs,
these interactions trigger the recruitment of host factors and
the remodeling of host cell cytoskeleton required for internaliza-
tion of the bacteria (Figure 1). For example, the interaction
between the Listeria surface protein InlA and its cellular receptor
E-cadherin promotes Listeria’s invasion into epithelial cells of the
intestine. Activation of E-cadherin by InlA leads to phosphoryla-
tion and ubiquitination of E-cadherin by the Src kinase and
the Hakai E3 ligase, respectively. These PTMs trigger the recruit-
ment of the host’s clathrin-mediated endocytic machinery
followed by rearrangements of the actin cytoskeleton and inter-
nalization of the bacteria (Bonazzi et al., 2008).
In contrast, entry of Listeria into cells that do not express
E-cadherin is mediated by another surface protein, InlB, which
interacts with and activates Met, the hepatocyte growth factor
(HGF) receptor (Figure 1). Similar to HGF activation, Met activa-
tion by InlB induces its autophosphorylation and subsequent
monoubiquitination by the host E3 ligase Cbl. This leads to
the recruitment of the host’s clathrin-dependent endocytic
698 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
machinery, actin rearrangements, and ultimately, the internaliza-
tion of the bacteria (Veiga and Cossart, 2005; Veiga et al., 2007).
To avoid being killed, pathogens can also actively inhibit their
engulfment by professional phagocytes. The mechanisms
involved in this process may also require various pathogen effec-
tors to regulate the PTMs of host proteins (Figure 1). Pathogenic
Yersinia species are involved in human diseases, ranging from
enteric disorders to the plague. One virulence factor secreted
by Yersinia, YopH, displays potent phosphatase activity. It
decreases phosphorylation levels of host proteins involved in
focal adhesion complexes and impairs the cytoskeleton rear-
rangements required for bacterial uptake. Another factor of
Yersinia, YopT, is a protease that cleaves the membrane-
anchoring domain of host Rho-GTPases, leading to their irre-
versible detachment from the plasma membrane and their inac-
tivation (Figure 2 and Figure 1) (Shao et al., 2002). Thus, YopT
contributes to the inhibition of bacterial phagocytosis by pre-
venting rearrangements of the actin cytoskeleton.
Finally, some bacterial pathogens, such as Clostridium diffi-
cile, secrete several toxins that posttranslationally modify host
Rho-GTPases, leading to their constitutive activation, inactiva-
tion, or degradation (Figure 2). This alteration of Rho-GTPases
is widespread and allows bacteria to regulate the host cell’s
cytoskeleton in numerous ways, as well as gene transcription
Figure 3. Pathogen-Mediated PTMs Target
the MAP Kinase and NF-kB Signaling
PathwaysThe MAP kinase (left) and NF-kB (right) signalingcascades trigger immune responses in the hostcell during infections. Both bacterial (green) andviral (blue) effectors weaken these immuneresponses by inducing or counteracting post-translational modifications of key components inthese critical pathways.
and cytokine expression (reviewed in Ak-
tories and Barbieri, 2005).
Inhibition of the NF-kB Pathway
The NF-kB pathway is an example of
a pathway tightly regulated by ubiquitina-
tion (Figure 3). The NF-kB pathway plays
a central role in inflammation and in the
establishment of both innate and immune
responses. Specific signals, such as
cytokines or microbial signatures, acti-
vate this pathway by switching on the
IkB kinase (IKK) complex. This leads to
the phosphorylation of IkBa, an inhibitor
protein that sequesters transcription
factors of the NF-kB family in the cyto-
plasm. Phosphorylated IkBa is then
recognized by specific ubiquitin E3
ligases, polyubiquitinated with K48-
linked chains, and targeted to the protea-
some for degradation. Destroying IkBa
leads to the release of NF-kB transcrip-
tion factors, allowing them to translocate
into the nucleus and initiate transcriptionof various genes involved in host immune responses. Because
the NF-kB pathway plays a central role in immune responses,
there is a strong evolutionary pressure on pathogens to prevent
activation of this pathway during infection.
One possibility for dampening this pathway is to block the
ubiquitination of IkBa, thereby inhibiting its proteasomal degra-
dation and the translocation of NF-kB factors into the nucleus
(Figure 3). In numerous cases, factors achieve this goal by inter-
fering with the host ubiquitination machinery. For example,
S. flexneri secretes the effector OspG into the host cell’s
cytoplasm, where it binds to and inhibits UbcH5, a host E2
ubiquitin enzyme involved in IkBa ubiquitination (Kim et al.,
2005). The accessory protein Vpu (viral protein U) of HIV1 also
interferes with IkBa ubiquitination by inhibiting the E3 ubiquitin
ligase involved in IkBa’s modification (Bour et al., 2001). The
DUB-like SseL factor produced by S. Typhimurium inhibits
IkBa ubiquitination in response to the TNF-a cytokine, suggest-
ing that SseL acts directly by removing the K48-linked chains of
IkBa (Le Negrate et al., 2008).
Numerous factors also target the IKK complex directly
(Figure 3). For example, in addition to producing OspG, S. flex-
neri also secretes IpaH9.8, an effector with E3 ubiquitin ligase
activity. IpaH9.8 polyubiquitinates the NEMO/IKKg protein of
the IKK complex and targets it to the proteasome, thereby
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 699
impairing the phosphorylation and subsequent degradation of
IkBa (Rohde et al., 2007; Ashida et al., 2010). L. monocytogenes
intracellularly secretes InlC, which directly interacts with the
IKKa protein to block the phosphorylation of IkBa (Gouin et al.,
2010). Similarly, YopJ/P, an effector produced by pathogenic
Yersinia species, mediates the acetylation of the IKKa and
b proteins, which prevents their activation and subsequent
IkBa phosphorylation (Mittal et al., 2006).
Interestingly, commensal bacteria of the human intestine can
also act on the NF-kB pathway. Indeed, some bacterial fermen-
tation products, such as butyrate or other short-chained fatty
acids, can stimulate the local production of reactive oxygen
species in intestinal epithelial cells. This leads to the inactivation
of some redox-sensitive enzymes, such as E2 Nedd8 enzyme,
and therefore a decrease in the neddylation level of host
proteins. In this context, reduced neddylation levels, in particular
the decrease in Cullin-1 neddylation, have been associated with
a downregulation of the NF-kB pathway and hypothesized to
contribute to the inflammatory tolerance of the intestinal epithe-
lium toward commensal bacteria (Kumar et al., 2009).
Targeting of MAP Kinase Pathway
Similar to the NF-kB pathway, the MAP kinase pathway is
another central signaling cascade that is essential for the activa-
tion of host innate immune responses. Therefore, not surpris-
ingly, pathogens often target the MAP kinase pathway in order
to facilitate their infection (Figure 3). One effector protein
secreted intracellularly by Shigella is OspF, which possesses
phosphothreonine lyase activity. OspF irreversibly dephosphor-
ylates host MAP kinases and, therefore, was proposed to partic-
ipate in the dampening of host immune responses (Li et al., 2007;
Arbibe et al., 2007). Interestingly, other bacterial virulence
factors, such as SpvC from S. Typhimurium or HopAI1 from
the plant pathogen P. syringae, possess the same phospho-
threonine lyase activity as OspF and also target MAP kinases
of their hosts (Mazurkiewicz et al., 2008; Zhang et al., 2007). In
addition to these factors, the Yersinia YopJ/P effector can inac-
tivate host MAP kinases by catalyzing their acetylation (Mittal
et al., 2006; Mukherjee et al., 2006). Finally, the anthrax lethal
factor, a subunit of the Anthrax toxin encoded by Bacillus anthra-
cis, cleaves host MAP kinases, leading to their irreversible inac-
tivation (reviewed in Turk, 2007).
Regulation of Cellular Immunoreceptors
To avoid detection by the immune system, some pathogens
restrict the surface expression of fundamental molecules of the
immune system by subverting host ubiquitination (Figure 2).
For example, KSHV encodes two E3 ubiquitin ligases, K3 and
K5, which both target the host protein’s major histocompatibility
complex class I (MHC I). An essential player of the immune
response, MHC I alerts the immune system to intracellular path-
ogens by sampling the protein repertoire of host cells and then
presenting peptides to cytotoxic T lymphocytes. K3 rapidly
mediates the polyubiquitination of MHC I molecules at the
surface of the cell with K63-linked chains, leading to their endo-
cytosis and degradation. Interestingly, K5 also mediates polyu-
biquitination of MHC I but with mixed K63 and K11 chains,
instead of homotypic chains. Indeed, these mixed chains are
required for the internalization of MHC I by K5, thus highlighting,
for the first time, the putative importance of such mixed polyubi-
quitin chains in the control of immune responses (Boname
et al., 2010). Some herpesvirus E3 ubiquitin ligases downregu-
late MHC I molecules by triggering their degradation by the
ERAD (endoplasmic reticulum-associated protein degradation)
pathway (reviewed in Randow and Lehner, 2009). Some viral
proteins, such as HIV Vpu accessory protein, can act as adap-
tors of host E3 ubiquitin ligases to induce the proteasomal
degradation of other types of host immunoreceptors, such as
CD4 (cluster of differentiation 4) receptor on T cells (Schubert
et al., 1998). Finally, bacterial pathogens, such as Salmonella,
can decrease the expression of MHC class II molecules at the
cell surface by modulating their ubiquitination, which also leads
to the dampening of host immune responses (Lapaque et al.,
2009).
ConclusionResearchers have known for decades that pathogens interfere
with the host’s PTMs. However, the current ‘‘re-emergence’’ of
this field of research reflects the importance of controlling
PTMs during infection and the complexity of these processes
in host-pathogen interactions. In this Review, we focused on
how pathogens manipulate host PTMs and how they use these
PTMs to solve their own biological needs.
It should be stressed that pathogens may also actively co-opt
or be the passive targets of the host cell’s PTM machinery. As
mentioned above, pathogen-encoded proteins can indeed be
ubiquitinated, SUMOylated, or ISGylated, and like with host
proteins, PTMs of pathogen-encoded proteins regulate these
factors’ half-lives, activities, intracellular localization, or binding
to other host- or pathogen-encoded factors. Therefore, it is
tempting to speculate that the diversity of known PTMs affecting
pathogen-encoded proteins will greatly increase in the near
future.
As the number of studies reporting crosstalk between different
PTMs increases, an emerging idea is that PTMs are more
complex than originally anticipated. For example, in the NF-kB
signaling pathway alone, phosphorylation, SUMOylation, K63-
polyubiquitination, and K48-polyubiquitination act in synergy
to regulate the activation or the inhibition of transcriptional
responses. Targeting of these pathways by pathogens, there-
fore, often requires a tightly controlled orchestration of multiple
levels of PTMs.
Studies on pathogen interference with host protein PTMs has
provided numerous insights into cell biology over the years. In
particular, some pathogen effectors serve as invaluable tools
to study particular aspects of cell biology. For example, the
C3 exoenzyme from Clostridium ADP-ribosylates and inhibits
multiple Rho-GTPases. Therefore, the C3 protein has been used
successfully to highlight the specific role of the Rho-GTPase in
stress fiber formation and to study the regulation of the actin
cytoskeleton dynamics in eukaryotic cells (Ridley and Hall,
1992; Ridley et al., 1992).
Finally, the development of new technologies, such as
improvements in mass spectrometry (especially the SILAC
[stable isotope labeling of amino acids in cell culture] technique;
Mann, 2006), will undoubtedly increase the list of currently
known PTMs and facilitate the understanding of their roles in
host-pathogen interactions. Identifying pathogen-encoded
700 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
enzymes that catalyze specific PTMs critical for infection will
provide valuable new targets for drug development. Indeed,
the selective inhibition of these enzymes may constitute a prom-
ising strategy to counter these insidious invaders.
ACKNOWLEDGMENTS
We apologize to authors whose work could not be included because of space
constraints. Work in P.C.’s laboratory receives financial support from Institut
Pasteur, Inserm, INRA, ERC (advanced grant 233348), the Fondation le
Roch Les Mousquetaires, and the Fondation Louis-Jeantet. D.R. is supported
by a fellowship from the Association pour la Recherche sur le Cancer. P.C. is
an international research scholar of the Howard Hughes Medical Institute.
REFERENCES
Aktories, K., and Barbieri, J.T. (2005). Bacterial cytotoxins: targeting eukary-
otic switches. Nat. Rev. Microbiol. 3, 397–410.
Arbibe, L., Kim, D.W., Batsche, E., Pedron, T., Mateescu, B., Muchardt, C.,
Parsot, C., and Sansonetti, P.J. (2007). An injected bacterial effector targets
chromatin access for transcription factor NF-kappaB to alter transcription of
host genes involved in immune responses. Nat. Immunol. 8, 47–56.
Ashida, H., Kim, M., Schmidt-Supprian, M., Ma, A., Ogawa, M., and Sasa-
kawa, C. (2010). A bacterial E3 ubiquitin ligase IpaH9.8 targets NEMO/IKK-
gamma to dampen the host NF-kappaB-mediated inflammatory response.
Nat. Cell Biol. 12, 66–73, 1–9.
Boggio, R., and Chiocca, S. (2006). Viruses and sumoylation: recent highlights.
Curr. Opin. Microbiol. 9, 430–436.
Boggio, R., Colombo, R., Hay, R.T., Draetta, G.F., and Chiocca, S. (2004).
A mechanism for inhibiting the SUMO pathway. Mol. Cell 16, 549–561.
Boname, J.M., Thomas, M., Stagg, H.R., Xu, P., Peng, J., and Lehner, P.J.
(2010). Efficient internalization of MHC I requires lysine-11 and lysine-63 mixed
linkage polyubiquitin chains. Traffic 11, 210–220.
Bonazzi, M., Veiga, E., Pizarro-Cerda, J., and Cossart, P. (2008). Successive
post-translational modifications of E-cadherin are required for InlA-mediated
internalization of Listeria monocytogenes. Cell. Microbiol. 10, 2208–2222.
Bour, S., Perrin, C., Akari, H., and Strebel, K. (2001). The human immunodefi-
ciency virus type 1 Vpu protein inhibits NF-kappa B activation by interfering
with beta TrCP-mediated degradation of Ikappa B. J. Biol. Chem. 276,
15920–15928.
Brennan, D.F., and Barford, D. (2009). Eliminylation: a post-translational
modification catalyzed by phosphothreonine lyases. Trends Biochem. Sci.
34, 108–114.
Chang, P.C., Izumiya, Y., Wu, C.Y., Fitzgerald, L.D., Campbell, M., Ellison, T.J.,
Lam, K.S., Luciw, P.A., and Kung, H.J. (2010). Kaposi’s sarcoma-associated
herpesvirus (KSHV) encodes a SUMO E3 ligase that is SIM-dependent and
SUMO-2/3-specific. J. Biol. Chem. 285, 5266–5273.
Chang, T.H., Kubota, T., Matsuoka, M., Jones, S., Bradfute, S.B., Bray, M.,
and Ozato, K. (2009). Ebola Zaire virus blocks type I interferon production by
exploiting the host SUMO modification machinery. PLoS Pathog. 5, e1000493.
Collier, R.J., and Cole, H.A. (1969). Diphtheria toxin subunit active in vitro.
Science 164, 1179–1181.
Durfee, L.A., Lyon, N., Seo, K., and Huibregtse, J.M. (2010). The ISG15 conju-
gation system broadly targets newly synthesized proteins: Implications for the
antiviral function of ISG15. Mol. Cell 38, 722–732.
Frias-Staheli, N., Giannakopoulos, N.V., Kikkert, M., Taylor, S.L., Bridgen, A.,
Paragas, J., Richt, J.A., Rowland, R.R., Schmaljohn, C.S., Lenschow, D.J.,
et al. (2007). Ovarian tumor domain-containing viral proteases evade ubiquitin-
and ISG15-dependent innate immune responses. Cell Host Microbe 2,
404–416.
Gastaldello, S., Hildebrand, S., Faridani, O., Callegari, S., Palmkvist, M.,
Di Guglielmo, C., and Masucci, M.G. (2010). A deneddylase encoded by
Epstein-Barr virus promotes viral DNA replication by regulating the activity
of cullin-RING ligases. Nat. Cell Biol. 12, 351–361.
Gouin, E., Adib-Conquy, M., Balestrino, D., Nahori, M.A., Villiers, V., Colland,
F., Dramsi, S., Dussurget, O., and Cossart, P. (2010). The Listeria monocyto-
genes InlC protein interferes with innate immune responses by targeting
the IkappaB kinase subunit IKKalpha. Proc. Natl. Acad. Sci. USA 107,
17333–17338.
Hicks, S.W., and Galan, J.E. (2010). Hijacking the host ubiquitin pathway:
structural strategies of bacterial E3 ubiquitin ligases. Curr. Opin. Microbiol.
13, 41–46.
Hotson, A., Chosed, R., Shu, H., Orth, K., and Mudgett, M.B. (2003). Xantho-
monas type III effector XopD targets SUMO-conjugated proteins in planta.
Mol. Microbiol. 50, 377–389.
Jeon, Y.J., Yoo, H.M., and Chung, C.H. (2010). ISG15 and immune diseases.
Biochim. Biophys. Acta 1802, 485–496.
Jubelin, G., Taieb, F., Duda, D.M., Hsu, Y., Samba-Louaka, A., Nobe, R.,
Penary, M., Watrin, C., Nougayrede, J.P., Schulman, B.A., et al. (2010). Path-
ogenic bacteria target NEDD8-conjugated cullins to hijack host-cell signaling
pathways. PLoS Pathog. 6, e1001128.
Kerscher, O., Felberbaum, R., and Hochstrasser, M. (2006). Modification of
proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell Dev. Biol.
22, 159–180.
Kim, D.W., Lenzen, G., Page, A.L., Legrain, P., Sansonetti, P.J., and Parsot, C.
(2005). The Shigella flexneri effector OspG interferes with innate immune
responses by targeting ubiquitin-conjugating enzymes. Proc. Natl. Acad.
Sci. USA 102, 14046–14051.
Kim, J.G., Taylor, K.W., Hotson, A., Keegan, M., Schmelz, E.A., and Mudgett,
M.B. (2008). XopD SUMO protease affects host transcription, promotes path-
ogen growth, and delays symptom development in xanthomonas-infected
tomato leaves. Plant Cell 20, 1915–1929.
Kinch, L.N., Yarbrough, M.L., Orth, K., and Grishin, N.V. (2009). Fido, a novel
AMPylation domain common to fic, doc, and AvrB. PLoS ONE 4, e5818.
Knodler, L.A., Winfree, S., Drecktrah, D., Ireland, R., and Steele-Mortimer, O.
(2009). Ubiquitination of the bacterial inositol phosphatase, SopB, regulates its
biological activity at the plasma membrane. Cell. Microbiol. 11, 1652–1670.
Kubori, T., and Galan, J.E. (2003). Temporal regulation of salmonella virulence
effector function by proteasome-dependent protein degradation. Cell 115,
333–342.
Kumar, A., Wu, H., Collier-Hyams, L.S., Kwon, Y.M., Hanson, J.M., and Neish,
A.S. (2009). The bacterial fermentation product butyrate influences epithelial
signaling via reactive oxygen species-mediated changes in cullin-1 neddyla-
tion. J. Immunol. 182, 538–546.
Lallemand-Breitenbach, V., Jeanne, M., Benhenda, S., Nasr, R., Lei, M., Peres,
L., Zhou, J., Zhu, J., Raught, B., and de The, H. (2008). Arsenic degrades PML
or PML-RARalpha through a SUMO-triggered RNF4/ubiquitin-mediated
pathway. Nat. Cell Biol. 10, 547–555.
Lapaque, N., Hutchinson, J.L., Jones, D.C., Meresse, S., Holden, D.W.,
Trowsdale, J., and Kelly, A.P. (2009). Salmonella regulates polyubiquitination
and surface expression of MHC class II antigens. Proc. Natl. Acad. Sci. USA
106, 14052–14057.
Le Negrate, G., Faustin, B., Welsh, K., Loeffler, M., Krajewska, M., Hasegawa,
P., Mukherjee, S., Orth, K., Krajewski, S., Godzik, A., et al. (2008). Salmonella
secreted factor L deubiquitinase of Salmonella typhimurium inhibits
NF-kappaB, suppresses IkappaBalpha ubiquitination and modulates innate
immune responses. J. Immunol. 180, 5045–5056.
Li, H., Xu, H., Zhou, Y., Zhang, J., Long, C., Li, S., Chen, S., Zhou, J.M., and
Shao, F. (2007). The phosphothreonine lyase activity of a bacterial type III
effector family. Science 315, 1000–1003.
Lindner, H.A., Fotouhi-Ardakani, N., Lytvyn, V., Lachance, P., Sulea, T., and
Menard, R. (2005). The papain-like protease from the severe acute respiratory
syndrome coronavirus is a deubiquitinating enzyme. J. Virol. 79, 15199–15208.
Mann, M. (2006). Functional and quantitative proteomics using SILAC. Nat.
Rev. Mol. Cell Biol. 7, 952–958.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 701
Mazurkiewicz, P., Thomas, J., Thompson, J.A., Liu, M., Arbibe, L., Sansonetti,
P., and Holden, D.W. (2008). SpvC is a Salmonella effector with phosphothreo-
nine lyase activity on host mitogen-activated protein kinases. Mol. Microbiol.
67, 1371–1383.
Misaghi, S., Balsara, Z.R., Catic, A., Spooner, E., Ploegh, H.L., and Starnbach,
M.N. (2006). Chlamydia trachomatis-derived deubiquitinating enzymes in
mammalian cells during infection. Mol. Microbiol. 61, 142–150.
Mittal, R., Peak-Chew, S.Y., and McMahon, H.T. (2006). Acetylation of MEK2
and I kappa B kinase (IKK) activation loop residues by YopJ inhibits signaling.
Proc. Natl. Acad. Sci. USA 103, 18574–18579.
Mukherjee, S., Keitany, G., Li, Y., Wang, Y., Ball, H.L., Goldsmith, E.J., and
Orth, K. (2006). Yersinia YopJ acetylates and inhibits kinase activation by
blocking phosphorylation. Science 312, 1211–1214.
Muller, M.P., Peters, H., Blumer, J., Blankenfeldt, W., Goody, R.S., and Itzen,
A. (2010). The Legionella effector protein DrrA AMPylates the membrane traffic
regulator Rab1b. Science 329, 964–969.
Patel, J.C., Hueffer, K., Lam, T.T., and Galan, J.E. (2009). Diversification of
a Salmonella virulence protein function by ubiquitin-dependent differential
localization. Cell 137, 283–294.
Perrin, A.J., Jiang, X., Birmingham, C.L., So, N.S., and Brumell, J.H. (2004).
Recognition of bacteria in the cytosol of mammalian cells by the ubiquitin
system. Curr. Biol. 14, 806–811.
Rabut, G., and Peter, M. (2008). Function and regulation of protein neddylation.
‘Protein modifications: beyond the usual suspects’ review series. EMBO Rep.
9, 969–976.
Randow, F., and Lehner, P.J. (2009). Viral avoidance and exploitation of the
ubiquitin system. Nat. Cell Biol. 11, 527–534.
Ribet, D., and Cossart, P. (2010). Post-translational modifications in host cells
during bacterial infection. FEBS Lett. 584, 2748–2758.
Ribet, D., Hamon, M., Gouin, E., Nahori, M.A., Impens, F., Neyret-Kahn, H.,
Gevaert, K., Vandekerckhove, J., Dejean, A., and Cossart, P. (2010). Listeria
monocytogenes impairs SUMOylation for efficient infection. Nature 464,
1192–1195.
Ridley, A.J., and Hall, A. (1992). The small GTP-binding protein rho regulates
the assembly of focal adhesions and actin stress fibers in response to growth
factors. Cell 70, 389–399.
Ridley, A.J., Paterson, H.F., Johnston, C.L., Diekmann, D., and Hall, A. (1992).
The small GTP-binding protein rac regulates growth factor-induced
membrane ruffling. Cell 70, 401–410.
Rohde, J.R., Breitkreutz, A., Chenal, A., Sansonetti, P.J., and Parsot, C. (2007).
Type III secretion effectors of the IpaH family are E3 ubiquitin ligases. Cell Host
Microbe 1, 77–83.
Rytkonen, A., Poh, J., Garmendia, J., Boyle, C., Thompson, A., Liu, M.,
Freemont, P., Hinton, J.C., and Holden, D.W. (2007). SseL, a Salmonella deu-
biquitinase required for macrophage killing and virulence. Proc. Natl. Acad.
Sci. USA 104, 3502–3507.
Scheffner, M., Werness, B.A., Huibregtse, J.M., Levine, A.J., and Howley, P.M.
(1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18
promotes the degradation of p53. Cell 63, 1129–1136.
Schubert, U., Anton, L.C., Bacık, I., Cox, J.H., Bour, S., Bennink, J.R., Orlow-
ski, M., Strebel, K., and Yewdell, J.W. (1998). CD4 glycoprotein degradation
induced by human immunodeficiency virus type 1 Vpu protein requires the
function of proteasomes and the ubiquitin-conjugating pathway. J. Virol. 72,
2280–2288.
Shao, F., Merritt, P.M., Bao, Z., Innes, R.W., and Dixon, J.E. (2002). A Yersinia
effector and a Pseudomonas avirulence protein define a family of cysteine
proteases functioning in bacterial pathogenesis. Cell 109, 575–588.
Skaug, B., and Chen, Z.J. (2010). Emerging role of ISG15 in antiviral immunity.
Cell 143, 187–190.
Tang, Y., Zhong, G., Zhu, L., Liu, X., Shan, Y., Feng, H., Bu, Z., Chen, H., and
Wang, C. (2010). Herc5 attenuates influenza A virus by catalyzing ISGylation of
viral NS1 protein. J. Immunol. 184, 5777–5790.
Tatham, M.H., Geoffroy, M.C., Shen, L., Plechanovova, A., Hattersley, N.,
Jaffray, E.G., Palvimo, J.J., and Hay, R.T. (2008). RNF4 is a poly-SUMO-
specific E3 ubiquitin ligase required for arsenic-induced PML degradation.
Nat. Cell Biol. 10, 538–546.
Thurston, T.L., Ryzhakov, G., Bloor, S., von Muhlinen, N., and Randow, F.
(2009). The TBK1 adaptor and autophagy receptor NDP52 restricts the prolif-
eration of ubiquitin-coated bacteria. Nat. Immunol. 10, 1215–1221.
Turk, B.E. (2007). Manipulation of host signalling pathways by anthrax toxins.
Biochem. J. 402, 405–417.
Veiga, E., and Cossart, P. (2005). Listeria hijacks the clathrin-dependent endo-
cytic machinery to invade mammalian cells. Nat. Cell Biol. 7, 894–900.
Veiga, E., Guttman, J.A., Bonazzi, M., Boucrot, E., Toledo-Arana, A., Lin, A.E.,
Enninga, J., Pizarro-Cerda, J., Finlay, B.B., Kirchhausen, T., and Cossart, P.
(2007). Invasive and adherent bacterial pathogens co-opt host clathrin for
infection. Cell Host Microbe 2, 340–351.
Worby, C.A., Mattoo, S., Kruger, R.P., Corbeil, L.B., Koller, A., Mendez, J.C.,
Zekarias, B., Lazar, C., and Dixon, J.E. (2009). The fic domain: regulation of
cell signaling by adenylylation. Mol. Cell 34, 93–103.
Yarbrough, M.L., Li, Y., Kinch, L.N., Grishin, N.V., Ball, H.L., and Orth, K.
(2009). AMPylation of Rho GTPases by Vibrio VopS disrupts effector binding
and downstream signaling. Science 323, 269–272.
Yuan, W., and Krug, R.M. (2001). Influenza B virus NS1 protein inhibits conju-
gation of the interferon (IFN)-induced ubiquitin-like ISG15 protein. EMBO J. 20,
362–371.
Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L.,
Chai, J., et al. (2007). A Pseudomonas syringae effector inactivates MAPKs
to suppress PAMP-induced immunity in plants. Cell Host Microbe 1, 175–185.
Zhao, C., Hsiang, T.Y., Kuo, R.L., and Krug, R.M. (2010). ISG15 conjugation
system targets the viral NS1 protein in influenza A virus-infected cells. Proc.
Natl. Acad. Sci. USA 107, 2253–2258.
Note Added in Proof
It came recently to our attention that AMPylation is also called adenylylation
and was first discovered in the late sixties as regulating the glutamine synthe-
tase of E. coli by modifying a tyrosine residue (Stadtman, E.R., 2001, The story
of glutamine synthetase regulation. J. Biol. Chem. 276, 44357–44364).
702 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
Leading Edge
Review
Modifications of Small RNAsand Their Associated ProteinsYoung-Kook Kim,1 Inha Heo,1 and V. Narry Kim1,*1School of Biological Sciences and Center for National Creative Research, Seoul National University, Seoul 151-742, Korea
*Correspondence: [email protected] 10.1016/j.cell.2010.11.018
Small regulatory RNAs and their associated proteins are subject to diverse modifications that canimpinge on their abundance and function. Some of the modifications are under the influence ofcellular signaling, thus contributing to the dynamic regulation of RNA silencing.
IntroductionThe past decade has witnessed an explosion of research on
small regulatory RNAs that has yielded a basic understanding
of the many types of small RNAs in diverse eukaryotic species,
the protein factors involved, and the functions of key factors
along the RNA silencing pathways. Much more remains to be
learned, however, with recent studies unveiling interesting new
layers of regulation and complexity associated with small
RNAs. We now know that both small RNAs and their associated
protein factors can be modified at multiple steps in their biogen-
esis and effector pathways.
Insight into modifications of small RNAs came initially from
sequencing efforts, which made it clear that most microRNA
(miRNA) loci generate multiple isoforms (called isomiRs) apart
from the reference sequence (Morin et al., 2008). Alternative/
inaccurate processing partly explains the heterogeneity, but
a substantial portion of the variation is due to RNA modifications.
Small RNAs are modified either internally or externally by untem-
plated nucleotide addition, exonucleolytic trimming, 20-O-methyl
transfer, and RNA editing. Protein factors in RNA silencing path-
ways are also subject to various posttranslational modifications,
including phosphorylation, hydroxylation, ubiquitination, and
methylation. In this Review, we focus on the recent develop-
ments in the modifications of RNAs and proteins in RNA silencing
pathways.
Small RNA BiogenesisRNA silencing is a widespread mechanism of gene regulation in
eukaryotes. At the core of all RNA silencing pathways lie small
RNAs (20–30 nt in length) associated with the Argonaute family
proteins (Kim et al., 2009). Small RNAs provide the specificity
of regulation by base-pairing to the target nucleic acids while
the Argonaute proteins execute the silencing effects. The Argo-
naute (Ago) proteins are grouped into Ago and Piwi subfamilies,
and in animals, three types of small RNAs have been described:
microRNAs (miRNAs), small interfering RNAs (siRNAs), and Piwi-
interacting RNAs (piRNAs).
miRNAs (�22 nt) induce mRNA degradation and/or transla-
tional repression. Nucleotides 2–7, from the 50 end of the miRNA,
are referred to as the ‘‘seed’’ and are critical for hybridization to
the targets (Bartel, 2009). As a class, miRNAs are found in all
tissues, although each miRNA species displays a unique spatio-
temporal pattern of expression. An miRNA originates from a long
primary transcript (pri-miRNA) containing a local hairpin struc-
ture (Kim et al., 2009). In animals, the nuclear RNase III Drosha
liberates the hairpin-shaped precursor miRNA (pre-miRNA)
(Figure 1). The cytoplasmic RNase III Dicer removes the terminal
loop to produce a small RNA duplex, consisting of the functional
miRNA strand and the passenger (*) strand (miRNA/miRNA*).
The duplex then binds to the Argonaute loading complex
(comprised of Dicer, TRBP, and Ago), whose action leads to
the incorporation of the functional miRNA strand (mature miRNA)
into Ago. The plant miRNA system differs from its animal coun-
terparts in several aspects (Figure 2). The plant homolog of Dicer,
Dicer-like 1 (DCL1), cleaves both pri-miRNA and pre-miRNA in
the nucleus. Plant miRNAs generally show extensive comple-
mentary to their target mRNAs and induce endonucleolytic
cleavage of the targets.
Endogenous siRNAs (endo-siRNAs, �21 nt) are similar to
miRNAs in their binding to the Ago subfamily proteins, in their
dependence on Dicer for biogenesis, and in exerting their regu-
latory effects posttranscriptionally (Kim et al., 2009). But unlike
miRNAs, endo-siRNAs originate from long double-stranded
RNA precursors (dsRNAs), and their biogenesis does not require
processing by Drosha. Endo-siRNAs are abundant in lower
eukaryotes and in plants, whereas in mammals, they are found
in restricted tissues such as the ovary.
Piwi-interacting RNAs (piRNAs, 21–30 nt) associate with the
Piwi subfamily of Argonaute proteins. piRNAs mediate the
silencing of repetitive elements in gonads via transcriptional
and posttranscriptional silencing mechanisms. Production of
piRNAs is not dependent on RNase III nucleases, and the steps
and factors involved in their biogenesis remain largely unknown.
Modifications of Small RNAs30 End Modifications: Uridylation, Adenylation,
and 20-O-Methylation
The 30 ends of mature miRNAs are highly heterogeneous,
whereas the 50 ends are relatively invariable. The patterns
and sources of heterogeneity seem to vary depending on the
miRNA species and the cell types. The 30 end often contains
extra 1–3 nucleotides that do not match the genomic DNA
sequences. These untemplated nucleotides are added by
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 703
terminal nucleotidyl transferases that preferentially introduce
uridyl or adenyl residues to the 30 terminus of RNA.
The first indication of 30 end modification of small RNA came
from a hen1 mutant of Arabidopsis (Li et al., 2005). HEN1 is
a methyl transferase that adds a methyl group to the 20-OH at
the 30 end of RNA (Yu et al., 2005). In hen1 mutants, miRNAs
are reduced in abundance and become heterogeneous in size
due to uridylation at the 30 end. Because U tailing correlates
with the exonucleolytic degradation of mRNAs (Shen and
Goodman, 2004), it was postulated that uridylation induces
degradation of plant miRNAs and that the 20-O-methyl moiety
is required to protect small RNAs from uridylation and decay
(see below). Consistent with this notion, in green algae Chlamy-
domonas, a nucleotidyl transferase, MUT68, uridylates the 30
end of small RNA, and the RRP6 exosome subunit facilitates
small RNA decay in a manner dependent on MUT68 in vitro (Ibra-
him et al., 2010). Deletion of MUT68 results in elevated miRNA
and siRNA levels, indicating that MUT68 and RRP6 collaborate
in the turnover of mature small RNAs in plants.
Similar links between 20-O-methylation, uridylation, and decay
appear to exist in animals. A recent study on the zebrafish Hen1
homolog shows that piRNAs are uridylated and adenylated and
that piRNA levels are reduced in hen1 mutant germ cells (Kam-
minga et al., 2010). In flies and mice, piRNAs are methylated
by HEN1 orthologs, but the connection to stability control
remains unclear (Horwich et al., 2007; Kirino and Mourelatos,
2007; Ohara et al., 2007; Saito et al., 2007). In flies, dAgo2-bound
RNAs (mostly siRNAs) are protected by 20-O-methylation from
being uridylated/adenylated, which in turn induces 30
exonucleolytic trimming (Ameres et al., 2010). In nematode
worms, the role of 20-O-methylation has yet to be determined.
However, a subset of endo-siRNAs associated with an Ago
homolog CSR-1 is uridylated at the 30 end, and the uridyl trans-
ferase CDE-1 (also known as CID-1 or PUP-1) negatively regu-
lates these siRNAs, indicating that uridylation serves as a trigger
for decay (van Wolfswinkel et al., 2009).
Although mature miRNAs lack methylation in animals, uridyla-
tion plays a significant role in the control of miRNA biogenesis.
In mammalian embryonic stem cells, let-7 biogenesis is sup-
pressed by the Lin28 protein that binds to the terminal loop of
the let-7 precursors (Heo et al., 2008; Newman et al., 2008;
Rybak et al., 2008; Viswanathan et al., 2008). Of interest, Lin28
induces 30 uridylation of pre-let-7 by recruiting the terminal
nucleotidyl transferase TUT4 (also known as ZCCHC11) (Hagan
Figure 1. Modifications in the Animal
MicroRNA Pathway(Left) MicroRNAs (miRNAs) are subject to diversemodifications. Pri-miRNAs are edited by ADARs,which convert adenosine to inosine (I). RNA editinginhibits processing and/or alters target specificity.Pre-let-7 is regulated through uridylation. Lin28recognizes pre-let-7 and, in turn, recruits a nucleo-tidyl transferase TUT4 (mammal) or PUP-2(worms), which adds an oligo-uridine tail at the 30
end of RNA. The uridylated pre-miRNA is resistantto Dicer processing and subject to decay. TUT4also uridylates mature miRNA (miR-26), whichreduces miRNA activity. Another nucleotidyl trans-ferase GLD-2 adenylates mature miRNAs, whichreduces the activity of miRNA and/or increasesthe stability of specific miRNAs (such as miR-122).(Bottom) Mature miRNAs are degraded throughseveral mechanisms. In worms, a 50/30 exonu-clease XRN-2 degrades miRNAs that are releasedfrom Ago. In flies and humans, extensive pairingbetween miRNA/siRNA and target RNA triggerstailing as well as 30/50 trimming of miRNA/siRNA.(Right) Protein factors, which are involved in themiRNA pathway, are also subject to various post-translational modifications. Human Drosha isphosphorylated at two serine residues, S300/S302, by an unknown kinase. Phosphorylationlocalizes Drosha to the nucleus, where the pri-miRNA processing occurs. MAP kinases Erk1/2phosphorylate human TRBP at S142, S152,S283, and S286, which increases the proteinstability of TRBP and Dicer. Ago2 is regulated bymultiple modifications. A prolyl hydroxylaseC-P4H(I) hydroxylates P700 in human Ago2, whichenhances stability of Ago2 and increases P bodylocalization. Phosphorylation of human Ago2 atS387 by MAPKAPK2, which is induced by p38pathway, also promotes P body localization ofAgo2. However, the biological significance ofP body localization of Ago2 remains unclear. Inmice, a stem cell-specific E3 ligase, mLin41, ubiq-uitinates Ago2 and targets it for proteosome-dependent degradation.
704 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
et al., 2009; Heo et al., 2009). The oligo U-tail added by TUT4
blocks Dicer processing and facilitates the decay of pre-let-7.
The homologs of TUT4 may have related functions in other
organisms. In nematode worms, PUP-2 uridylates pre-let-7
in vitro and suppresses the let-7 function in vivo (Lehrbach
et al., 2009).
Let-7 is unlikely to be the only miRNA uridylated at the pre-
miRNA level. In support of this notion, untemplated 30 uridine is
frequently found in other mature miRNAs originating from the
30 arm of pre-miRNAs (but significantly less frequently in those
from the 50 arm) (Burroughs et al., 2010; Chiang et al., 2010).
Because untemplated uridylation is observed in cells lacking
Lin28, it will be interesting to determine which pre-miRNAs other
than pre-let-7 are controlled by uridylation and to identify addi-
tional factors required for pre-miRNA uridylation.
Although uridylation is generally thought to induce the decay
of small RNAs, adenylation may have the opposite conse-
quence. In cottonwood P. trichoacarpa, many miRNA families
are adenylated at their 30 ends, and adenylation prevents miRNA
degradation in in vitro decay assay (Lu et al., 2009). In the case of
mammalian miR-122, which is adenylated by cytoplasmic poly
(A) polymerase GLD-2 (or TUTase2), 30 end adenylation is also
implicated in its stabilization (Katoh et al., 2009). In the liver of
Gld-2 knockout mice, the steady-state level of mature miR-122
is reduced, and the abundance of target mRNAs of miR-122
increases.
However, a recent study indicates that GLD-2 adenylates
most miRNAs, and the adenylation may affect their activity rather
than stability (Burroughs et al., 2010). Deep sequencing of Ago-
associated small RNAs shows that adenylated miRNAs are
relatively depleted in the Ago2 and Ago3 complexes, suggesting
that adenylation may interfere with Ago loading. Similarly, it
has been reported that uridylation of mature miR-26 by TUT4
results in the reduction of miR-26’s activity without altering the
miRNA levels (Jones et al., 2009). Therefore, it remains an inter-
esting but yet unresolved issue whether or not uridylation/
adenylation affects the stability of miRNAs in animals. One may
speculate that 30 modified miRNAs enter the silencing complex
with altered frequencies, which in turn affects the small RNA’s
sensitivity to nucleases. Further examination is needed to iden-
tify the players involved in these processes, particularly the
nucleases that recognize a U/A tail, and to dissect their action
mechanisms.
miRNA Decay
Several nucleases degrade small RNAs (Figures 1 and 2). An
Arabidopsis enzyme SDN1 (small RNA degrading nuclease,
a 30-to-50 exonuclease) degrades single-stranded miRNAs
in vitro (Ramachandran and Chen, 2008). miRNAs accumulate
in a mutant lacking SDN1 and its related nucleases SDN2 and
SDN3, indicating that the SDN proteins may act redundantly to
degrade plant miRNAs. The 20-O-methyl group at the 30 end of
miRNAs, which is a general feature of plant miRNAs, has
a protective effect against SDN1 in in vitro assays. Of note, uridy-
lation causes a small but detectable protective effect in the same
in vitro assay, indicating that SDN1 is unlikely to be the nuclease
responsible for U-tail-promoted degradation. Given that RRP6
(a 30-to-50 exonuclease) facilitates decay of small RNAs in a
MUT68-dependent manner in Chlamydomonas extracts, multi-
ple enzymes may be involved in small RNA decay in plants,
playing partially overlapping but differential roles (Ibrahim et al.,
2010).
In C. elegans, XRN-2 (a 50-to-30 exonuclease) is involved in the
degradation of mature miRNAs (Chatterjee and Grosshans,
2009). Because miRNAs are tightly bound to and protected by
Ago, it is unclear how XRN-2 accesses the 50 end of an miRNA
for decay. Of interest, larval lysate promotes efficient release of
miRNA in vitro, implicating an as yet unknown factor that assists
the release of miRNA from the otherwise tightly associated Argo-
naute protein (Chatterjee and Grosshans, 2009). In Arabidopsis,
two XRN-2 homologs, XRN2 and XRN3, degrade the loop of
miRNA precursor following processing, but they do not affect
mature miRNA levels (Gy et al., 2007).
In mammals, a general nuclease for miRNAs has yet to be
identified. Knockdown of XRN-1 or an exosome subunit in
human cells results in only partial upregulation of miR-382, and
XRN-2 depletion does not have a significant effect (Bail et al.,
2010). Thus, it awaits further investigation whether or not there
is one major conserved pathway for miRNA decay in mammals.
There have been intriguing reports of regulated decay of
miRNAs. For instance, miR-29b is degraded in dividing cells
more rapidly than in mitotically arrested cells (Hwang et al.,
2007). In the central nervous system of Aplysia, the levels of
miR-124 and miR-184 decrease in 1 hr after treatment with
the neurotransmitter serotonin (Rajasethupathy et al., 2009).
Figure 2. RNA Modifications in the Plant miRNA PathwayIn plants, both pri-miRNA and pre-miRNA are cleaved by DCL1/HYL1complex. After cleavage, 30 ends of miRNA duplex are 20-O-methylated bya methyl transferase HEN1. The methylation protects miRNAs from uridylationand exonucleolytic degradation. In the green algae Chlamydomonas, the nu-cleotidyl transferase MUT68 attaches uridine residues at the 30 end of maturemiRNA lacking a methyl group. Then, the RRP6 exosome subunit, a 30-to-50
exonuclease, degrades the uridylated miRNAs. In Arabidopsis, a 30/50
exonuclease SDN1 is reported to degrade mature miRNAs.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 705
Because U0126, an inhibitor of mitogen-activated protein kinase
(MAPK), blocks the reduction of miR-124, the decay process
may be dependent on the MAPK pathway. Of interest, a study
on mammalian neuronal cells shows that most miRNAs turn
over more rapidly in neurons than in other cell types (Krol et al.,
2010). Neuronal activation accelerates decay of the miRNAs,
whereas blocking neuronal activity stabilizes the miRNAs. It
will be exciting to discover the nuclease(s) and the upstream
signals for miRNA degradation in these systems.
Recently it has been shown that a polynucleotide phosphory-
lase (PNPase, a type I interferon-inducible 30-to-50 exonuclease)
binds specifically to several miRNAs (miR-221, miR-222, and
miR-106b) and induces rapid turnover in a human melanoma
cell line (Das et al., 2010). Because there is no apparent
commonality in terms of the sequences, it is unclear how
PNPase recognizes the miRNAs specifically.
As mentioned above, there is substantial evidence linking uri-
dylation/adenylation and exonucleolytic attack on small RNAs.
A recent study provides evidence that extensive complemen-
tarity between a small RNA and its target RNA triggers uridyl/
adenyl tailing as well as 30/50 trimming in flies and humans
(Figure 1) (Ameres et al., 2010). Animal small RNAs with high
complementarity to the targets, such as piRNAs and fly endo-
siRNAs, appear to be generally protected by 20-O-methylation
at the 30 end like plant small RNAs. It has been postulated that
animal miRNAs, which do not carry methylation, maintain only
partial complementarity with their targets so as to avoid tailing
and trimming of miRNAs. Of note, viruses seem to exploit a
related miRNA decay pathway to invade host cells more effec-
tively. Herpesvirus saimiri, a family of primate-infecting herpesvi-
ruses, expresses viral noncoding RNAs called HSURs (H. saimiri
U-rich RNAs). A recent report reveals that HSURs rapidly down-
regulate host miR-27 and that base-pairing between HSUR and
miR-27 is required for the degradation (Cazalla et al., 2010).
These discoveries imply an additional layer of stability control
of small RNAs, which is influenced by the interaction with the
target RNA.
miRNA Editing
Adenosine deaminases acting on RNAs (ADARs) convert
adenosine to inosine on the dsRNA region of small RNA precur-
sors (Figure 1 and Figure 3A). Because inosine (I) pairs with
cytosine instead of uridine, such edits could alter the structure
of small RNA precursor, thereby interfering with processing.
For instance, editing of pri-miR-142 by ADAR1 and ADAR2
suppresses Drosha processing (Yang et al., 2006), whereas
that of pre-miR-151 by ADAR1 interferes with Dicer processing
(Kawahara et al., 2007a). Because hyperedited dsRNAs can be
targeted by the nuclease Tudor-SN, RNA editing may also desta-
bilize small RNA precursors (Scadden, 2005). In rare cases, RNA
editing occurs in the seed sequence of miRNA, changing the
targeting specificity. In the brain, where ADAR is abundant,
miR-376 cluster miRNAs are frequently edited in the seed
region and are redirected to repress a different set of mRNAs
(Kawahara et al., 2007b). High-throughput sequencing of the
fly endo-siRNA pool also reveals evidence for RNA editing
(Kawamura et al., 2008). The precursors of endo-siRNAs (long
hairpins and sense-antisense pairs) may be targeted by ADARs,
although the functional significance of this siRNA modification is
unknown.
Posttranslational Protein ModificationsPhosphorylation of RNase III Enzymes
Human Dicer interacts with two related dsRNA-binding proteins,
TRBP and PACT. Although they do not influence Dicer process-
ing itself, TRBP and PACT stabilize Dicer and may also function
in RISC assembly (Chendrimada et al., 2005; Haase et al., 2005;
Lee et al., 2006). A recent study indicates that four serine
residues of human TRBP (S142, S152, S283, and S286) are
phosphorylated by the MAP kinase Erk, which controls cell
proliferation, survival, and differentiation (Figure 1) (Paroo et al.,
Figure 3. Modifications in the Endo-siRNA
and piRNA Pathways(A) Endogenous small interfering RNAs (endo-siRNAs) are processed from long dsRNAs ina Dicer-dependent manner and are loaded ontoAgo proteins. High-throughput sequencing datashow that the adenosine-to-inosine (I) editingoccurs in fly endo-siRNAs, likely by ADAR,although the role of RNA editing is unknown. Flyendo-siRNAs bound to dAgo2 are 20-O-methyl-ated by HEN1 homolog, which protects RNAsfrom uridyl/adenyl tailing and degradation. Inworms, a subset of endo-siRNAs, which are asso-ciated with an Ago homolog CSR-1, is uridylatedat the 30 end by the nucleotidyl transferase CDE-1.(B) piRNAs are generated from single-strandedRNA precursors that are processed by primaryprocessing and/or secondary processing (ping-pong amplification cycle). piRNAs are associatedwith Piwi subfamily proteins (PIWI). Animal piRNAsare 20-O-methylated by HEN1 orthologs. In zebra-fish, depletion of hen1 induces uridylation ofpiRNAs and facilitates decay, suggesting thatmethylation stabilizes piRNAs. However, the phys-iological significance of piRNA methylation in flies
and mammals remains unclear. PIWI proteins are methylated at arginine residues (sDMA, symmetrical dimethyl arginine) at their N termini by orthologs of themethyl transferase PRMT5. In flies and mice, TDRD proteins interact with PIWI proteins through sDMA and may play important roles in piRNA metabolism.
706 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
2009). Phosphorylation enhances protein stability of TRBP,
consequently elevating Dicer protein levels. Intriguingly, TRBP
phosphorylation preferentially increases growth-promoting
miRNAs such as miR-17, whereas tumor-suppressive let-7 is
reduced. The mechanism of selective downregulation of let-7
is unclear, but it may be an indirect effect. An interesting implica-
tion of these findings is that the MAPK/Erk pathway exerts its
effects, in part, by regulating miRNA biogenesis.
Drosha, a nuclear enzyme for pri-miRNA processing (Lee
et al., 2003), has recently been shown to be a direct target of
posttranslational modification (Tang et al., 2010). Mass spec-
trometry and mutagenesis studies reveal that human Drosha is
phosphorylated at serine 300 (S300) and serine 302 (S302)
(Figure 1). Phosphorylation of these residues is essential for
the nuclear localization of Drosha and is required for pri-miRNA
processing. Because both endogenous and overexpressed
Drosha localize to the nucleus constitutively, it is unclear whether
or not the phosphorylation at S300/S302 is a regulated process.
Understanding the physiological significance of this regulation
will require the identification of the kinase that phosphorylates
Drosha.
Argonaute2 Is a Target of Multiple Modifications
Ago2 is subject to multiple posttranslational modifications
(Figure 1). Human Ago2 binds to the type I collagen prolyl-4-
hydroxylase (C-P4H(I)) that hydroxylates Ago2 at proline 700
(Qi et al., 2008). Depletion of C-P4H(I) reduces the stability of
the Ago2 protein and, accordingly, downregulates siRNA-medi-
ated silencing. Furthermore, hydroxylation is required for Ago2
localization to the processing body (P body), a cytoplasmic
granule that is thought to be a site for RNA storage and degrada-
tion. P body localization of Ago2 is also enhanced by phosphor-
ylation at serine 387, which is mediated by the p38 MAPK
pathway (Zeng et al., 2008). However, given the controversy
over the direct role of P body in small RNA-mediated silencing,
the biological significance of P body localization of Ago2 remains
unclear.
Ubiquitination also plays a part in the control of Ago2. Mouse
Lin41 (mLin41 or Trim71), a stem cell-specific Trim-NHL protein,
inhibits the miRNA pathway (Rybak et al., 2009). As an E3 ubiq-
uitin ligase, mLin41 ubiquitinates Ago2 and targets it for protea-
some-dependent degradation. Of interest, mLin41 is a target of
let-7 miRNA, suggesting that mLin41 and let-7 may be engaged
in a reciprocal negative feedback loop. Recently, other Trim-NHL
proteins have been reported to associate with the Argonaute
proteins and affect miRNA pathway. Mei-P26 (fly) inhibits miRNA
biogenesis, whereas TRIM32 (mouse) and NHL-2 (worm) acti-
vate the miRNA pathway (Hammell et al., 2009; Neumuller
et al., 2008; Schwamborn et al., 2009). Their mechanism of
action appears to be different than that of mLin41 because the
E3 ligase activity of Mei-P26 and TRIM32 is dispensable for their
effects and because NHL-2 enhances miRNA activity without
a change in miRNA levels.
Tudor Regulates PIWI Proteins
The PIWI (P element-induced wimpy testis) clade proteins bind
to Piwi-interacting RNAs (piRNAs) and silence transposable
elements in gonads. Mouse has three PIWI homologs (MILI,
MIWI, and MIWI2), and there are three PIWI proteins in flies
(Aubergine [Aub], AGO3, and Piwi) (Kim et al., 2009). Recent
studies have revealed that PIWI proteins carry symmetrical
dimethyl arginine (sDMA) at their N termini. Arginine methylation
of PIWI is mediated by a methyl transferase PRMT5 (dPRMT5/
capsuleen [csul]/dart5 in Drosophila) (Figure 3B) (Heo and Kim,
2009; Siomi et al., 2010). sDMA is recognized by Tudor
domain-containing proteins (TDRDs), which are critical for germ-
line development. In both flies and mice, deletion of TDRDs alters
piRNA abundance and/or composition, indicating that TDRDs
play important roles in the piRNA metabolism through specific
binding to the sDMAs of PIWI proteins. How TDRDs act in the
piRNA pathway at a molecular level awaits further investigation.
PerspectivesAs we delve deeper and wider into the small RNA world, the
emerging landscape becomes ever more complex on both the
RNA and protein sides. High-throughput analyses have uncov-
ered a considerable heterogeneity in small RNA populations.
Some isomiRs are expressed differentially in certain tissues,
suggesting that these variations may be associated with specific
regulatory functions (Chiang et al., 2010). Biochemical and
genetic studies also provide substantial evidence for the regula-
tory roles of the modifications discussed in this Review. Thus, it
is likely that at least some of the observed heterogeneity reflects
multiple layers of regulation. We should be cautious, however, in
extrapolating the current evidence because it is unclear how
much fraction of the small RNA and protein modifications trans-
late into functional consequences and whether certain modifica-
tions simply reflect the noise of RNA metabolism.
In addition to the functionality issue, a number of key questions
remain to be answered. Are there conserved pathways and
enzymes for RNA and protein modifications? If so, what are
the similarities and differences? 20-O-methylation is applied to
many small RNA pathways, but the details differ significantly in
different systems. For instance, plant HEN1 acts on dsRNA
duplexes, whereas animal HEN1 homologs methylate ssRNA
loaded on Argonaute proteins. Uridylation/adenylation is carried
out by a family of ribonucleotidyl transferases. How each
member selectively recognizes its substrates is largely unknown.
RNA stability is likely to play important roles in RNA silencing
pathways. Decay pathways of small RNA are beginning to be
unraveled, but there is no consensus between different species
as yet. One possibility is that multiple enzymes act in parallel as
in the mRNA decay pathway, which involves several 30 exonucle-
ases, 50 exonucleases, and endonucleases. Some of the decay
enzymes may function redundantly, and it remains one of the
major challenges in the field to identify them. Protein modifica-
tion is also emerging as one of the key regulatory layers.
Outstanding questions include which enzymes are involved,
what the in vivo significance of such modifications is, and
whether the protein modifications are developmentally regu-
lated. Future studies will reveal new types of modifications, addi-
tional regulatory factors, and their biological relevance.
The RNA silencing machinery should respond accurately to
developmental and environmental cues. Most signaling path-
ways are thought to be connected to RNA silencing, but we
are just beginning to understand the molecular links between
RNA silencing and cell signaling. What the upstream signals
are, how certain RNAs and proteins get specifically recognized,
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 707
and what the downstream effects of the modifications are await
elucidation. We also need to understand the interplay between
different modifications. There appears to be a crosstalk between
certain modifications of RNA (such as methylation, uridylation,
and decay), which may influence their fate and function. It is likely
that there is a crosstalk between the different posttranslational
modifications in the proteins involved in the biogenesis and
effector functions of small RNA silencing pathways. Under-
standing these networks will undoubtedly provide ample oppor-
tunities to manipulate RNA silencing and will reveal new lessons
about gene regulation.
ACKNOWLEDGMENTS
We thank members of V.N.K.’s laboratory for helpful discussions and
comments. This work was supported by the Creative Research Initiatives
Program (20100000021) and the National Honor Scientist Program
(20100020415) through the National Research Foundation of Korea (NRF)
and the BK21 Research Fellowships (I.H.) from the Ministry of Education,
Science and Technology of Korea. We apologize to authors whose work has
not been covered because of space limitations.
REFERENCES
Ameres, S.L., Horwich, M.D., Hung, J.H., Xu, J., Ghildiyal, M., Weng, Z., and
Zamore, P.D. (2010). Target RNA-directed trimming and tailing of small
silencing RNAs. Science 328, 1534–1539.
Bail, S., Swerdel, M., Liu, H., Jiao, X., Goff, L.A., Hart, R.P., and Kiledjian, M.
(2010). Differential regulation of microRNA stability. RNA 16, 1032–1039.
Bartel, D.P. (2009). MicroRNAs: target recognition and regulatory functions.
Cell 136, 215–233.
Burroughs, A.M., Ando, Y., de Hoon, M.J., Tomaru, Y., Nishibu, T., Ukekawa,
R., Funakoshi, T., Kurokawa, T., Suzuki, H., Hayashizaki, Y., and Daub, C.O.
(2010). A comprehensive survey of 30 animal miRNA modification events and
a possible role for 30 adenylation in modulating miRNA targeting effectiveness.
Genome Res. 20, 1398–1410.
Cazalla, D., Yario, T., Steitz, J.A., and Steitz, J. (2010). Down-regulation of
a host microRNA by a Herpesvirus saimiri noncoding RNA. Science 328,
1563–1566.
Chatterjee, S., and Grosshans, H. (2009). Active turnover modulates mature
microRNA activity in Caenorhabditis elegans. Nature 461, 546–549.
Chendrimada, T.P., Gregory, R.I., Kumaraswamy, E., Norman, J., Cooch, N.,
Nishikura, K., and Shiekhattar, R. (2005). TRBP recruits the Dicer complex to
Ago2 for microRNA processing and gene silencing. Nature 436, 740–744.
Chiang, H.R., Schoenfeld, L.W., Ruby, J.G., Auyeung, V.C., Spies, N., Baek,
D., Johnston, W.K., Russ, C., Luo, S., Babiarz, J.E., et al. (2010). Mammalian
microRNAs: experimental evaluation of novel and previously annotated genes.
Genes Dev. 24, 992–1009.
Das, S.K., Sokhi, U.K., Bhutia, S.K., Azab, B., Su, Z.Z., Sarkar, D., and Fisher,
P.B. (2010). Human polynucleotide phosphorylase selectively and preferen-
tially degrades microRNA-221 in human melanoma cells. Proc. Natl. Acad.
Sci. USA 107, 11948–11953.
Gy, I., Gasciolli, V., Lauressergues, D., Morel, J.B., Gombert, J., Proux, F.,
Proux, C., Vaucheret, H., and Mallory, A.C. (2007). Arabidopsis FIERY1,
XRN2, and XRN3 are endogenous RNA silencing suppressors. Plant Cell 19,
3451–3461.
Haase, A.D., Jaskiewicz, L., Zhang, H., Laine, S., Sack, R., Gatignol, A., and
Filipowicz, W. (2005). TRBP, a regulator of cellular PKR and HIV-1 virus
expression, interacts with Dicer and functions in RNA silencing. EMBO Rep.
6, 961–967.
Hagan, J.P., Piskounova, E., and Gregory, R.I. (2009). Lin28 recruits the
TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells.
Nat. Struct. Mol. Biol. 16, 1021–1025.
Hammell, C.M., Lubin, I., Boag, P.R., Blackwell, T.K., and Ambros, V. (2009).
nhl-2 Modulates microRNA activity in Caenorhabditis elegans. Cell 136,
926–938.
Heo, I., and Kim, V.N. (2009). Regulating the regulators: posttranslational
modifications of RNA silencing factors. Cell 139, 28–31.
Heo, I., Joo, C., Cho, J., Ha, M., Han, J., and Kim, V.N. (2008). Lin28 mediates
the terminal uridylation of let-7 precursor MicroRNA. Mol. Cell 32, 276–284.
Heo, I., Joo, C., Kim, Y.K., Ha, M., Yoon, M.J., Cho, J., Yeom, K.H., Han, J.,
and Kim, V.N. (2009). TUT4 in concert with Lin28 suppresses microRNA
biogenesis through pre-microRNA uridylation. Cell 138, 696–708.
Horwich, M.D., Li, C., Matranga, C., Vagin, V., Farley, G., Wang, P., and
Zamore, P.D. (2007). The Drosophila RNA methyltransferase, DmHen1,
modifies germline piRNAs and single-stranded siRNAs in RISC. Curr. Biol.
17, 1265–1272.
Hwang, H.W., Wentzel, E.A., and Mendell, J.T. (2007). A hexanucleotide
element directs microRNA nuclear import. Science 315, 97–100.
Ibrahim, F., Rymarquis, L.A., Kim, E.J., Becker, J., Balassa, E., Green, P.J.,
and Cerutti, H. (2010). Uridylation of mature miRNAs and siRNAs by the
MUT68 nucleotidyltransferase promotes their degradation in Chlamydomo-
nas. Proc. Natl. Acad. Sci. USA 107, 3906–3911.
Jones, M.R., Quinton, L.J., Blahna, M.T., Neilson, J.R., Fu, S., Ivanov, A.R.,
Wolf, D.A., and Mizgerd, J.P. (2009). Zcchc11-dependent uridylation of micro-
RNA directs cytokine expression. Nat. Cell Biol. 11, 1157–1163.
Kamminga, L.M., Luteijn, M.J., den Broeder, M.J., Redl, S., Kaaij, L.J.,
Roovers, E.F., Ladurner, P., Berezikov, E., and Ketting, R.F. (2010). Hen1 is
required for oocyte development and piRNA stability in zebrafish. EMBO J.
29, 3688–3700.
Katoh, T., Sakaguchi, Y., Miyauchi, K., Suzuki, T., Kashiwabara, S., Baba, T.,
and Suzuki, T. (2009). Selective stabilization of mammalian microRNAs by 30
adenylation mediated by the cytoplasmic poly(A) polymerase GLD-2. Genes
Dev. 23, 433–438.
Kawahara, Y., Zinshteyn, B., Chendrimada, T.P., Shiekhattar, R., and Nishi-
kura, K. (2007a). RNA editing of the microRNA-151 precursor blocks cleavage
by the Dicer-TRBP complex. EMBO Rep. 8, 763–769.
Kawahara, Y., Zinshteyn, B., Sethupathy, P., Iizasa, H., Hatzigeorgiou, A.G.,
and Nishikura, K. (2007b). Redirection of silencing targets by adenosine-to-
inosine editing of miRNAs. Science 315, 1137–1140.
Kawamura, Y., Saito, K., Kin, T., Ono, Y., Asai, K., Sunohara, T., Okada, T.N.,
Siomi, M.C., and Siomi, H. (2008). Drosophila endogenous small RNAs bind to
Argonaute 2 in somatic cells. Nature 453, 793–797.
Kim, V.N., Han, J., and Siomi, M.C. (2009). Biogenesis of small RNAs in
animals. Nat. Rev. Mol. Cell Biol. 10, 126–139.
Kirino, Y., and Mourelatos, Z. (2007). The mouse homolog of HEN1 is a poten-
tial methylase for Piwi-interacting RNAs. RNA 13, 1397–1401.
Krol, J., Busskamp, V., Markiewicz, I., Stadler, M.B., Ribi, S., Richter, J.,
Duebel, J., Bicker, S., Fehling, H.J., Schubeler, D., et al. (2010). Characterizing
light-regulated retinal microRNAs reveals rapid turnover as a common
property of neuronal microRNAs. Cell 141, 618–631.
Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P.,
Radmark, O., Kim, S., and Kim, V.N. (2003). The nuclear RNase III Drosha initi-
ates microRNA processing. Nature 425, 415–419.
Lee, Y., Hur, I., Park, S.Y., Kim, Y.K., Suh, M.R., and Kim, V.N. (2006). The role
of PACT in the RNA silencing pathway. EMBO J. 25, 522–532.
Lehrbach, N.J., Armisen, J., Lightfoot, H.L., Murfitt, K.J., Bugaut, A., Balasu-
bramanian, S., and Miska, E.A. (2009). LIN-28 and the poly(U) polymerase
PUP-2 regulate let-7 microRNA processing in Caenorhabditis elegans. Nat.
Struct. Mol. Biol. 16, 1016–1020.
708 Cell 143, November 24, 2010 ª2010 Elsevier Inc.
Li, J., Yang, Z., Yu, B., Liu, J., and Chen, X. (2005). Methylation protects miR-
NAs and siRNAs from a 30-end uridylation activity in Arabidopsis. Curr. Biol. 15,
1501–1507.
Lu, S., Sun, Y.H., and Chiang, V.L. (2009). Adenylation of plant miRNAs.
Nucleic Acids Res. 37, 1878–1885.
Morin, R.D., O’Connor, M.D., Griffith, M., Kuchenbauer, F., Delaney, A.,
Prabhu, A.L., Zhao, Y., McDonald, H., Zeng, T., Hirst, M., et al. (2008). Appli-
cation of massively parallel sequencing to microRNA profiling and discovery
in human embryonic stem cells. Genome Res. 18, 610–621.
Neumuller, R.A., Betschinger, J., Fischer, A., Bushati, N., Poernbacher, I.,
Mechtler, K., Cohen, S.M., and Knoblich, J.A. (2008). Mei-P26 regulates micro-
RNAs and cell growth in the Drosophila ovarian stem cell lineage. Nature 454,
241–245.
Newman, M.A., Thomson, J.M., and Hammond, S.M. (2008). Lin-28 interaction
with the Let-7 precursor loop mediates regulated microRNA processing. RNA
14, 1539–1549.
Ohara, T., Sakaguchi, Y., Suzuki, T., Ueda, H., Miyauchi, K., and Suzuki, T.
(2007). The 30 termini of mouse Piwi-interacting RNAs are 20-O-methylated.
Nat. Struct. Mol. Biol. 14, 349–350.
Paroo, Z., Ye, X., Chen, S., and Liu, Q. (2009). Phosphorylation of the human
microRNA-generating complex mediates MAPK/Erk signaling. Cell 139,
112–122.
Qi, H.H., Ongusaha, P.P., Myllyharju, J., Cheng, D., Pakkanen, O., Shi, Y., Lee,
S.W., Peng, J., and Shi, Y. (2008). Prolyl 4-hydroxylation regulates Argonaute 2
stability. Nature 455, 421–424.
Rajasethupathy, P., Fiumara, F., Sheridan, R., Betel, D., Puthanveettil, S.V.,
Russo, J.J., Sander, C., Tuschl, T., and Kandel, E. (2009). Characterization
of small RNAs in Aplysia reveals a role for miR-124 in constraining synaptic
plasticity through CREB. Neuron 63, 803–817.
Ramachandran, V., and Chen, X. (2008). Degradation of microRNAs by a family
of exoribonucleases in Arabidopsis. Science 321, 1490–1492.
Rybak, A., Fuchs, H., Smirnova, L., Brandt, C., Pohl, E.E., Nitsch, R., and
Wulczyn, F.G. (2008). A feedback loop comprising lin-28 and let-7 controls
pre-let-7 maturation during neural stem-cell commitment. Nat. Cell Biol. 10,
987–993.
Rybak, A., Fuchs, H., Hadian, K., Smirnova, L., Wulczyn, E.A., Michel, G.,
Nitsch, R., Krappmann, D., and Wulczyn, F.G. (2009). The let-7 target gene
mouse lin-41 is a stem cell specific E3 ubiquitin ligase for the miRNA pathway
protein Ago2. Nat. Cell Biol. 11, 1411–1420.
Saito, K., Sakaguchi, Y., Suzuki, T., Suzuki, T., Siomi, H., and Siomi, M.C.
(2007). Pimet, the Drosophila homolog of HEN1, mediates 20-O-methylation
of Piwi- interacting RNAs at their 30 ends. Genes Dev. 21, 1603–1608.
Scadden, A.D. (2005). The RISC subunit Tudor-SN binds to hyper-edited
double-stranded RNA and promotes its cleavage. Nat. Struct. Mol. Biol. 12,
489–496.
Schwamborn, J.C., Berezikov, E., and Knoblich, J.A. (2009). The TRIM-NHL
protein TRIM32 activates microRNAs and prevents self-renewal in mouse
neural progenitors. Cell 136, 913–925.
Shen, B., and Goodman, H.M. (2004). Uridine addition after microRNA-
directed cleavage. Science 306, 997.
Siomi, M.C., Mannen, T., and Siomi, H. (2010). How does the royal family of
Tudor rule the PIWI-interacting RNA pathway? Genes Dev. 24, 636–646.
Tang, X., Zhang, Y., Tucker, L., and Ramratnam, B. (2010). Phosphorylation of
the RNase III enzyme Drosha at Serine300 or Serine302 is required for its
nuclear localization. Nucleic Acids Res. 38, 6610–6619.
van Wolfswinkel, J.C., Claycomb, J.M., Batista, P.J., Mello, C.C., Berezikov,
E., and Ketting, R.F. (2009). CDE-1 affects chromosome segregation through
uridylation of CSR-1-bound siRNAs. Cell 139, 135–148.
Viswanathan, S.R., Daley, G.Q., and Gregory, R.I. (2008). Selective blockade
of microRNA processing by Lin28. Science 320, 97–100.
Yang, W., Chendrimada, T.P., Wang, Q., Higuchi, M., Seeburg, P.H., Shiekhat-
tar, R., and Nishikura, K. (2006). Modulation of microRNA processing and
expression through RNA editing by ADAR deaminases. Nat. Struct. Mol.
Biol. 13, 13–21.
Yu, B., Yang, Z., Li, J., Minakhina, S., Yang, M., Padgett, R.W., Steward, R.,
and Chen, X. (2005). Methylation as a crucial step in plant microRNA biogen-
esis. Science 307, 932–935.
Zeng, Y., Sankala, H., Zhang, X., and Graves, P.R. (2008). Phosphorylation of
Argonaute 2 at serine-387 facilitates its localization to processing bodies.
Biochem. J. 413, 429–436.
Cell 143, November 24, 2010 ª2010 Elsevier Inc. 709
The ER UDPase ENTPD5 Promotes ProteinN-Glycosylation, the Warburg Effect,and Proliferation in the PTEN PathwayMin Fang,1 Zhirong Shen,1 Song Huang,1 Liping Zhao,1 She Chen,2 Tak W. Mak,3 and Xiaodong Wang1,2,*1Howard Hughes Medical Institute and Department of Biochemistry, University of Texas Southwestern Medical Center at Dallas,
5323 Harry Hines Boulevard, Dallas, TX 75390, USA2National Institute of Biological Sciences, Zhongguancun Life Science Park, Beijing 102206, China3The Campbell Family Institute for Breast Cancer Research, Princess Margaret Hospital, Toronto, ON M5G 2M9, Canada*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.10.010
SUMMARY
PI3K and PTEN lipid phosphatase control the level ofcellular phosphatidylinositol (3,4,5)-trisphosphate,an activator of AKT kinases that promotes cellgrowth and survival. Mutations activating AKT arecommonly observed in human cancers. We reporthere that ENTPD5, an endoplasmic reticulum (ER)enzyme, is upregulated in cell lines and primaryhuman tumor samples with active AKT. ENTPD5hydrolyzes UDP to UMP to promote protein N-glyco-sylation and folding in ER. Knockdown of ENTPD5 inPTEN null cells causes ER stress and loss of growthfactor receptors. ENTPD5, together with cytidinemonophosphate kinase-1 and adenylate kinase-1,constitute an ATP hydrolysis cycle that convertsATP to AMP, resulting in a compensatory increasein aerobic glycolysis known as the Warburg effect.The growth of PTEN null cells is inhibited bothin vitro and in mouse xenograft tumor models.ENTPD5 is therefore an integral part of the PI3K/PTEN regulatory loop and a potential target for anti-cancer therapy.
INTRODUCTION
Class I phosphatidylinositol 3-kinases (PI3Ks) and lipid phospha-
tase PTEN balance cellular response to growth and survival
signals (reviewed by Engelman et al., 2006). In response to acti-
vation of receptor tyrosine kinases, PI3K phosphorylates phos-
phatidylinositol 4,5-bisphosphate (PIP2) at the 3-OH position of
the inositol ring to generate phosphatidylinositol 3,4,5-trisphos-
phate (PIP3) that recruits and activates serine/threonine kinase
AKT (Whitman et al., 1988; Franke et al., 1997; Stephens et al.,
1998). AKT subsequently activates many downstream targets
for cell growth and survival, including the rapamycin-sensitive
mTOR complex 1 (mTORC1), which then phosphorylates
p70S6K and translation initiation factor 4E-BP1 to accelerate
the translational rate, thus accommodating rapid growth (Fingar
et al., 2002). PTEN, by dephosphorylating PIP3 back to PIP2,
antagonizes the signal generated by PI3K (Maehama and Dixon,
1998). The importance of the PI3K/PTEN pathway has been
manifested by frequent PI3K gain of function, or PTEN loss of
function, in a variety of human cancers (reviewed by Yuan and
Cantley, 2008; Keniry and Parsons, 2008).
AKT activation also contributes to the elevation of aerobic
glycolysis seen in tumor cells, known as the Warburg effect
(Elstrom et al., 2004; Warburg, 1925). AKT promotes cell-surface
expression of glucose transporters while sustaining activation of
hexokinase and phosphofructose kinase-1 (PFK1), thus acceler-
ating influx and capture of glucose for glycolysis (reviewed by
Vander Heiden et al., 2009). Of interest, in cancer cells, there is
invariant expression of the embryonic M2 splice version of pyru-
vate kinase, an enzyme working in the last step of glycolysis,
instead of a more active M1 splicing isoform expressed in
most of the adult tissues (Christofk et al., 2008). The combined
effects of more glucose entering into the glycolysis pathway
and slowing down pyruvate kinase activity build up intermediate
metabolites for synthesis of growth-enabling macromolecules.
One noticeable example is the entry of glucose-6-phosphate
to the pentose shunt pathway to generate ribose for nucleotide
synthesis (reviewed by Vander Heiden et al., 2009).
Another outlet of glucose-6-phosphate is to form UDP-
glucose, a substrate for protein glycosylation. In mammalian
cells, most secreted proteins and membrane proteins are glyco-
sylated at the asparagine (Asn) sites, i.e., N-glycosylated. Of
interest, receptor tyrosine kinases that promote cell growth
and proliferation, such as the epidermal growth factor receptor,
EGFR, are much more highly N-glycosylated than receptors
whose functions do not (Lau et al., 2007). Most of the glycosyla-
tion reactions happen in the Golgi apparatus, with two known
exceptions. One is the dolichol-linked 14 sugar core glycan
(Glc3Man9GlcNAc2) that is synthesized in cytoplasm and ER
membrane before being flipped into the lumen of ER, where it
is transferred to the Asn of the nascent polypeptide chain (re-
viewed by Helenius and Aebi, 2004). Another is reglucosylation
in ER after the third and second glucose (Glc) on the core glycan
are trimmed by glycosidase I and II. Trimming and reglucosyla-
tion by UDP-glucose:glycoprotein glucosyltransferase (UGGT)
generate monoglucosylated structures that are recognized by
Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc. 711
calnexin/calreticulin, an ER molecular chaperone system for
N-glycosylated proteins (reviewed by Ellgaard et al., 1999).
The removal and addition of glucose allow the binding and
release of calnexin/calreticulin to and from nascent polypeptide
chains until the proteins are correctly folded and transferred to
Golgi for further glycosylation. If proteins are misfolded beyond
repair, they are subjected to degradation by the ER-associated
protein degradation system (ERAD) (reviewed by Fewell et al.,
2001).
During a study using the embryonic fibroblasts (MEFs) from
the PTEN null mice and PTEN heterozygous littermates (Stam-
bolic et al., 1998), we made a surprising finding that an ER
UDP hydrolysis enzyme is upregulated by AKT activation. This
enzyme, ENTPD5, seems to mediate many of the observed
cancer-related phenotypes associated with AKT activation.
RESULTS
PTEN Knockout MEFs Have an Elevated Activity thatHydrolyzes ATP to AMPAs reported previously, the PTEN null MEFs showed elevated
levels of phosphorylated AKT and p70S6 kinase, whereas the
total protein level of these two kinases remained the same as
in PTEN heterozygous MEFs (Stambolic et al., 1998) (Figure 1A).
We noticed that S-100 cell extracts (prepared after collecting the
supernatants of 100,000 3 g spin of broken cells) from PTEN null
MEFs had a lower ATP level compared to that from the heterozy-
gous MEFs (Figure 1B, columns 7 and 8). Given that cellular ATP
levels are relatively stable, we reasoned that the difference in
their ATP contents occurred during S-100 preparation, which
took about 1 hr. Indeed, as shown in Figure 1B, the ATP levels
in PTEN null MEFs were only slightly lower than those in the
heterozygous MEFs if the measurement was carried out immedi-
ately after cells were harvested (Figure 1B, columns 1 and 2).
When the broken cell suspension, or supernatants after
10,000 3 g spin (S-10), or S-100 were incubated on ice for 1 hr
before the ATP levels were measured, ATP concentrations in
the extracts from PTEN knockout MEFs were much lower than
those from heterozygous MEFs (Figure 1B, columns 3–8). Such
an observation indicated that there was higher ATP hydrolysis
activity in the PTEN knockout cell extracts. To measure this
activity directly, we incubated a-P32-ATP with the S-100 extracts
and analyzed the radioactivity using thin layer chromatography.
As shown in Figure 1C, more radiolabeled ATP was hydrolyzed
when incubated with the S-100 from PTEN null MEFs, and the
nucleotide was hydrolyzed all the way to AMP.
To sort out whether the accelerated ATP hydrolysis was due to
a specific activity or a combination of nonspecific ATPases, we
fractioned the same amount of S-100 extracts from PTEN null
and PTEN heterozygous MEFs side by side on a Q Sepharose
ion-exchange column. The fractions from each column run
were dialyzed, and ATPase activity was measured by adding
each column fraction to the S-100 from PTEN heterozygous
MEF, which served as the baseline activity. A single peak of
elevated ATP-to-AMP activity centered at fractions 11–13 was
observed in fractionated S-100 from PTEN null MEFs, whereas
much less activity was seen in the corresponding fractions
from PTEN heterozygous MEFs (Figure 1D).
ENTPD5 Is Responsible for the Elevated ATPase Activityin PTEN Knockout CellsWe decided to purify the ATPase from large-scale cultured PTEN
knockout MEFs. We took 800 mg of S-100 from PTEN null MEFs
and put it through five chromatographic steps (Figure 2A). The
ATP hydrolysis activity was measured as in Figure 1D, and the
active fractions from each column step were pooled, dialyzed,
and loaded onto the next column. Finally, after a Superdex 200
gel-filtration column, the active fractions were loaded onto
a 100 ml Mini Q column and the bound protein was eluted with
a linear salt gradient. Fractions of 100 ml were collected and as-
sayed. Shown in Figure 2B, a single ATP hydrolysis peak
centered at fraction 6 was observed. When these fractions
were analyzed by SDS-PAGE followed by silver staining,
a protein band just below the 50 kDa molecular weight marker
correlated perfectly with the activity.
This protein was excised from the gel and subjected to mass
spectrometry analysis. The enzyme was identified as ectonu-
cleoside triphosphate diphosphohydrolase 5, ENTPD5, a mem-
ber of the ENTPD enzyme family known to hydrolyze tri- and/or
diphospshonucleotide to monophosphonucleotide (reviewed
by Robson et al., 2006).
To verify that ENTPD5 is indeed the enzyme that caused the
higher rate of ATP-to-AMP conversion in PTEN null MEFs, we
first did a western blotting analysis of ENTPD5 in these MEFs.
As shown in Figure 2C (bottom), ENTPD5 was only prominently
detected in PTEN null extracts, but not in PTEN heterozygous
extracts (Figure 2C, lanes 1 and 2). When mouse ENTPD5 was
exogenously expressed in the PTEN heterozygous MEFs, the
extracts from these cells showed the ability to hydrolyze ATP
to AMP just like that from PTEN null cells (Figure 2C, lanes
3–5). Moreover, when ENTPD5 was knocked down in PTEN
null MEFs with two different siRNA oligos, the ATP-to-AMP
conversion was diminished in each case, and a control siRNA
oligo had no effect (Figure 2C, lanes 6–10).
To confirmthat the elevated level ofENTPD5 isdue todeletion of
PTEN, we transfected a wild-type PTEN cDNA, or the phospha-
tase active site mutant (PTEN C124S), into PTEN null MEFs.
Indeed, restoring PTEN expression in these cells lowered phos-
phoAKT and diminishedENTPD5expression, whereas the catalyt-
ically dead mutant PTEN had no effect (Figure 2D, lanes 2 and 3).
Consistently, treatment of PTEN null MEFs with a PI3 kinase inhib-
itor also lowered the level of ENTPD5 (Figure 2E, lanes 2 and 3).
The upregulation of ENTPD5 in PTEN null cells is at transcrip-
tional level. Its mRNA is 6-fold higher in PTEN null MEFs
compared to that in PTEN heterozygous MEFs (Figure S1 avail-
able online). The promoter region of ENTPD5 is negatively regu-
lated by the FoxO family of transcription factors (Figure S2),
which upon phosphorylation by AKT, are displaced from the
nucleus into the cytoplasm (Brunet et al., 1999).
To directly demonstrate the nucleotide hydrolysis activity of
ENTPD5, we generated recombinant human ENTPD5 protein
in insect cells using a baculovirus vector and purified the enzyme
to homogeneity (Figure 3A, right). The purified enzyme was then
incubated with ATP, ADP, CTP, CDP, GTP, GDP, UTP, and UDP,
and the released phosphate was measured. Unexpectedly, the
purified recombinant ENTPD5 could only hydrolyze UDP and
GDP (Figure 3A, left).
712 Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc.
UMP or GMP Is a Required Cofactorfor the ATP Hydrolysis ActivityDuring our ENTPD5 purification efforts, we noticed that a small
molecule cofactor was required for the observed ATP-to-AMP
hydrolysis activity. S-100 extracts from PTEN null MEFs lost
ATP-to-AMP converting activity after dialysis (Figure 3B,
lane 4), and the activity was restored with addition of a small
molecule fraction prepared by a 10 kDa cutoff filter (Figure 3B,
lane 6). There was no difference in such a small molecule in
PTEN heterozygous and PTEN null MEFs (Figure 3B, lanes 6
Lu
min
es
ce
nc
e I
nte
ns
ity
0
100000
200000
300000
PT
EN
+/-
PT
EN
-/-
PT
EN
+/-
PT
EN
-/-
PT
EN
+/-
PT
EN
-/-
PT
EN
+/-
PT
EN
-/-
Sta
rt
Bro
ke
n c
ells
S-1
0
S-1
00
B
PT
EN
+/-
PT
EN
-/-
AMP
ADP
ATP
C
800800
10001000
12001200
14001400
16001600
0
250250
500500
750750
10001000
Na
Cl
(mM
)
800800
10001000
12001200
14001400
16001600
0
250250
500500
750750
10001000
UV
Ab
s. (m
AU
)U
V A
bs. (m
AU
)
Na
Cl
(mM
)
+/-
Sta
rt
-/-
Start
+/-
Flo
w
-/-
Flo
w
3 4 5 6 7 8 9 1011121314 1516
17+
18
Fraction №
S-100 (+/-)
+/-
-/-
D
AMP
ADP
ATP
AMP
ADP
ATP
UV
Ab
s. (m
AU
)U
V A
bs. (m
AU
)
PTEN
pAKT
AKT
pP70S6K
PTEN+/-
PTEN-/-
P70S6K
Actin
A
*
Figure 1. Identification of ATP Hydrolysis Activity in PTEN Knockout MEF Cells
(A) Total cell extracts from PTEN+/� and PTEN�/� cells were prepared as described in Experimental Procedures. Aliquots of 10 mg protein were subjected to 10%
SDS-PAGE followed by western analysis of PTEN (asterisk denotes a cross-reactive band), phosphorylated AKT (pAKT), AKT, phosphorylated P70S6 kinase
(pP70S6K), P70S6 kinase, and b-actin.
(B) Cell extracts were prepared from PTEN+/� and PTEN�/� cells, and at indicated steps of preparation, aliquots of 20 ml samples were incubated on ice for 1 hr
followed by immediate measurement of ATP using a Cell Titer-Glo kit. Error bar represents standard deviation of two independent experiments.
(C) Aliquots of 30 mg of S-100 fractions from PTEN+/� or PTEN�/� cells were incubated with a-P32-labeled ATP and analyzed by TLC as described in the
Experimental Procedures. Positions for ATP, ADP, or AMP were indicated.
(D) 6 ml each of S-100 from PTEN+/� or PTEN�/� cells (3.5 mg/ml) was separated by a 1 ml Q Sepharose HP column with a salt gradient elution as indicated.
Fractions of 1 ml were collected and dialyzed overnight at 4�C. 10.5 ml of each fraction was mixed with another 10.5 ml of undialyzed S-100 from PTEN+/� cells
and assayed for ATP hydrolysis activity as in (C). The positions of ATP, ADP, and AMP were indicated. FPLC histograms were presented in top panels.
Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc. 713
and 8), and the molecule was also present in S-100 from HeLa
cells (Figure 3B, lane 10), which have a wild-type PTEN.
Based on its biochemical properties, we deduced that the
cofactor is a nucleotide. Testing a variety of nucleotides revealed
that uracil and guanine, either in tri-, di-, or monophosphate
form, substituted the small molecule fraction from cells
(Figure 3C, lanes 1–15). In contrast, thymidine nucleotides
have no activity, whereas CMP only showed a slight activity.
To see whether the conversion of UTP/UDP to UMP is neces-
sary for the observed activity, we tested various forms of
nonhydrolyzable uracil, including UTPgS, UTPaS, and UMP-
PNP (Figure 3D). All of these nucleotides worked except UTPaS,
Start PTEN-/- S-100
SP HP
Q HP
Phenyl HP
Super-dex 200
Mini Q
A
Ve
c
PT
EN
PT
EN
-C
D
PTEN-/- MEF
Lane 1 2 3
Tranfection
ENTPD5
pAKT
AKT
ß-Actin
PTEN
D
Lane 1 2 3
Cell Line +/- -/-
LYDMSOTreatment
ENTPD5
pAKT
AKT
ß-Actin
E
3 4 5 6 7 8 9 1110
250KD
150KD
100KD
75KD
50KD
37KD
25KD
20KD
15KD
10KD
AMP
ADP
ATP
120mM127.5mM NaCl
B
Fraction №
ENTPD5
+/-
-/-
AMP
ADP
ATP
ENTPD5
+/- V
ecto
r
+/- E
NT
PD
5 1#
+/- E
NT
PD
5 2#
+/-
-/-
-/- s
iR
NA
G
FP
-/- s
iR
NA
E
NT
PD
5 1
#
-/- s
iR
NA
E
NT
PD
5 2
#
C
*
1 2 3 4 5 6 7 8 9 10Lane
Figure 2. Purification and Characterization of ENTPD5
(A) Diagram of the purification scheme for ATP hydrolysis activity from S-100 of PTEN�/� MEF cells.
(B) Final step of purification. (Top) Aliquots of 30 ml of indicated fractions from the Mini Q column were subjected to 4%–10% gradient SDS-PAGE gels followed by
staining using a silver staining kit from Invitrogen. (Bottom) Aliquots of 3 ml of indicated fractions were incubated with 10.5 ml of undialyzed S-100 from PTEN+/�
MEF cells and assayed for ATP hydrolysis activity.
(C) (Lanes 1–5) ATP hydrolysis activity in S-100 from PTEN+/� MEF cells expressing exogenous ENTPD5. PTEN+/� vector or PTEN+/� ENTPD5 1# and 2# (two
individual clones with different expression levels of ENTPD5) were established as described in the Experimental Procedures. Cell lysates (S-100) from indicated
cell lines were prepared, and aliquots of 30 mg were used for ATP hydrolysis assay. (Lanes 6–10) ENTPD5 expression in PTEN�/� MEFs was knocked down as
described in the Experimental Procedures. The cells were harvested, and S-100 were prepared and normalized for ATP hydrolysis assay. Positions of ATP, ADP,
and AMP are indicated. (Bottom) Aliquots of 10 mg protein of indicated samples were subjected to 10% SDS-PAGE followed by western analysis of ENTPD5.
Asterisk denotes cross-reactive proteins.
(D) PTEN�/� MEF cells were transfected with 4 mg plasmid DNA containing vector control or cDNA encoding PTEN or PTENcs as indicated. At 24 hr after trans-
fection, cells were harvested and total cell lysates were prepared. Aliquots of 10 mg of protein were loaded onto 10% SDS-PAGE followed by western analysis of
levels of PTEN, AKT, phosphorylated AKT(pAKT), ENTPD5, and b-actin as indicated.
(E) PTEN+/� and PTEN�/� MEF cells were treated with DMSO or LY294002 (50 mM) for 24 hr. Aliquots of 20 mg total cell extracts were subjected to 10% SDS-
PAGE followed by western analysis using indicated antibodies.
See also Figure S1 and Figure S2.
714 Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc.
which could not be hydrolyzed to UMP, indicating that the
conversion to UMP is critical for this cofactor to function. The
same holds true for guanine nucleotides (Figure S3).
UMP, ENTPD5, UMP/CMP Kinase-1, and AdenylateKinase-1 Constitute an ATP-to-AMP Hydrolysis CycleBased on the facts that purified ENTPD5 is unable to hydrolyze
ATP directly and the assay also contained S-100 from PTEN
heterozygous MEFs, we realized that there must be more factors
in the S-100, which are also required to hydrolyze ATP to AMP.
These factors presented in cells regardless of their PTEN status.
For example, when we added purified, recombinant ENTPD5
and UMP to the dialyzed S-100 from large-scale cultured HeLa
cells, the ATP-to-AMP hydrolysis was reconstituted (Figure 4A,
lanes 1–6). This observation made purification of these factors
easier because HeLa cells can be grown in large quantity in
Lane
+/- +/-
1 2 3 4 5 6 7 8 9 10
+/- +/- +/--/- -/- -/- -/- -/-
Dialysis
S-100
Small Molecule from +/- +/--/- -/- Hela
AMP
ADP
ATP
B
1000
250
62.5
15.625
4 1000
250
62.5
15.625
4 1000
250
62.5
15.625
4
Tri-phosphate Di-phosphate Mono-phosphate
Conc.(μM)
Uracil
Guanine
Cytosine
Thymidine
AMP
AMP
AMP
AMP
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15Lane
C
Lane 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Small Molecule - UMP UTPαSUTPγS PNP-UMP
10
00
25
0
62
.5
16
4 10
00
25
0
62
.5
16
4 10
00
25
0
62
.5
16
4 10
00
25
0
62
.5
16
4Conc.(μM)
AMP
ADP
ATP
D
17 18 19 20 21
Substrates
16
12
8
4
0No
rm
ali
ze
d [
Pi]
Fo
ld I
nc
re
as
e
Reaction 0hr
Reaction 2hr
ATP ADP CTP CDP GTP GDP UTP UDP
A
Figure 3. Small Molecule Requirement for ENTPD5-Mediated ATP Hydrolysis
(A) (Right) the recombinant human ENTPD5 was generated and purified as described in the Experimental Procedures. An aliquot of 120 ng recombinant ENTPD5
was subjected to SDS-PAGE followed by Coomassie brilliant blue staining. Arrows indicate recombinant ENTPD5. (Left) The nucleotide hydrolysis reactions were
carried out in triplicate by mixing 0.1 mg/ml ENTPD5 with 50 mM indicated nucleotides. After 2 hr incubation at 30�C, released free phosphate was measured by
malachite green assay as described in the Experimental Procedures. Data shown are representative of three independent experiments. Error bars indicate SEM.
(B) Small molecule (<10 kDa) was extracted from either PTEN+/� or PTEN�/� MEF cells or HeLa S3 cell lysates (S-100 fractions) as described in the Experimental
Procedures. Aliquots of 10.5 ml undialyzed cell lysates (lane 1 and 2) or dialyzed cell lysates (lane 3–10) fromPTEN+/� (lanes 1, 3, 5, 7, and 9) orPTEN�/� (lanes 2, 4,
6, 8, 10) MEFs (3.5 mg/ml) were mixed with another 10.5 ml buffer A (lane 1 to 4) or small molecule recovered from PTEN+/� (lanes 5 and 8), PTEN�/� cells (lanes 6
and 7), or from HeLa S3 cells (lanes 9 and 10) and were assayed for ATP hydrolysis activity. The positions of ATP, ADP, and AMP were indicated.
(C) Aliquots of 10.5 ml dialyzed S-100 from PTEN�/� MEF cells (3.5 mg/ml) were incubated in the presence of indicated final concentration of UTP, UDP, and UMP;
or GTP, GDP, and GMP; or CTP, CDP, and CMP; or TTP, TDP, and TMP as indicated at 30�C with a-P32-labeled ATP in a total volume of 30 ml at 30�C for 1 hr
followed by TLC to resolve radioactive adenosine nucleotides. Position of AMP on TLC plate is indicated.
(D) Aliquots of dialyzed S-100 prepared from PTEN�/� MEF cells were mixed with buffer A (lane 1) or indicated final concentration of indicated nucleotides and
assayed for ATP hydrolysis activity.
See also Figure S3.
Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc. 715
suspension. To identify these factors, we fractionated HeLa cell
S-100, using a Q Sepharose column, and collected both the
flowthrough (Q-FL) and column-bound fractions eluted with
300 mM NaCl (Q-30). Neither fraction alone was able to hydro-
lyze ATP to AMP, although the Q-30 fraction, when ENTPD5
and UMP were present, hydrolyzed ATP to ADP (Figure 4A, lanes
13 and 14). When both the Q-FL and Q-30 fractions were
included, the ATP-to-AMP activity was fully reconstituted (Fig-
ure 4A, lane 18).
We purified the activity present in the Q-30 fraction. The
activity present in the Q-30 fraction was purified by subjecting
HeLa S-100 onto four sequential column chromatographic steps
and finally onto a Mini Q column (Figure 4B, left). The activity
was eluted from this column with a linear salt gradient from 40
to 120 mM NaCl, and fractions eluted from the column were as-
sayed in the presence of recombinant ENTPD5, UMP, and the
Q-FL fraction (Figure 4B, right-bottom). A peak of activity was
observed at fractions 8–10. The same fractions were subjected
to SDS-PAGE followed by silver staining, and two protein bands
close to 37 and 20 kDa markers correlated perfectly with activity
(Figure 4B, right-top). Both bands were identified by mass
spectrometry as human UMP/CMP kinase-1 (CMPK1).
Fraction № 4 5 6 7 8 9 10 11 12
40 mM
120 mM NaCl
AMP
ADP
ATP
20KD
25KD
37KD
50KD
75KD
Start Hela S-100
Q HP
SP HP
Heparin HP
Super-dex 200
Mini Q
B
Fraction № ST 13 14 15 16 17 18 19 2220 21 23 24 25
AMP
ADP
ATP
AK1
C
rENTPD5 + -+ + - + - + - + - + - + - + - +
UMP - + - - + + - - + + - - + + - - + +
Hela S-100 Q-FL Q-30 Q-FL + Q-30
Lane 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
A
AMP
ADP
ATP
18
AMP
ADP
ATP
Lane 1 2 3 4 5 6 7 8
PN
Gase F
AK
1
CM
PK
1
ENTPD5
9 10 11 12
Glycosylated
ENTPD5
UnGlycosylated
ENTPD5
PNGaseF
AK1
CMPK1
ENTPD5 +- - ++ - + +
AK1 + - - + + - + +
CMPK1 +- - + +- + +
UMP + + + + + -+ +
D
N/T
Figure 4. Reconstitution of ENTPD5-Mediated ATP Hydrolysis
(A) HeLa S3 cell S-100 was fractionated by Q Sepharose column to two fractions (Q-FL [flowthrough] and Q-30). Q-30 represents fraction eluted with 300 mM
NaCl. Aliquots of 15 ml buffer A (lane 1 and 2), or dialyzed HeLa cell S-100 (lanes 3–6), or Q-FL (lanes 7–10), or Q-30 (lanes 11–14), or Q-FL combined with Q-30
(7.5 ml each) (lanes 15–18) were mixed with (lanes 1, 2, 4, 6, 8, 10, 12, 14, 16, and 18) or without (lanes 3, 5, 7, 9, 11, 13, 15, and 17) ENTPD5 in the presence (lanes 2,
5, 6, 9, 10, 13, 14, 17, and 18) or absence (lanes 1, 3, 4, 7, 8, 11, 12, 15, and 16) of 100 mM UMP and assayed for ATP hydrolysis activity.
(B) (Left) Diagram of the purification scheme for the required factor in Q-30. (Right) Final step of purification of CMPK1. (Top) Aliquots of 60 ml indicated Mini Q
fractions that were subjected to 4%–10% gradient SDS-PAGE followed by silver staining. Arrow indicates the protein band correlated with ATP hydrolysis
activity. (Bottom) Aliquots of 5 ml indicated fractions that were mixed with 15 ml of dialyzed Q-FL fraction in the presence of 100 mM UMP and 18 ng recombinant
ENTPD5 and were assayed for ATP hydrolysis activity.
(C) 3 ml of the Q-FL fraction was concentrated to 600 ml with a spin column and analyzed on a Supdex-200 column (10/30). Fractions of 1 ml were collected, and
aliquots of 7.5 ml of indicated fractions were combined with 7.5 ml dialyzed Q-30 fraction, 100 mM UMP, and 18 ng recombinant ENTPD5 and were assayed for ATP
hydrolysis activity. Positions of radioactive ATP, ADP, and AMP are indicated. (Bottom) Aliquots of 10 ml of indicated fractions were subjected to 10% SDS-PAGE
followed by western blotting analysis using an antibody against human adenylate kinase 1 (AK1).
(D) (Left) Aliquots of recombinant AK1 (lane 1), ENTPD5 (lane 2), and CMPK1 (lane 3) (final concentration, 1 mg/ml) were incubated alone or were sequentially
combined as indicated (lane 4 to 8) in the presence (lane 1 to 7) or absence (lane 8) of UMP (100 mM) for ATP hydrolysis activity. Position of ATP, ADP, or
AMP was indicated. (Right) Aliquots of 10 mg recombinant AK1 (lane 9), ENTPD5 (lane 10) or ENTPD5 pretreat with PNGase F (NEB) (50 units/mg ENTPD5)
(lane 11), and CMPK1 (lane 12) were subjected to 10% SDS-PAGE followed by Coomassie brilliant blue staining.
716 Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc.
The identification of UMP/CMP kinase in the Q-30 fraction
shed light on why UMP is a cofactor for the ATPase activity
and how ENTPD5 plus this enzyme generates ADP from ATP.
In this reaction, UMP is phosphorylated into UDP by CMPK1
and ATP, generating ADP. UDP is subsequently hydrolyzed by
ENTPD5 to UMP, completing the cycle with net conversion of
ATP to ADP.
With this knowledge, we then made an educated guess that the
third protein factor present in the Q flowthrough fraction should
be an adenylate kinase, which converts two ADP into one ATP
and AMP, causing the ATP-to-AMP conversion seen in PTEN
null cell extracts. To confirm this, we took the Q flowthrough frac-
tion and subjected it to a gel-filtration column and collected the
fractions eluted from the column to assay for ATP-to-AMP hydro-
lysis in the presence of UMP, purified recombinant ENTPD5, and
the Q-30 fraction that contains CMPK1. An ATP-to-AMP activity
peak centered at fractions 17 and 18 was observed (Figure 4C,
top). When these factions were subjected to western blotting
analysis using an antibody against adenylate kinase-1 (AK1),
the detected western blotting band correlated perfectly with the
activity peak (Figure 4C, bottom). The correlation was maintained
with additional chromatographic steps (data not shown).
We subsequently generated recombinant CMPK1 and AK1 in
bacteria and purified them to homogeneity (Figure 4D, lanes 9
and 12). Purified recombinant ENTPD5 expressed in insect cells
runs as a triplet on an SDS-PAGE gel that could be shifted down
to a doublet after treatment by PNGase F, indicating that
ENTPD-5 is glycosylated (Figure 4D, lanes 10 and 11).
These purified recombinant proteins allowed us to reconsti-
tute the ATP-to-AMP hydrolysis cycle. Only when all three
enzymes and UMP were present, efficient ATP-to-AMP conver-
sion was observed (Figure 4D, lanes 1–8).
ENTPD5 Is an ER EnzymeAfter purification and identification of ENTPD5 from PTEN null
cells, we realized that ENTPD5 is identical to a previously purified
ER UDPase (Trombetta and Helenius, 1999). Although we iden-
tified and purified ENTPD5 from the S-100, the enzyme most
likely fractionated there as a result of broken ER from physical
shearing during the cell-breaking process. When we expressed
an ENTPD5-GFP fusion protein in cells, the GFP signal was co-
localized with the coexpressed ER-DsRed marker (Figure 5A).
The ER location of ENTPD5 and its preferred specificity for
UDP suggested that ENTPD5 functions in the process of reglu-
cosylation catalyzed by UGGT for calnexin/calreticulin-mediated
protein folding (Trombetta and Parodi, 2003). In the process,
UDP is generated after the conjugated glucose gets transferred
to the glycosidase I/II trimmed core glycan on N-glycosylated
proteins. UDP-glucose is made in cytosol and transported into
ER through the UDP-sugar transporter, which is an antiporter
that must exchange out one molecule of UMP for each UDP
sugar conjugate imported into the ER (Hirschberg et al., 1998).
UDP therefore needs to be hydrolyzed to UMP to prevent end
product feedback inhibition of UGGT, as well as to serve as
a substrate for the antiporter (Trombetta and Helenius, 1999).
UMP is phosphorylated back to UDP by CMPK1 in the cytosol,
and the generated ADP is converted to ATP and AMP by AK1
(diagramed in Figure 5B).
Knockdown of ENTPD5 Causes ER Stress and GrowthInhibitionBecause cells with an activated PI3K/AKT pathway increase
their cellular protein translation level, cells need to evolve a corre-
sponding system in ER to accommodate the high demand for
protein folding process. It is possible that cells may do so by up-
regulating ENTPD5 to increase the conversion of UDP to UMP in
ER, thereby promoting N-glycosylation and folding. Thus,
reducing the level of ENTPD5 in cells with active AKT should
induce ER stress. In addition, because many growth-promoting
cell membrane receptors are highly N-glycosylated, loss of
function of ENTPD5 could affect their folding process, resulting
in their reduction and, subsequently, cell growth arrest. To test
this hypothesis, we engineered several cell lines based on
the PTEN null MEFs in which the expression of ENTPD5 could
be knocked down with the addition of doxcycline (Dox),
which turned on a Tet-suppressor-controlled shRNA-targeting
ENTPD5. The results from a representative cell line were shown
in Figure 5C. Comparing to PTEN null MEFs expressing GFP
shRNA, addition of Dox to the culture media resulted in success-
ful knockdown of ENTPD5 expression in these cells. As a result,
an ER stress marker, GRP78/BiP, was induced, and cellular
N-glycosylation level, as measured by PHA blotting, was down
(Figure 5C, lanes 5–8). Of interest, the levels of receptor tyrosine
kinases, including EGFR, Her-2/Erb-2, and type I insulin-like
growth factor receptor (IGF-IR) b, were significantly decreased
after ENTPD5 knockdown.
To confirm that the above-mentioned cellular effects after
ENTPD5-targeting shRNA expression were specific, we intro-
duced into these cells a cDNA encoding ENTPD5 with silent
mutations in the shRNA target sequence. In these cells, although
the endogenous ENTPD5 was still knocked down after addition
of Dox (Figure 5D, lanes 2, 4, and 6), the expression of an
shRNA-resistant wild-type transgene (three flag tags were fused
to ENTPD5 coding sequence so it migrated higher) led to
complete reversal of BiP induction, lowered glycosylation, and
downregulation of these growth factor receptors (Figure 5D,
lane 4). In contrast, introducing an E171A mutant that abolishes
UDP hydrolysis activity of ENTPD5 was not able to rescue these
phenotypes (Figure 5D, lane 6). In addition to BiP, another ER
stress marker, CHOP, was also induced when ENTPD5 was
knocked down (Figure 5D).
Consistent with the loss of growth factor receptors after
ENTPD5 knockdown, cell growth was also dramatically attenu-
ated. As shown in Figure 5E, when ENTPD5 in PTEN null MEFs
was knocked down after addition of Dox, very few colonies
grew on the culture dish after 10 days, although the same
number of cells was plated initially, and they were cultured under
the same condition (Figure 5E, left row). The growth inhibition
was rescued when the shRNA-resistant ENTPD5 cDNA was ex-
pressed (Figure 5E, middle row), whereas the inhibition was
exacerbated if an enzymatic dead mutant of ENTPD5 was ex-
pressed instead (Figure 5E, right row).
ENTPD5 Promotes Aerobic GlycolysisOne implication of elevated ENTPD5 expression is that a
significant percentage of cellular ATP is consumed through
the ENTPD5/CMPK1/AK1 enzyme cascade. To maintain the
Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc. 717
ENTPD5-GFP
ENTPD5-GFP
DsRed
ER-DsRed Merge
Mer ge
A
N-acetylglucosamine
manose UUU uridine
glucose PPP phosphate
2xATP 2xADP AMP
2xUMP 2xUDP
ENTPD5
CMPK1
AK11/2 1/2
2xPi
CytosolER Lumen
ATP 2xAMP
+PiInput Output
B
UP UUP
UGGT FoldingGlycoprotein
Cytosol
ER Lumen
UDP-GlucoseUMP
Phosphate
PhosphateTransporter
Antiporter
ENTPD5
UP UUP
UP UUPi
PTEN-/- MEF shRNA ENTPD5Rescue Vec sr ENTPD5 sr ENTPD5 E171A
Cell line
- Dox+ Dox
E
Lane 1 2 43 5 6 7 8Dox +- + + +- - -
Time 2d 4d 4d2d
Cell LineGFP ENTPD5PTEN-/- sh RNA
ENTPD5
GRP78/BiP
EGFR
ß-Actin
*
PH
A B
lot
Her-2/ErbB-2
IGFRß
C
PTEN-/- MEFsh RNA ENTPD5
Vec
sr E
NT
PD
5
sr E
NT
PD
5 E
171A
Lane 1 2 3 54 6Dox - - -+ + +
Cell Line
ENTPD5sr ENTPD5-3Flag
GRP78/BiP
*
EGFR
ß-Actin
PH
A B
lot
Rescue
Her-2/ErbB-2
IGFRß
D
CHOP
Figure 5. Biological Function of ENTPD5 in PTEN�/� MEF Cells
(A) PTEN�/� MEF cells were cotransfected with mouse ENTPD5-GFP and free DsRed or with ENTPD5-GFP and ER-localized DsRed (ER-DsRed). ENTPD5-GFP
colocalized with ER-DsRed (bottom row), but no obvious codistribution with free DsRed was observed (top row). Scale bars, 10 mm.
(B) Working model for ENTPD5. See the text for details.
(C) PTEN�/� MEF cells with doxycycline (Dox)-inducible expression of shRNA-targeting ENTPD5 was generated as described in the Experimental Procedures.
After 2 or 4 days induction with Dox (0.125 mg/ml), cells were harvested and total cell lysates were prepared as described in the Extended Experimental Proce-
dures. Aliquots of 10 mg protein were subjected to SDS-PAGE followed by western blotting analysis using the indicated antibodies. Glycosylation was visualized
by PHA blot as indicated. Asterisk denotes decreased glycosylated proteins.
718 Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc.
intracellular ATP level, the extra ATP consumed should come
from either increased oxidative phosphorylation or glycolysis.
We therefore tested both by measuring oxygen consumption
and lactate production, respectively. Consistent with previous
reports, there was not much difference in the respiration rate of
PTEN null and PTEN heterozygous MEFs (Figure S4), but
PTEN null cells showed �40% higher lactate production in their
cultured medium (Figure 6A, columns 4 and 5). When ENTPD5
was ectopically expressed in two PTEN heterozygous MEF lines,
lactate production was increased, and the level of increase
correlated with that of ENTPD5 expression (Figure 6A, columns
2 and 3). Consistently, when ENTPD5 was knocked down with
addition of Dox as in Figure 5D, lactate production was signifi-
cantly decreased (Figure 6B, columns 1 and 2). In PTEN null
MEFs harboring Dox-inducible ENTPD5-targeting shRNA that
also expressed shRNA-resistant ENTPD5 transgene, addition
of Dox did not result in a decrease in lactate production, and
the basal lactate production also became higher, correlated
with the higher than endogenous expression of the transgene
(Figure 6B, columns 3 and 4, and Figure 5D). In contrast, when
the catalytic site mutant ENTPD5 transgene was expressed to
the similar level, lactate production still reduced with the addition
of Dox (Figure 6B, columns 5 and 6).
If the ATP hydrolysis cycle initiated by ENTPD5 discovered
in vitro is operational in cells, and the extra ATP consumed by
a higher level of ENTPD5 is compensated by increased glycol-
ysis, glucose starvation of these cells should result in much
faster decrease of intracellular ATP level compared to cells
with lower ENTPD5 expression. Indeed, when intracellular ATP
concentrations in PTEN heterozygous and PTEN null MEFs
were measured after glucose withdrawal from the culture media,
that in PTEN null MEFs decreased to about half of the original
level within the first hour, while there was little change of ATP
in PTEN-heterozygous MEF within 2 hr (Figure 6C).
To confirm that the faster ATP level dropping in PTEN null cells
was due to higher expression of ENTPD5, the same set of MEFs
as in Figure 6B was subjected to glucose starvation after
ENTPD5 was knocked down with the addition of Dox. Knock-
down of ENTPD5 for 2 days in PTEN null MEFS caused the total
cellular ATP level to decrease (Figure 6D, columns 3 and 4).
However, the ATP level did not decrease further after glucose
starvation for 1 hr, whereas cells without Dox treatment
consumed 50% of original ATP during this period (Figure 6D,
columns 1 and 2). The MEFs expressing the shRNA-resistant
ENTPD5 did not lower their ATP level with Dox treatment, but
their ATP levels were even more drastically lowered after glucose
starvation, possibly due to ENTPD5 overexpression (Figure 6D,
columns 5–8). In contrast, cells expressing a similar level of the
catalytic dead mutant ENTPD5 behaved the same as cells
without transgene expression (Figure 6D, columns 9–12).
The observed decrease of glycolysis after ENTPD5 knock-
down could be due to lowered tyrosine kinases receptors and
AKT activity (Figure 5C and Figure S5), which stimulates the
glucose transporter activity on cell surface (Kohn et al., 1996;
Plas et al., 2001). In addition, knockdown of ENTPD5 may reduce
the production of ADP/AMP, which allosterically activate glycol-
ysis enzymes such as phosphofructose kinase (PFK) (Gevers
and Krebs, 1966). To distinguish these possibilities, cellular
fructose-6-phosphate and fructose-1,6-bisphosphate were
measured using LC-Mass. As shown in Figure 6E, the former
was lowered by �20% after ENTPD5 knockdown (Figure 6E,
left), whereas the latter dropped by �60% (Figure 6E, right).
These results suggested that ENTPD5 indeed affects glucose
influx to cells, but its major impact on glycolysis is to directly
activate glycolysis enzymes such as PFK by hydrolyzing ATP.
ENTPD5 Expression Correlates with AKT Activation inHuman Cancer Cell Lines and Primary Tumor SamplesPTEN mutation and AKT activation are common features for
human cancer. To check whether what was observed in PTEN
null MEFs is also true for human cancer cells, we screened
a panel of human cancer cell lines for the expression of PTEN,
activated AKT, and ENTPD5. As shown in Figure 7A, AKT activa-
tion was seen in human prostate cancer lines C42 and LNCaP
cells, and in these two cell lines, elevated ENTPD5 expression
was also observed.
We also examined ENTPD5 expression and AKT activation in
primary human tumor samples by staining two adjacent sections
from a formalin-fixed, paraffin-embedded human primary pros-
tate cancer sample with rabbit monoclonal antibodies against
human ENTPD5 and phosphoAKT, respectively. The specificity
of this anti-ENTPD5 antibody was verified by western blotting
analysis using LNCaP cell lines with or without their ENTPD5
knocked down (Figure S6A). The staining intensity for ENTPD5
in tumor was significantly greater compared with adjacent normal
tissue and was correlated with pAKT staining (Figure 7B). Out of
10 samples from patients between age 57 and 76, only one tumor
sample from a 57-year-old patient and another sample collected
from a patient who had just gone through therapy did not show
strong ENTPD5 staining, and the same tumors were also negative
for pAKT (Figure S6B2 and Figure S6B10). The remaining eight
samples all showed greater tumor staining of pAKT and ENTPD5
(Figure 7B and Figures S6B3–S6B9).
Because microarray data of many tumors are publicly avail-
able, we also analyzed a group of recently publicized microarray
data from human prostate cancer samples (Bermudo et al.,
2008). We found that ENTPD5 is highly expressed in all 20 tumor
samples compared to normal prostate epithelium cells (Fig-
ure S7). In addition, after clustering all gene expression profiles
from prostate tumor microarray data using SOM (self-organiza-
tion method), we identified dozens of genes associated with
AKT activation, including Her-3, PI3KCB, Ras, S6 kinase,
CD36, IL8, EGF, osteropontin, and FoxO1, which are signifi-
cantly coregulated with ENTPD5 (Figure S7).
(D) Rescue cell lines with expression of shRNA-resistant wild-type or catalytic dead mutant (E171A) ENTPD-5 were established as described in the Extended
Experiments Procedures. Same as in (C), after 2 days culture, cells were harvested, and total cell lysates (10 mg/lane) were subjected to SDS-PAGE followed
by western analysis as indicated. Glycosylation was visualized by PHA blot analysis.
(E) Rescue cell line was plated at density of 5 3 104/100 mm dish and treated with Dox as in (C). Cell medium was changed each 3 days. After 10 days culture, the
plates were stained by methylene blue.
Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc. 719
ENTPD5 Is Important for Cancer Cell GrowthTo verify the functional significance of ENTPD5 expression in
human cancer cells, we generated a cell line from the original
LNCaP cells in which an shRNA against human ENTPD5 could
be induced by Dox. In these cells, knockdown of ENTPD5 by
adding Dox to the culture media also lowered N-glycosylation
(Figure 7C, comparing lanes 7 and 8, 9 and 10, and 11 and 12)
and induced BiP expression (Figure 7C, lanes 8, 10, and 12).
B
lact
ate
(nm
ol/m
g pr
otei
n)
400
800
1200
0
Dox - + - -+ +
Cell Line PTEN-/- MEF shRNA ENTPD5
Rescue Vec sr ENTPD5 sr ENTPD5E171A
PTEN+/- PTEN-/-Cell Line
- Glucose 0 1 h 2 h 0 1 h 2 h
ATP
(nm
ol/m
g pr
otei
n)
C
0
2
4
6
8
10
0
0.2
0.4
0.6
0.8
1.0
1.2
Rel
ativ
e Fr
ucto
se-6
-P C
onte
nt
PTEN-/- MEFshRNA ENTPD5
- +Dox
0
0.2
0.4
0.6
0.8
1.0
1.2
Rel
ativ
e Fr
ucto
se-1
, 6-2
P C
onte
nt
PTEN-/- MEFshRNA ENTPD5
- +Dox
EF-6-P F-1,6-2P
Clone № 1# 2#
Stable transfected with Vec ENTPD5-Flag
PTEN+/- -/-Cell Line
lact
ate
(nm
ol/m
g pr
otei
n)400
200
600
800
0
ENTPD5ENTPD5 Flag
ß-Actin
A
- Glucose
Rescue
Dox
Cell Line
D
0
2
4
6
8
10
12AT
P (n
mol
/mg
prot
ein)
ENTPD5sr ENTPD5 3Flag
ß-Actin
- - - - - -+ + + + + +
sr ENTPD5 sr ENTPD5 E171A
- - -+ + +
Vec
PTEN-/- MEF shRNA ENTPD5
Figure 6. ENTPD5 Promotes ATP Hydrolysis and Glycolysis In Vivo
(A) Lactate in the culture media of PTEN+/� and PTEN�/� MEF cells (columns 4 and 5) as well as PTEN+/� MEF clones stably transfected with vector control
(column 1) or Flag-tagged mouse ENTPD5 (column 2, clone 1 and column 3, clone 2, as used in Figure 2C) was measured as described in the Extended
Experimental Procedures, and the value was normalized to total protein amount.
(B) Lactate in the culture media of ENTPD5 knockdown and rescue cell lines was measured as in (A) except pretreatment with or without Dox for 2 days.
(C)PTEN+/� andPTEN�/� MEF were deprived of glucose for indicated time periods, and intracellular ATP was determined as described in Extended Experimental
procedures.
(D) The intracellular ATP was measured 1 hr after glucose starvation on ENTPD5 knockdown and rescue cell lines as in (B).
(E) ENTPD5 was knocked down as in (B), and the intracellular fructose-6-phosphate (left) and fructose-1,6-bisphosphate (right) were separated and quantified by
HPLC mass spectrometry (ABI 3200 Q TRAP LC/MS/MS Systems). The relative amount of metabolite is normalized to total ion count (TIC). All experiments were
repeated at least two times, and the error bar represents standard deviation.
See also Figure S4 and Figure S5.
720 Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc.
These phenotypes were rescued by the expression of a wild-
type shRNA-resistant ENTPD5 transgene, but not by the active
site mutant ENTPD5 (Figure 7C, lanes 13–24). Several growth
factor receptors were also checked in these cell lines after Dox
treatment. As shown in Figure 7D, EGFR and Her2/ErbB-2
were significantly down, and IGFRbwas slightly down (Figure 7D,
lanes 1–4). They were restored to the normal level by the expres-
sion of shRNA-resistant ENTPD5 transgene (Figure 7D, lanes 5
and 6), but not the active site mutant (Figure 7D, lanes 7 and
8). Consistently, when the cell number was measured after
4 day knockdown of ENTPD5, only about half of LNCaP cells
were there, compared to a control knockdown cell line, and
the defect was rescued by expression of wild-type ENTPD5
transgene, but not active site mutant (Figure 7E).
To test whether knocking down ENTPD5 in LNCaP cells also
has an effect on their growth in vivo, we implanted the LNCaP
cells bearing a Dox-inducible shRNA targeting ENTPD5 in matri-
gel in nude mice. As a control, LNCaP cells with a Dox-inducible
shRNA targeting GFP were also implanted. After the xenograft
tumors reached the size of 500 mm3, a cohort of seven mice
were fed with Dox-containing water. The level of ENTPD5 in
these tumors was measured after 6 weeks. Compared with
mice fed with normal water, the ENTPD5 levels in ENTPD5-tar-
geting shRNA containing tumors from mice fed with Dox-con-
taining water were significantly lower except in one mouse
(Figure 7F). Whereas ENTPD5-targeting shRNA containing
tumors in mice fed with normal water continued to grow, the
tumors in mice fed with Dox-containing water shrank (Figure 7G).
Amazingly, when these tumor samples were analyzed under
a microscope after fixing and staining with hematoxylin and
eosin, there were very few tumor cells left in the matrigel in
tumors grown in Dox-fed mice, whereas in mice fed with normal
water, the matrigel was filled with tumor cells (Figure 7H). The
GFP shRNA-containing tumors did not respond to Dox treatment
and continued to grow during the period of experiment.
DISCUSSION
ENTPD5 Is an Important Link in the PI3K/PTENSignaling LoopThe experimental data reported here identify ENTPD5, an ER
UDPase, as an important link in the PI3K/PTEN/AKT signaling
loop. We reason that ENTPD5 upregulation is important for
AKT-activated cells to cope with elevated translational activity
that generates more nascent polypeptide chains destined for
the ER.
ENTPD5 is a member of the ectonucleoside triphosphate
diphosphohydrolase family, which consists of seven other
members (reviewed by Robson et al., 2006). ENTPD 1–3
(CD39, CD39L1, and CD39L3) are typical ectoenzymes, whereas
the other five members have a predominant intracellular localiza-
tion including ER, Golgi apparatus, and lysosomal/auto-
phagic vacuoles. The functions of these organelle-associated
ENTPDases are still largely unexplored, but judging by their loca-
tion and substrate preference, it would not be surprising if they all
turn out to regulate protein glycosylation.
Among members of this group of enzymes, however, ENTPD5
is the only intracellular ENTPDase that is transcriptionally upre-
gulated in PTEN null cells (Figure S1). The mRNA of an extracel-
luar ENTPDase, ENTPD2, although expressed at a much lower
level than ENTPD5, was also elevated in PTEN null cells (Fig-
ure S1). The significance of such is unknown.
ENTPD5 Contributes to Warburg EffectOne of the surprising findings reported here is how quickly ATP
can be consumed as a result of ENTPD5 upregulation. One
naturally raised question is where the extra consumed ATP
comes from. After measuring both oxygen consumption and
lactate generation, we found that the lactate production was
elevated in these PTEN null cells, whereas oxygen consumption
did not change (Figure 6A and Figure S4). When ENTPD5 was
knocked down, higher lactate production returned to normal
(Figure 6B). Moreover, simply ectopically expressing ENTPD5
in PTEN heterozygous MEF elevated their lactate production
(Figure 6A). These results indicate that ENTPD5 is a critical player
in causing the Warburg effect, i.e., elevated lactate production
under aerobic conditions, in these PTEN null cells.
In addition to being part of the activation loop for AKT that
promotes glucose uptake into cells (Kohn et al., 1996; Plas
et al., 2001), a major effect of ENTPD5 on glycolysis might be
its ability to generate ADP/AMP through the aid of CMPK1 and
AK1. Elevated AMP levels (and to a lesser extent, ADP) activate
phosphofructokinase and inhibit fructose diphosphatase to drive
glycolysis and prevent gluconeogenesis, resulting in higher
lactate production (Gevers and Krebs, 1966). Consistently, the
fructose-1,6-bisphosphate level dropped to a much lower level
than that of fructose-6-phosphate when the ENTPD5 in PTEN
null cells was knocked down (Figure 6E).
In addition to UDP, ENTPD5 also use GDP as a substrate and
hydrolyze it to GMP (Figure 3A and Figure S3). It is interesting to
note that GDP-conjugated sugars are another group of major
substrates for glycosylation. The significance of hydrolyzing
GDP by ENTPD5 is not clear because it is believed that GDP
sugars are transferred to proteins in the Golgi.
ENTPD5 Is Potentially an Anticancer TargetThe current study highlighted ENTPD5 as a critical link in the
PI3K/PTEN pathway that promotes cell growth and survival,
a pathway that is often activated in cancer cells. We saw good
correlation between ENTPD5 expression and AKT activation in
both cultured prostate cancer cell lines and primary human pros-
tate carcinoma samples (Figures 7A and 7B and Figures S6 and
S7). Therefore, inhibition of this enzyme, similar to knockdown,
can potentially generate benefits for anticancer activity. It should
induce more severe ER stress in cancer cells with active AKT due
to higher protein traffic through the secretory pathway. It may
cause synthetic lethality in these cells, which otherwise maintain
survival advantage and resistance to common anticancer drugs.
It will also lower many growth factor receptors on the cell surface
due to their high N-glycosylation nature, a phenomenon that may
reflect the evolutionary connection between fast growth and
nutrient availability in mammalian cells (Lau et al., 2007). Among
such receptors, EGFR, Her2/ErB2, and IGFR levels were down
after ENTPD5 knockdown (Figure 5 and Figure 7), whereas
a nongrowth-promoting TGFb receptor did not change (data
not shown).
Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc. 721
G
LNCaPshRNA GFP -DoxLNCaPshRNA GFP +DoxLNCaPshRNA ENTPD5 -DoxLNCaPshRNA ENTPD5 +Dox
1 2 3 4 5 6Weeks after Dox
Tuno
r si
ze c
hang
e af
ter
Dox
(%)
50%
70%
90%
110%
130%
150%
170%
190%
*
B
a b
c d
ENTPD5 pAKT
LNCaP shRNA GFP ENTPD5
Lane 1 2 3 4 5 6 7 8Dox - + - + - + - +
Rescue
No
ne
sr
EN
TP
D5
sr
EN
TP
D5
E1
72
A
0
20
40
60
80
100
120
E
Cel
l gro
wth
inhi
bitio
n (%
)
- DOX - DOX
+ DOX + DOX
H
500um 100um
LNC
aP s
h R
NA
EN
TPD
5 tu
mor
s
DU
145
LAPC
4
PC3
LNC
aPC
42
MC
F-7
MB
A23
1SK
BR
-3
T47-
D
Prostate Breast
PTEN
pAKT
ENTPD5
AKT
ß-Actin
A
GRP78/BiP
Lane 1 2 3 54 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24Dox - - -+ + + - - -+ + + - - -+ + + - - -+ + +
Time 2d 4d 6d 2d 4d 6d 2d 4d 6d 2d 4d 6dLNCaP shRNA GFP LNCaP shRNA ENTPD5
Rescue None sr ENTPD5 sr ENTPD5 E172A
ENTPD5sr ENTPD5-3Flag
PH
A B
lot
*
Cell Line
C
ß-Actin
D
Dox - - -+ + +
sr E
NTP
D5
sr E
NTP
D5
E17
2ANon
e
- +Lane 1 2 3 4 5 6 7 8
Cell Line (LNCaP shRNA) GFP ENTPD5
ENTPD5sr ENTPD5-3Flag
EGFR
ß-Actin
Rescue
Her-2/ErbB-2
IGFRß
ENTPD5
Ponceau S
-Dox +Dox
LNCaP shRNA ENTPD5 tumorsF
Figure 7. Knockdown of ENTPD5 in LNCaP Cells Decreases Glycosylation, Expression of Cell Surface Receptors, and Tumor Progression
(A) Aliquots of 20 mg of total cell extracts from indicated cell lines were subjected to 10% SDS-PAGE followed by western blotting analysis using antibodies as
indicated.
(B) Immunohistochemical staining for ENTPD5 (a and c) and pAKT (b and d) in adjacent sections of a human prostatic carcinoma sample (a/b 103 and c/d 203
lenses). Scale bar, 200 mM (a and b); 100 mM (c and d). Arrows indicate tumor.
(C) Inducible ENTPD5 knockdown and rescue stable cell lines were treated with or without Dox (0.0625 mg/ml) for indicated time periods. Aliquots of 10 mg of total
cell extracts were subjected to 10% SDS-PAGE for western blotting analysis of ENTPD5, BiP, glycosylated proteins (PHA blot), and b-actin. Asterisk indicates
decreased glycosylated proteins.
(D) Indicated cell lines were plated and treated with or without Dox for 6 days, total cell lysates were prepared, and aliquots of 10 mg protein were subjected to
SDS-PAGE followed by western blotting analysis using indicated antibodies.
(E) Indicated cells (1 3 104) were seeded in 96-well plates and then treated with and without Dox (1 mg/ml) for 4 days. Cell contents were measured.
(F–H) 2 3 106 LNCaP cells with Dox-inducible shRNA target GFP or ENTPD5 were injected subcutaneously into the flank of nude mice as described in the
Extended Experimental Procedures. When the tumors reached a volume of �500 mm3, mice were fed with normal or Dox-containing water.
722 Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc.
Chronic inhibition of ENTPD5 may cause liver and male fertility
defects because mice with ENTPD5 deficiency show hepatop-
athy and aspermia (Read et al., 2009). These defects in mice,
however, only become obvious after 1 year of age. Given the
poor prognosis of PI3K/PTEN mutations in human cancers and
potential synthetic lethal effect of AKT activation and ENTPD5
inhibition, developing ENTPD5 inhibitors for cancer therapy
may be a worthwhile pursuit.
EXPERIMENTAL PROCEDURES
General Reagents and Methods
General chemicals are from Sigma unless otherwise described. We obtained
a-P32-labeled ATP from GE Healthcare. All other nucleotides are from Sigma.
Nonhydrolyzable uracil and guanine nucleotide analogs are from Gena Biosci-
ence (Germany). HRP-conjugated E-type PHA is from USBioLogical
(Ca#P3371-25). Puromycin, blasticidin, and hygromycin, which are used for
establishment and maintenance of stable cell lines, are purchased from Inviv-
ogen (Ca#ant-pr-1, ant-bl-1, and ant-hg-1, respectively). G418 is from Calbio-
chem (Ca#345810). The sources of antibodies used are listed in the Extended
Experimental Procedures.
Cell Culture
PTEN+/� and PTEN�/� MEF cells are established previously (Stambolic et al.,
1998). The sources of all other cell lines used and their culture conditions are
described in the Extended Experimental Procedures.
In Vitro ATP Hydrolysis Assay
The ATP hydrolysis assays were carried out by incubation-indicated cell
extracts or purified enzymes with a-P32-ATP and were analyzed by thin layer
chromatography (TLC). The detailed method was described in the Extended
Experimental Procedures.
Purification of ENTPD5 and CMPK
All purification steps were carried out at 4�C. All chromatography steps were
carried out using an automatic fast protein liquid chromatography (FPLC)
station (Pharmacia). The details of purification methods were described in
the Extended Experimental Procedures.
ENTPD5 Expression and ENTPD5 shRNA Constructs
All ENTPD5 expression and shRNA constructs were made as described in the
Extended Experimental Procedures.
Preparation of Recombinant ENTPD5, CMPK1, and Adenylate
Kinase
Human ENTPD5 recombinant protein was generated using Bac-to-Bac Bacu-
lovirus Expression Systems (Invitrogen Cat# 10359-016). Human CMPK1 and
AK1 were generated by bacterial expression. The details of methods were
described in the Extended Experimental Procedures.
Measurement of Lactate Production in Cell Culture Medium
We purchased Lactate Assay kit from Biovision (Cat#K627-100). Measure-
ment of Lactate concentration in cell culture medium was performed accord-
ing the manufacturer’s instruction and described in detail in the Extended
Experimental Procedures.
Measurement of Intracellular Fructose-6-P and Fructose-1,6-2P
The preparation and measurement of these two phosphosugars by LC-Mass
were described in the Extended Experimental Procedures.
Cell Survival Assay
Cell survival analysis was performed using the Cell Titer-Glo Luminescent Cell
Viability Assay kit (Promega) following manufacturer’s instruction with minor
modification. In brief, 25 ml of Cell Titer-Glo reagent was added to the cell
culture medium. Cells were placed on a shaker for 10 min and were then
incubated at room temperature for an additional 10 min. Luminescent reading
was carried on a Tecan SPECTRAFluor Plus reader (Tecan).
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures, seven
figures, and one table and can be found with this article online at doi:10.1016/j.
cell.2010.10.010.
ACKNOWLEDGMENTS
We would like to express our gratitude to Drs. Fenghe Du and Liping Liu for
excellent technical assistance. We are grateful for Dr. Aijun Liu from the 301
Hospital in Beijing for providing the human prostate tumor samples and
Dr. Benjamin Tu from University of Texas Southwestern for help with the phos-
phofructose sugar measurement. We thank Mr. Gregory Kunkel and Dr. Lai
Wang for critical reading of the manuscript. This work is also supported by
a grant from the National Cancer Institute (NCI) (PO1 CA 95471) and the
National High Technology Projects 863 from Chinese Ministry of Science
and Technology.
Received: May 14, 2010
Revised: September 10, 2010
Accepted: October 7, 2010
Published online: November 11, 2010
REFERENCES
Bermudo, R., Abia, D., Ferrer, B., Nayach, I., Benguria, A., Zaballos, A., del
Rey, J., Miro, R., Campo, E., Martınez-A, C., et al. (2008). Co-regulation anal-
ysis of closely linked genes identifies a highly recurrent gain on chromosome
17q25.3 in prostate cancer. BMC Cancer 8, 315.
Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., Anderson,
M.J., Arden, K.C., Blenis, J., and Greenberg, M.E. (1999). Akt promotes cell
survival by phosphorylating and inhibiting a Forkhead transcription factor.
Cell 96, 857–868.
Christofk, H.R., Vander Heiden, M.G., Harris, M.H., Ramanathan, A., Gerszten,
R.E., Wei, R., Fleming, M.D., Schreiber, S.L., and Cantley, L.C. (2008). The M2
splice isoform of pyruvate kinase is important for cancer metabolism and
tumour growth. Nature 452, 230–233.
Ellgaard, L., Molinari, M., and Helenius, A. (1999). Setting the standards:
quality control in the secretory pathway. Science 286, 1882–1888.
Elstrom, R.L., Bauer, D.E., Buzzai, M., Karnauskas, R., Harris, M.H., Plas, D.R.,
Zhuang, H., Cinalli, R.M., Alavi, A., Rudin, C.M., and Thompson, C.B. (2004).
Akt stimulates aerobic glycolysis in cancer cells. Cancer Res. 64, 3892–3899.
Engelman, J.A., Luo, J., and Cantley, L.C. (2006). The evolution of phosphati-
dylinositol 3-kinases as regulators of growth and metabolism. Nat. Rev. Genet.
7, 606–619.
(F) Tumors lysates were extracted after 6 weeks, and aliquots of 20 mg of protein were subjected to 10% SDS-PAGE and transfer to nitrocellulose filter. The filter
was stained with Ponceau S staining (bottom) followed by western blotting analysis using an antibody against ENTPD5 (top).
(G) Time course of tumor shrinkage caused by ENTPD5 knocking down. Tumor size was measured, and statistic analysis was performed as described in the
Extended Experimental Procedures. Each group consisted of seven mice. The values are represented as mean ± SD. *p < 0.05.
(H) Hematoxylin and eosin staining of resected tumors. (Left) Scale bar, 500 um. (Right) Scale bar, 100 um. (Top) Tumor without Dox. (Bottom) Tumor with Dox.
See also Figure S6 and Figure S7.
Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc. 723
Fewell, S.W., Travers, K.J., Weissman, J.S., and Brodsky, J.L. (2001). The
action of molecular chaperones in the early secretory pathway. Annu. Rev.
Genet. 35, 149–191.
Fingar, D.C., Salama, S., Tsou, C., Harlow, E., and Blenis, J. (2002).
Mammalian cell size is controlled by mTOR and its downstream targets
S6K1 and 4EBP1/eIF4E. Genes Dev. 16, 1472–1487.
Franke, T.F., Kaplan, D.R., Cantley, L.C., and Toker, A. (1997). Direct regula-
tion of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphos-
phate. Science 275, 665–668.
Gevers, W., and Krebs, H.A. (1966). The effects of adenine nucleotides on
carbohydrate metabolism in pigeon-liver homogenates. Biochem. J. 98,
720–735.
Helenius, A., and Aebi, M. (2004). Roles of N-linked glycans in the endoplasmic
reticulum. Annu. Rev. Biochem. 73, 1019–1049.
Hirschberg, C.B., Robbins, P.W., and Abeijon, C. (1998). Transporters of
nucleotide sugars, ATP, and nucleotide sulfate in the endoplasmic reticulum
and Golgi apparatus. Annu. Rev. Biochem. 67, 49–69.
Keniry, M., and Parsons, R. (2008). The role of PTEN signaling perturbations in
cancer and in targeted therapy. Oncogene 27, 5477–5485.
Kohn, A.D., Summers, S.A., Birnbaum, M.J., and Roth, R.A. (1996). Expression
of a constitutively active Akt Ser/Thr kinase in 3T3-L1 adipocytes stimulates
glucose uptake and glucose transporter 4 translocation. J. Biol. Chem. 271,
31372–31378.
Lau, K.S., Partridge, E.A., Grigorian, A., Silvescu, C.I., Reinhold, V.N.,
Demetriou, M., and Dennis, J.W. (2007). Complex N-glycan number and
degree of branching cooperate to regulate cell proliferation and differentiation.
Cell 129, 123–134.
Maehama, T., and Dixon, J.E. (1998). The tumor suppressor, PTEN/MMAC1,
dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-tris-
phosphate. J. Biol. Chem. 273, 13375–13378.
Plas, D.R., Talapatra, S., Edinger, A.L., Rathmell, J.C., and Thompson, C.B.
(2001). Akt and Bcl-xL promote growth factor-independent survival through
distinct effects on mitochondrial physiology. J. Biol. Chem. 276, 12041–12048.
Read, R., Hansen, G., Kramer, J., Finch, R., Li, L., and Vogel, P. (2009).
Ectonucleoside triphosphate diphosphohydrolase type 5 (Entpd5)-deficient
mice develop progressive hepatopathy, hepatocellular tumors, and spermato-
genic arrest. Vet. Pathol. 46, 491–504.
Robson, S.C., Sevigny, J., and Zimmermann, H. (2006). The E-NTPDase family
of ectonucleotidases: Structure function relationships and pathophysiological
significance. Purinergic Signal. 2, 409–430.
Stambolic, V., Suzuki, A., de la Pompa, J.L., Brothers, G.M., Mirtsos, C.,
Sasaki, T., Ruland, J., Penninger, J.M., Siderovski, D.P., and Mak, T.W.
(1998). Negative regulation of PKB/Akt-dependent cell survival by the tumor
suppressor PTEN. Cell 95, 29–39.
Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G.F.,
Holmes, A.B., Gaffney, P.R.J., Reese, C.B., McCormick, F., Tempst, P., et al.
(1998). Protein kinase B kinases that mediate phosphatidylinositol 3,4,5-tris-
phosphate-dependent activation of protein kinase B. Science 279, 710–714.
Trombetta, E.S., and Helenius, A. (1999). Glycoprotein reglucosylation and
nucleotide sugar utilization in the secretory pathway: identification of a nucle-
oside diphosphatase in the endoplasmic reticulum. EMBO J. 18, 3282–3292.
Trombetta, E.S., and Parodi, A.J. (2003). Quality control and protein folding in
the secretory pathway. Annu. Rev. Cell Dev. Biol. 19, 649–676.
Vander Heiden, M.G., Cantley, L.C., and Thompson, C.B. (2009).
Understanding the Warburg effect: the metabolic requirements of cell prolifer-
ation. Science 324, 1029–1033.
Warburg, O. (1925). Uber den Stoffwechsel der Carcinomzelle. Klin.
Wochenschr. 4, 534–536.
Whitman, M., Downes, C.P., Keeler, M., Keller, T., and Cantley, L.C. (1988).
Type I phosphatidylinositol kinase makes a novel inositol phospholipid, phos-
phatidylinositol-3-phosphate. Nature 332, 644–646.
Yuan, T.L., and Cantley, L.C. (2008). PI3K pathway alterations in cancer:
variations on a theme. Oncogene 27, 5497–5510.
724 Cell 143, 711–724, November 24, 2010 ª2010 Elsevier Inc.
Stepwise Histone Replacement by SWR1Requires Dual Activation with HistoneH2A.Z and Canonical NucleosomeEd Luk,1,* Anand Ranjan,1 Peter C. FitzGerald,2 Gaku Mizuguchi,1 Yingzi Huang,1 Debbie Wei,1 and Carl Wu1,*1Laboratory of Biochemistry and Molecular Biology2Genome Analysis Unit
National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA
*Correspondence: [email protected] (E.L.), [email protected] (C.W.)DOI 10.1016/j.cell.2010.10.019
SUMMARY
Histone variant H2A.Z-containing nucleosomes areincorporated at most eukaryotic promoters. Thisincorporation is mediated by the conserved SWR1complex, which replaces histone H2A in canonicalnucleosomes with H2A.Z in an ATP-dependentmanner. Here, we show that promoter-proximalnucleosomes are highly heterogeneous for H2A.Z inSaccharomyces cerevisiae, with substantial repre-sentation of nucleosomes containing one, two, orzero H2A.Z molecules. SWR1-catalyzed H2A.Zreplacement in vitro occurs in a stepwise and unidi-rectional fashion, one H2A.Z-H2B dimer at a time,producing heterotypic nucleosomes as intermedi-ates and homotypic H2A.Z nucleosomes as endproducts. The ATPase activity of SWR1 is specificallystimulated by H2A-containing nucleosomes withoutensuing histone H2A eviction. Remarkably, furtheraddition of free H2A.Z-H2B dimer leads to hyperstim-ulation of ATPase activity, eviction of nucleosomalH2A-H2B, and deposition of H2A.Z-H2B. Theseresults suggest that the combination of H2A-contain-ing nucleosome and free H2A.Z-H2B dimer acting asboth effector and substrate for SWR1 governs thespecificity and outcome of the replacement reaction.
INTRODUCTION
The eukaryotic genome is packaged into chromatin within the
cell nucleus. The fundamental packaging unit of chromatin is
the nucleosome, which consists of an octameric histone core
around which 147 base pairs (bp) of DNA are wrapped in �1.7
left-handed superhelical turns, plus linker DNA of variable length
between adjacent nucleosome core particles (Kornberg and
Lorch, 1999). The canonical nucleosome, containing two each
of the four main histones, H2A, H2B, H3, and H4, is representa-
tive of the bulk of chromatin in the cell nucleus. However, a minor
fraction of the nucleosome population is assembled from nonal-
lelic histone variants, which have an important role in major chro-
mosome activities of the cell, including transcription, DNA repli-
cation, and repair (Ausio, 2006).
The widely conserved histone H2A.Z variant shares 60%
sequence identity with the canonical H2A histone and plays
essential, nonredundant roles in higher eukaryotes (Guillemette
and Gaudreau, 2006). In yeasts, H2A.Z is not essential, but cells
exhibit slow growth (Carr et al., 1994; Santisteban et al., 2000),
chromosome instability (Carr et al., 1994; Krogan et al., 2004),
gene silencing defects (Meneghini et al., 2003), and sensitivity
to genotoxic and environmental stress (Jackson and Gorovsky,
2000; Kobor et al., 2004; Mizuguchi et al., 2004). Crystallo-
graphic studies have shown that H2A.Z-containing nucleosomes
are in general structurally similar to canonical nucleosomes but
possess distinct internal and surface features (Suto et al.,
2000). Biophysical studies also reported differences in nucleo-
some stability, positioning, and higher-order interactions
(Zlatanova and Thakar, 2008). Of interest, it has been recently
demonstrated that purified nucleosomes containing both
histone H2A.Z and the histone H3.3 variant are the least stable
among native nucleosomes to salt-induced dissociation
(Jin and Felsenfeld, 2007; Zhang et al., 2005).
Genome-wide mapping of nucleosome distribution indicates
that the vast majority of budding yeast promoters have a stereo-
typical chromatin architecture, characterized by two well-posi-
tioned nucleosomes (+1 and �1) flanking an 80–230 base pair
region that is relatively depleted for histones and is commonly
referred to as the ‘‘nucleosome-free region’’ (NFR) (Cairns,
2009; Jiang and Pugh, 2009b; Weiner et al., 2010). With its
NFR-proximal edge covering the transcription start site (TSS),
the +1 nucleosome acts as a barrier that occludes the TSS and
helps position downstream nucleosomes in the coding region
(Jiang and Pugh, 2009b). Formaldehyde crosslinking and chro-
matin immunoprecipitation (ChIP) experiments conducted on
the budding yeast Saccharomyces cerevisiae first demonstrated
that histone H2A.Z (called Htz1) is enriched at intergenic regions
upstream of PHO5 and GAL1 even under repressed conditions
(Santisteban et al., 2000). It was subsequently shown in
genome-wide studies that H2A.Z is dramatically enriched at
the promoter-proximal +1 and �1 nucleosomes (Albert et al.,
2007; Raisner et al., 2005), with enrichment diminishing progres-
sively away from the promoter (Albert et al., 2007). The presence
Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc. 725
of H2A.Z nucleosomes surrounding most yeast promoters in the
absence of transcription has led to the proposal that H2A.Z-con-
taining nucleosomes help poise genes for transcription (Jin and
Felsenfeld, 2007; Li et al., 2005; Santisteban et al., 2000; Zhang
et al., 2005). In metazoans, H2A.Z is localized to nucleosomes
proximal to promoters of active genes (Rando and Chang,
2009). More recently, H2A.Z has also been implicated in DNA
repair (Morrison and Shen, 2009) and in suppression of spurious
noncoding transcription (Zofall et al., 2009). The molecular func-
tion of H2A.Z in transcription and DNA repair remains obscure.
Previous studies have shown that the 14 subunit S. cerevisiae
SWI/SNF-related SWR1 complex (SWR1) is required for the
incorporation of H2A.Z (Kobor et al., 2004; Krogan et al., 2003;
Mizuguchi et al., 2004). Human counterparts of SWR1, named
SRCAP and p400, have also been identified (Gevry et al., 2007;
Ruhl et al., 2006). SWR1 is itself enriched at promoters, coinci-
dent with the maxima of H2A.Z distribution (Venters and Pugh,
2009). The recruitment of SWR1 to promoters is attributed in
part to the bromodomain-containing Bdf1 subunit of SWR1
and its interaction with acetylated histone H3 and H4 tails (Altaf
et al., 2010; Koerber et al., 2009; Raisner et al., 2005).
How SWR1 carries out the ATP-dependent replacement of
nucleosomal H2A with H2A.Z is not well understood. Studies
from our laboratory have shown that the histone replacement
reaction can be sufficiently reconstituted in vitro with purified
components (Luk et al., 2007; Mizuguchi et al., 2004). This basic
reaction has also been demonstrated with purified components
from mammalian and insect cells and can be enhanced by
acetylation of the nucleosomal substrate (Altaf et al., 2010;
Kusch et al., 2004; Ruhl et al., 2006). In the replacement reaction,
the H2A.Z-H2B dimer is delivered as a unit to SWR1 (Mizuguchi
et al., 2004; Ruhl et al., 2006) specifically to its Swc2 subunit.
Delivery is assisted by an H2A.Z-specific chaperone Chz1,
which is displaced upon H2A.Z-H2B binding (Luk et al., 2007).
A second binding site for H2A.Z-H2B was recently localized to
the N-terminal domain of the Swr1 ATPase subunit (Wu et al.,
2009). The binding of H2A.Z-H2B to SWR1 is independent of
ATP (Wu et al., 2005).
Other important steps of the histone replacement reaction
involve the ATP-dependent eviction of nucleosomal H2A-H2B
and insertion of H2A.Z-H2B. However, the mechanisms by which
these steps are carried out are obscure. It is also unclear whether
SWR1 replaces one or both histone H2A-H2B dimers in a canon-
ical nucleosome with H2A.Z-H2B, producing heterotypic (AZ) or
homotypic (ZZ) H2A.Z-containing nucleosomes. In vitro reconsti-
tution by salt dialysis shows that the two species can be reconsti-
tuted from purified histones and DNA (Chakravarthy et al., 2004;
Suto et al., 2000). Therefore, it is of particular interest to determine
whether promoter-proximal H2A.Z nucleosomes are organized in
the AZ or ZZ state because they are indistinguishable by standard
ChIP procedures (Albert et al., 2007; Raisner et al., 2005). Muta-
tion of the ATP-binding pocket of the Swr1 ATPase subunit and
studies with nonhydrolyzable ATP analogs documented that
ATP hydrolysis is an absolute requirement for the histone
replacement reaction (Mizuguchi et al., 2004). How the ATPase
activity of the SWR1 complex is transduced to the eviction of
H2A-H2B and insertion of H2A.Z-H2B and whether the ATPase
activity is regulated in the course of the reaction are unknown.
In this study, we investigated whether the homotypic and
heterotypic states of H2A.Z-containing nucleosomes are
present at the promoters of budding yeast in vivo. We found
that promoter-proximal nucleosomes are highly heterogeneous
in histone variant composition, with substantial representation
of nucleosomes containing one, two, or zero H2A.Z molecules.
To further understand this phenomenon, we developed an
in vitro assay to distinguish between compositional states and
found that the histone replacement reaction is stepwise and
unidirectional, i.e., progressing from AA (canonical) to AZ to ZZ
nucleosomes. Further investigation of the underlying mechanism
showed that ATP hydrolysis by the SWR1 complex is specifically
activated by H2A-containing nucleosome and additionally by
H2A.Z-H2B dimer, leading to histone replacement. These results
lead to a model in which specific activation of SWR1 by the two
in vivo histone substrates drives the stepwise, unidirectional
pathway of histone H2A.Z replacement.
RESULTS
Both AZ and ZZ Nucleosomes Are Presentin Saccharomyces cerevisiae
To investigate whether budding yeast nucleosomes contain one
or two copies of the H2A.Z variant, we performed coimmunopre-
cipitation (co-IP) analysis with the use of a diploid strain in which
one allele of HTZ1, the gene encoding S. cerevisiae H2A.Z, is left
untagged and the second HTZ1 allele bears a Flag epitope tag
(HTZ1FLAG) to facilitate purification. Cells in asynchronous
culture were fixed with formaldehyde to preserve nucleosome
integrity, and mononucleosomes were generated by MNase
digestion (Figure S1A available online). We immunoprecipitated
Htz1Flag-containing nucleosomes with anti-Flag antibodies and
analyzed their composition by reversal of crosslinking and
western blotting. Probing with anti-Htz1 antibodies showed
that untagged Htz1 copurifies with Htz1Flag, indicating the pres-
ence of homotypic H2A.Z (ZZ) nucleosomes in yeast cells
(Figure 1A). Moreover, reprobing the same blot with anti-H2A
antibodies shows copurification of H2A with Htz1Flag, demon-
strating the existence of heterotypic H2A.Z (AZ) nucleosomes
as well (Figure 1B). Based on the experimentally determined
ratios (Z:ZF = 0.29, Figure 1A; A:ZF = 0.49, Figures 1C and 1D),
we calculated the relative distribution of ZZ and AZ nucleosomes
to be �35% and �65%, respectively (Figure S1B).
In principle, AZ nucleosomes could be generated from AA
nucleosomes by stepwise replacement with H2A.Z-H2B dimers.
This replacement could occur in a replication-independent
manner in all phases of the cell cycle, including the G1 phase
(S. Sen and C.W., unpublished data). In addition, AZ nucleo-
somes could arise as a consequence of disruption of ZZ nucle-
osomes and reassembly with a mixed histone dimer pool during
DNA replication in S phase. The latter contribution can be mini-
mized in our analysis by the use of yeast cells arrested in G1
phase by a-mating factor (Figure 1F). Under these conditions,
a haploid yeast strain carrying Htz1Flag as the sole copy still
exhibits substantial copurification of H2A with Htz1Flag (�75%
compared to asynchronous cells) (Figure 1E).
We measured the relative proportion of H2A.Z to H2A bound to
chromatin in G1-arrested cells by quantitative western blotting
726 Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc.
using purified bacterially expressed Htz1 and H2A as protein
standards (Figures 1G and 1H). Htz1 constitutes �9% of total
H2A-like histones in chromatin, comparable to previous results
obtained for mammalian cells (4%) (West and Bonner, 1980).
ZZ and AZ Nucleosomes Are Enriched at PromotersThe presence of homotypic and heterotypic H2A.Z nucleosomes
in G1-arrested cells prompted us to map their genomic
locations. Both AZ and ZZ nucleosomes could be enriched at
promoters genome-wide, or they could be differentially distrib-
uted among distinct sets of genes. To distinguish between these
possibilities, we used sequential IP to fractionate the heteroge-
neous nucleosome population into three subpopulations
representing ZZ, AZ, and AA nucleosomes. We first immunopuri-
fied Htz1Flag-containing nucleosomes from haploid yeast cells
(expressing Htz1Flag as sole source) with the use of anti-Flag
antibodies to isolate ZZ and AZ nucleosomes in the bound
fraction, followed by secondary IP of the eluate with anti-H2A
antibodies to separate ZZ from AZ nucleosomes (Figure S2A).
Western blotting of bound and flowthrough fractions confirmed
that IP was highly efficient (Figure S2B). In addition, the
flowthrough fraction from the first anti-Flag IP, which is quantita-
Figure 1. Isolation of Homotypic ZZ and
Heterotypic AZ Nucleosomes
(A and B) Histone co-IP analysis of mononucleo-
somes prepared from fixed diploid HTZ1FLAG/
HTZ1 cells (yEL021). (A) The SDS-PAGE and
anti-Htz1 (a-Htz1) western analyses of MNase-
treated nuclear extract (Input), flowthrough of
anti-Flag IP (FT), and anti-Flag immunoprecipi-
tates eluted with Flag peptides (Flag eluate). 20,
10, 5, and 2 ml of the Flag eluate was loaded in
lanes 3, 4, 5, and 6, respectively. Lane 3 was
imaged from a separate western blot. The ratio
of untagged Htz1-to-Htz1Flag for the Flag eluate
is 0.29 ± 0.08 (average and range of two western
analyses). The membrane was stripped and
reprobed with anti-H2A (a-H2A) antibodies in (B).
(C and D) The Flag eluate of (A) was quantified by
a-Htz1 and a-H2A western analyses using
recombinant Htz1 and H2A standards. The esti-
mated molar ratio of H2A to Htz1Flag in the Flag
eluate is 0.49.
(E) Co-IP and western analyses of the Flag eluate
from G1-arrested, asynchronous haploid cells
(yJL036). Numbers indicate quantification of the
Htz1Flag western signal relative to H2A.
(F) FACS analysis ofasynchronous andG1-arrested
cells.
(G and H) Quantification of total H2A and Htz1 poly-
peptides in the nuclear extract (Input) of G1-ar-
rested cells. Asterisk (*) indicates a cross-reactive
band. The two panels in (H) are imaged from the
same western blot.
See also Figure S1.
tively depleted for AZ and ZZ nucleo-
somes, was subjected to additional IP
with anti-H2A to give a bound fraction
highly enriched for AA nucleosomes.We mapped the locations of each distinct nucleosomal pop-
ulation by hybridization of amplified, fluorescently labeled DNA
to oligonucleotide tiling microarrays covering two yeast chro-
mosomes (chromosomes 3 and 6 plus other selected regions),
at 10 bp resolution, for both DNA strands. The results are pre-
sented as normalized ratios of nucleosomal to genomic DNA
fluorescence (Figure 2A and Figure S3). Consistent with
previous studies (Albert et al., 2007; Raisner et al., 2005), we
confirmed that Htz1-containing nucleosomes (Z total) map
predominantly to the promoter-proximal +1 and �1 nucleo-
somes, with enrichment tapering off away from the promoter
(Figure 2). Of interest, we found that the subpopulations of
AZ and ZZ nucleosomes are similarly enriched at most
promoters (Figure 2A). This is especially evident in the normal-
ized average profiles for 466 nucleosomes in the +1 position
(Figure 2B). The relative abundances of AZ and ZZ nucleo-
somes at the +1 location are highly correlated (R = 0.89),
arguing against differential enrichment of AZ or ZZ nucleo-
somes for a specific subset of promoters (Figure S2C). The
average AZ and ZZ nucleosome profiles surrounding the
promoter region also show differences. ZZ nucleosome enrich-
ment is more restricted to the �1 and +1 positions, whereas AZ
Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc. 727
enrichment is comparatively lower and declines more gradually
away from the promoter (Figure 2B).
Substantial Presence of AA Nucleosomes at PromotersPrevious studies of H2A.Z enrichment at promoters genome-
wide did not include canonical (AA) nucleosomes, which are
commonly assumed to be depleted at promoters. To test this
assumption, we determined the genomic distribution of the puri-
fied AA nucleosome subpopulation on tiling microarrays
(Figure S2A). As anticipated, the normalized AA nucleosome
distribution is similar to that observed for the total nucleosome
pool (total) (Figures 2A and 2B and Figure S3). However, the abun-
dance of AA nucleosomes at promoters is surprisingly substan-
tial, despite enrichment of the ZZ and AZ variants. This is espe-
cially evident at the �1 and +1 nucleosome positions, where
H2A.Z is thought to be predominant but in fact exhibits a similar
abundance to canonical H2A (Figure 2B). We conclude that
steady-state histone variation at promoter-proximal nucleo-
somes is quite heterogeneous in a population of budding yeast,
showing significant levels of both variant and canonical nucleo-
somes. Clustering analysis of H2A.Z nucleosome distributions
for the TATA-containing and TATA-less promoters shows that
histone heterogeneity appears to be a common feature of most
yeast promoters, irrespective of gene category (Figure S2D).
SWR1 Generates Nucleosomal AZ Intermediate and ZZEnd Product In VitroThe steady-state level of H2A.Z at promoter-proximal nucleo-
somes is a product of opposing H2A.Z assembly and disas-
sembly pathways in vivo. Incorporation of H2A.Z in nucleosomes
Figure 2. Genomic Distribution of the AA, AZ, and ZZ Nucleosomes
(A) Tiling microarray data of a representative region in chromosome 3 showing the genomic distribution of the Z total (orange), ZZ (green), AZ (purple), AA (red),
and total (blue) nucleosomes. The data are presented as the normalized ratio of nucleosomal and genomic DNA signals. Gray bars indicate coding regions.
(B) Normalized average nucleosome distribution in and around the +1 nucleosome center of 466 genes (Jiang and Pugh, 2009a). Circles illustrate the estimated
positions of the �1, +1, +2, +3, and +4 nucleosomes.
See also Figure S2 and Table S2.
728 Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc.
is catalyzed by the SWR1 chromatin remodeling complex, which
could convert AA nucleosomes to the ZZ state by replacing both
nucleosomal H2A-H2B dimers with Htz1-H2B in a concerted
reaction. Alternatively, SWR1 could replace the H2A-H2B dimers
in a stepwise manner involving AZ nucleosomes as a reaction
intermediate. To distinguish these models, we developed
a new histone replacement assay.
In this assay, immobilized arrays of canonical nucleosomes
are incubated with SWR1 purified from an htz1D strain,
Htz1Flag-H2B dimers, and ATP as previously described (Fig-
ure 3A). The chromatin product is then subjected to MNase
digestion to liberate mononucleosomes. Because Htz1 bears
a 33Flag epitope tag, replacement of one nucleosomal H2A-
H2B dimer with Htz1Flag-H2B retards the native electrophoretic
mobility of the nucleosome, and replacement of two dimers
retards the mobility further. Thus, in an ATP-dependent, limited
replacement reaction, three nucleosomal species with discrete
mobility can be resolved by nondenaturing PAGE (Figures 3A
and 3B). We examined the identities of each nucleosome
species by western blotting and confirmed that the top, middle,
and bottom gel bands correspond to ZZ nucleosomes with two
Flags (ZFZF), AZ nucleosomes with one Flag (AZF), and AA nucle-
osomes, respectively (Figure S4A).
The detection of AZ nucleosomes in a partial replacement
reaction suggests that the heterotypic H2A.Z nucleosome may
be a reaction intermediate. To investigate this possibility, we
monitored the progression of the SWR1-catalyzed replacement
reaction in vitro. Consistent with the hypothesis, we found that
the AZ species briefly accumulates upon the addition of ATP,
reaching a maximum at 30 min, followed by a gradual decrease
over time (Figure 3C and Figure S4B). By contrast, the ZZ
Figure 3. In Vitro Assay Showing the Step-
wise Assembly of AZ and ZZ Nucleosomes
(A and B) Overview and experiment for the in vitro
histone replacement assay. Bead-bound canon-
ical nucleosome arrays (depicted with three nucle-
osomes for simplicity) were incubated with
Htz1Flag-H2B dimer (chaperoned by Chz1, not de-
picted), SWR1, and ATP for 1 hr (step 1). After
washing, the chromatin was digested with MNase
to liberate mononucleosomes (step 2), which were
subsequently analyzed by nondenaturing PAGE
(step 3). AA (bottom), AZF (middle), and ZFZF
(top) nucleosomes were detected by SYBR green
staining.
(C) In vitro histone replacement time course.
SWR1-mediated histone replacement reactions
were stopped at various times by bead pull-
down and washing. Nucleosomal products were
analyzed as described in (A). (Middle) Densito-
metric measurement of the indicated gel region.
(Right) Peak height versus time.
species continues to accumulate past
30 min, reaching a plateau where ZZ
nucleosomes represent the bulk of the
nucleosome population, and AA nucleo-
somes are correspondingly diminished
to a minor fraction (Figure 3C and Fig-
ure S4B). Thus, reaction kinetics suggests that SWR1 converts
AA nucleosomes to the AZ and ZZ species in a stepwise manner.
Data of the above experiment do not inform whether a fully
replaced ZZ nucleosome is the reaction end product or
a substrate for additional rounds of H2A.Z replacement (i.e.,
H2A.Z replacing H2A.Z). We addressed this question by first
generating a mixed population of immobilized AA, AZ, and ZZ
nucleosomes by a partial replacement reaction in which Htz1-
H2B dimers provided to SWR1 bear a fluorescent Alexa633 label
on Htz1 and a Flag tag on H2B (Htz1Alexa-H2BFlag dimers) (Fig-
ure 4A). (Analysis of an aliquot by MNase digestion confirms
that mononucleosome products exhibit retarded electrophoretic
mobility and Alexa633 fluorescence depending on the extent of
replacement—the bottom band corresponding to unreplaced
nucleosomes, and the middle and top bands to nucleosomes
containing one and two Htz1Alexa-H2BFlag dimers, respectively
[Figures 4A and 4B, lane I].) A second round of SWR1-mediated
histone replacementusing untagged, unlabeled Htz1-H2B dimers
enabled us to evaluate whether the two Htz1Alexa-H2BFlag dimers
in the ZZ nucleosome were replaceable, as shown by a loss of
Alexa633 fluorescence, SYBR green staining, and Htz1 content
in the top nucleosome band (Figure 4A). However, all three indica-
tors remained essentially unchanged after the second SWR1
reaction, indicating that SWR1 does not catalyze replacement
of ZZ nucleosomes with new H2A.Z-H2B dimers (Figure 4B).
This experiment also permitted us to confirm directly that the
heterotypic AZ nucleosome (middle band) is a substrate for
SWR1-catalyzed histone replacement by virtue of a potential
increase in Htz1 content without a change in electrophoretic
mobility (Figures 4A and 4B, lane II). We found that the middle
band indeed shows a major increase in the Htz1 western blotting
Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc. 729
signal, demonstrating that the AZ nucleosome, like the AA nucle-
osome (bottom band) is a substrate for SWR1 activity (Figure 4B,
bottom, lane II). Taken together, these results provide compel-
ling evidence that the AZ and ZZ nucleosomes are a bona fide
intermediate and end product, respectively, of the SWR1-medi-
ated histone replacement reaction.
No Reverse Replacement of ZZ Nucleosomes with H2A-H2B DimersWe confirmed that SWR1 does not replace ZZ nucleosomes with
H2A.Z-H2B dimers using immobilized ZZ nucleosome arrays
reconstituted from bacterially expressed histones. Incubation
of these arrays with Flag-tagged histone dimers, SWR1, and
ATP showed that SWR1 failed to replace ZZ nucleosomes with
Htz1Flag-H2B dimers even when dimers were in excess relative
to nucleosomes (Figure 4C).
Next, we examined whether AZ and AA nucleosomes could be
produced from the ZZ species though a reverse reaction by incu-
bation of immobilized ZZ nucleosome arrays with excess
H2AFlag-H2B dimers, SWR1, and ATP. This reaction also failed
to produce detectable incorporation of H2AFlag above back-
ground in the bead-bound chromatin fraction (Figure 4D). We
also tested whether the related INO80 remodeling complex
could mediate a reverse replacement reaction and found no
detectable ATP-driven exchange of H2AFlag into ZZ nucleosomal
arrays under reaction conditions (Figure 4D). Thus, other mech-
anisms may be responsible for the displacement of H2A.Z and
reassembly of the canonical nucleosome. By contrast, incuba-
tion of AA nucleosome arrays with saturating H2A-H2B dimers
(60 nM) gave a small but reproducible level of ATP-dependent
incorporation of H2AFlag into chromatin (Figure 4E), consistent
with previous findings (Mizuguchi et al., 2004). We conclude
that the histone replacement pathway mediated by SWR1 is
unidirectional, with strong substrate specificity for H2A-contain-
ing nucleosomes and the Htz1-H2B dimer.
Canonical Nucleosomes Specifically Stimulate SWR1ATPaseHistone variant replacement by the multicomponent SWR1
complex involves interaction with at least three essential
substrates: ATP, the H2A-containing nucleosome, and the
Htz1-H2B dimer. The differential utilization of H2A-containing
nucleosomes suggests that SWR1 recognizes H2A- over
H2A.Z-containing nucleosomes. Specific recognition could be
Figure 4. AA or AZ Nucleosomes Together with Htz1-H2B Dimer Are the Specific Substrates for SWR1
(A and B) Overview and experiment for the in vitro histone replacement assay. Nucleosomal arrays bearing a mixed population of AA, AZ, and ZZ nucleosomes
were marked with Htz1Alexa-H2BFlag dimers. After incubating with unlabeled, untagged Htz1-H2B, SWR1, and ATP, two potential scenarios depicted in II and III
could occur. (B) is the experiment. (Red) Htz1Alexa. (Flag) H2BFLAG. (Scan) Densitometric analysis of the a-Htz1 western blot.
(C–E) Standard histone replacement assay (Mizuguchi et al., 2004). Immobilized AA or ZZ nucleosomal arrays were incubated with SWR1 (or INO80), native Flag-
epitope-tagged histone dimers, and ATP where indicated. 60 nM of dimers and �15 nM nucleosome equivalents were used. The arrays were washed with 0.4 M
KCl before SDS elution and western analysis. (Top) SDS-eluted fraction of the chromatin-bound histones. (Bottom) Free histones in the supernatant fraction. AA
and ZZ ovals indicate the type of nucleosomal arrays used. ZF/B, Htz1Flag-H2B dimer; AF/B, H2AFlag-H2B dimer.
See also Figure S3.
730 Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc.
a consequence of differential nucleosome binding and/or activa-
tion of the ATPase activity of SWR1. We examined whether AA
and ZZ nucleosomes differentially stimulate the ATPase activity
of SWR1 with the use of a real-time fluorescence assay that
monitors production of inorganic phosphate from ATP hydrolysis
(Brune et al., 1994).
Previously, we reported that the SWR1 complex exhibits
nucleosome-stimulated ATPase activity as shown by hydrolysis
of P32-ATP (Mizuguchi et al., 2004). This was confirmed by the
fluorescence assay, which shows strong stimulation of ATP
hydrolysis by conventional nucleosomes, and not by naked
DNA (Figure 5A and Figure S5A). Analysis of initial rates indicates
an �2.5-fold increase of ATP hydrolysis at saturating nucleo-
some and ATP levels. Strikingly, similar concentrations of ZZ
nucleosomes failed to stimulate the ATPase activity of the
SWR1 complex (Figure 5A and Figure S5A). This demonstrates
that SWR1 can functionally discriminate between conventional
and variant nucleosomes. By contrast, INO80 and SWI/SNF
exhibit no differential stimulation of ATPase activity by saturating
levels of AA and ZZ nucleosomes (Figures 5B and 5C and Fig-
ure S5). Of interest, both free H2A-H2B and Htz1-H2B dimers
failed to stimulate the ATPase activity of SWR1 in the absence
Figure 5. AA, but Not ZZ, Nucleosomes Stimulate SWR1 ATPase
(A–C) ATPase assay for chromatin remodelers. Inorganic phosphate (Pi) produced during ATP hydrolysis was monitored in real time by MDCC-PBP, which
increases in fluorescence upon phosphate binding (Brune et al., 1994). Reactions were performed at 23�C in the absence (orange) or presence of 15 nM AA nucle-
osomes (red), ZZ nucleosomes (green), or free DNA (blue). ATP was added �20 s before the first measurement (zero time) to final concentrations of 62.5 mM for
SWR1 and 500 mM for INO80 and SWI/SNF. Relative fluorescence was set as zero at zero time for all reactions.
(D) ATPase assay for SWR1 in the absence (orange) or presence of 15 nM recombinant Htz1-H2B dimers (Z/B, black), H2A-H2B dimers (A/B, gray), or AA nucle-
osomes (red).
(E) ATPase assay for SWR1 in the presence of AA nucleosomes and various ATP concentrations. Phosphate concentrations (calculated based on a linear phos-
phate standard curve) were plotted against time. Initial rate (vo) was determined by the slope of the linear part of each curve (0–300 s).
(F and G) Plots of initial rate versus substrate (ATP) concentrations for 1 nM SWR1 and 0.1 nM INO80 in the presence or absence of 15 nM AA nucleosomes, ZZ
nucleosomes, or DNA. The kinetic parameters Vmax and KM were determined by nonlinear fitting of the Michaelis-Menten curve over plotted values.
(H) Turnover number kcat (obtained from dividing Vmax by total enzyme concentration) and KM for the ATPase of SWR1, INO80, and SWI/SNF in the presence or
absence of 15 nM AA nucleosomes, ZZ nucleosomes, or DNA. Error bars represent the range of two measurements.
See also Figure S5.
Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc. 731
of nucleosomes, suggesting that H2A-specific recognition must
be in the context of nucleosome architecture (Figure 5D).
We determined kinetic parameters for ATP hydrolysis by the
SWR1 complex (Figures 5E, 5F, and 5H). SWR1 has an enzyme
turnover rate (kcat) of 0.1 s�1 in the presence or absence of DNA.
The kcat remains essentially the same when SWR1 is incubated
with ZZ nucleosomes but increases to 0.25 s�1 (2.5-fold) with
saturating AA nucleosomes (Figures 5F and 5H). Hence, binding
of H2A-containing nucleosomes to SWR1 stimulates ATPase
activity by increasing the catalytic efficiency of the enzyme.
Figure 6. Further Binding of H2A.Z-H2B Dimer Hy-
peractivates SWR1 ATPase and Evicts Nucleo-
somal H2A-H2B
(A) Standard histone replacement assay (Mizuguchi et al.,
2004). Immobilized AA nucleosomal arrays (reconstituted
with H2AHA histone) were incubated with SWR1,
Htz1Flag-H2B (Z/B), histone chaperones, and ATP where
indicated. (Top) Western analyses of chromatin-bound
histones eluted by SDS. (Bottom) Western analyses of
unincorporated histones. 22 nM of Chz1 or FACT was
added to facilitate possible histone eviction.
(B) ATPase assay for SWR1 in the presence of 15 nM AA
nucleosomes and 15 nM Htz1-H2B dimers (purple). Red
is the AA only control.
(C) Kinetic parameters of SWR1 ATPase in the presence of
15 nM AA nucleosomes and 15 nM Htz1-H2B dimers
(purple). For comparison, the curve and parameters for
AA alone (red) are reproduced from Figures 5H and 5F,
respectively. Errors represent the range of two measure-
ments.
(D) Specificity of SWR1 ATPase hyperstimulation. ATPase
assay was performed as described in Figure 5A except
with different combinations of nucleosomes (Nuc) and
histone dimers. Z/B, Htz1-H2B dimers; A/B, H2A-H2B
dimers; AA, AA nucleosomes; ZZ, ZZ nucleosomes; (–)
control, no dimer or nucleosome.
See also Figure S6.
The Michaelis constant (KM), which represents
the ATP concentration at half maximal velocity
(1/2 Vmax), shows little change for canonical
and variant nucleosomes (5 mM and 7 mM,
respectively). In comparison, the stimulated
SWI/SNF has a kcat of 5.5 s�1 and KM of 80.5
mM, values consistent with previous determina-
tions (Smith and Peterson, 2005) (Figure 5H).
Nucleosome Stimulation of SWR1ATPase Is Not Sufficient for H2A-H2BEvictionThe stimulation of SWR1 ATPase by incubation
with conventional nucleosomes raised the
question of whether such ATP hydrolysis would
be sufficient for eviction of the nucleosomal
H2A-H2B dimer to facilitate Htz1-H2B deposi-
tion. To test this hypothesis, we incubated
SWR1 with immobilized arrays of conventional
nucleosomes carrying epitope-tagged histone
H2AHA and monitored H2AHA-H2B eviction in the supernatant
fraction by western blotting. Whereas the SWR1-catalyzed
Htz1 replacement reaction in the presence of Htz1-H2B dimer
(and histone chaperone) occurs robustly with quantitative evic-
tion of H2AHA, we did not detect any eviction of histone H2AHA
in the absence of Htz1Flag-H2B dimer (Figure 6A). Thus, the stim-
ulation of ATP hydrolysis provided solely by canonical nucleo-
some effector is inadequate for eviction of nucleosomal
H2A-H2B. Moreover, eviction of H2A-H2B and insertion of
Htz1-H2B appear to be coupled processes.
732 Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc.
Htz1-H2BDimer andCanonical NucleosomeSpecificallyActivate SWR1The requirement for free Htz1-H2B dimers for SWR1-mediated
H2A.Z replacement prompted us to investigate whether addition
of Htz1-H2B to SWR1 further increases ATP hydrolysis. Indeed,
we observed a clear hyperstimulation of the ATPase activity of
SWR1 when saturating Htz1-H2B dimers (15 nM), and canonical
nucleosomes are both provided to SWR1 in the reaction (Figures
6B and 6D). The hyperstimulated ATPase activity exhibits a kcat
of 0.45 s�1, which represents an additional 1.8-fold increase in
the kcat relative to the stimulation by nucleosomes only (a 4.1-
fold increase in total), with little change of KM (Figure 6C). We
observed less hyperstimulation when H2A-H2B dimers were
substituted for Htz1-H2B at the same molar concentration
(Figure 6D, left). Importantly, a 4-fold increase of H2A-H2B
dimers (�60 nM) hyperstimulated ATPase activity to nearly
maximal level (Figure 6D, right), whereas hyperstimulation of
the ATPase activity upon addition of Htz1-H2B or H2A-H2B
dimers (at either concentration) to ZZ nucleosomes was much
lower (Figure 6D). Given that incorporation of new H2A in canon-
ical nucleosomal arrays is low (Figure 4E) under conditions
wherein ATPase activity is high, these findings indicate that
high ATPase activity per se is not sufficient for histone replace-
ment. It is the presence of the correct in vivo substrates that
ensures efficient coupling of the high ATPase activity to histone
replacement.
DISCUSSION
The steady-state level of H2A.Z at promoter-proximal nucleo-
somes is a consequence of the opposing pathways of H2A.Z
incorporation and H2A.Z eviction. Our observation of three
distinct variant states of promoter nucleosomes in a cell popu-
lation is complementary to previous mapping studies of H2A.Z
in budding yeast (Albert et al., 2007; Raisner et al., 2005; San-
tisteban et al., 2000). The comparable representation of AA
and ZZ states suggests that the AA-to-ZZ and ZZ-to-AA path-
ways are balanced for many genes, without one pathway domi-
nating. However, this balance can be shifted, for example, at
highly transcribed promoters (top 10% RNA Pol II occupancy)
in which the ZZ and AZ states are underrepresented relative
to the AA state for the +1 nucleosome position (Figure S2E),
suggesting that H2A.Z eviction is occurring at a faster rate
than incorporation. The greater restriction of the ZZ than AZ
state to +1 and �1 nucleosome positions is interesting and
may be a consequence of the stepwise nature of the histone
replacement reaction and the local concentration of SWR1
recruited to gene promoters (Venters and Pugh, 2009; Yoshida
et al., 2010).
Our in vitro studies show that SWR1 is capable of stepwise
deposition of H2A.Z-H2B into canonical nucleosomes, coupled
with H2A-H2B eviction, to give a fully replaced variant nucleo-
some. However, once incorporated, H2A.Z cannot be evicted
by SWR1, even in excess of either H2A.Z-H2B or H2A-H2B
dimers under otherwise identical reaction conditions. Therefore,
the SWR1-mediated pathway of H2A.Z replacement is unidirec-
tional, terminating with ZZ nucleosomes. It is possible that
a reverse reaction from the ZZ to AA nucleosome state requires
different conditions, cofactors, or modifications of the SWR1
enzyme or histone substrates. Alternatively, a return to the AA
state may occur through separate pathways. For example, other
SWI/SNF family members might possess the capability for
specific replacement of nucleosomal H2A.Z-H2B with H2A-
H2B, but we have not observed such activity for INO80,
a chromatin remodeling complex paralogous to SWR1, under
conditions in which INO80 displays robust nucleosome- or
DNA-stimulated ATPase and histone octamer sliding activities
(Figure 5, Figure S5, and unpublished data).
More likely, the well-documented high histone H3 turnover
rate at promoters implies promoter-specific nucleosome
disassembly, i.e., eviction of H2A.Z-H2B and H3-H4, and subse-
quent nucleosome reassembly with new histones (Dion et al.,
2007; Rufiange et al., 2007), thereby completing the dynamic
cycling of H2A and H2A.Z at gene promoters (Figure 7A).
These processes are likely to be mediated by a combination of
SWI/SNF family enzymes (Barbaric et al., 2007; Gutierrez
Figure 7. A Model for SWR1-Mediated
Histone Replacement
(A) Promoter nucleosome cycle. An AA nucleo-
some at the +1 promoter-proximal position is con-
verted to the AZ and ZZ states by SWR1 via a step-
wise, unidirectional pathway. The ZZ nucleosome
is subsequently converted back to the AA state
through pathways most likely involving nucleo-
some eviction and reassembly with an AA nucleo-
some (dotted gray arrows).
(B) SWR1 catalytic cycle. SWR1 stochastically
binds to one face of an AA nucleosome and the
H2A.Z-H2B dimer, leading to hyperstimulation of
ATPase activity (deep red) and a conformational
change in SWR1 (shown) required for histone
replacement. The newly incorporated Z face of
the AZ nucleosome deactivates the ATPase and
stops further histone replacement activity. The
AZ nucleosome dissociates and rebinds stochas-
tically on the A face for a second replacement
reaction.
Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc. 733
et al., 2007; Lorch et al., 2006), RNA polymerase (Weiner et al.,
2010), and core histone chaperones (Corpet and Almouzni,
2009; Das et al., 2010). In addition, the in vivo lability of H2A.Z-
containing nucleosomes as reflected in salt sensitivity should
also contribute (Henikoff et al., 2009; Jin and Felsenfeld, 2007;
Zhang et al., 2005). Indeed, histone modifications at promoters
correlate with the signatures of newly deposited histones, such
as H3K56Ac and H4K16 deAc (Rando and Chang, 2009).
The directional nature of the H2A.Z replacement pathway
implies that SWR1 must functionally differentiate between ZZ
and AA (or AZ) nucleosomes. We have traced this differentiation,
at least in part, to a specific, 2.5-fold increase of the ATPase
activity (kcat) of SWR1 induced by AA, but not ZZ, nucleosomes.
However, this level of stimulation is insufficient for the eviction of
H2A-H2B from nucleosomes. Only after further addition of free
H2A.Z-H2B dimers is the ATPase activity of SWR1 hyperstimu-
lated (4-fold increase of kcat), concurrent with H2A-H2B eviction
and H2A.Z-H2B deposition. However, a hyperstimulated SWR1
ATPase is only necessary, but not sufficient, to mediate robust
histone replacement, as saturating free H2A-H2B dimers can
hyperstimulate SWR1 ATPase to nearly maximal level but with
substantially reduced histone replacement (Figure 4E and Fig-
ure 6D). This finding implies that unique features of H2A.Z-H2B
dimer, in addition to stimulating ATP hydrolysis, enhance histone
replacement by allosterically coupling the ATPase motor to
histone transactions. This additional molecular specificity seems
biologically necessary, given that H2A-H2B dimers should be in
excess over H2A.Z-H2B dimers in vivo.
Overall, our data suggest a model in which SWR1 binding to
and recognition of its two in vivo histone substrates (one face
of the AA nucleosome and the H2A.Z-H2B dimer) lead to hyper-
stimulation of ATPase activity as well as a conformational
change in SWR1 required for displacement of H2A-H2B and
insertion of H2A.Z-H2B (Figure 7B). The order of SWR1 binding
to nucleosomes and H2A.Z-H2B dimers should be stochastic.
The newly incorporated Z face of the AZ nucleosome deactivates
the ATPase and stops further histone replacement. The AZ
nucleosome subsequently dissociates from and reassociates
with SWR1 in a stochastic fashion (Figures 7B and 7C). In the
second round, recognition by SWR1 of the A face of the AZ
nucleosome and new H2A.Z-H2B dimer binding restimulates
SWR1 activity to catalyze replacement of the remaining nucleo-
somal H2A-H2B with H2A.Z-H2B. Functional recognition of the A
face of an AA or AZ nucleosome and the requirement for free
H2A.Z-H2B dimer ensures that only these effectors, which are
also substrates for SWR1, are productively utilized. This
provides a way of controlling the specificity and outcome of
the replacement reaction, which terminates with the ZZ
nucleosome.
The SWR1 complex contains multiple ATP-binding subunits,
including Swr1, actin, actin-related proteins Arp4 and Arp6,
and the Rvb1-Rvb2 dodecamer, members of the AAA+ family
of ATPases (Jha and Dutta, 2009; Mizuguchi et al., 2004). We
have previously found that a mutation (K727G substitution) in
the ATP-binding motif of the Swr1 subunit is sufficient to
abrogate Htz1 replacement in vivo and in vitro without affecting
assembly of the SWR1 complex (Mizuguchi et al., 2004). The
ATPase activity of the purified mutant enzyme is neither stimu-
lated by AA nucleosomes nor hyperstimulated by further addition
of Htz1-H2B dimer (Figure S6). These findings indicate that the
Swr1 ATPase is the key subunit whose activity is governed,
directly and/or indirectly, by the histone effectors.
It will be interesting to define the molecular determinants
within the canonical nucleosome and the H2A.Z-H2B dimer
that are specifically recognized by the SWR1 complex, to identify
the SWR1 components interacting with the nucleosome, and to
follow the fate of the evicted H2A-H2B dimer. Other questions
are the importance of the two Htz1-binding modules in SWR1
(Swc2 and the N terminus of the Swr1 subunit itself); the relation-
ship between ATPase activity, DNA translocase activity, and un-
wrapping of nucleosomal DNA; the timing and coupling of H2A
eviction and H2A.Z insertion; and the structural transformations
of SWR1 that accompany these events. Our present findings and
the biochemical assays that we have developed should facilitate
future investigations on the mechanism of histone H2A.Z
replacement.
EXPERIMENTAL PROCEDURES
Immunopurification of AA, AZ, and ZZ Nucleosomes
Crude chromatin was isolated from formaldehyde-fixed yeast cells as
described in Liang and Stillman (1997) and digested with MNase to mononu-
cleosomal level. Sequential IP was performed with the use of anti-Flag M2
agarose (Sigma) and anti-H2A antibodies (Active Motif) bound to nProtein A
Sepharose (GE Healthcare).
Amplification and Labeling of Nucleosomal DNA for Microarray
Analysis
Nucleosomal DNA and MNase-treated genomic DNA control were treated with
alkaline phosphatase (CIP, NEB) and end-repair enzyme mix (End-It kit, Epi-
centre) before being amplified by ligation-mediated PCR (Johnson et al.,
2008). Labeling was performed using the BioPrime Plus labeling kit (Invitrogen)
according to the manufacturer’s protocol.
Microarrays
Custom tiling microarrays were designed based on the Agilent 4 3 180K plat-
form. Each microarray contained �150,000 biological probes spanning
selected genomic regions. The tiling probes were spaced, on average, 10 bp
apart and covered both the sense and antisense DNA strands.
Normalization ofMicroarray Data for Different Nucleosomal Species
Given that Htz1 is the only H2A variant in budding yeast, normalization of mi-
croarray data was performed based on the assumptions that, to a first approx-
imation, the sum of Z total and AA nucleosomes is equal to the total nucleo-
some signal and that the sum of AZ and ZZ nucleosomes is equal to the Z
total nucleosome signal. Details are provided in Figure S3 and legend.
In Vitro Histone Replacement Assay
The SWR1 histone replacement assay was performed according to Mizuguchi
et al. (2004) except the immobilized nucleosomal arrays (80 ng DNA equiva-
lents) were digested with 0.16 U/ml MNase (+ 2 mM CaCl2) to liberate the nucle-
osomes. The reactions were stopped with 10 mM EDTA before analysis by
nondenaturing PAGE.
In Vitro Histone Replacement Assay Using Fluorescently Labeled
Htz1-H2B Substrate
To generate the mixed AA, AZ, and ZZ nucleosomal substrate for the experi-
ment in Figure 4B, AA nucleosomal arrays were incubated with SWR1 pre-
charged with Htz1Alexa-H2BFlag and with Htz1-H2BFlag. The resulting chromatin
had comparable levels of AA, AZ, and ZZ nucleosomes, which also exhibited
comparable Alexa633 fluorescence for the AZ and ZZ nucleosomal species. In
the chase step, the labeled nucleosomes were incubated with SWR1
734 Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc.
precharged with the unlabeled, untagged Htz1-H2B. After washing, the nucle-
osomal products were released by MNase digestion and analyzed by nonde-
naturing PAGE as described above.
ATPase Assay
ATPase assay was performed based on the procedure described in Brune
et al. (1994). In this assay, inorganic phosphate (Pi) produced during ATP
hydrolysis is monitored by the fluorophore-modified phosphate-binding
protein MDCC-PBP (Phosphate Sensor, Invitrogen), which increases in fluo-
rescence upon Pi binding. Measurements were performed at 23�C on a Wallac
Victor plate reader using a 405 nm excitation, 460 nm emission filter set.
ACCESSION NUMBERS
The GEO accession number for the microarray data sets is GSE24618.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures, six
figures, and three tables and can be found with this article online at doi:10.
1016/j.cell.2010.10.019.
ACKNOWLEDGMENTS
We thank W.H. Wu for the yeast strain SWR1-FL htz1D and J. Landry for the
yeast strain yJL036. We also thank H. Cam and C. Rubin for advice on micro-
array techniques, F. Pugh and members of the Wu lab for critical reading of the
manuscript, and anonymous reviewers for helpful suggestions. This work was
supported by the intramural research program of the National Cancer Institute
(C.W.) and by the Leukemia and Lymphoma Society (E.L. and A.R.).
Received: May 27, 2010
Revised: August 25, 2010
Accepted: October 12, 2010
Published: November 24, 2010
REFERENCES
Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and
Pugh, B.F. (2007). Translational and rotational settings of H2A.Z nucleosomes
across the Saccharomyces cerevisiae genome. Nature 446, 572–576.
Altaf, M., Auger, A., Monnet-Saksouk, J., Brodeur, J., Piquet, S., Cramet, M.,
Bouchard, N., Lacoste, N., Utley, R.T., Gaudreau, L., and Cote, J. (2010).
NuA4-dependent acetylation of nucleosomal histones H4 and H2A directly
stimulates incorporation of H2A.Z by the SWR1 complex. J. Biol. Chem.
285, 15966–15977.
Ausio, J. (2006). Histone variants—the structure behind the function. Brief.
Funct. Genomics Proteomics 5, 228–243.
Barbaric, S., Luckenbach, T., Schmid, A., Blaschke, D., Horz, W., and Korber,
P. (2007). Redundancy of chromatin remodeling pathways for the induction of
the yeast PHO5 promoter in vivo. J. Biol. Chem. 282, 27610–27621.
Brune, M., Hunter, J.L., Corrie, J.E., and Webb, M.R. (1994). Direct, real-time
measurement of rapid inorganic phosphate release using a novel fluorescent
probe and its application to actomyosin subfragment 1 ATPase. Biochemistry
33, 8262–8271.
Cairns, B.R. (2009). The logic of chromatin architecture and remodelling at
promoters. Nature 461, 193–198.
Carr, A.M., Dorrington, S.M., Hindley, J., Phear, G.A., Aves, S.J., and Nurse, P.
(1994). Analysis of a histone H2A variant from fission yeast: evidence for a role
in chromosome stability. Mol. Gen. Genet. 245, 628–635.
Chakravarthy, S., Bao, Y., Roberts, V.A., Tremethick, D., and Luger, K. (2004).
Structural characterization of histone H2A variants. Cold Spring Harb. Symp.
Quant. Biol. 69, 227–234.
Corpet, A., and Almouzni, G. (2009). Making copies of chromatin: the challenge
of nucleosomal organization and epigenetic information. Trends Cell Biol. 19,
29–41.
Das, C., Tyler, J.K., and Churchill, M.E. (2010). The histone shuffle: histone
chaperones in an energetic dance. Trends Biochem. Sci. 35, 476–489.
Dion, M.F., Kaplan, T., Kim, M., Buratowski, S., Friedman, N., and Rando, O.J.
(2007). Dynamics of replication-independent histone turnover in budding
yeast. Science 315, 1405–1408.
Gevry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L.
(2007). p21 transcription is regulated by differential localization of histone
H2A.Z. Genes Dev. 21, 1869–1881.
Guillemette, B., and Gaudreau, L. (2006). Reuniting the contrasting functions of
H2A.Z. Biochem. Cell Biol. 84, 528–535.
Gutierrez, J.L., Chandy, M., Carrozza, M.J., and Workman, J.L. (2007). Activa-
tion domains drive nucleosome eviction by SWI/SNF. EMBO J. 26, 730–740.
Henikoff, S., Henikoff, J.G., Sakai, A., Loeb, G.B., and Ahmad, K. (2009).
Genome-wide profiling of salt fractions maps physical properties of chromatin.
Genome Res. 19, 460–469.
Jackson, J.D., and Gorovsky, M.A. (2000). Histone H2A.Z has a conserved
function that is distinct from that of the major H2A sequence variants. Nucleic
Acids Res. 28, 3811–3816.
Jha, S., and Dutta, A. (2009). RVB1/RVB2: running rings around molecular
biology. Mol. Cell 34, 521–533.
Jiang, C., and Pugh, B.F. (2009a). A compiled and systematic reference map of
nucleosome positions across the Saccharomyces cerevisiae genome.
Genome Biol. 10, R109.
Jiang, C., and Pugh, B.F. (2009b). Nucleosome positioning and gene regula-
tion: advances through genomics. Nat. Rev. Genet. 10, 161–172.
Jin, C., and Felsenfeld, G. (2007). Nucleosome stability mediated by histone
variants H3.3 and H2A.Z. Genes Dev. 21, 1519–1529.
Johnson, D.S., Li, W., Gordon, D.B., Bhattacharjee, A., Curry, B., Ghosh, J.,
Brizuela, L., Carroll, J.S., Brown, M., Flicek, P., et al. (2008). Systematic eval-
uation of variability in ChIP-chip experiments using predefined DNA targets.
Genome Res. 18, 393–403.
Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jen-
nings, J.L., Link, A.J., Madhani, H.D., and Rine, J. (2004). A protein complex
containing the conserved Swi2/Snf2-related ATPase Swr1p deposits histone
variant H2A.Z into euchromatin. PLoS Biol. 2, E131.
Koerber, R.T., Rhee, H.S., Jiang, C., and Pugh, B.F. (2009). Interaction of tran-
scriptional regulators with specific nucleosomes across the Saccharomyces
genome. Mol. Cell 35, 889–902.
Kornberg, R.D., and Lorch, Y. (1999). Twenty-five years of the nucleosome,
fundamental particle of the eukaryote chromosome. Cell 98, 285–294.
Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C., Ryan, O.W., Ding, H., Haw,
R.A., Pootoolal, J., Tong, A., Canadien, V., et al. (2003). A Snf2 family
ATPase complex required for recruitment of the histone H2A variant Htz1.
Mol. Cell 12, 1565–1576.
Krogan, N.J., Baetz, K., Keogh, M.C., Datta, N., Sawa, C., Kwok, T.C., Thomp-
son, N.J., Davey, M.G., Pootoolal, J., Hughes, T.R., et al. (2004). Regulation of
chromosome stability by the histone H2A variant Htz1, the Swr1 chromatin re-
modeling complex, and the histone acetyltransferase NuA4. Proc. Natl. Acad.
Sci. USA 101, 13513–13518.
Kusch, T., Florens, L., Macdonald, W.H., Swanson, S.K., Glaser, R.L., Yates,
J.R., III, Abmayr, S.M., Washburn, M.P., and Workman, J.L. (2004). Acetylation
by Tip60 is required for selective histone variant exchange at DNA lesions.
Science 306, 2084–2087.
Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C., Gerton, J.,
and Workman, J.L. (2005). Preferential occupancy of histone variant H2AZ at
inactive promoters influences local histone modifications and chromatin re-
modeling. Proc. Natl. Acad. Sci. USA 102, 18385–18390.
Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc. 735
Liang, C., and Stillman, B. (1997). Persistent initiation of DNA replication and
chromatin-bound MCM proteins during the cell cycle in cdc6 mutants. Genes
Dev. 11, 3375–3386.
Lorch, Y., Maier-Davis, B., and Kornberg, R.D. (2006). Chromatin remodeling
by nucleosome disassembly in vitro. Proc. Natl. Acad. Sci. USA 103, 3090–
3093.
Luk, E., Vu, N.D., Patteson, K., Mizuguchi, G., Wu, W.H., Ranjan, A., Backus,
J., Sen, S., Lewis, M., Bai, Y., and Wu, C. (2007). Chz1, a nuclear chaperone for
histone H2AZ. Mol. Cell 25, 357–368.
Meneghini, M.D., Wu, M., and Madhani, H.D. (2003). Conserved histone
variant H2A.Z protects euchromatin from the ectopic spread of silent hetero-
chromatin. Cell 112, 725–736.
Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. (2004). ATP-
driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin re-
modeling complex. Science 303, 343–348.
Morrison, A.J., and Shen, X. (2009). Chromatin remodelling beyond transcrip-
tion: the INO80 and SWR1 complexes. Nat. Rev. Mol. Cell Biol. 10, 373–384.
Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber,
S.L., Rando, O.J., and Madhani, H.D. (2005). Histone variant H2A.Z marks the
50 ends of both active and inactive genes in euchromatin. Cell 123, 233–248.
Rando, O.J., and Chang, H.Y. (2009). Genome-wide views of chromatin struc-
ture. Annu. Rev. Biochem. 78, 245–271.
Rufiange, A., Jacques, P.E., Bhat, W., Robert, F., and Nourani, A. (2007).
Genome-wide replication-independent histone H3 exchange occurs predom-
inantly at promoters and implicates H3 K56 acetylation and Asf1. Mol. Cell 27,
393–405.
Ruhl, D.D., Jin, J., Cai, Y., Swanson, S., Florens, L., Washburn, M.P., Con-
away, R.C., Conaway, J.W., and Chrivia, J.C. (2006). Purification of a human
SRCAP complex that remodels chromatin by incorporating the histone variant
H2A.Z into nucleosomes. Biochemistry 45, 5671–5677.
Santisteban, M.S., Kalashnikova, T., and Smith, M.M. (2000). Histone H2A.Z
regulats transcription and is partially redundant with nucleosome remodeling
complexes. Cell 103, 411–422.
Smith, C.L., and Peterson, C.L. (2005). A conserved Swi2/Snf2 ATPase motif
couples ATP hydrolysis to chromatin remodeling. Mol. Cell. Biol. 25, 5880–
5892.
Suto, R.K., Clarkson, M.J., Tremethick, D.J., and Luger, K. (2000). Crystal
structure of a nucleosome core particle containing the variant histone
H2A.Z. Nat. Struct. Biol. 7, 1121–1124.
Venters, B.J., and Pugh, B.F. (2009). A canonical promoter organization of the
transcription machinery and its regulators in the Saccharomyces genome.
Genome Res. 19, 360–371.
Weiner, A., Hughes, A., Yassour, M., Rando, O.J., and Friedman, N. (2010).
High-resolution nucleosome mapping reveals transcription-dependent
promoter packaging. Genome Res. 20, 90–100.
West, M.H., and Bonner, W.M. (1980). Histone 2A, a heteromorphous family of
eight protein species. Biochemistry 19, 3238–3245.
Wu, W.H., Alami, S., Luk, E., Wu, C.H., Sen, S., Mizuguchi, G., Wei, D., and Wu,
C. (2005). Swc2 is a widely conserved H2AZ-binding module essential for ATP-
dependent histone exchange. Nat. Struct. Mol. Biol. 12, 1064–1071.
Wu, W.H., Wu, C.H., Ladurner, A., Mizuguchi, G., Wei, D., Xiao, H., Luk, E.,
Ranjan, A., and Wu, C. (2009). N terminus of Swr1 binds to histone H2AZ
and provides a platform for subunit assembly in the chromatin remodeling
complex. J. Biol. Chem. 284, 6200–6207.
Yoshida, T., Shimada, K., Oma, Y., Kalck, V., Akimura, K., Taddei, A., Iwahashi,
H., Kugou, K., Ohta, K., Gasser, S.M., and Harata, M. (2010). Actin-related
protein Arp6 influences H2A.Z-dependent and -independent gene expression
and links ribosomal protein genes to nuclear pores. PLoS Genet. 6, e1000910.
Zhang, H., Roberts, D.N., and Cairns, B.R. (2005). Genome-wide dynamics of
Htz1, a histone H2A variant that poises repressed/basal promoters for activa-
tion through histone loss. Cell 123, 219–231.
Zlatanova, J., and Thakar, A. (2008). H2A.Z: view from the top. Structure 16,
166–179.
Zofall, M., Fischer, T., Zhang, K., Zhou, M., Cui, B., Veenstra, T.D., and Grewal,
S.I. (2009). Histone H2A.Z cooperates with RNAi and heterochromatin factors
to suppress antisense RNAs. Nature 461, 419–422.
736 Cell 143, 725–736, November 24, 2010 ª2010 Elsevier Inc.
Sororin Mediates Sister ChromatidCohesion by Antagonizing WaplTomoko Nishiyama,1 Rene Ladurner,1 Julia Schmitz,1,4 Emanuel Kreidl,1 Alexander Schleiffer,1 Venugopal Bhaskara,1
Masashige Bando,2 Katsuhiko Shirahige,2 Anthony A. Hyman,3 Karl Mechtler,1 and Jan-Michael Peters1,*1Research Institute of Molecular Pathology, Dr. Bohr-Gasse 7, A-1030 Vienna, Austria2Institute of Molecular and Cellular Biosciences, University of Tokyo, Yayoi, Tokyo 113-0032, Japan3Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, D-01307 Dresden, Germany4Present address: World Health Organization, Avenue Appia 20, CH-1211 Geneva 27, Switzerland
*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.10.031
SUMMARY
Sister chromatid cohesion is essential for chromo-some segregation and is mediated by cohesin boundto DNA. Cohesin-DNA interactions can be reversedby the cohesion-associated protein Wapl, whereasa stably DNA-bound form of cohesin is thought tomediate cohesion. In vertebrates, Sororin is essentialfor cohesion and stable cohesin-DNA interactions,but how Sororin performs these functions isunknown.We show that DNA replication and cohesinacetylation promote binding of Sororin to cohesin,and that Sororin displaces Wapl from its bindingpartner Pds5. In the absence of Wapl, Sororinbecomes dispensable for cohesion. We proposethat Sororin maintains cohesion by inhibiting Wapl’sability to dissociate cohesin from DNA. Sororin hasonly been identified in vertebrates, but we showthat many invertebrate species contain Sororin-related proteins, and that one of these, Dalmatian,is essential for cohesion in Drosophila. The mecha-nism we describe here may therefore be widelyconserved among different species.
INTRODUCTION
In eukaryotic cells, sister chromatids remain physically con-
nected from the time of their synthesis during DNA replication
until their separation during mitosis or meiosis. This sister chro-
matid cohesion is essential for biorientation of chromosomes on
the spindle and for DNA-damage repair (reviewed in Nasmyth
and Haering, 2009; Onn et al., 2008; Peters et al., 2008). Cohe-
sion is mediated by cohesin complexes. Three cohesin subunits,
the ATPases Smc1 and Smc3 and the kleisin Scc1/Rad21/
Mcd1, form triangular structures that have been proposed to
mediate cohesion by embracing sister chromatids (Gruber
et al., 2003; for an illustration of this ‘‘ring model,’’ see Figure 6C
below). Scc1 binds to a fourth core subunit, called Scc3 in yeast
and stromal antigen (SA) in vertebrates, where somatic cells
contain two SA paralogs (SA1 and SA2). Scc1 and SA proteins
are further associated with a heterodimer of two proteins, called
Wapl and Pds5, the latter of which also exists in two isoforms in
vertebrates (Pds5A and Pds5B; Gandhi et al., 2006; Kueng et al.,
2006).
Cohesin complexes are loaded onto DNA before replication (in
animal cells already in telophase) and establish cohesion during
replication. In the subsequent mitosis, cohesion is dissolved by
removal of cohesin from chromosomes. In vertebrate cells, this
process occurs in two steps (Waizenegger et al., 2000): the
bulk of cohesin is removed from chromosomes in prophase by
a mechanism that depends on Polo-like kinase 1 (Plk1/Plx1)
and Wapl (Gandhi et al., 2006; Kueng et al., 2006). At centro-
meres, small amounts of cohesin are protected from the
prophase pathway by Shugoshin, and these complexes can
only be removed from chromosomes by the protease separase
(reviewed in Sakuno and Watanabe, 2009). This process occurs
only in metaphase because a surveillance mechanism called the
spindle assembly checkpoint (SAC) prevents separase activa-
tion until all chromosomes have been bioriented. The SAC
inhibits APC/CCdc20 (anaphase-promoting complex/cyclosome
associated with Cdc20), a complex whose ubiquitin ligase
activity is required for separase activation (reviewed in Peters,
2006).
How cohesion is established and maintained is poorly under-
stood. Fluorescence recovery after photobleaching (FRAP)
experiments in mammalian cells revealed that cohesin binds to
DNA much more stably after than before DNA replication, sug-
gesting that cohesion depends on an unidentified event during
DNA replication that stabilizes cohesin on DNA (Gerlich et al.,
2006). The dynamic mode of cohesin binding to DNA might
depend on Wapl because depletion of this protein from mamma-
lian cells does not only interfere with the prophase pathway but
also increases the residence time of cohesin on chromatin during
interphase (Kueng et al., 2006).
The only molecular event during DNA replication that is known
to be essential for cohesion establishment is acetylation of cohe-
sin (Ben-Shahar et al., 2008; Unal et al., 2008; Zhang et al., 2008).
This modification occurs on two lysine residues in the ATPase
domain of Smc3 (K112/113 in budding yeast) and is catalyzed
by the acetyltransferase Eco1. The lethality of yeast that is
caused by deletion of the ECO1 gene can be suppressed by
changing K112/113 to residues that might functionally mimic
Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc. 737
Figure 1. Sororin Is Required for Cohesion in S Phase
(A) FISH of Sororin-depleted S phase cells. HeLa cells were synchronized in S phase by double thymidine arrest and transfected with control or Sororin siRNA.
Four hours after release from the second thymidine arrest, cells were labeled with BrdU for 15 min, pre-extracted, and subjected to FISH with a probe specific for
738 Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc.
acetylated lysine but also by deletion of the WPL1/RAD61 gene,
which encodes a Wapl ortholog, and by mutations in Pds5 (Ben-
Shahar et al., 2008; Rowland et al., 2009; Sutani et al., 2009; Unal
et al., 2008). Cohesin is also acetylated in mammalian cells on
Smc3 residues K105/106 (Zhang et al., 2008), where two Eco1
orthologs exist, called Esco1 and Esco2 (Hou and Zou, 2005).
In vertebrate cells, cohesin-DNA interactions are also regu-
lated by Sororin. This protein was identified as a substrate of
APC/CCdh1, a form of the APC/C that is active during mitotic
exit and G1 phase, and Soronin was found to be essential for
cohesion in mammalian cells (Rankin et al., 2005). Interestingly,
Sororin depletion also reduces the number of cohesin com-
plexes that bind stably to DNA during G2 phase, indicating that
Sororin is required for the formation of stable cohesin-DNA inter-
actions (Schmitz et al., 2007). However, it is unknown how
Sororin performs this function, and whether the role of Sororin
is related to the function of cohesin acetylation. Furthermore, it
is unknown how widespread the role of Sororin is because
Sororin has only been identified in vertebrates.
Here we provide evidence that Sororin is recruited to chro-
matin-bound cohesin complexes in a manner that depends on
DNA replication and Smc3 acetylation, that Sororin causes
a conformational rearrangement within cohesin by displacing
Wapl from Pds5, and that these molecular events stabilize cohe-
sin on DNA by antagonizing Wapl’s ability to dissociate cohesin
from DNA. Furthermore, we show that distant orthologs of So-
rorin exist in many metazoan species, and that one of these
proteins, Dalmatian, is required for cohesion in Drosophila. We
therefore propose that sister chromatid cohesion depends on
stabilization of cohesin on DNA by Sororin-related proteins.
RESULTS
Sororin Is Required for Cohesion during S PhaseWe had previously shown that Sororin is required for cohesion in
G2 phase (Schmitz et al., 2007). To address whether Sororin’s
function is already needed during S phase, we used RNA inter-
ference (RNAi) to deplete Sororin from HeLa cells that had
been synchronized in the cell cycle and pulse-labeled these cells
with bromodeoxyuridine (BrdU). Cells in S phase were identified
by immunofluorescence microscopy (IFM) using BrdU anti-
bodies, and the distance between sister chromatids was
measured by DNA fluorescence in situ hybridization (FISH) using
a probe for an arm region on chromosome 21. On average, FISH
signals were twice as far separated in BrdU-positive, Sororin-
depleted cells than in control cells (Figures 1A and 1B), indicating
that Sororin is already required for cohesion during S phase. At
variance with these results, it has been reported that Sororin-
depleted cells only lose cohesion during metaphase and that So-
rorin is therefore not required for cohesion in early mitosis (Diaz-
Martinez et al., 2007). However, in time-lapse microscopy exper-
iments we observed that most Sororin-depleted cells failed to
congress chromosomes, consistent with the existence of cohe-
sion defects before metaphase (Figures S1A–S1D available on-
line). The function of Sororin is therefore not restricted to mitosis
and is instead already needed during or shortly after DNA
replication.
Sororin Associates with Chromatin during the Periodof the Cell Cycle Where Cohesion ExistsWe next analyzed the intracellular distribution of Sororin.
Previous IFM and fractionation experiments had shown that So-
rorin associates with chromatin in interphase, but Sororin could
not be detected on mitotic chromosomes (Rankin et al., 2005).
Because our antibodies could not detect Sororin in IFM experi-
ments, we tagged Sororin at its carboxy-terminus with a localiza-
tion-affinity purification (LAP) tag that contains green fluorescent
protein (GFP; Figure S1E). We modified the Sororin gene on
a bacterial artificial chromosome (BAC), enabling gene expres-
sion from the endogenous promoter (Poser et al., 2008). We
used a mouse BAC for these experiments to enable RNAi
‘‘rescue’’ experiments and generated clonal HeLa cell lines
that had stably integrated this BAC. The LAP-tagged version of
mouse Sororin could substitute for the cohesion function of
endogenous human Sororin when this was depleted by RNAi
(Figures S1F and S1G), and in tandem affinity purification exper-
iments mouse Sororin-LAP was found associated with human
cohesin (Figures S1H and S1I), indicating that this tagged
version of Sororin behaves similarly to endogenous Sororin.
We therefore analyzed by IFM the intracellular distribution of So-
rorin-LAP, using antibodies to GFP. We stained proliferating cell
nuclear antigen (PCNA) and Aurora B in the same cells as
markers for S and G2 phases, respectively. Cellular Sororin-
LAP levels were low in G1, accumulated between early S and
G2 phases in the nucleus, and became dispersed in the cyto-
plasm following nuclear envelope breakdown (Figures S1J–
S1L). When we analyzed cells from which soluble proteins had
been extracted before fixation, we observed that Sororin-LAP
accumulated on chromatin between early S phase and G2
phase, whereas most Sororin-LAP disappeared from chromo-
somes in prophase (Figures 1C–1E). At this stage, the cellular
levels of Sororin were still high (Figure S1L), indicating that the
removal of Sororin from prophase chromosomes is caused by
dissociation, not degradation. Biochemical fractionation experi-
ments confirmed this notion (Figure S1M). Importantly, however,
small amounts of Sororin-LAP could still be detected by IFM on
the trisomic tff1 locus on chromosome 21. BrdU-labeled nuclei (blue) with three pairs of FISH signals (red) are shown. Higher-magnification images are shown in
the insets. Bar: 5 mm.
(B) Quantification of the distance between paired FISH signals in (A) (mean ± standard deviation [SD]; n R 30 per condition, *p < 0.01).
(C) Sororin-LAP cells were pre-extracted prior to fixation and stained for Sor-LAP (GFP), PCNA, and Aurora B. DNA was counterstained with Hoechst. Bar: 10 mm.
(D) Quantification of chromatin-bound Sororin-LAP levels in (C) (mean ± SD; n R 50 per class).
(E) Sororin-LAP cells were synchronized in mitosis, pre-extracted prior to fixation, and stained for Sor-LAP (GFP), Scc1, and DNA (Hoechst). Bar: 10 mm.
(F) Sororin-LAP localizes to centromeres in mitosis. Sororin-LAP cells were pre-extracted prior to fixation and stained for Sor-LAP (GFP), kinetochores (CREST),
and DNA (DAPI). Insets show magnified views. Bar: 10 mm.
See also Figure S1.
Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc. 739
chromosomes in prophase, prometaphase, and metaphase, but
not in anaphase or telophase (Figure 1E). Like cohesin (Waize-
negger et al., 2000), Sororin-LAP was enriched at centromeres
in prometa/metaphase (Figure 1F). Sororin therefore associates
with chromatin from S phase until metaphase, i.e., as long as
cohesion exists.
The Association of Sororin with Chromatin Dependson CohesinBecause Sororin binds to cohesin and, like cohesin, is removed
from mitotic chromosomes in two steps, during prophase and at
the metaphase-anaphase transition, we tested whether the
association of Sororin with chromatin depends on cohesin.
Scc1 depletion reduced the intensity of Sororin-LAP staining
on chromatin without affecting the cellular levels of Sororin-
LAP (Figures 2A–2D), indicating that Sororin can only efficiently
associate with chromatin in the presence of cohesin. Biochem-
ical experiments in Xenopus egg extracts confirmed this notion
(see Figure 2F below). The presence of Sororin on mitotic
chromosomes also depends on cohesin, as depletion of either
Scc1 or Shugoshin-like 1 (Sgo1) reduced chromosomal So-
rorin-LAP staining, whereas depletion of Wapl or inhibition of
Plk1 increased the amounts of Sororin on chromosome arms
(Figure S2A).
Although the intracellular distribution of Sororin and cohesin is
similar from prophase to anaphase, the two proteins behave
differently in telophase. Whereas cohesin reassociates with
chromatin at this stage, little if any Sororin-LAP could be de-
tected on chromatin in telophase (Figure 1E). This difference
was not due to lower sensitivity in the detection of Sororin than
cohesin because Sororin-LAP could easily be observed on early
mitotic chromosomes, where endogenous cohesin cannot be
detected (due to its low abundance; Waizenegger et al., 2000).
The absence of Sororin on telophase chromatin was also not
caused by APC/CCdh1-mediated degradation of all cellular So-
rorin because Sororin-LAP could be observed in fixed telophase
cells (Figure S1L). Time-lapse microscopy of living cells showed
that Sororin levels begin to decrease in anaphase when APC/
CCdh1 becomes active but revealed that most Sororin degrada-
tion occurs after telophase, i.e., during G1, as is typical for
APC/CCdh1 substrates (Figures S2B–S2E). The absence of So-
rorin on chromatin in telophase is therefore not simply due to
the complete degradation of Sororin.
Efficient Association of Sororin with ChromatinDepends on DNA ReplicationThe absence of Sororin on telophase chromatin could be caused
by local APC/CCdh1-mediated degradation on chromatin, or the
Figure 2. Association of Sororin with
Chromatin Depends on Cohesin and DNA
Replication
(A–D) Sororin-LAP cells were transfected with
siRNAs and synchronized in G2 phase. Cells
were fixed (C and D) or pre-extracted prior to
fixation (A and B) and stained for Sor-LAP (GFP),
Scc1, and DNA (Hoechst). Bar: 10 mm. Quantifica-
tion of Sororin-LAP levels in (A) and (C) is shown in
(B) and (D), respectively (mean ± SD; n R 110 (B)
and n R 130 (D) per condition).
(E) Sororin is stably present throughout the cell
cycle but associates with chromatin during S
phase in Xenopus egg extracts. CaCl2 and cyclo-
heximide were added to meiotic metaphase II
(MII) arrested CSF extract to induce meiotic exit.
At 90 min after CaCl2 addition, D90 Cyclin B was
added to induce mitosis. Samples were taken at
indicated time points after CaCl2 addition (release
from MII) or D90 Cyclin B addition (D90 Cyc B
addition). DNA replication (DNA repl.) was moni-
tored by incorporation of [a-32P]dCTP into sperm
chromatin. Chromatin-bound proteins in the
same extracts are also shown. Chromatin was
preincubated for 30 min in CSF extracts.
(F) Sororin association with chromatin depends
on cohesin. Xenopus interphase extracts were
subjected to mock or SA1/2 immunodepletion.
Two hours after sperm chromatin addition, chro-
matin fractions were analyzed by immunoblotting.
(G) Sororin association with chromatin depends
on DNA replication. Interphase extracts were
incubated for indicated times with sperm chro-
matin. DMSO, aphidicolin (Aph.), or actinomycin
D (ActD) was added to the extracts 25 min
after sperm addition. Chromatin fractions were
analyzed by immunoblotting.
See also Figure S2.
740 Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc.
association of cohesin with chromatin could be required but not
sufficient for Sororin binding to chromatin. To distinguish
between these possibilities, we analyzed the chromatin associa-
tion of Sororin in Xenopus eggs, which do not contain Cdh1 and
where Sororin is therefore predicted to be stable during mitotic
exit. If cohesin was sufficient for recruiting Sororin to chromatin,
both proteins would be expected to associate with chromatin
simultaneously in Xenopus egg extracts. To test this possibility,
we isolated two Xenopus Sororin cDNAs (Sororin-A and -B),
which encode closely related 35 kDa proteins. Xenopus Sororin
antibodies recognized both Sororin isoforms in immunoblots
(visible as a doublet of bands; see for example Figure 2E) and
could deplete both proteins from egg extracts (see Figure 4A
below). Immunodepletion experiments also revealed that the
chromatin association of Xenopus Sororin proteins depends on
cohesin (Figure 2F) and that these proteins are required for cohe-
sion (see Figure 4B below), even though their amino acid
sequences are only 38% identical to the sequence of human So-
rorin. The two Xenopus proteins characterized here (hereafter
collectively called Xenopus Sororin) are therefore functionally
related to mammalian Sororin.
To address when Sororin and cohesin associate with chro-
matin, we released Xenopus egg extracts from a cytostatic
factor (CSF) arrest in metaphase of meiosis II into interphase
by addition of Ca2+, which leads to activation of APC/CCdc20,
degradation of mitotic Cyclins, and mitotic exit (Figure 2E). As
a source of chromatin, demembranated sperm nuclei were
added. DNA replication was monitored by incorporation of
[a-32P]dCTP into DNA and occurred within 60 min after Ca2+
addition. After 90 min, we added a recombinant form of nonde-
gradable Cyclin B (D90 Cyc B) to induce entry of the extract into
a mitotic state. At different time points, proteins in the chromatin
fraction or the total extract were analyzed by immunoblotting
(Figure 2E). As expected, Ca2+ addition led to rapid degradation
of Cyclin B2 (a substrate of APC/CCdc20), but the levels of the
APC/CCdh1 substrates Sororin and Plx1 remained largely
unchanged (only the electrophoretic mobility of Sororin was
reduced by phosphorylation in CSF and mitotic extracts). Impor-
tantly, even though Sororin was present throughout all stages of
the cell cycle, it began to associate with chromatin only 60 min
after addition of Ca2+, i.e., when DNA replication was initiated.
In contrast, the cohesin subunits Scc1 and Smc3 could be de-
tected on chromatin at least 30 min earlier. The association of
Sororin with chromatin was abolished by Geminin (Figure S2F),
a protein that inhibits cohesin loading onto DNA (Gillespie and
Hirano, 2004; Takahashi et al., 2004), indicating that our assay
reflected physiological binding of Sororin to chromatin. These
observations suggest that local APC/CCdh1-mediated degrada-
tion of Sororin on chromatin cannot explain why Sororin associ-
ates with chromatin later than cohesin. Instead, our results indi-
cate that the presence of cohesin on chromatin is not sufficient
for recruitment of Sororin.
Because Sororin associates with chromatin during S phase in
Xenopus extracts and in somatic cells (Figure 1C and Figure 2E),
we tested whether DNA replication is required for recruitment of
Sororin to chromatin. We prevented replication in Xenopus
extracts by addition of aphidicolin or actinomycin D. Aphidicolin
allows initiation of DNA replication but leads to the stalling of
replication forks from which the replicative MCM helicase is un-
coupled, whereas actinomycin D inhibits progression of both
DNA polymerase and helicase (Pacek and Walter, 2004). In our
assays, aphidicolin reduced association of Sororin with chro-
matin partially, and actinomycin D inhibited this process largely,
even though Smc3 levels on chromatin were not reduced (Fig-
ure 2G). DNA replication is therefore required for efficient recruit-
ment of Sororin to chromatin. However, because aphidicolin and
actinomycin D inhibited DNA replication more efficiently than So-
rorin binding, it is possible that some Sororin can associate with
chromatin in the absence of DNA replication. Similar observa-
tions were made in HeLa cells where inhibition of DNA replication
by thymidine also reduced the Sororin-LAP levels on chromatin
(Figures S2G and S2H).
Cohesin Acetylation Facilitates but Is Not Sufficient forthe Association of Sororin with ChromatinBecause Sororin associates with chromatin during DNA replica-
tion, i.e., when cohesin is known to be acetylated, we analyzed
whether Smc3 acetylation and Sororin binding depend on each
other. To detect Smc3 acetylation, we used a monoclonal anti-
body that specifically recognizes Smc3 singly acetylated on
K106 or doubly acetylated on K105 and K106 (Figure S3A). We
observed that Sororin binding to chromatin and Smc3 acetyla-
tion occurred at the same time (Figure 2E) and that inhibition of
DNA replication had similar effects on both events, supporting
the notion that the two events are linked (Figure 2G). However,
depletion of Sororin from Xenopus extracts or from HeLa cells
affected neither the kinetics nor the degree of Smc3 acetylation,
suggesting that Sororin is not required for cohesin acetylation
(Figures S3B and S3C).
To test whether Smc3 acetylation is required for the chromatin
association of Sororin, we depleted Esco1 and Esco2 from HeLa
cells. Only depletion of both enzymes reduced Smc3 acetylation,
indicating that Esco1 and Esco2 can both acetylate cohesin
(Figure 3A). To analyze whether depletion of Esco1 and Esco2
affects the association of Sororin with chromatin, we synchro-
nized cells in S phase by double thymidine arrest-release and
measured the amount of Sororin-LAP on chromatin by immuno-
blotting and IFM. We also depleted endogenous Sororin in these
experiments to ensure that Sororin-LAP was analyzed under
conditions where it is functional. To rule out that reduced chro-
matin binding of Sororin was caused indirectly by a delay in
DNA replication, we labeled cells with BrdU and quantified
Sororin-LAP IFM signals only in cells that had similar amounts
of BrdU incorporated. Both by immunoblotting and IFM we
observed a reduction in Sororin on chromatin (Figures 3B–3D).
Depletion of Esco1 and Esco2 also reduced the amount of
endogenous Sororin that was associated with chromatin-bound
cohesin (Figures S3D and S3E). Esco1 and Esco2 are therefore
required for efficient binding of Sororin to cohesin on chromatin.
It is possible that the residual amounts of Sororin on chromatin
that were seen in our assays were due to incomplete depletion
of Esco1 and Esco2.
To address whether Esco1 and Esco2 regulate Sororin by
acetylating Smc3, we mutated K105 and K106 in Smc3 to either
glutamine (Smc3QQ), arginine (Smc3RR), or alanine (Smc3AA)
residues. Smc3QQ has been proposed to mimic acetylated and
Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc. 741
Smc3RR and Smc3AA to mimic nonacetylated Smc3. We
mutated a LAP-tagged version of the Smc3 gene on a BAC,
stably integrated the modified BACs into HeLa cells, purified
the wild-type and mutant forms of Smc3 either from soluble
extracts or from chromatin, and analyzed their interaction part-
ners by immunoblotting and mass spectrometry. For wild-type
Smc3-LAP, these experiments confirmed that Sororin only asso-
ciates with cohesin on chromatin but not, or only to a small
degree, with soluble cohesin (Figure S3G). However, when
Smc3QQ-LAP was purified, Sororin could also reproducibly be
found in association with soluble cohesin, consistent with the
possibility that Smc3 acetylation promotes binding of Sororin
to cohesin (Figure 3E and Figure S3G). This interaction was abol-
ished by depletion of Scc1, indicating that Smc3QQ does not
simply represent a misfolded protein to which Sororin binds
nonspecifically (Figure S3H). Unexpectedly, similar results
were also obtained when Smc3RR and Smc3AA were analyzed
(Figures 3E, Figure S3F, and Figure S3G). This suggests that So-
rorin-cohesin interactions can be stabilized not only by muta-
tions that might chemically mimic acetylation but also by other
mutations that alter K105 and K106 (for possible interpretations
of these results, see Discussion).
We also attempted to generate acetylated cohesin in vitro by
using recombinant purified Esco1 (Figure S3I). We observed
that Esco1 could acetylate Smc3 when cohesin was associated
with chromatin in a Xenopus extract, but not in extract lacking
chromatin or when Esco1 was incubated with purified soluble
cohesin (Figure 3F and data not shown). Esco1 may therefore
only be able to modify cohesin on chromatin. Consistent with
this possibility, endogenous acetylated forms of Smc3 could
only be detected by immunoblotting in chromatin fractions (Fig-
ure S3J), and quantitative mass spectrometry indicated that the
fraction of acetylated Smc3 relative to total Smc3 is 97-fold
higher for chromatin-bound than for soluble cohesin (data not
shown).
When we added Esco1 to Xenopus extract containing chro-
matin, we observed that Smc3 acetylation was advanced by at
least 30 min, but Esco1 had no effect on the chromatin associa-
tion of Sororin (Figure 3F), indicating that Smc3 acetylation is not
sufficient for recruitment of Sororin to chromatin. In support of
Figure 3. Acetylation of Smc3 Facilitates
but Is Not Sufficient for the Association of
Sororin with Chromatin
(A) RNAi against both Esco1 and Esco2 causes
a decrease in Smc3 acetylation. HeLa cells were
transfected with siRNAs and harvested at S
phase. Chromatin-bound proteins were analyzed
by immunoblotting. Asterisks indicate nonspecific
signals.
(B) Reduction of Smc3 acetylation causes a
decrease of Sororin on chromatin. Sororin-LAP
HeLa cells were synchronized at S phase and
chromatin fractions were analyzed by immuno-
blotting.
(C) Cells in (B) were treated with BrdU after the
second thymidine release, pre-extracted, and
costained for BrdU, Sor-LAP (GFP), and DNA
(DAPI). Bar: 10 mm.
(D) Quantification of chromatin-associated
Sororin-LAP signal in cells with similar levels of
BrdU incorporation. Cells described in (C) with
similar BrdU intensities (left) were analyzed for
Sor-LAP intensity (right) (mean ± confidence
interval; *p < 0.01).
(E) Soluble Smc3QQ and Smc3RR proteins stably
bind to Sororin in HeLa cells. HeLa cells express-
ing Smc3WT-, Smc3QQ-, or Smc3RR-LAP were
synchronized in G2 phase, Smc3-LAP was immu-
noprecipitated from the soluble fraction of cells,
and the coprecipitated proteins were analyzed
by immunoblotting using a 2-fold serial dilution.
(F) Acetylation of Smc3 is not sufficient for Sororin
binding to chromatin. Interphase Xenopus egg
extracts were incubated with sperm chromatin
in the presence (Esco1) or absence (buffer) of
Esco1 for indicated times. Chromatin fractions
were analyzed by immunoblotting (on chromatin).
Extracts without sperm chromatin were incubated
for 120 min in the presence or absence of Esco1
(extracts).
See also Figure S3.
742 Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc.
this hypothesis, we found that the association of Sororin with
Smc3QQ was still partially dependent on DNA replication (Fig-
ure S3K). Taken together, these results indicate that Smc3 acet-
ylation is required but not sufficient for efficient recruitment of
Sororin to chromatin-bound cohesin.
Sororin Is Dispensable for Cohesion in the Absenceof WaplSeveral previous observations are consistent with the possibility
that Sororin and Wapl have antagonistic functions: depletion of
Sororin and Wapl has opposite effects on cohesion (increased
and decreased proximity between sister chromatids, respec-
tively) and on the stability of cohesin-DNA interactions
(decreased and increased residence times of cohesin on chro-
matin, respectively). Likewise, addition of excess Sororin to Xen-
opus extracts mimics the ‘‘overcohesion’’ phenotype caused by
depletion of Wapl, and overexpression of Wapl causes cohesion
defects, as does loss of Sororin (Gandhi et al., 2006; Kueng et al.,
Figure 4. Sororin Is Dispensable for Cohe-
sion in the Absence of Wapl
(A) Chromatin fractions from mock-, Sororin-,
Wapl-, and Wapl- and Sororin-depleted inter-
phase extracts were analyzed by immunoblotting.
(B) D90 Cyclin B was added to the extracts shown
in (A) and mitotic chromosomes were assembled.
Chromosomes were isolated 120 min after D90
Cyclin B addition and stained for XCAP-E
(magenta) and Bub1 (green). Higher-magnification
images are shown in lower panels. Distance
between two chromosome arms stained by
XCAP-E in each extract is shown in a histogram
as a comparison to the mock-depleted extract.
Depletion of SA1/2 is shown as an example of
cohesin depletion. Bar: 5 mm.
(C) Codepletion of Sororin and Wapl in HeLa cells.
Cells were transfected with the indicated siRNAs
and treated with nocodazole. After mitotic shake-
off for chromosome spreads (D and E), residual
cells were harvested for immunoblotting. See
also Figure S4A.
(D) Analysis of chromosome spreads after Sororin
and Wapl depletion. Mitotic cells harvested as in
(C) were examined by chromosome spreading
and Giemsa staining. Five hundred cells per RNAi
experiment were classified into three categories.
(E) Representative pictures of the most prominent
phenotype class upon RNAi depletion in the
Giemsa spread analysis. Color code is shown in
(D). Bar: 10 mm.
2006; Rankin et al., 2005; Schmitz et al.,
2007; Shintomi and Hirano, 2009).
To understand the functional relation-
ship between Sororin and Wapl we
depleted both proteins either individually
or simultaneously from Xenopus extracts
and analyzed cohesion in mitotic chro-
mosomes. We analyzed chromosome
morphology by staining the condensin
subunit XCAP-E and Bub1 as markers
for sister chromatid arms and kinetochores, respectively. Deple-
tion of Sororin alone increased the distance between sister chro-
matids, indicating a partial cohesion defect (Figures 4A and 4B).
This defect was similar in magnitude to the defect that was
observed after simultaneous depletion of the cohesin subunits
SA1 and SA2, suggesting that also in Xenopus extracts Sororin
is similarly important for cohesion as cohesin itself (Figure 4B).
As expected, depletion of Wapl had the opposite effect, i.e., re-
sulted in tightly connected chromatids. Remarkably, depletion of
both proteins caused a phenotype that was very similar to the
phenotype caused by depletion of Wapl alone. Similar results
were obtained when Sororin and Wapl were depleted singly or
simultaneously by RNAi from HeLa cells and mitotic chromo-
somes were analyzed by Giemsa staining (Figures 4C–4E).
Also in this case, the phenotype obtained after codepletion of
Sororin and Wapl was nearly identical to the phenotype obtained
after depletion of Wapl alone, i.e., in the majority of mitotic cells
sister chromatids were more tightly associated with each other
Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc. 743
than normally. These observations indicate that Sororin is only
required for cohesion in the presence of Wapl, and they therefore
suggest that Sororin’s key function is to antagonize Wapl.
We also observed in these experiments that Wapl depletion
greatly increased the degree of Smc3 acetylation (Figure 4C
and Figure S4A). Wapl depletion could cause this effect by
increasing the residence time of cohesin on DNA, but it is also
possible that Wapl inhibits cohesin acetylation and that this func-
tion is required for Wapl’s ability to allow cohesin dissociation
from DNA.
Sororin Interacts with Pds5 via a Conserved FGF Motifand Can Displace Wapl from Pds5When we isolated Sororin-LAP via tandem affinity purification,
we identified cohesin core subunits and Pds5A and Pds5B, indi-
cating that Sororin can directly bind to these proteins (Figure S1I
and data not shown). Sororin antibodies also immunoprecipi-
tated Pds5A and Pds5B from solubilized chromatin of HeLa cells
(Figure S4B), and when we immunodepleted Pds5A and Pds5B
from Xenopus extracts the binding of Sororin to chromatin was
greatly reduced (Figure 5A). The latter effect was not caused
by a delay in DNA replication because [a-32P]dCTP incorporation
into sperm DNA was unaffected by depletion of Pds5 proteins
(Figure 5B). These observations are consistent with the possi-
bility that the association of Sororin with cohesin depends on
Pds5 proteins.
To address directly whether Sororin interacts with Pds5
proteins or Pds5-Wapl heterodimers, we purified recombinant
forms of human Sororin, Pds5A and Wapl. As predicted, Wapl
bound efficiently to Pds5A, either when expressed simulta-
neously in Baculovirus-infected insect cells or when incubated
with each other as individually purified proteins (Figure S4C
Figure 5. The FGF Motif of Sororin Is
Required for Cohesion
(A and B) Pds5 is required for Sororin association
with chromatin. Interphase Xenopus egg extracts
were subjected to mock or Pds5A and B immuno-
depletion. Two hours after sperm chromatin addi-
tion, chromatin fractions were analyzed by immu-
noblotting (A). DNA replication in the extracts
shown in (A) was monitored for 30 or 60 min by
incorporation of [a-32P]dCTP into sperm chro-
matin (B).
(C) Sequence comparison in the region including
FGF motifs of vertebrate Sororin and fly Dalmatian.
Identical and similar residues are shaded in black
and gray, respectively. In Xenopus, Sororin-A is
shown. In fruit fly, the latter two of three FGF motifs
are shown (see also Figure 7A).
(D) Anti-Pds5A antibody beads were incubated
with Sororin-WT or -AA mutant in the presence
or absence of Pds5A protein. Beads-bound pro-
teins were analyzed by immunoblotting.
(E) Anti-Pds5A antibody beads were incubated
with Sororin-WT or -AA mutant in the presence or
absence of the Pds5A-Wapl heterodimer. Beads-
bound proteins were separated from the superna-
tant and were analyzed by immunoblotting.
(F) Wapl removal activity of Sororin is increased in
a dose-dependent manner. Increasing amounts
(10–40 ng/ml) of Sororin-WT or -AA mutant were
used in the experiment shown in (E), supernatant
fractions were analyzed by immunoblotting (left),
and signal intensity of Wapl was quantified (right).
(G) Sororin-depleted interphase extracts were
combined with buffer, Sororin-WT, or -AA mutant.
Two hours after sperm chromatin addition, chro-
matin fractions were analyzed by immunoblotting.
(H) D90 Cyclin B was added to the extracts shown
in (G) and mitotic chromosomes were assembled.
Chromosomes were isolated 120 min after
D90 Cyclin B addition and stained for XCAP-E.
Magnified images are shown in lower panels.
Distance between two chromosome arms stained
by XCAP-E is shown in lower histogram as a
comparison to mock-depleted extract. Bar: 5 mm.
See also Figure S4.
744 Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc.
and data not shown). The interaction between Pds5 and Wapl
depends on two sequence elements composed of phenylala-
nine-glycine-phenylalanine (FGF) residues in Wapl (Shintomi
and Hirano, 2009), and we noticed that a similar FGF motif is
also present at a conserved position in all known Sororin
sequences (Figure 5C and see Figure S5B). We therefore also
generated a Sororin mutant in which the two phenylalanine resi-
dues in this motif were changed to alanines (hereafter called
‘‘Sororin-AA’’). Wild-type Sororin associated with Pds5A,
whereas the AA mutant bound less well (Figure 5D). Also,
when added to Xenopus extracts, wild-type Sororin associated
with cohesin and Pds5B more efficiently than the AA mutant (Fig-
ure S4D). When we performed Sororin-binding experiments with
Pds5A-Wapl, we observed, remarkably, that Sororin displaced
some Wapl from the Pds5A-Wapl heterodimers. Also, this effect
was reduced when the AA mutant was used (Figures 5E and 5F).
These observations raised the possibility that Sororin regulates
cohesin by interacting with the Pds5-Wapl heterodimer.
The FGF Motif of Sororin Is Essential for Its CohesionFunctionTo address whether Sororin’s ability to displace Wapl from Pds5
is of functional relevance, we replaced Sororin in Xenopus
extracts by the Sororin-AA mutant and analyzed its effect on
cohesion. We immunodepleted Sororin from interphase egg
extracts, added either buffer, recombinant wild-type Sororin,
or the AA mutant, and analyzed mitotic chromosomes as above.
Importantly, the cohesion defect observed after Sororin deple-
tion could be restored by wild-type Sororin but not by the AA
mutant (Figures 4G and 4H). Similar results were obtained
when excess Sororin was added to Xenopus extracts from which
the endogenous protein had not been depleted: in this assay
wild-type Sororin causes an ‘‘overcohesion’’ phenotype (Rankin
et al., 2005), but the AA mutant had no effect (Figure S4E). These
results show that the FGF motif of Sororin is required for its func-
tion in cohesion, and they suggest that Sororin might execute
this function by displacing Wapl from Pds5.
However, we could not obtain evidence that the Sororin-
dependent displacement of Wapl from Pds5 results in the disso-
ciation of Wapl from chromatin. Addition of recombinant Sororin
to Xenopus extracts increased, and did not decrease, the
amount of Wapl and Pds5A on chromatin, as if Sororin stabilized
the interactions between Pds5A-Wapl and cohesin, rather than
dissociating Wapl from cohesin (Figure S4F). It is therefore
possible that the Sororin-mediated displacement of Wapl from
Pds5A causes a rearrangement in the topology of cohesin-asso-
ciated proteins and does not lead to dissociation of Wapl from
cohesin.
Sororin Is Inactivated by Phosphorylation in MitosisThe prophase pathway of cohesin dissociation depends on Wapl
(Gandhi et al., 2006; Kueng et al., 2006). It is therefore conceiv-
able that Sororin has to be inactivated at the onset of mitosis
to relieve Wapl from its inhibition by Sororin. We therefore
analyzed whether Sororin’s ability to dissociate Wapl from
Pds5 proteins is cell cycle regulated. Consistent with this possi-
bility, recombinant Sororin could associate with Pds5B in Xeno-
pus interphase extracts but not in mitotic extracts where Sororin
is phosphorylated (Figure 6A). Furthermore, we observed that
Sororin could bind to recombinant purified Wapl-Pds5A
Sororin
FGF
S/G2-phase M-phaseTelo/G1-phase
DNA replication
dynamic
Pds5
mitotic entry
stable
WaplPds5
SororinWap
l
Smc3 acetylation
dynamic
Pds5
WaplSororinP
I-S
or
M-S
or λ
PP
supernatant
Sororin
Wapl
Pds5A
M-S
or
I-S
or
M-S
or
M-S
or λ
PP
beads bound
buffe
r
buffe
r
A B
C
I MI M
Sororin
Pds5B
: human Sororin− +
*
Figure 6. Phosphorylated Sororin Is Unable
to Dissociate Wapl from Pds5
(A) Sororin is dissociated from Pds5 in mitosis.
Sororin-WT was incubated in either interphase (I)
or mitotic (M) Xenopus egg extracts and immuno-
precipitated, and the precipitates were analyzed
by immunoblotting. Asterisk indicates nonspecific
signal.
(B) Wapl removal activity is abolished by phosphor-
ylation of Sororin. Wapl-Pds5A heterodimer on anti-
Pds5A antibody beads was incubated with either
buffer, Sororin preincubated in interphase egg
extract (I-Sor) or mitotic egg extract (M-Sor), or
l-protein phosphatase-treated M-Sor (M-Sor
l-PP). Beads-bound proteins were separated from
the supernatant and analyzed by immunoblotting.
(C) Model for the role of Sororin in sister chromatid
cohesion. The cohesin complex is loaded onto
chromatin during telo/G1 phase, where Wapl-
Pds5 destabilizes cohesin binding to chromatin
in the absence of Sororin. During DNA replication
in S phase, Sororin associates with chromatin
depending on cohesin and this association is facil-
itated by acetylation of Smc3. Sororin binds to
Pds5 through its FGF motif and thereby can antag-
onize the function of Wapl by modulating the
topology of Wapl and Pds5 so that stable cohesion
is maintained. Upon entry into mitosis, phosphory-
lation of Sororin abolishes the ability to inhibit
Wapl, allowing cohesin removal in prophase.
Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc. 745
heterodimers and dissociate Wapl from Pds5A when Sororin
was preincubated in Xenopus interphase extracts but not when
Sororin had been incubated in a mitotic extract (Figure 6B).
The Wapl dissociation activity of mitotic Sororin was fully
restored when Sororin was first dephosphorylated by l-protein
phosphatase. These results suggest that Sororin phosphoryla-
tion in mitosis relieves Wapl from inhibition by Sororin (Figure 6C;
for further discussion of this model see below).
Dalmatian Is a Drosophila Ortholog of SororinWapl orthologs exist in species from yeast to human (Kueng
et al., 2006), but Sororin has only been identified in vertebrates
(Rankin et al., 2005). To address whether inhibition of Wapl by
Sororin could also be required for cohesion in nonvertebrate
species, we searched for Sororin-related sequences in inverte-
brate genomes (Table S1). BLAST searches identified Sororin
Figure 7. Dalmatian Is an Ortholog of So-
rorin in Drosophila
(A) Schematic sequence comparison of human
and Xenopus Sororin and Drosophila Dalmatian.
The conserved regions are shaded in gray and
KEN-box and FGF motifs are depicted with white
and black boxes, respectively.
(B) Dalmatian (Dmt) RNAi causes premature sister
chromatid separation in S2 cells. Cells were trans-
fected with dsRNA against Dmt or BubR1 or were
left untransfected (control). Chromosome spreads
were stained with DAPI. Representative images
are shown. Bar: 5 mm.
(C) Cells described in (B) were quantified for loss of
cohesion. Error bars denote standard deviations
between three independent experiments.
(D) Mitotic defects in Dalmatian knockdown cells.
Cells were transfected with dsRNA against Dmt
or BubR1 or were untransfected (control) and
costained for a-tubulin and Cyclin B to define
mitotic stages, CID (Cenp-A in Drosophila) to
assess centromere pairing, and DAPI (upper
panel). The lower table summarizes the observed
phenotype over all mitotic cells (n > 59 per condi-
tion). Bar: 5 mm.
See also Figure S5 and Table S1.
sequences in vertebrates and one
distantly related protein in the mollusc
Lottia gigantea. We used the C-terminal
portion of these sequences, where the
highest degree of similarity is found, to
perform iterative rounds of similarity
searches in invertebrate proteome data-
bases. We identified a single sequence
with significant similarity to Sororin in 18
different metazoan species belonging to
different taxa, including cephalochor-
dates, echinoderms, insecta, cnidaria,
and placozoa. All of these proteins
contain sequences related to the C
terminus of Sororin, which we therefore
call the ‘‘Sororin domain’’ (Figure S5A). Furthermore, 17 of these
proteins also contain an FGF sequence motif (Figure S5B), or
sometimes several of these motifs (Figure 7A).
Of the 18 hypothetical proteins, only one has previously been
characterized. This is a 95 kDa protein called Dalmatian, which is
required for development of theDrosophila embryonic peripheral
nervous system (Prokopenko et al., 2000). Recent RNAi screens
have shown that depletion of Dalmatian causes defects in mitotic
spindle assembly, chromosome alignment, and cell division
(Goshima et al., 2007; Somma et al., 2008). Dalmatian inactiva-
tion also causes precocious sister chromatid separation in the
presence of colchicine, a compound that activates the SAC. It
has therefore been proposed that Dalmatian is required for the
SAC (Somma et al., 2008).
Because Dalmatian shares sequence similarity with Sororin,
we tested whether Dalmatian is required for cohesion. If this
746 Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc.
were the case, Dalmatian depletion would be predicted to cause
precocious sister chromatid separation, to activate the SAC, and
thus to cause an increase in mitotic index, whereas inactivation
of a SAC protein would shorten mitosis and cause a decrease
in mitotic index. We observed a modest increase in mitotic index
from 3.2% in control Drosophila S2 cells to 5.3% in Dalmatian
RNAi cells, whereas depletion of BubR1, a protein required for
the SAC (Perez-Mongiovi et al., 2005), decreased the mitotic
index to 1.4% (data not shown). Chromosome spreading re-
vealed that cohesion had been lost in 82% of all mitotic Dalma-
tian RNAi cells, but only in less than 6% of mitotic control or
BubR1 RNAi cells (Figures 6B and 6C). In IFM experiments, we
observed that Dalmatian depletion caused chromosome con-
gression defects (‘‘scattered chromosomes’’) in 57.6% of prom-
eta/metaphase cells (Figure 6D). Many of the scattered chromo-
somes were single sister chromatids, as judged by staining of
the centromere protein centromere identifier (CID), and Cyclin
B levels were similarly high in cells with scattered chromatids
as in control prometaphase cells. Because SAC defects would
lead to precocious APC/CCdc20 activation and Cyclin B degrada-
tion, these results indicate that Dalmatian depletion does not
inactivate the SAC. Instead, our results suggest that Dalmatian
is a distant ortholog of Sororin that is required for cohesion.
DISCUSSION
Although establishment and maintenance of sister chromatid
cohesion are essential for chromosome segregation, it is poorly
understood how cohesin generates cohesive structures during
DNA replication and how these are maintained for hours, or in
the case of mammalian oocytes even for years. Recent studies
have revealed that both the stability of cohesin-DNA interactions
(Gerlich et al., 2006) and the acetylation state of cohesin change
during DNA replication (Ben-Shahar et al., 2008; Rowland et al.,
2009; Unal et al., 2008; Zhang et al., 2008), suggesting that cohe-
sion is not simply established by doubling the number of sister
chromatids inside otherwise unchanged cohesin rings. Our
results further extend this view by showing that also the compo-
sition of cohesin complexes changes during DNA replication
through the recruitment of Sororin, and importantly our data
suggest that only Sororin-associated cohesin complexes are
able to mediate cohesion. Consistent with this view, we find
that Sororin is the only known protein whose presence on chro-
matin coincides precisely with the periods of the cell cycle during
which cohesion exists (from initiation of DNA replication to meta-
phase), whereas cohesin binds to DNA long before cohesion is
established.
Based on our results, we propose the following model for how
Sororin enables cohesin to become ‘‘cohesive’’ (Figure 6C):
Smc3 acetylation and possibly other unidentified events during
DNA replication promote the recruitment of Sororin to chro-
matin-bound cohesin. These events might occur directly at repli-
cation forks because Eco1 has been detected at these sites
(Lengronne et al., 2006), Smc3 can only be acetylated on chro-
matin (Unal et al., 2008; this study), and actinomycin D,
a compound that inhibits DNA polymerase and MCM helicase
progression (Pacek and Walter, 2004), prevents both Smc3 acet-
ylation and Sororin recruitment. Because Smc3 acetylation and
Sororin recruitment are blocked less efficiently by aphidicolin
and thymidine, in whose presence helicase progression can still
occur, it is possible that Smc3 acetylation and Sororin binding
are coupled to helicase progression. Within the cohesin
complex, Sororin binds to Pds5 via an FGF sequence motif
that is shared between Sororin and Wapl. Sororin displaces
Wapl from Pds5, but not from cohesin, suggesting that Sororin
induces a rearrangement in the topology of these cohesin-
associated proteins. We propose that these changes inhibit
Wapl’s ability to dissociate cohesin from DNA, and that the re-
sulting stable interaction of cohesin with DNA enables cohesin
to mediate cohesion. Our data further indicate that in prophase,
Sororin is inactivated by phosphorylation, enabling Wapl to
dissociate cohesin from mitotic chromosomes. Later in telo-
phase and G1, APC/CCdh1 targets Sororin for degradation. The
function of this process remains to be understood, but it might
ensure that Sororin associates with cohesin only after the initia-
tion of DNA replication once APC/CCdh1 has been inactivated.
This model makes a number of important predictions: (1) If So-
rorin is an antagonist of Wapl, one would expect that Sororin or-
thologs can be identified in species where Wapl exists. We show
that this is indeed the case for many metazoans, including
species from evolutionarily old taxa such as cnidaria (jellyfish)
and placozoa, the simplest known metazoa. Our observation
that depletion of the Drosophila member of this protein family
(Dalmatian) causes cohesion defects suggests that these
proteins are also functionally related to Sororin. We have so far
not been able to identify Sororin-related proteins in worms or
yeast. It therefore remains to be seen whether Sororin is required
for cohesion in all eukaryotes, or whether some species have
evolved cohesion mechanisms that are independent of Sororin.
(2) If the key function of Sororin is to inhibit Wapl, then Sororin
is expected to be dispensable in the absence of Wapl. Our
results indicate that this is indeed the case. An interesting impli-
cation of this result is that Sororin might not be essential for the
initial entrapment of sister chromatids by cohesin rings, i.e., for
cohesion establishment, at least in the absence of Wapl. It is
therefore possible that Sororin’s main function is to prevent
dissociation of cohesin from DNA, rather than enabling opening
and closure of the ring around DNA. However, the situation could
be different in yeast where deletion of WAPL/RAD61 does not
result in accumulation of cohesin on DNA but has the opposite
effect, a reduction of cohesin on chromatin (Rowland et al.,
2009; Sutani et al., 2009). If a Sororin-related Wapl/Rad61 antag-
onist exists in yeast, such a protein (or protein domain) might
therefore instead be needed for cohesion establishment by
having to overcome the proposed ‘‘anti-establishment’’ activity
of Wapl/Rad61 (Rowland et al., 2009; Sutani et al., 2009).
(3) If the stable postreplicative association of cohesin with
DNA was due to inhibition of Wapl by Sororin, depletion of
Wapl should enable cohesin to bind to DNA also stably before
Sororin has been recruited to cohesin, i.e., in G1 phase. At vari-
ance with this prediction, we observed previously that depletion
of Wapl from HeLa cells increased the residence time of dynam-
ically bound cohesin complexes only modestly, from 8 min in
control cells to 18 min (Kueng et al., 2006), and not to many
hours, as is normally seen for cohesin complexes in G2 phase
(Gerlich et al., 2006). However, we have in the meantime
Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc. 747
measured the residence time of cohesin on chromatin in mouse
embryonic fibroblasts from which the Wapl gene has been
deleted, and in which therefore a more complete depletion of
Wapl can be achieved than by RNAi. In these cells the residence
time of cohesin on chromatin is increased from minutes to
several hours even before S phase (A. Tedeschi, personal
communication), indicating that it is indeed the presence of
Wapl that enables cohesin to interact with DNA dynamically
before replication. This result supports the hypothesis that inhi-
bition of Wapl by Sororin enables stable binding of cohesin to
DNA in postreplicative cells.
Our model also raises several important new questions. One of
them is whether the essential function of Smc3 acetylation is to
recruit Sororin, or whether this modification has other important
effects, for example on the ATPase activity of Smc3. The
absence of Sororin in yeast would suggest that cohesin acetyla-
tion must have other essential functions, but given the low
sequence similarity among Sororin orthologs it cannot be
excluded that Sororin-related proteins also exist in yeast.
A related important question is how Smc3 acetylation might
promote recruitment of Sororin. As Pds5 proteins are required
for the recruitment of Sororin to cohesin, and Sororin binds to
Pds5 proteins, we suspect that Smc3 acetylation promotes So-
rorin binding indirectly, possibly by causing changes in how
Pds5 or Wapl interact with cohesin or each other. Likewise, it
is unclear why replacement of K105/106 to not only glutamine
(which is believed to mimic acetylated lysine) but also to arginine
or alanine residues can stabilize cohesin-Sororin interactions. It
is possible that it is not the presence of acetyl residues on
K105/106 that creates a binding site, for example for a cohesin
subunit, but that any mutation that removes lysines at these posi-
tions will destroy a binding site or pocket, which would lead to
subunit rearrangements that would facilitate Sororin recruitment.
A more detailed characterization of how cohesin interacts with
Wapl, Pds5, and Sororin will be required to address these
questions.
EXPERIMENTAL PROCEDURES
Immunodepletion and Monitoring of DNA Replication in Xenopus
Egg Extracts
For immunodepletion of Xenopus egg extracts, affinity-purified antibody (70
mg anti-Sororin, mixture of 40 mg anti-Pds5A and 25 mg anti-Pds5B, 200 mg
anti-Wapl, or 250 mg anti-SA1/2) was conjugated to 30 ml Affi-Prep Protein A
Matrix (Bio-Rad), mixed with 100 ml interphase extracts, incubated for 30
min for Sororin depletion or 1 hr for Pds5A/B, Wapl, and SA1/2 depletions
on ice, and beads were removed by centrifugation. For add-back experiments,
Sororin wild-type or AA mutant (F166A, F168A) was added to Sororin-depleted
extracts at 6.5 nM.
DNA replication was monitored by the incorporation of [a-32P]dCTP into
DNA. Demembranated sperm nuclei (2000 nuclei/ml) were added to egg
extract containing [a-32P]dCTP (3.7 kBq/ml), incubated at 22�C, and the reac-
tion stopped by addition of 2 volumes of stop solution (8 mM EDTA, 0.13%
phosphoric acid, 10% Ficoll, 5% SDS, 0.2% bromophenol blue, 80 mM Tris-
HCl pH 8.0). The mixture was incubated with 2 mg/ml Proteinase K for 30
min at 37�C and analyzed by agarose gel electrophoresis followed by
autoradiography.
Preparation of Xenopus Chromatin Fractions
Sperm nuclei were incubated in extracts at a concentration of 2000 nuclei/ml.
Thirty microliters of extract was diluted 10-fold with ice-cold extract buffer (EB;
5 mM MgCl2, 100 mM KCl, HEPES-KOH pH 7.5) containing 0.25% Triton X-
100, overlaid onto a 30% sucrose/EB cushion, and spun at 15,000 g for 10
min. The pellets were washed with EB containing 0.25% Triton X-100 and re-
suspended in SDS sample buffer.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures, five
figures, and one table and can be found with this article online at doi:10.
1016/j.cell.2010.10.031.
ACKNOWLEDGMENTS
We are grateful to O. Hudecz, P. Huis in’t Veld, I. Poser, and M. Sykora for
assistance and reagents; to G. Karpen, J. Knoblich, C. Lehner, and C. Sunkel
for reagents and advice on Drosophila experiments; and to N. Kraut for BI
2536. T.N. is supported by the European Molecular Biology Organization
(EMBO) and the Japanese Society for the Promotion of Science (JSPS). K.S.
is supported by Grant-in-Aid for Scientific Research (S). Research in the
groups of J.-M.P. and K.M. is supported by Boehringer Ingelheim and the
Austrian Science Fund via the special research program ‘‘Chromosome
Dynamics’’ (F34-B03). Work in the groups of J.-M.P., K.M., and A.A.H. was
also supported by the EC via the Integrated Project ‘‘MitoCheck.’’
Received: May 20, 2010
Revised: August 30, 2010
Accepted: October 21, 2010
Published: November 24, 2010
REFERENCES
Ben-Shahar, T., Heeger, S., Lehane, C., East, P., Flynn, H., Skehel, M., and
Uhlmann, F. (2008). Eco1-dependent cohesin acetylation during establish-
ment of sister chromatid cohesion. Science 321, 563–566.
Diaz-Martinez, L.A., Gimenez-Abian, J.F., and Clarke, D.J. (2007). Regulation
of centromeric cohesion by sororin independently of the APC/C. Cell Cycle 6,
714–724.
Gandhi, R., Gillespie, P.J., and Hirano, T. (2006). Human Wapl is a cohesin-
binding protein that promotes sister-chromatid resolution in mitotic prophase.
Curr. Biol. 16, 2406–2417.
Gerlich, D., Koch, B., Dupeux, F., Peters, J.M., and Ellenberg, J. (2006). Live-
cell imaging reveals a stable cohesin-chromatin interaction after but not before
DNA replication. Curr. Biol. 16, 1571–1578.
Gillespie, P.J., and Hirano, T. (2004). Scc2 couples replication licensing to
sister chromatid cohesion in Xenopus egg extracts. Curr. Biol. 14, 1598–1603.
Goshima, G., Wollman, R., Goodwin, S.S., Zhang, N., Scholey, J.M., Vale,
R.D., and Stuurman, N. (2007). Genes required for mitotic spindle assembly
in Drosophila S2 cells. Science 316, 417–421.
Gruber, S., Haering, C.H., and Nasmyth, K. (2003). Chromosomal cohesin
forms a ring. Cell 112, 765–777.
Hou, F., and Zou, H. (2005). Two human orthologues of Eco1/Ctf7 acetyltrans-
ferases are both required for proper sister-chromatid cohesion. Mol. Biol. Cell
16, 3908–3918.
Kueng, S., Hegemann, B., Peters, B.H., Lipp, J.J., Schleiffer, A., Mechtler, K.,
and Peters, J.M. (2006). Wapl controls the dynamic association of cohesin with
chromatin. Cell 127, 955–967.
Lengronne, A., McIntyre, J., Katou, Y., Kanoh, Y., Hopfner, K.P., Shirahige, K.,
and Uhlmann, F. (2006). Establishment of sister chromatid cohesion at the
S. cerevisiae replication fork. Mol. Cell 23, 787–799.
Nasmyth, K., and Haering, C.H. (2009). Cohesin: its roles and mechanisms.
Annu. Rev. Genet. 43, 525–558.
Onn, I., Heidinger-Pauli, J.M., Guacci, V., Unal, E., and Koshland, D.E. (2008).
Sister chromatid cohesion: a simple concept with a complex reality. Annu.
Rev. Cell Dev. Biol. 24, 105–129.
748 Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc.
Pacek, M., and Walter, J.C. (2004). A requirement for MCM7 and Cdc45 in
chromosome unwinding during eukaryotic DNA replication. EMBO J. 23,
3667–3676.
Perez-Mongiovi, D., Malmanche, N., Bousbaa, H., and Sunkel, C. (2005).
Maternal expression of the checkpoint protein BubR1 is required for
synchrony of syncytial nuclear divisions and polar body arrest in Drosophila
melanogaster. Development 132, 4509–4520.
Peters, J.M. (2006). The anaphase promoting complex/cyclosome: a machine
designed to destroy. Nat. Rev. Mol. Cell Biol. 7, 644–656.
Peters, J.M., Tedeschi, A., and Schmitz, J. (2008). The cohesin complex and its
roles in chromosome biology. Genes Dev. 22, 3089–3114.
Poser, I., Sarov, M., Hutchins, J.R., Heriche, J.K., Toyoda, Y., Pozniakovsky,
A., Weigl, D., Nitzsche, A., Hegemann, B., Bird, A.W., et al. (2008). BAC Trans-
geneOmics: a high-throughput method for exploration of protein function in
mammals. Nat. Methods 5, 409–415.
Prokopenko, S.N., He, Y., Lu, Y., and Bellen, H.J. (2000). Mutations affecting
the development of the peripheral nervous system in Drosophila: a molecular
screen for novel proteins. Genetics 156, 1691–1715.
Rankin, S., Ayad, N.G., and Kirschner, M.W. (2005). Sororin, a substrate of the
anaphase-promoting complex, is required for sister chromatid cohesion in
vertebrates. Mol. Cell 18, 185–200.
Rowland, B.D., Roig, M.B., Nishino, T., Kurze, A., Uluocak, P., Mishra, A.,
Beckouet, F., Underwood, P., Metson, J., Imre, R., et al. (2009). Building sister
chromatid cohesion: Smc3 acetylation counteracts an antiestablishment
activity. Mol. Cell 33, 763–774.
Sakuno, T., and Watanabe, Y. (2009). Studies of meiosis disclose distinct roles
of cohesion in the core centromere and pericentromeric regions. Chromosome
Res. 17, 239–249.
Schmitz, J., Watrin, E., Lenart, P., Mechtler, K., and Peters, J.M. (2007).
Sororin is required for stable binding of cohesin to chromatin and for sister
chromatid cohesion in interphase. Curr. Biol. 17, 630–636.
Shintomi, K., and Hirano, T. (2009). Releasing cohesin from chromosome arms
in early mitosis: opposing actions of Wapl-Pds5 and Sgo1. Genes Dev. 23,
2224–2236.
Somma, M.P., Ceprani, F., Bucciarelli, E., Naim, V., De Arcangelis, V.,
Piergentili, R., Palena, A., Ciapponi, L., Giansanti, M.G., Pellacani, C., et al.
(2008). Identification of Drosophila mitotic genes by combining co-expression
analysis and RNA interference. PLoS Genet. 4, e1000126.
Sutani, T., Kawaguchi, T., Kanno, R., Itoh, T., and Shirahige, K. (2009). Budding
yeast Wpl1(Rad61)-Pds5 complex counteracts sister chromatid cohesion-
establishing reaction. Curr. Biol. 19, 492–497.
Takahashi, T.S., Yiu, P., Chou, M.F., Gygi, S., and Walter, J.C. (2004). Recruit-
ment of Xenopus Scc2 and cohesin to chromatin requires the pre-replication
complex. Nat. Cell Biol. 6, 991–996.
Unal, E., Heidinger-Pauli, J.M., Kim, W., Guacci, V., Onn, I., Gygi, S.P., and
Koshland, D.E. (2008). A molecular determinant for the establishment of sister
chromatid cohesion. Science 321, 566–569.
Waizenegger, I.C., Hauf, S., Meinke, A., and Peters, J.M. (2000). Two distinct
pathways remove mammalian cohesin from chromosome arms in prophase
and from centromeres in anaphase. Cell 103, 399–410.
Zhang, J., Shi, X., Li, Y., Kim, B.J., Jia, J., Huang, Z., Yang, T., Fu, X., Jung,
S.Y., Wang, Y., et al. (2008). Acetylation of Smc3 by Eco1 is required for
S phase sister chromatid cohesion in both human and yeast. Mol. Cell 31,
143–151.
Cell 143, 737–749, November 24, 2010 ª2010 Elsevier Inc. 749
Nonenzymatic Rapid Controlof GIRK Channel Functionby a G Protein-Coupled Receptor KinaseAdi Raveh,1 Ayelet Cooper,1 Liora Guy-David,1 and Eitan Reuveny1,*1Department Biological Chemistry Weizmann Institute of Science, Rehovot 76100, Israel
*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.10.018
SUMMARY
G protein-coupled receptors (GPCRs) respond toagonists to activate downstream enzymatic path-ways or to gate ion channel function. Turning offGPCR signaling is known to involve phosphorylationof the GPCR by GPCR kinases (GRKs) to initiate theirinternalization. The process, however, is relativelyslow and cannot account for the faster desensitiza-tion responses required to regulate channel gating.Here, we show that GRKs enable rapid desensitiza-tion of the G protein-coupled potassium channel(GIRK/Kir3.x) through a mechanism independent oftheir kinase activity. On GPCR activation, GRKstranslocate to the membrane and quench channelactivation by competitively binding and titrating Gprotein bg subunits away from the channel. Ofinterest, the ability of GRKs to effect this rapid desen-sitization depends on the receptor type. The findingsthus reveal a stimulus-specific, phosphorylation-independent mechanism for rapidly downregulatingGPCR activity at the effector level.
INTRODUCTION
G protein-coupled receptors (GPCR) modulate the activity of
enzymes and ion channels to fine tune cellular activity (Pierce
et al., 2002). To avoid abnormal cellular activity, GPCR-mediated
G protein cycles should be temporally precise. Several mecha-
nisms guarantee the precise length of GPCR activation by
controlling the levels of agonist. For example, the level of free
neurotransmitters present in the synapse are limited by fast
neurotransmitter reuptake at the presynaptic site (Torres et al.,
2003), or degradation at the synaptic cleft (Massoulie et al.,
1993). These processes are specific for specific types of ligands.
For regulation at a longer time scale, additional mechanisms
control GPCR signaling efficacy. These mechanisms control
the robustness of the activation signals by regulating receptor
number at the plasma membrane, in a process termed downre-
gulation (Bunemann et al., 1999; Tsao and von Zastrow, 2000).
This mechanism involves a receptor-mediated signaling
cascade, where activated receptors are initially phosphorylated
by GPCR kinases (GRKs), to initiate intracellular events leading
to a clathrin-mediated endocytosis of the GPCRs. This process
occurs over a time scale of many minutes to hours.
In the context of GPCR-mediated regulation of ion channel
activity, short-term desensitization to an activating signal has
been observed. For instance, regulation of GPCR-controlled
excitability through the activation of the G protein-coupled
potassium channels (GIRK/Kir3.x), displays short-term desensi-
tization characterized by a reduction in channel currents in the
presence of the receptor agonist in a time scale of few seconds
(Sickmann and Alzheimer, 2003). This short-term reduction in
postsynaptic GIRK channel activity is independent of elements
that are known to affect the G protein cycle and PtdIns(4,5)P2
hydrolysis. It is, therefore, of great interest to identify the molec-
ular mechanism that mediates this process.
We set out to identify the mechanism responsible for short-
term desensitization of GIRK channels. We found that for some
GPCRs, continued activation of their receptors leads to GIRK
current desensitization (GCD). This current desensitization is
enhanced in the presence of GRK2 and, surprisingly, does not
involve its kinase activity, but rather depends on its ability to
bind the Gbg subunits of the G protein. This binding appears
to compete for the available pool of the G protein subunits that
activate the channel and hence to effectively quench channel
activity. These findings assign a new role for the GRK proteins
in providing negative feedback control of GPCR function at the
effector level.
RESULTS
GRK2 Accelerates Desensitization of GIRK CurrentsInduced by A1R and mOR, but Not by mGluR2 and M4RWe set out to test the involvement of GRK2 in mediating short-
term desensitization of GIRK channels. GRK2 is involved in the
desensitization of GPCRs after exposure to their agonists. For
this purpose we expressed GIRK1, GIRK4 (for now on referred
as GIRK channels) and adenosine type 1 receptor (A1R) with or
without (control) GRK2 in HEK293 cells, and used whole cell
patch-clamp recordings to measure various channel current
parameters after receptor activation by adenosine (Figure 1A).
After A1R activation by adenosine (100 mM), GIRK channel
currents desensitize (GCD) as evident from the monoexponential
750 Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc.
decay curve of the current traces with a time constant of 24.9 ±
11.1 s, n = 8 (Figures 1A, upper trace, and 1C). Interestingly, in
cells cotransfected with GRK2, GCD rates were accelerated
�10-fold, to 2.6 ± 0.0 s, n = 9 (p < 0.05). To assess whether
the enhancement of current desensitization was a general
phenomena to all PTX-sensitive GPCRs, we also tested GCD
rates induced by m-opioid receptor (mOR). Similar to the effect
of GRK2 on A1R-mediated GCD, mOR activation (methionine
enkephalin, ME, 100 nM) accelerated GCD in the presence of
GRK2 compared to control cells, with a time constant of 38.9 ±
5.9 s, n = 10 and 64.4 ± 6.18 s, n = 7, respectively (see Figures
S1A and S1C available online). In contrast, activation of GIRK
channels in the absence or presence of GRK2 by metabotropic
glutamate type 2 receptor (mGluR2) (Figures 1B and 1C) or
muscarinic acetylcholine type 4 receptor (M4R) activation
(Figures S1B and S1C) did not show any acceleration in GCD,
with time constants 41.7 ± 8.6 s, n = 9 and 41.7 ± 9.5 s, n = 9,
0
20
40
60
80
100
NT siGRK2 #1 siGRK2 #2 siGRK2 #1 + smGRK2GFP
Rescue
% C
urre
nt (@
2 m
)
0
20
40
60
0
50
100
shGRK2 NT
GK2
(%)
A
B
shRNA NTGRK2
GFP
A1R
mG
luR
2
C
D
10s1000pA
mGluR2A1R
+GR
K2+G
RK2
NTsiGRK2 #1
F
G
E
0
20
40
60
80
100
NT siGRK2 #1 siGRK2 #2
GR
K2 R
NA
(%, n
orm
aliz
ed)
10s100 pA
Figure 1. GRK2 Accelerates the Desensiti-
zation of GIRK Currents Induced by A1R,
but Not by mGluR2
(A) GIRK channel currents induced by the activa-
tion of A1R rapidly desensitize in the presence of
GRK2.
(B) GIRK channel currents induced by mGluR2
activation are insensitive to GRK2.
(C) Bar plot that depicts GCD rates of cells acti-
vated with A1R or mGluR2 without or with GRK2,
GRK2 shRNA, or nontarget (NT) shRNA.
(D) Bar plot compares the normalized expression
levels of GRK2 in silenced and NT cells as de-
picted from western blot for GRK2 (inset).
(E) GIRK current traces induced by adenosine in
control HL-1 cell (black) and of siRNA#1 silenced
cell (gray).
(F) Bar plot depicting GCD in HL-1 cells trans-
fected with two independent siRNAs, NT, and
siRNA#1 transfected cells rescued by the expres-
sion of silently mutated GRK2GFP (smGRK2GFP).
(G) GRK2 mRNA quantification in HL-1 cells trans-
fected with two independent siRNAs or NT control.
See also Figure S1.
respectively for mGluR2, and 37.7 ±
10.7 s, n = 7 and 33.4 ± 11.7 s, n = 6,
respectively, for M4R. Like in the case
shown above for GRK2, GRK3, but not
GRK6, also accelerated GCD in a similar
receptor-specific manner (data not
shown).
Because GRK2 is endogenously ex-
pressed in HEK293 cells (Violin et al.,
2006), we were interested to know
whether there is a contribution of the
endogenous protein to current desensiti-
zation in cells not transfected with GRK2.
To address this question we silenced
endogenous GRK2 levels using shRNA
specific for the human GRK2 (shGRK2).
GRK2 expression levels were reduced
by 58%, as determined using western blot (Figure 1D). A1R-in-
duced GIRK currents were significantly slower in GRK2-silenced
cells (42.9 ± 6.8 s, n = 12) in comparison with cells cotransfected
with nontarget (NT) shRNA (26.0 ± 4.5 s, n = 12) (Figure 1C), con-
firming that endogenous levels of GRK2 are sufficient to enhance
GCD rate after A1R simulation. The above results suggest that
GRK2 has a role in modulating current desensitization rates of
GIRK currents in a receptor-selective manner.
To study whether GRK is also involved in GCD in cells that
natively express GIRK, A1R and the kinase, we measured
GIRK currents in HL-1 cells. HL-1 is a mouse cardiac muscle
cell-line that maintains the characteristics of adult cardiac myo-
cytes, including contraction (Claycomb et al., 1998). These cells
express both GIRK channels and the necessary components for
their activation (Nobles et al., 2010). GIRK currents of HL-1 cells,
where GRK2 was silenced using two independent siRNAs,
(siGRK2#1 and siGRK2#2) displayed significantly smaller
Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc. 751
desensitizations compared to cells transfected with NT (Figures
1E and 1F). After continuous application of adenosine, the
induced currents were reduced to 79.2 ± 11.0% (n = 6), 86.3 ±
7.3% (n = 5) and 24.7 ± 7.4% (n = 6) at 2 min, for both silenced
and NT cells, respectively. Expression of silently mutated
GRK2-GFP (smGRK2-GFP) in cells silenced with siGRK2#1
rescued the reduction in current desensitization (31.5 ± 12.5%,
n = 4) to levels comparable to NT cells (Figure 1F). Similarly,
GRK2 mRNA levels were reduced in cells transfected with either
siGRK2#1 or siGRK2#2 compared to NT control cells with 54.0 ±
2.4% and 57.1 ± 0.6%, respectively (Figure 1G). Qualitatively
similar results were obtained using primary mouse hippocampal
neurons (Figure S1). These experiments suggest that, qualita-
tively, the effect of GRK in HEK cells is relevant at physiological
expression levels, and is not due to overexpression of GRK, the
receptors or the channels.
A1R Activation Recruits GRK2-GFP to the MembraneSimultaneously with GIRK Current Desensitization,but Not mGluR2GRK2 is mainly cytosolic and translocates to the membrane to
phosphorylate active receptors (Pitcher et al., 1998). We wanted
to detect these translocations and to test whether there is a
correlation between the acceleration of GIRK desensitization
rates and GRK translocations. For this purpose, we C-terminally
tagged GRK2 with EGFP (GRK2-GFP) and used total internal
reflection fluorescence (TIRF) microscopy to detect exclusively
the membrane-associated fluorescence (Riven et al., 2003).
Cells transfected with GRK2-GFP and A1R showed a significant
GRK2-GFP basal membrane associated fluorescence (Fig-
ure 2A), as previously reported (Garcia-Higuera et al., 1994).
On A1R activation (Figures 2B and 2C) the membrane-associ-
ated fluorescent signal increased by 22.2 ± 6.2% with a t of
1.5 ± 0.4 s (Figures 2D and 2F). mOR also increased membrane
associated fluorescence on activation by 10.8 ± 2.8% with a t
of 23.4 ± 3.9 s (n = 11), temporally correlated with GCD for this
receptor (Figure S1D). Similar to the inability of mGluR2 to
accelerate GCD, membrane associated fluorescence also did
not significantly increase after mGluR2 activation (Figure 2D).
Similarly, M4R activation by carbachol did not induce GRK2
translocation to the membrane (data not shown). The transloca-
tions of GRK2-GFP to the membrane were reversible, as
membrane fluorescence returned to its basal level after washing
out the agonist (Figure S2). These results may indicate a strong
correlation between GRK2 translocation to the plasma
membrane and the acceleration in GCD rates. To further
strengthen this idea, we recorded A1R induced GIRK currents
and measured GRK-GFP translocation simultaneously, using
whole cell recording of the patch clamp technique, and quantita-
tive fluorescence under TIRF, respectively (Figure 2E). In cells
measured this way, GIRK desensitization and GRK2 recruit-
ments to the membrane occurred simultaneously, with change
of currents and membrane-associated fluorescence displaying t
of 2.4 ± 0.5 s and 4.6 ± 0.9 s, n = 5, respectively. Additional
independent observations of GCD rates and membrane-associ-
ated fluorescence increase of GRK2-GFP were also temporally
correlated with t of 1.3 ± 0.3 s, n = 20 and 1.5 ± 0.4 s, n = 11,
respectively (Figure 2F).
GPCR Phosphorylation and Receptor DownregulationAre Not Required for GRK2-Mediated GIRK CurrentDesensitizationIn the traditional view, after translocation to the membrane,
GRKs are responsible for the phosphorylation of activated
GPCRs. This event initiates the process of receptor downregula-
tion by clathrin-mediated endocytosis (Tsao and von Zastrow,
2000). To examine the relationship between this process and
the apparent GRK2-mediated acceleration in GCD as shown
above, we tested the ability of GRK2/K220R (dnGRK2), a domi-
nant negative mutant that lacks kinase catalytic activity (Kong
et al., 1994), in accelerating GCD rates (Figure 3A). The GCD
rates of cell cotransfected with GIRK, A1R, and dnGRK2 (5.5 ±
1.1 s, n = 9) were not different from cells expressing GRK2, the
receptor and channel components, with t of 2.6 ± 0.0 s (n = 9),
and significantly faster than in cells that were not cotransfected
with the kinase (24.9 ± 11.1 s; n = 8). These results suggest that
the enhancement of GCD rates is not mediated via the kinase
activity of GRK2.
Another possible mechanism for enhancing GCD might be
a change in receptor number, independent of GRK2-mediated
phosphorylation, or channel number, at the plasma membrane.
To test for these two possibilities, we C-terminally tagged the
A1R with GFP (A1R-GFP) or C-terminally tagged GIRK4 with
GFP (GIRK4-GFP) and measured plasma membrane-associated
fluorescence under TIRF. A1R-GFP and GIRK4-GFP plasma
membrane levels remained constant in the first minute after
agonist application both in control cells and in cells cotrans-
fected with GRK2, with DF/F of 96.3 ± 1.0%; n = 6 and 97.7 ±
0.3%; n = 12, for A1R-GFP and 96.4 ± 0.6%; n = 5 and
106.5 ± 1.4%; n = 9, for GIRK4-GFP, respectively (Figure 3B).
These results suggest that GRK2-mediated acceleration of the
GCD is neither due to a loss of receptors nor due to a loss of
GIRK channels from the plasma membrane.
Pertussis Toxin-Insensitive Pathways Are Sufficientto Induce GRK2 Translocations and Accelerationof GIRK Current DesensitizationThe sensitivity of A1R and mOR to GRK2-mediated desensitiza-
tion was distinct in comparison to mGluR2 and M4R, GPCRs that
display pure Gi/o activation. However, whereas A1R and mOR
primarily activate the Gi/o pathway, they may have also a
secondary transduction mechanism through different G protein
subsets (Cordeaux et al., 2004). We therefore tested whether
other minor secondary G protein activation mechanisms might
explain the selectivity of only a subset of receptors to induce
GRK2-mediated GCD. To inactivate the Gai/o pathway, we
coexpressed the catalytic subunit of pertussis toxin, PTX-S1,
that been shown to effectively abolish GPCR-mediated GIRK
activation (Sadja and Reuveny, 2009). In cells cotransfected
with PTX-S1, A1R, and GIRK channels, A1R activation did not
induce GIRK currents, in agreement with Gai/o sensitivity to
PTX (Figure 3C, middle). In contrast, when cells cotransfected
with both GRK2 and PTX-S1 were activated, the basal activity
of the GIRK channels, assessed by barium sensitivity of the
inward K+ currents at �80 mV, was rapidly reduced, in agree-
ment with the observation that a major part of GIRK basal activity
is Gbg-dependent (Rishal et al., 2005). Along the same line,
752 Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc.
GRK2 translocation to the plasma membrane remained intact,
demonstrating that GRK2 membrane recruitment is not depen-
dent on the Gai/o pathway (Figures 3D and 3E). DF/F values
without or with PTX were 7.8 ± 0.6%, n = 13 and 8.0 ± 1.0%,
n = 7, respectively. As shown above, PTX-insensitive pathways
were sufficient to induce GRK2 translocations. The involvement
of other G protein signaling pathways, Gaq and Gas, were also
tested and were found not to be involved in GRK2 action on
GCD (Figures S3).
The Effects of Mutations in GRK2 that Impair ItsInteraction with Various Auxiliary MoleculesGRK2 is known to form a quaternary complex with Gaq and Gbg
(Tesmer et al., 2005). We set out to test whether impairing its
ability to interact with these auxiliary proteins may affect the
ability of GRK2 to accelerate GCD rates. GRK2 mutations that
disrupt GRK2-Gaq interaction, GRK2/R106A;D110A (Day et al.,
2004; Sterne-Marr et al., 2003) were tested. These mutations
are located in the RGS homology domain that is known to bind
Gaq but not Gai/o (Carman et al., 1999). GRK2/R106A;D110A
also accelerated GCD, similar to wt GRK2 (Figure S4A), with t
of 1.3 ± 0.4 s, n = 6 and 1.3 ± 0.3 s, n = 20, respectively.
GRK2D97-140, a GRK2 mutant that lacks the two helices that
are involved in GRK2-Gaq interaction, was also able enhance
GCD with t of 3.2 ± 0.8 s; n = 8. These results indicate that
A B
C
E
D
Figure 3. Kinase Catalytic Activity Is Not Required for GRK2 Effect
on GCD
A1R-GFP or GIRK1/GIRK4-GFP plasma membrane levels are not affected by
A1R stimulation. PTX treatment is not affecting basal GCD and membrane
recruitment.
(A) A bar graph summarizing measurements of GCD rates (t, s) from cells
cotransfected with GRK2/K220R (dnGRK2), GIRK, and A1R.
(B) The relative change of membrane fluorescence under TIRF (DF/F, %) asso-
ciated with either A1R-GFP or GIRK1/GIRK4-GFP before and during A1R
activation (1 min after adenosine application).
(C) Typical current traces of cells expressing GIRK and A1R (control); GIRK,
A1R and PTX (+PTX); and GIRK, A1R, PTX and GRK2 (+PTX +GRK2).
(D) A bar plot summarizing DF/F of GRK2-GFP signal after A1R activation,
measured under TIRF in cells expressing GIRK, PTX, and GRK2.
(E) A typical TIRF data of the membrane fluorescence change of GRK2-GFP
overtime of a cell expressing PTX after A1R activation.
See also Figure S3.
60
100
140
180
0 20 40 6
Fluo
resc
ence
Time (s)
0.0
1.0
2.0
Current desensitization
GRK2 translocation
t 0.6
7 (s
)
t=0 t=60s +AdeA
C
B
0
10
20
30
A1R mGluR2
dF/F
(%)
D
1s
Ade
20pA
FluorescenceCurrent
(s)
F
Ade
E
dF/F
(%)
Figure 2. A1R Activation Recruits GFP-Tagged GRK2 to the
Membrane Simultaneously with GCD as Revealed under TIRF
(A) A TIRF image of HEK293 cell transfected with GRK2-GFP. Basal membra-
nous fluorescence can be detected before stimulation by A1R.
(B) Image of the same cell in the presence of adenosine.
(C) Time course of fluorescence increase seen on receptor activation.
(D) A bar plot comparing the relative membrane-associated fluorescent
change (DF/F, in %) of GRK2-GFP after activation of A1R or mGluR2.
(E) Typical trace of whole-cell GIRK currents (black) and TIRF signal (green)
recorded simultaneously from the same cell.
(F) Bar graph depicting the similarity between GRK2-GFP translocation and
GCD rates.
See also Figure S2.
Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc. 753
GRK2 interaction with Gaq is not required for GRK2 action on
GIRK currents.
The interactions between GRK2 and Gbg or phosphatidylino-
sitol 4,5-bisphosphate (PtdIns(4,5)P2) have also been thoroughly
studied in vitro, with different point mutations in GRK2
PH-domain (Carman et al., 2000; Sterne-Marr et al., 2003;
Touhara et al., 1995). Because both Gbg and PtdIns(4,5)P2 are
key players in the activation of GIRK channels (Huang et al.,
1998; Logothetis et al., 1987; Reuveny et al., 1994; Sui et al.,
1998), the GRK2-mediated enhancement of GCD might involve
interference of the interactions with these two molecules. We
thus compared GCD rates of control and GRK2 transfected cells,
and compared them with cells coexpressing the various GRK2
mutants (Figure 4A): GRK2/R587Q (Carman et al., 2000) and
GRK2/K663E;K665E;K667E (Touhara et al., 1995), that disrupt
the interactions of the kinase with Gbg, and GRK2/
K567E;R578E mutant that disrupts GRK2-PtdIns(4,5)P2 interac-
tions. Disrupting GRK2 interactions with Gbg abolished the
GRK2-mediated enhancement of GCD with t of 15.6 ± 1.9 s,
n = 32 and 12.6 ± 1.8 s, n = 15 for the GRK2/R587Q and
GRK2/K663E;K665E;K667E, respectively (Figure 4B). These
rates are comparable with cells that do not coexpress GRK2,
(t of 19.3 ± 2.1 s, n = 37). Furthermore, mutations that interrupt
GRK2 interactions with PtdIns(4,5)P2, GRK2/K567E;R578E
partially reduced the enhancement of GCD with t of 5.8 ±
0.6 s, n = 13. When the ability of membrane translocation after
receptor activation was tested for both PtdIns(4,5)P2 and Gbg
interaction mutants, using GRK2/K567E;R578E-GFP, GRK2/
K663E;K665E;K667E-GFP or GRK2/R587Q-GFP, respectively,
translocations to the membrane could be seen, but were
reduced in comparison to the wt GRK2 (Figure S4B). On the
contrary, a triple mutant GRK2/K567E;R578E;R587Q-GFP, in
which mutations that disrupt both Gbg and PtdIns(4,5)P2 binding
were introduced, no translocations were observed (Figure S4B).
These results are in agreement with the observations of coordi-
nated interactions of GRK2 with Gbg and PtdIns(4,5)P2 in
mediating GRK2 membrane recruitment (Pitcher et al., 1995).
To address whether the inability of GRK2/R587Q to accelerate
GCD is due to its reduced membrane translocation, we tethered
wild-type GRK2-GFP and GRK2/R587Q-GFP to the membrane
by fusing them with Src-myristoylation signal (myrGRK2-GFP
and myrGRK2/R587Q-GFP, respectively) (Figure 4C). GCD rates
were 1.3 ± 0.5 s (n = 8) and 23.9 ± 5.4 s (n = 5), for myrGRK2-GFP
and myrGRK2/R587Q-GFP, respectively (p < 0.05). Moreover,
five cells expressing myrGRK2/R587Q-GFP did not display
GCD at all. This supports the idea that failure of myrGRK2/
R587Q to accelerate GCD is due to its inability to chelate Gbg,
and not due to its impaired membrane targeting.
GRK2 Does Not Cause Desensitizationof Constituently Active GIRK MutantsBecause Gbg-GRK2 interactions seem to play an important role
in mediating the enhancement of GCD, one possible scenario is
that GRK2 is competing with the GIRK channel for Gbg on A1R-
activated release. To test this possibility, we examined the effect
of GRK on constituently active, Gbg independent GIRK mutant
channels (Sadja et al., 2001), GIRK1/S170P;GIRK4/S176P (Fig-
ure 5A). To avoid saturation and to ensure high quality voltage
clamp, we recorded currents in 5.6 mM external K+ solution.
Whole cell recordings of GIRK1/S170P;GIRK4/S176P show
high basal activity regardless of receptor activation (Figure S5)
(Sadja et al., 2001), with only a minor current induction on aden-
osine application. In contrast to wt GIRK recordings, GRK2 failed
to accelerate the GCD rates of the mutant channels (Figure 5B).
Currents flowing through GIRK1/S170P;GIRK4/S176P channel
mutants without or with GRK2 cotransfection showed current
levels of 95 ± 2%, n = 8 and 81 ± 4%, n = 10 (at 5 s of agonist
application), respectively. This is in contrast to the significant
GCD observed for the wild-type channel that had a reduction
of the residual current from 94 ± 14%, n = 7 to only 21 ± 4%,
n = 10 with GRK2 cotransfection at the same time point
(Figure 5B). These findings further point toward the possibility
that GRK2-mediated GCD involves the competition between
the channel and GRK2 for Gbg subunit.
B
A
C
Figure 4. GRK2 Mutants with Impaired GbgBinding Capability Fail to
Accelerate GIRK Desensitization
(A) A cartoon that displays the structure of the complex of GRK2 with Gbg
(Tesmer et al., 2005). The locations of the different point-mutations that were
used in (B) are marked in red.
(B) A bar plot summarizing the desensitization rates (t, s) of GIRK currents,
measured from cells transfected with GIRK channel, A1R, and the various
GRK2 mutants.
(C) A bar plot comparing the effect of myristoylated GRK2 (myr-GRK2) and
myrGRK2/R587Q mutant on GIRK desensitization rate.
See also Figure S4.
754 Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc.
In light of the results described above, we were interested to
test whether PtdIns(4,5)P2 depletion from the channel may also
account for GRK2-mediated GCD. Therefore, we took an
advantage of the previously described GIRK mutants that
display enhanced PtdIns(4,5)P2 affinity, GIRK1/M223L;GIRK4/
I229L (Koike-Tani et al., 2005; Zhang et al., 1999) (Figure 5C).
Increasing GIRK channel affinity to PtdIns(4,5)P2 did not inhibit
the action of GRK2 on GCD rates, where GIRK1/M223L;
GIRK4/I229L without or with GRK2 showed (at 5 s during agonist
application) residual currents of 75 ± 4%, n = 13 and 31 ± 7%,
n = 16, respectively. Wild-type GIRK without or with GRK2
showed residual currents of 88 ± 5%, n = 7 and 14 ± 4%, n = 10,
respectively (Figure 5D). These results demonstrate that
GRK2-mediated acceleration of GCD does not occur by PtdIns
(4,5)P2 depletion from the channel.
A1R Activation Increases the Fraction of GRK2-BoundGbg PopulationAs shown above, mutations that impair GRK2-Gbg interaction
abolish the ability of GRK2 to accelerate GCD. To obtain further
evidence that indeed GRK2 binds Gbg in the context of the
plasma membrane, we recorded dynamic FRET using fluores-
cence lifetime approach (FRET-FLIM), under TIRF microscopy.
In this method donor fluorescence lifetime is recorded continu-
ously and shortening in donor lifetime is indicative of FRET. For
this purpose we used YFP and mCherry as donor and acceptor,
respectively. This pair has the advantage of a significant overlap
between donor emission and acceptor absorption, yet leaving an
acceptor-free donor fluorescence bandwidth for detection,
resulting in high FRET efficiencies (Goedhart et al., 2007) (Fig-
ure S6A). YFP has a nearly monoexponential lifetime decay
(Figures S6A and S6B) (Kremers et al., 2006), making it suitable
for use as a donor for FLIM measurements. Although cytosolic
+GRK2
Ade
Ade
50pA10s
Ba++
Ba++CONTROL
200pA10s
Ade
Ade
Ba++
Ba++
0
20
40
60
80
100
WT GIRK1/M223L; GIRK4/I229L
% C
urre
nt (
@ 5
s)
CONTROL GRK2
+GRK2
CONTROL
0
20
40
60
80
100
120
WT GIRK1/S170P; GIRK4/S176P
% C
urre
nt (@
5 s
)
CONTROL GRK2
A C
B D
Figure 5. Constituently Active, Gbg-Inde-
pendent, but Not GIRK Mutants that Have
Higher Affinity to PtdIns(4,5)P2, Are Insensi-
tive to GRK2
(A) Typical traces of GIRK1/S170P;GIRK4/S176P
channel mutants, without (upper trace) or in the
presence of GRK2 (lower trace).
(B) A bar plot summarizing the residual current
(in % of total current) after agonist application
without (dark gray) and in the presence of GRK2
(light gray).
(C) Typical current traces of GIRK1/M223L;GIRK4/
I229L channel mutants, without (upper trace) or in
the presence of GRK2 (lower trace).
(D) A bar plot summarizing the residual current (in
% of induced current) after agonist application
from cell without (dark gray) and with GRK2
(light gray). In both case, desensitization was
measure 5 s after agonist application.
See also Figure S5.
YFP showed a t of 2.6 ± 0.0 ns, n = 10,
in a fused dimer of YFP and mCherry
a subpopulation (92.9 ± 0.5%) of the
donor molecules displayed a much
shorter lifetime (0.6 ± 0.0 ns) corresponding to a FRET efficiency
of 76.7 ± 0.2%, n = 10 (Figure S6A). We set out to measure the
changes in FRET between N-terminally fused Gb1 with YFP
(YFP-Gb1) (Riven et al., 2006) and C-terminally fused GRK2
with mCherry (GRK2-Cherry) (Figure 6A). On A1R activation
YFP-Gb1 fluorescence decreased in the presence of GRK2-
Cherry, in agreement with YFP fluorescence quenching by
mCherry due to FRET (Figure 6B). Fitting the fluorescence life-
time decays of the donor over time revealed that, at rest, two
donor subpopulations exist (Figure 6C). One subpopulation
(22.6 ± 0.9%, n = 8) contains YFP-Gb1 proteins that interact
with GRK2-Cherry and hence result in shorter fluorescent life-
times of 0.6 ± 0.1 ns, n = 8. The remaining fraction consists of
free YFP-Gb1 proteins that display the characteristic monoexpo-
nential lifetime of YFP-Gb1 monomers (t-3.04 ns; see Fig-
ure S6B). After A1R activation, the relative fraction of YFP-Gb1
subunits that interact with GRK2-Cherry increases, seen as an
increase in the relative fraction of the shorter lifetime constants
(to 29.4 ± 1.6%, n = 8, p < 0.05) and as a decrease in the fraction
displaying long lifetime of the YFP (Figure 6C, D). The time
course of the shift in relative fraction of short and long lifetimes
(4.2 ± 0.7 s) resembles GCD rates and GRK2 translocations.
Similar correlation was seen when mOR was used, the rates of
YFP-Gb1 association with GRK2-Cherry was similar to the
GCD and to the GRK2-GFP translocation rates, with t average
for binding increase of 69.5 ± 15.3 s (n = 6) (Figure S6C). These
findings support the above observations that GRK2 action on
GCD is mediated through the binding of Gbg to GRK2.
DISCUSSION
Desensitization is an important cellular mechanism that allows
cells to adapt to long-term external stimuli. In the case of
Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc. 755
GPCR signaling pathways, desensitization is mediated by a
decrease in the cellular response to a continuous GPCR stimula-
tion by agonists, resulting in a decrease in receptor number at
the plasma membrane. This process, that takes minutes to
hours, is mediated by phosphorylation of the receptor by GRK,
leading to clathrin-mediated endocytosis, in a process termed
downregulation (Bunemann et al., 1999; Tsao and von Zastrow,
2000). In addition to this well characterized process, other
mechanisms are necessary for a more rapid control of GPCR-
mediated signaling, specifically when the signal is intended to
control changes in electrical responsiveness of cells. In this
study we have described a mechanism that is responsible for
the termination of GPCR-mediated activation of GIRK channels,
which occurs within seconds.
In locus ceruleus neurons, Blanchet and Luscher (2002)
showed that prolonged activation of the mOR leads to inhibition
of GIRK function. It was shown that whereas mOR-mediated
presynaptic inhibition remained constant over time, postsyn-
aptic inhibition, mediated by GIRK activation, showed strong
desensitization of the response, indicating control over the
GIRK currents downstream of the receptors. This decrease in
GIRK currents could be overcome by additional activation of
G protein pathways. As a possible model for their results, it
was suggested that the receptor might activate Gbg scaven-
gers such as GRK2 and GRK3, to induce competitive inhibition
on GIRK activation. In a separate study using the same
neurons, it was shown that GCD was dependent on two molec-
ular pathways, the b-arrestin/GRK2 and the ERK1/2 pathways
(Dang et al., 2009). These findings suggested that GCD might
involve modifications of the G protein pathway that serves to
translate receptor activation to GIRK gating. In contrast, GCD
by muscarinic receptor stimulation has been attributed to
a mechanism solely involved the GPCR phosphorylation-
dependent and independent mechanisms by GRK2, and not
the G protein subunits (Shui et al., 1998). Here, using electro-
physiological and fluorescence resonance energy transfer
techniques, we unequivocally demonstrate that GRK2 is the
component of the G protein pathway that mediates this
short-term current decrease in the presence of the receptor
agonist. The molecular mechanism of this action will be
discussed below.
Based on our results, we suggest the following mechanism for
GRK2-mediated GCD (Figure 7): at rest, trimeric G-proteins are
bound to the nonactivated Gi/o-coupled GPCR and the channel
(Riven et al., 2006). After receptor activation by an agonist, the
Gbg subunits dissociate from the Ga subunit to interact with
the Gbg-binding domains on the channel, and promote channel
gating (opening). At the same time, GRK2 is recruited, either
within the two-dimensional space of the membrane (within
100 nm of the membrane space), or through the classical
cytosolic-to-plasma membrane translocation (Pitcher et al.,
1998). The former possibility may be aided by PtdIns(4,5)P2 or
by other membrane associated proteins, including the GIRK1
channel subunit (Dhami et al., 2004; Li et al., 2003; Palczewski,
1997; Rishal et al., 2005). This recruitment of GRK2, which is in
our case a receptor-specific event, promotes the binding of
the Gbg subunit to GRK2 or GRK3, but not GRK6 that lacks
Gbg binding capability, and thus reduces the availability of the
Gbg subunits to the channel. To have this chelation capacity,
GRK2 has to have a higher or comparable affinity for Gbg than
does the channel. Indeed, from binding studies it has been
shown that Gbg subunits bind recombinant GIRK1 or GIRK4
subunits with dissociation constants of �125 nM and �50 nM,
respectively (Krapivinsky et al., 1995), whereas Gbg affinity for
GRK2 is �20 nM (Pitcher et al., 1992; Wu et al., 1998). Further
evidence to support the idea that differential affinity to Gbg
may mediate this action comes from experiments where
GIRK4 was overexpressed in atrial myocytes (Bender et al.,
20
30
40
50
60
70
80
0 50 100 150 200 250 300
Rel
ativ
e fra
ctio
n (%
)
Time (s)
Tau donor
Tau fret
Ade
Ade
C
BA
-40-20
020406080
100120
0 20 40 60 80
Incr
ease
bin
ding
(Nor
mal
ized
, %)
Time (s)
DAde
600650700750800850900950
1000
0 50 100 150 200 250 300
Cou
nts
Time (s)
Figure 6. FLIM-FRET under TIRF Reveals
that A1R Activation Increases the Fraction
of GRK2-Bound Gbg
(A) A cartoon showing the experimental scheme
used in the FLIM-FRET experiments.
(B) Time course of YFP-Gb1 emission after the
activation of A1R in the presence of GRK2-Cherry,
in agreement with YFP quenching by mCherry on
increase of FRET.
(C) YFP-Gb1 lifetime changes after A1R activation.
Yellow symbol depicts the FRET-free YFP-Gb1
(t of 3.0 ns fraction) and red symbol depicts the
faster lifetime component (0.9 ns) that corre-
sponds to a FRET interaction between YFP-Gb1
and GRK2-Cherry. This FRET interaction corre-
sponds to a FRET efficiency of 0.7.
(D) YFP-Gb1 GRK2-Cherry binding increases
after A1R activation (n = 9). Black line depicts
the fitting to a monoexponential function with a
t = 4.2 ± 0.7 s.
See also Figure S6.
756 Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc.
2001). In these experiments, GCD rates were greatly reduced, in
comparison to the GCD of GIRK1/4 heterotetramer, supporting
the idea that high affinity binding of Gbg may determine the
extent of channel current desensitization. Removal of Gbg from
the channel by GRK to affect channel function may not require
the removal of all four Gbg subunits, due to the steep depen-
dence of channel function on Gbg binding (Sadja et al., 2002).
Removing only one Gbg dimer reduces the efficacy of gating
by �70%. Finally, by using other means to chelate Gbg on the
membrane, such as coexpression of phosducin, similar effects
on GCD can be achieved (Riven et al., 2006). In conclusion, the
evidence provided above strongly points toward the possibility
that the acceleration of GCD by GRK2 is due to competition
for Gbg dimers with the channel.
How may GRK2-mediated GCD be interpreted in light of
previous suggested mechanisms? Few other mechanisms
have been proposed in the past to explain GCD. It has been
proposed that GIRK desensitization in cardiac cells might result
from simultaneous activation of M2R and M3R of the Gi/o and
the Gq pathways by acetylcholine, respectively (Keselman
et al., 2007; Kobrinsky et al., 2000; Meyer et al., 2001). Whereas
the former leads to GIRK opening, the latter leads to GCD by
PLC-mediated PtdIns(4,5)P2 depletion. Evidently, GCD occurs
also in simpler cases, where cross-talk between different GPCRs
pathways are probably not involved, and can be independent of
PtdIns(4,5)P2 depletion as showed by the use of PLC inhibitors
or activators (Meyer et al., 2001; Sickmann and Alzheimer,
2003). This was also true for our observations using NCDC,
a PLC inhibitor that does not block GIRK channel function (Sick-
mann et al., 2008). Furthermore, as shown above, mutations that
affect the affinity of the channel to PtdIns(4,5)P2 (Koike-Tani
et al., 2005; Zhang et al., 1999), are not affecting GRK2-mediated
channel desensitization. We thus suggest that changes in PtdIns
(4,5)P2 may only be an additional form of a much slower regula-
tion of channel function, mediated by the enzymatic activity of
PLC (Kobrinsky et al., 2000).
Our observations show that among four different receptors
described in this study, GCD was tightly regulated by GRK2 in
currents induced by A1R and mOR, showing a very robust
acceleration of GCD. On the contrary two other receptors,
namely mGluR2 and M4R were not able to induce GCD in the
presence of GRK2. How might this receptor selectivity be
addressed? It is interesting to note that receptors that were not
able to support GRK2-mediated GCD, were also not able to
recruit GRK2 to the plasma membrane, even though they all
release Gbg on activation to gate GIRK channels. This may
suggest that different receptors have differential mechanisms
to recruit GRK2 to the plasma membrane. The process of
membrane recruitment of GRK proteins has been ascribed to
a Gbg subunit-dependent mechanism (Pitcher et al., 1998;
Pitcher et al., 1992). It is therefore not clear how only a subset
of receptors have the ability to recruit the kinase, where others,
that also release Gbg to activate the GIRK channels, do not.
We have tried to address this issue and found that neither PLC
inhibition by NCDC, treatment with pertussis toxin, or using
dominant negative Gas mutant (Berlot, 2002) affected the ability
of the receptor to recruit GRK2 to the membrane (see Figure S3).
This may suggest of other still unknown mechanisms that
mediate this process by selective type of GPCRs, probably by
a specific direct interaction of the intracellular loops of the
receptor with GRK2.
How might the immediate desensitization be achieved? In
addition to cytosolic GRK that is recruited to the membrane on
receptor activation, a basal membranous subpopulation of
GRK2 is observed by us and by others (Aragay et al., 1998;
Garcia-Higuera et al., 1994; Murga et al., 1998). This subpopula-
tion can enable the immediate negative feedback of GIRK
activation. We cannot rule out also the possibility that GRK is
precoupled to GIRK (Rishal et al., 2005) and undergoes an
orientation/conformation change on activation, enabling its
immediate competition with the channels for Gbg subunits.
There are many studies suggesting the existence of signaling
complex between GIRK and Gbg (Clancy et al., 2005; Doupnik,
2008; Nikolov and Ivanova-Nikolova, 2004; Riven et al., 2006).
The GIRK-Gbg precoupling, before GPCR activation, might
enable the specificity of GPCR signaling cascade in an environ-
ment that may be populated by receptors of different types. Gbg
precoupled to GIRK undergo local rearrangement on GPCR
activation to immediately transduce GIRK gating independent
of diffusion rates (Riven et al., 2006). So if indeed the effector
(GIRK) is a module precoupled to its ‘‘switch-on,’’ could it be
that it is also precoupled to its ‘‘switch-off’’? There is evidence
that GRK2 and GIRK channel encompass a common signaling
complex (Nikolov and Ivanova-Nikolova, 2004).
Figure 7. A Cartoon Describing the Mechanism by
Which GRK2 Is Negatively Regulating GIRK Channel
Function
On receptor stimulation by GPCR, the G protein trimer
undergoes activation characterized by the exchange of GDP
for GTP on the Ga subunit. This in turn leads to the dissociation
of the Gbg subunits to freely bind and activate the GIRK
channel. Concomitantly, the GPCR induces the recruitment
of GRK2 to the plasma membrane making it available to bind
Gbg subunits of the G protein. Due to the relative higher affinity
of GRK2 for Gbg and to the larger mass action, GRK2 is now
able to effectively compete for the available pool of Gbg with
the GIRK channel, leading to a gradual removal of the Gbg
subunits and to a channel closure (desensitization), still in the
presence of the receptor agonist. Channel activation precedes
the action of GRK2 mainly due to the preexisting trimeric G
proteins in the vicinity of the channels (Riven et al., 2006).
Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc. 757
Our results add a unique aspect to emerging evidence for
phosphorylation-independent activity of the GRK family, from
the regulation of receptor numbers or uncoupling of the GPCR
from the G protein at the plasma membrane, to regulation of
intracellular enzymes (for reviews see Ferguson [2007] and Reiter
and Lefkowitz [2006]). In all of these cases, there is no indication
of a direct involvement of the Gbg subunits of the G protein in
GRK action. GPCR/GRK2-dependent action on channel activity,
or other effectors, forms a new mechanism for a short-term
negative feedback for GPCR function, that selectively regulate
effector activity in the continued presence of receptor agonists.
This mechanism may not exclusively pertain to GIRK channels,
but can be relevant to all membrane associated Gbg regulated
effectors (Dupre et al., 2009). Because drug therapies for many
diseases are targeted to the receptor, a better understanding
of the pathway that links receptor to effector activation and
regulation (in this case the GIRK channel), and finding new
means to regulate these steps, might lead to therapies with
better resistance to complications such as tolerance and
side-effects.
EXPERIMENTAL PROCEDURES
Patch-Clamp Recordings
Membrane currents were recorded under voltage-clamp conditions using
whole-cell patch-clamp configuration with an Axopatch 200B (Axon Instru-
ments) patch-clamp amplifier. Patch pipettes were fabricated from borosili-
cate glass capillaries (2–5 MU). Signals were analog filtered using a 1 kHz
low-pass Bessel filter. After patch formation in a low K+ bath solution, the
bath solution was changed to high K+ solution. Adenosine (100 mM), glutamate
(100 mM), methionine enkephalin (ME, 100 nM), carbachol (100 mM), and Ba+2
(3 mM) were used to study induced and basal GIRK currents. GIRK currents
were measured as inward currents at a holding potential of �80 mV at room
temperature. Data acquisition and analysis were done using pCLAMP 9
software (Axon Instruments). To determine GCD kinetics, current traces
were fitted to a monoexponential decay function using Chebyshev method.
Results are expressed as average ± standard error of the mean (SEM). Signif-
icant differences were considered when p < 0.05 using Student’s t test.
TIRF Microscopy
Fluorescence was measured using through the objective TIRF microscopy
(Riven et al., 2003) with a 60 3 1.45 N.A. TIRFM objective (Olympus, Japan)
and TIRF condenser (TILL Photonics, Germany). Images were acquired with
Ixon+ EMCCD camera (Andor, Ireland) using Imaging Workbench 6 software
(Indec, USA). DF/F (%) was calculated from ROI that contained the whole
cell membrane area and was background subtracted. Time constant (t) for
GRK2 translocations, was calculated by determining the time after agonist
application when fluorescence reached 63% of maximum.
Fluorescence Lifetime Measurements
For fluorescence lifetime measurements (FLIM), 470 nm ps diode laser
(FWHM < 90 ps) was used, driven by a 40 MHz pulse controller, PDL 800-B.
Single photons were collected using PMA-165P photon counter and
processed using TimeHarp 200 PC-board. Data was acquired and analyzed
using SymPhoTime software (PicoQuant, Germany). Donor fluorescence
was collected from single cells under TIRF configuration (Riven et al., 2003).
For all measurements, laser intensities were set such that signal count rate
will be <1% of laser pulse rate. IRF was reconstructed from lifetime measure-
ment of YFP-Gb1 under TIRF using laser powers comparable to those used in
the experiment. YFP-Gb1 monomer lifetime was monoexponential with t of
3.0 ns (Figure S6B). To extract lifetimes and relative intensities, donor fluores-
cence traces were binned to 1-s segments and IRF reconvoluted trace
was fitted to double-exponential fitting model. One t parameter, td, was
constrained to 3.0 ns (YFP-Gb1), and tda as well as the relative size for
each exponential term was extracted from fitting result (Lleres et al., 2007;
Peter et al., 2005; Wallrabe and Periasamy, 2005; Yasuda et al., 2006).
Maximum likelihood estimation (MLE) method was used for fitting. Fit quality
was examined both by c2 values and by the absence of systematic variations
of fit residuals.
Molecular Biology and Cell Culture
Fusions to fluorescent proteins (EGFP, YFP and mCherry) were based on
commercially available pCMV-XFP vectors (Clontech). In EGFP A206K point
mutation was made to eliminate its week dimerization tendency (Zacharias
et al., 2002). Point mutations and deletion done in GIRK and GRK2 were
carried out by polymerase chain reaction (PCR) and verified by sequencing.
Nonfused GIRK and PTX-S1 subunits (Sadja and Reuveny, 2009) were all in
pcDNA3.1 (Invitrogen). C-terminal fusion of fluorescent proteins to GRK2 did
not affect its function. HEK293 cells were transiently transfected using
Metafectene (Biontex, Germany) with cDNAs encoding for the channel
subunits, the receptor of choice and GRK (wt, GFP-fused or mutant). In
GRK2 silencing experiments GRK2 shRNA (0.1 mg) or nontarget control
(0.1 mg) was cotransfected with the channel and the receptor. Currents were
measured 24–48 hr posttransfection according to Raveh et al. (2008). The
HL-1 cells, a gift from Dr. William C. Claycomb, were maintained using the
recommended protocols (Claycomb et al., 1998). For electrophysiology
experiments, cells were transferred to uncoated 24-mm glass coverslips on
the day of the recording.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures
and six figures and can be found with this article online at doi:10.1016/
j.cell.2010.10.018.
ACKNOWLEDGMENTS
The authors like to thank Ruth Meller and Elisha Shalgi for technical help,
and the Reuveny laboratory for helpful comments. We are grateful to
Drs. J.L. Benovic for GRK2 and GRK6, W.C. Claycomb for HL-1 cells,
D.E. Logothetis for PtdIns(4,5)P2 GIRK mutants, C. Barlot for Gas mutant,
S. Nakanishi for the mGluR2, Z. Vogel for mOR, and R. Tsien for mCherry
cDNAs. The work was supported in part by the Josef Cohn Center for
Biomembrane Research, The Israeli Science Foundation (ISF grant 207/09),
The Minerva Foundation, and the Human Frontier Science Program.
Received: April 12, 2010
Revised: August 3, 2010
Accepted: October 11, 2010
Published: November 24, 2010
REFERENCES
Aragay, A.M., Ruiz-Gomez, A., Penela, P., Sarnago, S., Elorza, A., Jimenez-
Sainz, M.C., and Mayor, F., Jr. (1998). G protein-coupled receptor kinase 2
(GRK2): mechanisms of regulation and physiological functions. FEBS Lett.
430, 37–40.
Bender, K., Wellner-Kienitz, M.C., Inanobe, A., Meyer, T., Kurachi, Y., and Pott,
L. (2001). Overexpression of monomeric and multimeric GIRK4 subunits in rat
atrial myocytes removes fast desensitization and reduces inward rectification
of muscarinic K(+) current (I(K(ACh))). Evidence for functional homomeric
GIRK4 channels. J. Biol. Chem. 276, 28873–28880.
Berlot, C.H. (2002). A highly effective dominant negative alpha s construct
containing mutations that affect distinct functions inhibits multiple Gs-coupled
receptor signaling pathways. J. Biol. Chem. 277, 21080–21085.
Blanchet, C., and Luscher, C. (2002). Desensitization of mu-opioid receptor-
evoked potassium currents: initiation at the receptor, expression at the
effector. Proc. Natl. Acad. Sci. USA 99, 4674–4679.
758 Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc.
Bunemann, M., Lee, K.B., Pals-Rylaarsdam, R., Roseberry, A.G., and Hosey,
M.M. (1999). Desensitization of G-protein-coupled receptors in the cardiovas-
cular system. Annu. Rev. Physiol. 61, 169–192.
Carman, C.V., Parent, J.L., Day, P.W., Pronin, A.N., Sternweis, P.M.,
Wedegaertner, P.B., Gilman, A.G., Benovic, J.L., and Kozasa, T. (1999).
Selective regulation of Galpha(q/11) by an RGS domain in the G protein-
coupled receptor kinase, GRK2. J. Biol. Chem. 274, 34483–34492.
Carman, C.V., Barak, L.S., Chen, C., Liu-Chen, L.Y., Onorato, J.J., Kennedy,
S.P., Caron, M.G., and Benovic, J.L. (2000). Mutational analysis of
Gbetagamma and phospholipid interaction with G protein-coupled receptor
kinase 2. J. Biol. Chem. 275, 10443–10452.
Clancy, S.M., Fowler, C.E., Finley, M., Suen, K.F., Arrabit, C., Berton, F.,
Kosaza, T., Casey, P.J., and Slesinger, P.A. (2005). Pertussis-toxin-sensitive
Galpha subunits selectively bind to C-terminal domain of neuronal GIRK
channels: evidence for a heterotrimeric G-protein-channel complex. Mol.
Cell. Neurosci. 28, 375–389.
Claycomb, W.C., Lanson, N.A., Jr., Stallworth, B.S., Egeland, D.B., Delcarpio,
J.B., Bahinski, A., and Izzo, N.J., Jr. (1998). HL-1 cells: a cardiac muscle cell
line that contracts and retains phenotypic characteristics of the adult cardio-
myocyte. Proc. Natl. Acad. Sci. USA 95, 2979–2984.
Cordeaux, Y., Ijzerman, A.P., and Hill, S.J. (2004). Coupling of the human A1
adenosine receptor to different heterotrimeric G proteins: evidence for
agonist-specific G protein activation. Br. J. Pharmacol. 143, 705–714.
Dang, V.C., Napier, I.A., and Christie, M.J. (2009). Two distinct mechanisms
mediate acute mu-opioid receptor desensitization in native neurons.
J. Neurosci. 29, 3322–3327.
Day, P.W., Tesmer, J.J., Sterne-Marr, R., Freeman, L.C., Benovic, J.L., and
Wedegaertner, P.B. (2004). Characterization of the GRK2 binding site of
Galphaq. J. Biol. Chem. 279, 53643–53652.
Dhami, G.K., Dale, L.B., Anborgh, P.H., O’Connor-Halligan, K.E., Sterne-Marr,
R., and Ferguson, S.S. (2004). G Protein-coupled receptor kinase 2 regulator
of G protein signaling homology domain binds to both metabotropic glutamate
receptor 1a and Galphaq to attenuate signaling. J. Biol. Chem. 279, 16614–
16620.
Doupnik, C.A. (2008). GPCR-Kir channel signaling complexes: defining rules of
engagement. J. Recept. Signal Transduct. Res. 28, 83–91.
Dupre, D.J., Robitaille, M., Rebois, R.V., and Hebert, T.E. (2009). The role of
Gbetagamma subunits in the organization, assembly, and function of GPCR
signaling complexes. Annu. Rev. Pharmacol. Toxicol. 49, 31–56.
Ferguson, S.S. (2007). Phosphorylation-independent attenuation of GPCR
signalling. Trends Pharmacol. Sci. 28, 173–179.
Garcia-Higuera, I., Penela, P., Murga, C., Egea, G., Bonay, P., Benovic, J.L.,
and Mayor, F., Jr. (1994). Association of the regulatory beta-adrenergic
receptor kinase with rat liver microsomal membranes. J. Biol. Chem. 269,
1348–1355.
Goedhart, J., Vermeer, J.E., Adjobo-Hermans, M.J., van Weeren, L., and
Gadella, T.W., Jr. (2007). Sensitive detection of p65 homodimers using
red-shifted and fluorescent protein-based FRET couples. PLoS ONE 2, e1011.
Huang, C.L., Feng, S., and Hilgemann, D.W. (1998). Direct activation of inward
rectifier potassium channels by PIP2 and its stabilization by Gbetagamma.
Nature 391, 803–806.
Keselman, I., Fribourg, M., Felsenfeld, D.P., and Logothetis, D.E. (2007).
Mechanism of PLC-mediated Kir3 current inhibition. Channels (Austin) 1,
113–123.
Kobrinsky, E., Mirshahi, T., Zhang, H., Jin, T., and Logothetis, D.E. (2000).
Receptor-mediated hydrolysis of plasma membrane messenger PIP2 leads
to K+-current desensitization. Nat. Cell Biol. 2, 507–514.
Koike-Tani, M., Collins, J.M., Kawano, T., Zhao, P., Zhao, Q., Kozasa, T.,
Nakajima, S., and Nakajima, Y. (2005). Signal transduction pathway for the
substance P-induced inhibition of rat Kir3 (GIRK) channel. J. Physiol. 564,
489–500.
Kong, G., Penn, R., and Benovic, J.L. (1994). A beta-adrenergic receptor
kinase dominant negative mutant attenuates desensitization of the beta
2-adrenergic receptor. J. Biol. Chem. 269, 13084–13087.
Krapivinsky, G., Krapivinsky, L., Wickman, K., and Clapham, D.E. (1995).
G beta gamma binds directly to the G protein-gated K+ channel, IKACh.
J. Biol. Chem. 270, 29059–29062.
Kremers, G.J., Goedhart, J., van Munster, E.B., and Gadella, T.W., Jr. (2006).
Cyan and yellow super fluorescent proteins with improved brightness, protein
folding, and FRET Forster radius. Biochemistry 45, 6570–6580.
Li, J., Xiang, B., Su, W., Zhang, X., Huang, Y., and Ma, L. (2003). Agonist-
induced formation of opioid receptor-G protein-coupled receptor kinase
(GRK)-G beta gamma complex on membrane is required for GRK2 function
in vivo. J. Biol. Chem. 278, 30219–30226.
Lleres, D., Swift, S., and Lamond, A.I. (2007). Detecting protein-protein
interactions in vivo with FRET using multiphoton fluorescence lifetime imaging
microscopy (FLIM). Curr. Protoc. Cytom. Chapter 12, Unit12.10.
Logothetis, D.E., Kurachi, Y., Galper, J., Neer, E.J., and Clapham, D.E. (1987).
The beta gamma subunits of GTP-binding proteins activate the muscarinic K+
channel in heart. Nature 325, 321–326.
Massoulie, J., Pezzementi, L., Bon, S., Krejci, E., and Vallette, F.M. (1993).
Molecular and cellular biology of cholinesterases. Prog. Neurobiol. 41, 31–91.
Meyer, T., Wellner-Kienitz, M.C., Biewald, A., Bender, K., Eickel, A., and Pott,
L. (2001). Depletion of phosphatidylinositol 4,5-bisphosphate by activation of
phospholipase C-coupled receptors causes slow inhibition but not desensiti-
zation of G protein-gated inward rectifier K+ current in atrial myocytes. J. Biol.
Chem. 276, 5650–5658.
Murga, C., Penela, P., Zafra, F., and Mayor, F., Jr. (1998). The subcellular and
cellular distribution of G protein-coupled receptor kinase 2 in rat brain.
Neuroscience 87, 631–637.
Nikolov, E.N., and Ivanova-Nikolova, T.T. (2004). Coordination of membrane
excitability through a GIRK1 signaling complex in the atria. J. Biol. Chem.
279, 23630–23636.
Nobles, M., Sebastian, S., and Tinker, A. (2010). HL-1 cells express an inwardly
rectifying K+ current activated via muscarinic receptors comparable to that in
mouse atrial myocytes. Pflugers Arch. 460, 99–108.
Palczewski, K. (1997). GTP-binding-protein-coupled receptor kinases–two
mechanistic models. Eur. J. Biochem. 248, 261–269.
Peter, M., Ameer-Beg, S.M., Hughes, M.K., Keppler, M.D., Prag, S., Marsh, M.,
Vojnovic, B., and Ng, T. (2005). Multiphoton-FLIM quantification of the
EGFP-mRFP1 FRET pair for localization of membrane receptor-kinase
interactions. Biophys. J. 88, 1224–1237.
Pierce, K.L., Premont, R.T., and Lefkowitz, R.J. (2002). Seven-transmembrane
receptors. Nat. Rev. Mol. Cell Biol. 3, 639–650.
Pitcher, J.A., Inglese, J., Higgins, J.B., Arriza, J.L., Casey, P.J., Kim, C.,
Benovic, J.L., Kwatra, M.M., Caron, M.G., and Lefkowitz, R.J. (1992). Role
of beta gamma subunits of G proteins in targeting the beta-adrenergic
receptor kinase to membrane-bound receptors. Science 257, 1264–1267.
Pitcher, J.A., Touhara, K., Payne, E.S., and Lefkowitz, R.J. (1995). Pleckstrin
homology domain-mediated membrane association and activation of the
beta-adrenergic receptor kinase requires coordinate interaction with G beta
gamma subunits and lipid. J. Biol. Chem. 270, 11707–11710.
Pitcher, J.A., Freedman, N.J., and Lefkowitz, R.J. (1998). G protein-coupled
receptor kinases. Annu. Rev. Biochem. 67, 653–692.
Raveh, A., Riven, I., and Reuveny, E. (2008). The use of FRET microscopy to
elucidate steady state channel conformational rearrangements and G protein
interaction with the GIRK channels. Methods Mol. Biol. 491, 199–212.
Reiter, E., and Lefkowitz, R.J. (2006). GRKs and beta-arrestins: roles in
receptor silencing, trafficking and signaling. Trends Endocrinol. Metab. 17,
159–165.
Reuveny, E., Slesinger, P.A., Inglese, J., Morales, J.M., Iniguez-Lluhi, J.A.,
Lefkowitz, R.J., Bourne, H.R., Jan, Y.N., and Jan, L.Y. (1994). Activation of
the cloned muscarinic potassium channel by G protein beta gamma subunits.
Nature 370, 143–146.
Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc. 759
Rishal, I., Porozov, Y., Yakubovich, D., Varon, D., and Dascal, N. (2005).
Gbetagamma-dependent and Gbetagamma-independent basal activity of G
protein-activated K+ channels. J. Biol. Chem. 280, 16685–16694.
Riven, I., Kalmanzon, E., Segev, L., and Reuveny, E. (2003). Conformational
rearrangements associated with the gating of the G protein-coupled
potassium channel revealed by FRET microscopy. Neuron 38, 225–235.
Riven, I., Iwanir, S., and Reuveny, E. (2006). GIRK channel activation involves
a local rearrangement of a preformed G protein channel complex. Neuron 51,
561–573.
Sadja, R., and Reuveny, E. (2009). Activation gating kinetics of GIRK channels
are mediated by cytoplasmic residues adjacent to transmembrane domains.
Channels (Austin) 3, 205–214.
Sadja, R., Smadja, K., Alagem, N., and Reuveny, E. (2001). Coupling
Gbetagamma-dependent activation to channel opening via pore elements in
inwardly rectifying potassium channels. Neuron 29, 669–680.
Sadja, R., Alagem, N., and Reuveny, E. (2002). Graded contribution of the
Gbeta gamma binding domains to GIRK channel activation. Proc. Natl.
Acad. Sci. USA 99, 10783–10788.
Shui, Z., Khan, I.A., Tsuga, H., Haga, T., and Boyett, M.R. (1998). Role of
receptor kinase in short-term desensitization of cardiac muscarinic K+ chan-
nels expressed in Chinese hamster ovary cells. J. Physiol. 507, 325–334.
Sickmann, T., and Alzheimer, C. (2003). Short-term desensitization of
G-protein-activated, inwardly rectifying K+ (GIRK) currents in pyramidal
neurons of rat neocortex. J. Neurophysiol. 90, 2494–2503.
Sickmann, T., Klose, A., Huth, T., and Alzheimer, C. (2008). Unexpected
suppression of neuronal G protein-activated, inwardly rectifying K+ current
by common phospholipase C inhibitor. Neurosci. Lett. 436, 102–106.
Sterne-Marr, R., Tesmer, J.J., Day, P.W., Stracquatanio, R.P., Cilente, J.A.,
O’Connor, K.E., Pronin, A.N., Benovic, J.L., and Wedegaertner, P.B. (2003).
G protein-coupled receptor Kinase 2/G alpha q/11 interaction. A novel surface
on a regulator of G protein signaling homology domain for binding G alpha
subunits. J. Biol. Chem. 278, 6050–6058.
Sui, J.L., Petit-Jacques, J., and Logothetis, D.E. (1998). Activation of the
atrial KACh channel by the betagamma subunits of G proteins or intracellular
Na+ ions depends on the presence of phosphatidylinositol phosphates. Proc.
Natl. Acad. Sci. USA 95, 1307–1312.
Tesmer, V.M., Kawano, T., Shankaranarayanan, A., Kozasa, T., and Tesmer,
J.J. (2005). Snapshot of activated G proteins at the membrane: the
Galphaq-GRK2-Gbetagamma complex. Science 310, 1686–1690.
Torres, G.E., Gainetdinov, R.R., and Caron, M.G. (2003). Plasma membrane
monoamine transporters: structure, regulation and function. Nat. Rev.
Neurosci. 4, 13–25.
Touhara, K., Koch, W.J., Hawes, B.E., and Lefkowitz, R.J. (1995). Mutational
analysis of the pleckstrin homology domain of the beta-adrenergic receptor
kinase. Differential effects on G beta gamma and phosphatidylinositol
4,5-bisphosphate binding. J. Biol. Chem. 270, 17000–17005.
Tsao, P., and von Zastrow, M. (2000). Downregulation of G protein-coupled
receptors. Curr. Opin. Neurobiol. 10, 365–369.
Violin, J.D., Ren, X.R., and Lefkowitz, R.J. (2006). G-protein-coupled receptor
kinase specificity for beta-arrestin recruitment to the beta2-adrenergic
receptor revealed by fluorescence resonance energy transfer. J. Biol. Chem.
281, 20577–20588.
Wallrabe, H., and Periasamy, A. (2005). Imaging protein molecules using FRET
and FLIM microscopy. Curr. Opin. Biotechnol. 16, 19–27.
Wu, G., Benovic, J.L., Hildebrandt, J.D., and Lanier, S.M. (1998). Receptor
docking sites for G-protein betagamma subunits. Implications for signal
regulation. J. Biol. Chem. 273, 7197–7200.
Yasuda, R., Harvey, C.D., Zhong, H., Sobczyk, A., van Aelst, L., and Svoboda,
K. (2006). Supersensitive Ras activation in dendrites and spines revealed by
two-photon fluorescence lifetime imaging. Nat. Neurosci. 9, 283–291.
Zacharias, D.A., Violin, J.D., Newton, A.C., and Tsien, R.Y. (2002). Partitioning
of lipid-modified monomeric GFPs into membrane microdomains of live cells.
Science 296, 913–916.
Zhang, H., He, C., Yan, X., Mirshahi, T., and Logothetis, D.E. (1999). Activation
of inwardly rectifying K+ channels by distinct PtdIns(4,5)P2 interactions.
Nat. Cell Biol. 1, 183–188.
760 Cell 143, 750–760, November 24, 2010 ª2010 Elsevier Inc.
Sequence-Dependent Sortingof Recycling Proteins by Actin-StabilizedEndosomal MicrodomainsManojkumar A. Puthenveedu,1,* Benjamin Lauffer,2 Paul Temkin,2 Rachel Vistein,1 Peter Carlton,3 Kurt Thorn,4
Jack Taunton,5 Orion D. Weiner,4 Robert G. Parton,6 and Mark von Zastrow2,5
1Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA2Department of Psychiatry3Department of Physiology4Department of Biochemistry and Biophysics5Department of Cellular and Molecular Pharmacology
University of California at San Francisco, San Francisco, CA 94158, USA6The University of Queensland, Institute for Molecular Bioscience and Centre for Microscopy and Microanalysis, St. Lucia,
Queensland 4072, Australia 8
*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.10.003
SUMMARY
The functional consequences of signaling receptorendocytosis are determined by the endosomal sort-ing of receptors between degradation and recyclingpathways. How receptors recycle efficiently, ina sequence-dependent manner that is distinct frombulk membrane recycling, is not known. Here, inlive cells, we visualize the sorting of a prototypicalsequence-dependent recycling receptor, the beta-2adrenergic receptor, from bulk recycling proteinsand the degrading delta-opioid receptor. Our resultsreveal a remarkable diversity in recycling routes atthe level of individual endosomes, and indicate thatsequence-dependent recycling is an active processmediated by distinct endosomal subdomainsdistinct from those mediating bulk recycling. Weidentify a specialized subset of tubular microdo-mains on endosomes, stabilized by a highly localizedbut dynamic actin machinery, that mediate this sort-ing, and provide evidence that these actin-stabilizeddomains provide the physical basis for a two-stepkinetic and affinity-based model for protein sortinginto the sequence-dependent recycling pathway.
INTRODUCTION
Cells constantly internalize a large fraction of proteins from their
surface and the extracellular environment. The fates of these
internalized proteins in the endosome have a direct impact on
several critical functions of the cell, including its response to
environmental signals (Lefkowitz et al., 1998; Marchese et al.,
2008; Sorkin and von Zastrow, 2009).
Internalized proteins have three main fates in the endosome.
First, many membrane proteins, such as the transferrin receptor
(TfR), are sorted away from soluble proteins, largely by bulk
membrane flow back to the cell surface. This occurs via the
formation and fission of narrow tubules that have a high ratio
of membrane surface area (and therefore membrane proteins)
to volume (soluble contents) (Mayor et al., 1993). Several
proteins have been implicated in the formation of these tubules
(Shinozaki-Narikawa et al., 2006; Cullen, 2008; Traer et al.,
2007), which provide a geometric basis to bulk recycling and
explain how nutrient receptors can recycle leaving soluble
nutrients behind to be utilized in the lysosome (Dunn and
Maxfield, 1992; Mayor et al., 1993; Maxfield and McGraw,
2004). Second, many membrane proteins are transported to
the lysosome to be degraded. This involves a process called
involution, where proteins are packaged into vesicles that bud
off to the interior of the endosome and, in essence, converts
these proteins into being a part of the soluble contents (Piper
and Katzmann, 2007). Involution has also been studied exten-
sively, and the machinery responsible, termed ESCRT complex,
identified (Hurley, 2008; Saksena et al., 2007; Williams and Urbe,
2007). Third, several other membrane proteins, such as many
signaling receptors, escape the bulk recycling and degradation
pathways, and are instead recycled in a regulated manner (Ha-
nyaloglu and von Zastrow, 2008; Yudowski et al., 2009). This
requires a specific cis-acting sorting sequence present on the
receptor’s cytoplasmic surface (Cao et al., 1999; Hanyaloglu
and von Zastrow, 2008). How receptors use these sequences
to escape the involution pathway and recycle, though they are
excluded from the default recycling pathway (Maxfield and
McGraw, 2004; Hanyaloglu et al., 2005), is a fundamental cell
biological question that is still unanswered.
Although it is clear that different recycling cargo can travel
through discrete endosomal populations (Maxfield and McGraw,
2004), endosome-to-plasma membrane recycling from a single
endosome is generally thought to occur via a uniform population
of tubules. Contrary to this traditional view, we identify special-
ized endosomal tubular domains mediating sequence-depen-
dent recycling that are kinetically and biochemically distinct
Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc. 761
from the domains that mediate bulk recycling. These domains
are stabilized by a local actin cytoskeleton that is required and
sufficient for receptor recycling. We propose that such special-
ized actin-stabilized domains provide the physical basis for over-
coming a kinetic barrier for receptor entry into endosomal
tubules and for affinity-based concentration of proteins in the
sequence-dependent recycling pathway.
RESULTS
Visualization of Receptor Sorting in the Endosomesof Living CellsThe beta 2-adrenergic receptor (B2AR) and the delta opioid
receptor (DOR) provide excellent models for physiologically rele-
vant proteins that are sorted from each other in the endosome.
Although they share endocytic pathways, B2AR is recycled effi-
ciently in a sequence-dependent manner while DOR is selec-
tively degraded in the lysosome (Cao et al., 1999; Whistler
et al., 2002). To study the endosomal sorting of these cargo
molecules, we started by testing whether tubulation was
involved in this process. Because such sorting has not been
observed in vivo, we first attempted to visualize the dynamics
of receptor sorting in live HEK293 cells expressing fluorescently
labeled B2AR or DOR receptors, using high-resolution confocal
microscopy. Both receptors were observed mostly on the cell
surface before isoproterenol or DADLE, their respective
agonists, were added. After agonist addition, both B2AR
(Figure 1A) and DOR (data not shown) were robustly internalized,
and appeared in endosomes within 5 min (Figure 1A and Movie
S1 available online). As a control, receptors did not internalize
in cells not treated with agonists, but imaged for the same period
of time (Figure S1A). The B2AR-containing endosomes colocal-
ized with the early endosome markers Rab5 (Figure S1B) and
EEA1 (data not shown), consistent with previous data.
Internalized B2AR (Figure 1B), but not DOR (Figure 1C), also
labeled tubules that extended from the main body of the
receptor. When receptor fluorescence was quantified across
multiple B2AR-containing tubules, we saw that receptors were
enriched in these tubules compared to the rest of the endosomal
limiting membrane (Figure 1D). The bulk recycling protein TfR, in
contrast, was not enriched in endosomal tubules (Figure 1D).
This suggests that sequence-dependent recycling receptors
are enriched by an active mechanism in these endosomal
tubules.
These endosomal tubules were preferentially enriched for
B2AR over DOR on the same endosome. In cells coexpressing
FLAG-tagged B2AR and GFP-tagged DOR, we observed endo-
somes that contained both receptors within 5 min after coapply-
ing isoproterenol and DADLE. Notably, these endosomes
extruded tubules that contained B2AR but not detectable DOR
Figure 1. B2AR Is Enriched in Endosomal Tubular Domains Devoid of DOR
(A) HEK293 cells stably expressing FLAG-B2AR, labeled with fluorescently-tagged anti-FLAG antibodies, were followed by live confocal imaging before (left) and
after 5 min (right) of isoproterenol treatment. Arrows show internal endosomes.
(B) Example endosomes showing tubular domains enriched in B2AR (arrowheads) with one enlarged in the inset.
(C) Examples of DOR endosomes. DOR is smoothly distributed on the endosomal membrane and is not detected in tubules.
(D) Average fluorescence of B2AR (red circles) and TfR (green diamonds) calculated across multiple tubules (n = 123 for B2AR, 100 for TfR). B2AR shows a 50%
enrichment over the endosomal membrane, while TfR is not enriched. Each point denotes an individual tubule, the bar denotes the mean, and the gray dotted line
denotes the fluorescence of the endosomal membrane.
(E) An endosome containing both internalized B2AR and DOR, showing a tubule containing B2AR but no detectable DOR (arrowheads).
(F) Trace of linear pixel values across the same endosome, normalized to the maximum, confirms that the tubule is enriched for B2AR but not DOR.
(G) Linear pixel values of endosomal tubules averaged across 11 endosomes show specific enrichment of B2AR in tubules.
Error bars are SEM. See also Figure S1 and Movie S1 and Movie S2.
762 Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc.
(e.g., in Figure 1E and in Movie S2). Fluorescence traces across
the endosome and the tubule confirmed that DOR was not
detectable in these B2AR tubules, suggesting that B2AR was
specifically sorted into these tubular domains (e.g., in Figure 1F).
When linear pixel values from multiple sorting events were quan-
tified, B2AR was enriched�50% in the endosomal domains from
which tubules originate, compared to the endosomal membrane
outside these domains (Figure 1G). Thus, these experiments
resolve, for the first time, individual events that mediate sorting
of two signaling receptors in the endosomes of live cells.
B2AR-ContainingEndosomal TubulesDeliver Receptorsto the Cell SurfaceTo test whether these tubules mediated recycling of B2AR, we
visualized direct delivery of receptors from these tubules to the
cell surface. In endosomes containing internalized B2AR and
DOR, these tubular domains pinched off vesicles that contained
B2AR but not detectable levels of DOR (Figure 2A and Movie S3).
To reliably assess if these vesicles traveled to the surface and
fused with the plasma membrane, we combined our current
imaging with a method that we have used previously to visualize
individual vesicle fusion events mediating surface receptor
delivery (Yudowski et al., 2006). Briefly, we attached the pH-
sensitive GFP variant superecliptic pHluorin to the extracellular
domain of B2AR (SpH-B2AR) (Miesenbock et al., 1998). SpH-
B2AR is highly fluorescent when exposed to the neutral pH at
the cell surface, but is quenched in the acidic environments of
endosomes and intracellular vesicles. This allows the detection
of individual fusion events of vesicles containing B2AR at the
cell surface (Yudowski et al., 2009). In cells coexpressing SpH-
B2AR and B2AR labeled with a pH-insensitive fluorescent dye
(Alexa-555), vesicles derived from the endosomal tubules traf-
ficked to the cell surface and fused, as seen by a sudden
increase in SpH fluorescence followed by loss of fluorescence
due to diffusion (Figure 2B, and Movie S4). A fluorescence trace
from movie S4 confirmed the fusion and loss of B2AR fluores-
cence (Figure 2C). Also, Rab4 and Rab11, which function in
endosome-to-plasma membrane recycling (Zerial and McBride,
2001; Maxfield and McGraw, 2004), were localized to the
domains containing B2AR (Figure S1). Together, this indicates
that the B2AR-containing endosomal tubules mediate delivery
of B2AR to the cell surface.
B2AR-Containing Tubules Are Marked by a HighlyLocalized Actin CytoskeletonWe next examined whether the B2AR-containing microdomains
were biochemically distinct from the rest of the endosomal
membrane. We first focused on actin, as the actin cytoskeleton
Figure 2. Membranes Derived from Endosomal Tubules Deliver B2AR to the Cell Surface
(A) Frames from a representative time lapse series showing scission of a vesicle that contains B2AR but not detectable DOR, from an endosomal tubule.
(B) An image plane close to the plasma membrane in cells coexpressing SpH-B2AR and FLAG-B2AR (labeled with Alexa555), exposed to isoproterenol for 5 min,
and imaged by fast dual-color confocal microscopy. Arrows denote the FLAG-B2AR-containing membrane derived from the endosomal tubule that fuses.
(C) Fluorescence trace of the B2AR-containing membranes from the endosome in movie S4, showing the spike in SpH-B2AR fluorescence (fusion) followed by
rapid loss of fluorescence.
Scale bars represent 1mm. See also Figure S1 and Movie S3 and Movie S4.
Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc. 763
is required for efficient recycling of B2AR but not of TfR (Cao
et al., 1999; Gage et al., 2005), and as it has been implicated in
endosome motility (Stamnes, 2002; Girao et al., 2008) and
vesicle scission at the cell surface (Yarar et al., 2005; Perrais
and Merrifield, 2005; Kaksonen et al., 2005). Strikingly, in cells
coexpressing B2AR and actin-GFP, actin was concentrated on
the endosome specifically on the tubular domains containing
B2AR (Figure 3A). Virtually every B2AR tubule observed showed
this specific actin concentration on the tubule (n = 350). As with
actin, coronin-GFP (Uetrecht and Bear, 2006), an F-actin binding
protein, also localized specifically to the B2AR-containing
tubules on endosomes (Figure 3B), confirming that this was
a polymerized actin cytoskeleton. Coronin was also observed
on the B2AR-containing vesicle that was generated by dynamic
scission of the B2AR tubule (Figure 3B and Movie S5). Fluores-
cence traces of the linear pixels across the tubule and the vesicle
Figure 3. B2AR Tubules Are Marked by a Highly Localized Actin Cytoskeleton
(A) Cells coexpressing fluorescently labeled B2AR and actin-GFP exposed to isoproterenol for 5 min. The boxed area is enlarged in the inset, with arrowheads
indicating specific concentration of actin on B2AR endosomal tubules.
(B) Time lapse series from an example endosome with B2AR and coronin-GFP. Coronin is detectable on the endosomal tubule (arrows) and on the vesicle (arrow-
heads) that buds off the endosome.
(C) A trace of linear pixel values across the same endosome, normalized to maximum fluorescence, shows coronin on the endosomal domain and the vesicle.
(D) Example structured illumination image of a B2AR endosome showing specific localization of coronin to a B2AR tubule (arrowheads).
(E) Electron micrograph of an HRP-positive endosome (arrow) showing actin filaments (labeled with 9 nm gold, arrowheads) along a tubule. The right panel shows
an enlarged view.
See also Movie S5 and Movie S6.
764 Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc.
confirmed that coronin pinched off with the B2AR vesicle
(Figure 3C).
We also used two separate techniques to characterize actin
localization on these tubules beyond the �250 nm resolution
offered by conventional microscopy. First, we first imaged the
localization of coronin on endosomes containing B2AR tubules
using structured illumination microscopy (Gustafsson et al.,
2008), which resolves structures at �100 nm spatial resolution.
3D stacks obtained using this high-resolution technique
confirmed that coronin was specifically localized on the endoso-
mal tubule that contained B2AR (Figure 3D and Movie S6).
Second, we examined the morphology of actin on endosomal
tubules at the ultrastructural level by pre-embedding immunoe-
lectron microscopy. Actin was clearly labeled as filaments lying
along tubules extruded from endosomal structures (Figure 3E).
Actin Is Dynamically Turned over on the B2AR-Containing Endosomal TubulesWe then tested whether the actin filaments on these tubules
were a stable structure or were dynamically turned over. When
cells expressing actin-GFP were exposed to latrunculin, a drug
that prevents actin polymerization, endosomal actin fluores-
cence became indistinguishable from the ‘‘background’’ cyto-
plasmic fluorescence within 16–18 s after drug exposure (e.g.,
in Figure 4A). When quantified across multiple cells, endosomal
actin fluorescence showed an exponential loss after latrunculin
exposure, with a t1/2 of 3.5 s (99% Confidence Interval = 3.0 to
4.1 s) (Figure 4B), indicating that endosomal actin turned over
quite rapidly. As a control, stress fibers, which are composed
of relatively stable capped actin filaments, were turned over
more slowly in these same cells (e.g., in Figure S2A). Endosomal
actin was lost in >98% of cells within 30 s after latrunculin, in
contrast to stress fibers, which persisted for over 2 min in
>98% of cells (Figure S2B). Rapid turnover of endosomal actin
was also independently confirmed by fluorescence recovery
after photobleaching (FRAP) studies. When a single endosomal
actin spot was bleached, the fluorescence recovered rapidly
within 20 s (Figure 4C). As a control for more stable actin fila-
ments, stress fibers showed little recovery of fluorescence after
bleaching in this interval (Figure 4C). Exponential curve fits
yielding a t1/2 of 8.26 s (99% CI = 7.65 to 8.97 s), consistent
with rapid actin turnover (Figure 4D). In contrast, only part of
the fluorescence (�30%) was recovered in stress fibers in the
same cells by 20 s, with curve fits yielding a t1/2 of 50.35 s
(99% CI = 46.05 to 55.54 s). These results indicate that actin is
dynamically assembled on the B2AR recycling tubules.
Considering the rapid turnover of actin, we next explored the
machinery responsible for localizing actin at the tubule.
The Arp2/3 complex is a major nucleator of dynamic actin poly-
merization that has been implicated in polymerization-based en-
dosome motility (Stamnes, 2002; Girao et al., 2008; Pollard,
2007). Arp3, an integral part of the Arp2/3 complex useful for
visualizing this complex in intact cells (Merrifield et al., 2004),
was specifically concentrated at the base of the B2AR tubules
on the endosome (e.g., in Figure 4E and fluorescence trace in
Figure 4F, Movie S7). Every B2AR tubule observed had a corre-
sponding Arp3 spot at its base (n = 200). Surprisingly, however,
we did not see N-WASP and WAVE-2, canonical members of the
two main families of Arp2/3 activators (Millard et al., 2004), on the
endosome (Figure 4G). Similarly, we did not see endosomal
recruitment of activated Cdc42, as assessed by a previously
characterized GFP-fusion reporter consisting of the GTPase
binding domain of N-WASP (Benink and Bement, 2005)
(data not shown). All three proteins were readily detected at
lamellipodia and filopodia as expected, indicating that the
proteins were functional in these cells. While we cannot rule
out a weak or transitory interaction of these activators with
Arp2/3 at the endosome, the lack of enrichment prompted us
to test for alternate Arp2/3 activators. Cortactin, an Arp- and
actin- binding protein present on endosomes, has been
proposed to be such an activator (Kaksonen et al., 2000; Millard
et al., 2004; Daly, 2004). Cortactin-GFP was clearly concentrated
at the base of the B2AR tubule on the endosome (Figure 4G), in
a pattern identical to Arp2/3. When quantified (>200 endosomes
each), every B2AR tubule was marked by cortactin, while none of
the endosomes showed detectable N-WASP, WAVE-2, or
Cdc42. Similarly, the WASH protein complex, which has been
recently implicated in trafficking from the endosome (Derivery
et al., 2009; Gomez and Billadeau, 2009; Duleh and Welch,
2010), was also clearly localized to B2AR tubules (Figure 4G).
Together, these data suggest that an Arp2/3-, cortactin- and
WASH-based machinery mediates dynamic actin assembly on
the endosome.
B2AR-Containing Tubules Are a Specialized Subsetof Recycling Tubules on the EndosomeSince the traditional view is that the endosomal tubules that
mediate direct recycling to the plasma membrane are a uniform
population, we next tested whether these tubules were the same
as those that recycle bulk cargo. When B2AR recycling was visu-
alized along with bulk recycling of TfR, endosomes containing
both cargo typically extruded three to four tubules containing
TfR. Strikingly, however, only one of these contained detectable
amounts of B2AR (Example in Figure 5A, quantified in Figure 5B).
This was consistent with fast 3D confocal live cell imaging of
B2AR in endosomes, which showed that most endosomes
extruded only one B2AR containing tubule, with a small fraction
containing two. When quantified, only 24.4% of all TfR tubules
contained detectable B2AR (n = 358 tubules).
B2AR Tubules Are a Kinetically and BiochemicallyDistinct from Bulk Recycling TubulesWhen the lifetimes of tubules were quantified, the majority
(>80%) of B2AR tubules lasted more than 30 s. In contrast, the
majority of TfR tubules devoid of B2AR lasted less than 30 s
(Figures 5B and 5C, Movie S8). Each endosome extruded
several tubules containing TfR, only a subset (�30%) of which
were marked by actin, coronin, or cortactin (Figures 5D and
5E, arrows). Time-lapse movies indicated that the highly tran-
sient TfR-containing tubules were extruded from endosomal
domains that were lacking cortactin (Figure 5E, arrows), while
the relatively stable B2AR containing tubules were marked by
cortactin (Figure 5E, arrowheads). Importantly, the relative
stability of the subset of tubules was conferred by the actin cyto-
skeleton, as disruption of actin using latrunculin virtually abol-
ished the stable fraction of TfR tubules (Figures 5B and 5C).
Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc. 765
Figure 4. Actin on B2AR Tubules Is Dynamic and Arp2/3-Nucleated
(A) Cells expressing actin-GFP imaged live after treatment with 10 mM latrunculin for the indicated times, show rapid loss of endosomal actin. A time series of the
boxed area, showing several endosomal actin loci, is shown at the lower panel.
(B) The change in endosomal and cytoplasmic actin fluorescence over time after latrunculin normalized to initial endosomal actin fluorescence (n = 10). One-
phase exponential curve fits (solid lines) show a t1/2 of 3.5 s for actin loss (R2 = 0.984, d.f = 23, Sy.x = 2.1 for endosomal actin, R2 = 0.960, d.f = 23, Sy.x =
1.9 for cytoplasmic). Endosomal and cytoplasmc actin fluorescence becomes statistically identical within 15 s after latrunculin. Error bars denote SEM.
(C) Time series showing FRAP of representative examples of endosomal actin (top) and stress fibers (bottom).
(D) Kinetics of FRAP of actin (mean ± s.e.m) quantified from 14 endosomes and 17 stress fibers. One-phase exponential curve fits (lines), show a t1/2 of 8.26 s for
endosomal actin (R2 = 0.973, d.f = 34, Sy.x = 4.8) and 50.35 s for stress fibers (R2 = 0.801, d.f = 34, Sy.x = 3.9).
766 Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc.
Together, these results suggest that sequence-dependent
recycling of B2AR is mediated by specialized tubules that are
kinetically and biochemically distinct from the bulk recycling
tubules containing only TfR.
A Kinetic Model for Sorting of B2AR into a Subsetof Endosomal TubulesThe relative stability of B2AR tubules suggested a simple model,
based on kinetic sorting, for how sequence-dependent cargo
was sorted into a specific subset of tubules and excluded from
the transient TfR-containing bulk-recycling tubules. We hypoth-
esized that B2AR diffuses more slowly on the endosomal
membrane relative to bulk recycling cargo. The short lifetimes
of the bulk-recycling tubules would then create a kinetic barrier
for B2AR entry, while this barrier would be overcome in the
subset of tubules stabilized by actin.
To test the key prediction of this model, that B2AR diffuses
more slowly than TfR on the endosomal membrane, we directly
measured the diffusion rates of B2AR and TfR using FRAP. When
B2AR or TfR was bleached on a small part of the endosomal
membrane, B2AR fluorescence took significantly longer to
recover than TfR (Figure 5F). When quantified, the rate of
recovery of fluorescence of B2AR (t1/2 = 25.77 s, 99% CI 23.45
to 28.6 s) was �4 times slower than that of TfR (t1/2 = 6.21 s,
99% CI 5.49 to 7.17 s), indicating that B2AR diffuses significantly
slower on the endosomal membrane than TfR (Figures 5F and
5G). Neither B2AR or TfR recovered within the time analyzed
when the whole endosome was bleached (Figure 5H), confirming
that the recovery of fluorescence was due to diffusion from the
unbleached part of the endosome and not due to delivery of
new receptors via trafficking. Further, B2AR on the plasma
membrane diffused much faster than on the endosome (t1/2 =
6.45 s, 99% CI 5.62 to 7.66 s), comparable to TfR, suggesting
that B2AR diffusion was slower specifically on the endosome
(Figure 5H).
We next tested whether the diffusion of B2AR into endosomal
tubules was slower than that of TfR, by using the rate of increase
of B2AR fluorescence as an index of receptor entry into tubules.
B2AR fluorescence continuously increased throughout the dura-
tion of the tubule lifetimes (Figure S3A). Further, in a single tubule
containing TfR and B2AR, TfR fluorescence reached its
maximum at a markedly faster rate than that of B2AR (Fig-
ure S3B). Together, these results suggest that slow diffusion of
B2AR on the endosome and stabilization of recycling tubules
by actin can provide a kinetic basis for specific sorting of
sequence-dependent cargo into subsets of endosomal tubules.
Local Actin Assembly Is Required for B2AR Entryinto the Subset of TubulesBecause actin stabilizes the B2AR-containing subset of tubules,
the model predicts that endosomal actin would be required for
sequence-dependent concentration of B2AR into these tubules.
Consistent with this, B2AR was no longer concentrated in endo-
somal tubules when endosomal actin was acutely removed
using latrunculin (e.g., in Figure 6A). When the pixel fluorescence
along the limiting membrane of multiple endosomes was quanti-
fied, B2AR was distributed more uniformly along the endosomal
membrane in the absence of actin (Figures 6B and 6C). We
further confirmed this by comparing the variance in B2AR fluo-
rescence along the endosomal perimeter, irrespective of their
orientation. B2AR fluorescence was significantly more uniform
in endosomes without actin (Figure 6D), indicating that actin
was required for endosomes to concentrate B2AR in microdo-
mains. Less than 20% of endosomes showed B2AR-containing
tubules in the absence of endosomal actin, in contrast to control
cells where over 75% of endosomes showed B2AR-containing
tubules (Figure 6E). Further, cytochalasin D, a barbed-end
capping drug that prevents further actin polymerization but
does not actively cause depolymerization, also inhibited B2AR
entry into tubules (Figure 6E) and B2AR surface recycling
(Figure S4A). Neither TfR tubules on endosomes (Figure 6E)
nor TfR recycling (Figure S4B) was inhibited by actin depolymer-
ization, consistent with a role for actin specifically in sequence-
dependent recycling of B2AR (Cao et al., 1999). Further, deple-
tion of cortactin using siRNA (Figure 6F) also inhibited B2AR
entry into tubules (Figures 6G and 6H). This inhibition was
specific to cortactin depletion, as it was rescued by exogenous
expression of cortactin (Figure 6H). Together, these results indi-
cate that a localized actin cytoskeleton concentrates sequence-
dependent recycling cargo into a specific subset of recycling
tubules on the endosome.
B2AR Sorting into the Recycling SubdomainsIs Mediated by Its C-Terminal PDZ-Interacting DomainWe next asked whether this actin-dependent concentration of
receptors into endosomal tubules depended on the PDZ-inter-
acting sequence present in the B2AR cytoplasmic tail that medi-
ates sequence-dependent recycling (Cao et al., 1999; Gage
et al., 2005). To test if the sequence was required, we used
a mutant B2AR (B2AR-ala) in which the recycling sequence
was specifically disrupted by the addition of a single alanine
(Cao et al., 1999). Unlike B2AR, internalized B2AR-ala was not
able to enter the tubular domains in the endosome (e.g., in
Figure 6I, quantified in Figure 6J), or recycle to the cell surface
(Figure S4). To test if this sequence was sufficient, we used
a chimeric DOR construct with the B2AR-derived recycling
sequence fused to its cytoplasmic tail, termed DOR-B2 (Gage
et al., 2005), which recycles much more efficiently than DOR
(Figure S4). In contrast to DOR, which showed little concentra-
tion in endosomal tubules, DOR-B2 entered tubules (Figures 6I
and 6J) and recycled in an actin-dependent manner similar to
B2AR (Figure S4D). Together, these results indicate that the
(E) Example endosomes in live cells coexpressing B2AR and Arp3-GFP showing Arp3 at the base of B2AR tubules (arrowhead in the inset).
(F) Trace of linear pixel fluorescence of B2AR and Arp3 shows Arp3 specifically on the endosomal tubule.
(G) Example endosomes from cells coexpressing B2AR and N-WASP-, WAVE2-, cortactin-, or WASH-GFP. N-WASP and WAVE2 were not detected on endo-
somes, while cortactin and WASH were concentrated at the B2AR tubules (arrowheads).
Scale bars represent 1 mm. See also Figure S2 and Movie S7.
Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc. 767
Figure 5. B2AR Is Enriched Specifically in a Subset of Endosomal Tubules that Are Stabilized by Actin
(A) A representative example of an endosome with two tubules containing TfR, only one of which is enriched for B2AR.
(B) The number of tubules with B2AR, TfR, and TfR in the presence of 10 mM latrunculin, per endosome per min, binned into lifetimes less than or more than 30 s,
quantified across 28 endosomes and 281 tubules.
(C) The percentages of B2AR, TfR, and TfR + latrunculin tubules with lifetimes less than or more than 30 s, normalized to total number of tubules in each case.
(D) An example endosome containing TfR and coronin, showing that coronin is present on a subset of the TfR tubules. Arrowheads indicate a TfR tubule that is
marked by coronin, and arrows show a TfR tubule that is not.
(E) Time lapse series showing TfR-containing tubules extruding from endosomal domains without detectable cortactin. Arrowheads indicate a relatively stable
TfR tubule that is marked by coronin, and arrows denote rapid transient TfR tubules without detectable cortactin.
(F) Frames from a representative time lapse movie showing FRAP of B2AR (top row) or TfR (bottom row). The circles mark the bleached area of the endosome. TfR
fluorescence recovers rapidly, while B2AR fluorescence recovers slowly.
(G) Fluorescence recovery of B2AR (red circles) and TfR (green diamonds) on endosomes quantified from 11 experiments. Exponential fits (solid lines) show that
B2AR fluorescence recovers with a t1/2 of 25.77 s (R2 = 0.83, d.f = 37, Sy.x = 6.3), while TfR fluorescence recovers with a t1/2 of 6.21 s (R2 = 0.91, d.f = 30, Sy.x = 7.1).
768 Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc.
PDZ-interacting recycling sequence on B2AR was both required
and sufficient to mediate concentration of receptors in the actin-
stabilized endosomal tubular domains.
As PDZ-domain interactions have been established to indi-
rectly link various integral membrane proteins to cortical actin
(Fehon et al., 2010), we tested whether linking DOR to actin
was sufficient to drive receptor entry into endosomal tubules.
Remarkably, fusion of the actin-binding domain of the ERM
protein ezrin (Turunen et al., 1994) to the C terminus of DOR
was sufficient to localize the receptor (termed DOR-ABD) to
endosomal tubules (Figure 6J). The surface recycling of B2AR,
DOR-B2, and DOR-ABD were dependent on the presence of
an intact actin cytoskeleton (Figure S4), consistent with previous
publications (Cao et al., 1999; Gage et al., 2005; Lauffer et al.,
2009). Further, transplantation of the actin-binding domain was
also sufficient to specifically confer recycling to a version of
B2AR lacking its native recycling signal (Figure S4F). These
results indicate that the concentration of B2AR in the actin-stabi-
lized recycling tubules is mediated by linking receptors to the
local actin cytoskeleton through PDZ interactions.
DISCUSSION
Even though endocytic receptor sorting was first appreciated
over two decades ago (e.g., Brown et al., 1983; Farquhar,
1983; Steinman et al., 1983), our understanding of the principles
of this process has been limited. A major reason for this has been
the lack of direct assays to visualize signaling receptor sorting in
the endosome. Here we directly visualized, in living cells, endo-
somal sorting between two prototypic members of the largest
known family of signaling receptors for which sequence-specific
recycling is critical for physiological regulation of cell signaling
(Pippig et al., 1995; Lefkowitz et al., 1998; Xiang and Kobilka,
2003). We resolve sorting at the level of single trafficking events
on individual endosomes, and define a kinetic and affinity-based
model for how sequence-dependent receptors are sorted away
from bulk-recycling and degrading proteins.
By analyzing individual sorting and recycling events on single
endosomes, we demonstrate a remarkable diversity in recycling
pathways emanating from the same organelle (Scita and Di
Fiore, 2010). The traditional view has been that recycling to the
plasma membrane is mediated by a uniform set of endosomal
tubules from a single endosome. In contrast to this view, we
demonstrate that the recycling pathway is highly specialized,
and that specific cargo can segregate into specialized subsets
of tubules that are biochemically, biophysically, and functionally
distinct. Receptor recycling plays a critical role in controlling the
rate of cellular re-sensitization to signals (Lefkowitz et al., 1998;
Sorkin and von Zastrow, 2009), and recent data suggest that
the sequence-dependent recycling of signaling receptors is
selectively controlled by signaling pathways (Yudowski et al.,
2009). The physical separation between bulk and sequence-
dependent recycling that we demonstrate here allows for such
selective control without affecting the recycling of constitutively
cycling nutrient receptors. Further, such physical separation
might also reflect the differences in molecular requirements
that have been observed between bulk and sequence-depen-
dent recycling (Hanyaloglu and von Zastrow, 2007).
Endosome-associated actin likely plays a dual role in endoso-
mal sorting, both of which contribute to sequence-dependent
entry of cargo selectively into special domains. First, by stabi-
lizing the specialized endosomal tubules relative to the much
more dynamic tubules that mediate bulk recycling, the local actin
cytoskeleton could allow sequence-dependent cargo to
overcome a kinetic barrier that limits their entry into the bulk
pathway. Supporting this, we show that most endosomal tubules
are highly transient, lasting less than a few seconds (Figures 5B
and 5C), which allows enough time for entry of the fast-diffusing
bulk recycling cargo, but not the slow-diffusing sequence-
dependent cargo (Figures 5F and 5G), into these tubules.
A subset of these tubules representing the sequence-dependent
recycling pathway is stabilized by the presence of an actin cyto-
skeleton (Figures 5B and 5C). This stabilization allows time for
B2AR to diffuse into these tubules (Figure S3), which eventually
pinch off membranes that can directly fuse with the plasma
membrane (Figure 2). Interestingly, inhibition of actin caused
a decrease in the total number of tubules by approximately
25% (Figure 5B), suggesting that the actin cytoskeleton plays
a role in maintaining the B2AR-containing subset of tubules,
and not just in the sorting of B2AR into these tubules.
Second, a local actin cytoskeleton could provide the
machinery for active concentration of recycling proteins like
the B2AR, which interact with actin-associated sorting proteins
(ERM and ERM-binding proteins) through C-terminal sequences
(Weinman et al., 2006; Wheeler et al., 2007; Lauffer et al., 2009;
Fehon et al., 2010), in specialized recycling tubules. Consistent
with this, the C-terminal sequence on B2AR was both required
and sufficient for sorting to the endosome and for recycling,
and a distinct actin-binding sequence was sufficient for both
receptor entry into tubules and recycling (Figure 6 and Figure S4).
PDZ-interacting sequences have been identified on several
signaling receptors, including multiple GPCRs, with different
specificities for distinct PDZ-domain proteins (Weinman et al.,
2006). Further, actin-stabilized subsets of tubules were present
even in the absence of B2AR in the endosome. We propose
that, using a combination of kinetic and affinity-based sorting
principles, discrete Actin-Stabilized SEquence-dependent
Recycling Tubule (ASSERT) domains could thus mediate effi-
cient sorting of sequence-dependent recycling cargo away
from both degradation and bulk recycling pathways that diverge
from the same endosomes.
Our results, therefore, uncover an additional role for actin poly-
merization in endocytic sorting, separate from its role in endo-
some motility. It will be interesting to investigate the mechanism
and signals that control the nucleation of such a spatially local-
ized actin cytoskeleton on the endosome. The lack of obvious
(H) Fluorescence recovery of B2AR (blue triangles) and TfR (green diamonds) on endosomes when the whole endosome was bleached, or of B2AR on the cell
surface (red circles) quantified from 12 experiments. B2AR fluorescence on the surface recovers with a t1/2 of 6.49 s (R2 = 0.94, d.f = 27, Sy.x = 8.1).
Error bars denote SEM. Scale bars represent 1 mm. See also Figure S3 and Movie S8.
Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc. 769
Figure 6. B2AR Enrichment in Tubules Depends on Endosomal Actin and a PDZ-Interacting Sequence on the B2AR Cytoplasmic Domain
(A) Representative fields from B2AR-expressing cells exposed to isoproterenol showing B2AR endosomes before (top panel) or after (bottom panel) exposure to
10 mM latrunculin for 5 min. Tubular endosomal domains enriched in B2AR (arrowheads) are lost upon exposure to latrunculin.
(B) Schematic of measurement of endosomal B2AR fluorescence profiles in the limiting membrane. The profile was measured in a clockwise manner starting from
the area diametrically opposite the tubule (an angle of 0�).(C) B2AR concentration along the endosomal membrane, calculated from fluorescence profiles of 20 endosomes, normalized to the average endosomal B2AR
fluorescence. In the presence of latrunculin, B2AR enrichment in tubules is abolished, and B2AR fluorescence shows little variation along the endosomal
membrane.
(D) Variance in endosomal B2AR fluorescence values measured before and after latrunculin. B2AR distribution becomes more uniform after latrunculin.
(E) The percentages of endosomes extruding B2AR-containing tubules, calculated before (n = 246) and after (n = 106) treatment with latrunculin, or before
(n = 141) and after (n = 168) cytochalasin-D, show a significant reduction after treatment with either drug. As a control, the percentages of endosomes extruding
TfR-containing tubules before (n = 317) and after (n = 286), respectively, are shown.
(F) Cortactin immunoblot showing reduction in protein levels after siRNA.
(G) Representative fields from B2AR-containing endosomes in cells treated with control and cortactin siRNA. Arrowheads denote endosomal tubules in the
control siRNA-treated cells.
(H) Percentages of endosomes extruding B2AR tubules calculated in control siRNA-treated cells (n = 210), cortactin siRNA-treated cells (n = 269), and cortactin
siRNA-treated cells expressing an siRNA-resistant cortactin (n = 250).
(I) Representative examples of endosomes from agonist-exposed cells expressing B2AR, B2AR-ala, DOR, or DOR-B2. Arrowheads denote receptor-containing
tubules on B2AR and DOR-B2 endosomes.
(J) The percentage of endosomes with tubular domains containing B2AR, B2AR-ala, DOR, DOR-B2, or DOR-ABD (n = 246, 302, 137, 200, and 245, respectively)
were quantified.
Scale bars represent 1 mm; and error bars represent SEM. See also Figure S4.
770 Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc.
concentration of the canonical Arp2/3 activators, WASP and
WAVE, suggests a novel mode of actin nucleation involving cor-
tactin. Cortactin can act as a nucleation-promoting factor for
Arp2/3, at least in vitro (Ammer and Weed, 2008), and can
interact with dynamin (Schafer et al., 2002; McNiven et al.,
2000), which makes it an attractive candidate for coordinating
actin dynamics on membranes. Interestingly, inhibition of
WASH, a recently described Arp regulator that is present on
B2AR tubules, has been reported to result in an increase in endo-
somal tubules (Derivery et al., 2009). Although its role in
sequence-dependent recycling remains to be tested, this
suggests the presence of multiple actin-associated proteins
with distinct functions on the endosome.
The simple kinetic and affinity-based principle that we
propose likely provides a physical basis for sequence-depen-
dent sorting of internalized membrane proteins between essen-
tially opposite fates in distinct endosomal domains. Proteins that
bind sequence-dependent degrading receptors and are required
for their degradation (Whistler et al., 2002; Marley and von
Zastrow, 2010) might act as scaffolds and provide a similar
kinetic barrier to prevent them from accessing the rapid bulk-re-
cycling tubules. Entry of these receptors into the involution
pathway might then be accelerated by their association with
the well-characterized ESCRT-associated domains on the vacu-
olar portion of endosomes (Hurley, 2008; Saksena et al., 2007;
Williams and Urbe, 2007), complementary to the presently iden-
tified ASSERT domains on a subset of endosomal tubules.
Such diversity at the level of individual trafficking events to the
same destination from the same organelle raises the possibility
that there exists yet further specialization among the pathways
that mediate exit out of the endosome, including in the degrada-
tive pathway and the retromer-based pathway to the trans-Golgi
network. Importantly, the physical separation in pathways that
we report here potentially allows for cargo-mediated regulation
as a mode for controlling receptor recycling to the plasma
membrane. Such a mechanism can provide virtually an unlimited
level of selectivity in the post-endocytic system using minimal
core trafficking machineries, as has been observed for endocy-
tosis at the cell surface (Puthenveedu and von Zastrow, 2006).
As the principles of such sorting depend critically on kinetics,
the high-resolution imaging used here to analyze domain kinetics
and biochemistry, and to achieve single-event resolution in living
cells, provides a powerful method to elucidate biologically
important sorting processes in the future.
EXPERIMENTAL PROCEDURES
Constructs and Reagents
Receptor constructs and stably transfected HEK293 cell lines are described
previously (Gage et al., 2005; Lauffer et al., 2009) Transfections were per-
formed using Effectene (QIAGEN) according to manufacturer’s instructions.
For visualizing receptors, FLAG-tagged receptors were labeled with M1 anti-
bodies (Sigma) conjugated with Alexa-555 (Invitrogen) as described (Gage
et al., 2005), or fusion constructs were generated where receptors were
tagged on the N-terminus with GFP. Latrunculin and Cytochalasin D (Sigma)
were used at 10 mM final concentration.
Live-Cell and Fluorescence Imaging
Cells were imaged using a Nikon TE-2000E inverted microscope with a 1003
1.49 NA TIRF objective (Nikon) and a Yokagawa CSU22 confocal head (Sola-
mere), or an Andor Revolution XD Spinning disk system on a Nikon Ti micro-
scope. A 488 nm Ar laser and a 568 nm Ar/Kr laser (Melles Griot), or 488 nm
and 561 nm solid-state lasers (Coherent) were used as light sources. Cells
were imaged in Opti-MEM (GIBCO) with 2% serum and 30 mM HEPES
(pH 7.4), maintained at 37�C using a temperature-controlled incubation
chamber. Time lapse images were acquired with a Cascade II EM-CCD
camera (Photometrics) driven by MicroManager (www.micro-manager.org)
or an Andor iXon+ EM-CCD camera using iQ (Andor). The same lasers were
used as sources for bleaching in FRAP experiments. Structured illumination
microscopy was performed as described earlier (Gustafsson et al., 2008).
Electron Microscopy
EM studies were carried out using MDCK cells because they are amenable to
a previously described pre-embedding processing that facilitates detection of
cytoplasmic actin filaments (Ikonen et al., 1996; Parton et al., 1991), and
because they contain morphologically similar endosomes to HEK293 cells.
Cells were grown on polycarbonate filters (Transwell 3412; Costar, Cam-
bridge, MA) for 4 days as described previously (Parton et al., 1991). To allow
visualization of early endosomes and any associated filaments a pre-embed-
ding approach was employed. Cells were incubated with HRP (Sigma type II,
10mg/ml) in the apical and basolateral medium for 10min at 37�C and then
washed, perforated, and immunogold labeled with a rabbit anti- actin anti-
body, a gift of Professor Jan de Mey (Strasbourg), followed by 9nm protein
A-gold. HRP visualization and epon embedding was as described previously
(Parton et al., 1991; Ikonen et al., 1996).
Image and Data Analysis
Acquired image sequences were saved as 16-bit tiff stacks, and quantified
using ImageJ (http://rsb.info.nih.gov/ij/). For estimating receptor enrichment,
a circular mask 5 px in diameter was used to manually select the membrane
at the base of the tubule or membranes derived from endosomes. Fluores-
cence values measured were normalized to that of the endosomal membrane
devoid of tubules. An area of the coverslip lacking cells was used to estimate
background fluorescence. For estimating linear pixel values along the tubules,
a line selection was drawn along the tubule and across the endosome, and the
Plot Profile function used to measure pixel values. For obtaining the average
value plot across multiple sorting events, the linear pixels were first normalized
to the diameter of the endosome and then averaged. To generate pixel values
along the endosomal limiting membranes, the Oval Profile plugin, with 60
segments, was used after manually selecting the endosomal membrane using
an oval ROI. Lifetimes of tubules were calculated by manually tracking the
extension and retraction of tubules over time-lapse series. Microsoft Excel
was used for simple data analyses and graphing. Curve fits of data were per-
formed using GraphPad Prism. All P-values are from two-tailed Mann-Whitney
tests unless otherwise noted.
SUPPLEMENTAL INFORMATION
Supplemental Information includes four figures and eight movies and can be
found with this article online at doi:10.1016/j.cell.2010.10.003.
ACKNOWLEDGMENTS
The majority of the imaging was performed at the Nikon Imaging Center at
UCSF. We thank David Drubin, Matt Welch, John Sedat, Aylin Hanyaloglu,
Aaron Marley, and James Hislop for essential reagents and valuable help.
M.A.P. was supported by a K99/R00 grant DA024698, M.v.Z. by an R37 grant
DA010711, and O.D.W. by an RO1 grant GM084040, all from the NIH. J.T. is an
investigator of the Howard Hughes Medical Institute.
Received: October 31, 2009
Revised: April 7, 2010
Accepted: September 27, 2010
Published: November 24, 2010
Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc. 771
REFERENCES
Ammer, A.G., and Weed, S.A. (2008). Cortactin branches out: roles in regu-
lating protrusive actin dynamics. Cell Motil. Cytoskeleton 65, 687–707.
Brown, M.S., Anderson, R.G., and Goldstein, J.L. (1983). Recycling receptors:
the round-trip itinerary of migrant membrane proteins. Cell 32, 663–667.
Benink, H.A., and Bement, W.M. (2005). Concentric zones of active RhoA and
Cdc42 around single cell wounds. J. Cell Biol. 168, 429–439.
Cao, T.T., Deacon, H.W., Reczek, D., Bretscher, A., and von Zastrow, M.
(1999). A kinase-regulated PDZ-domain interaction controls endocytic sorting
of the b2-adrenergic receptor. Nature 401, 286–290.
Cullen, P.J. (2008). Endosomal sorting and signalling: an emerging role for
sorting nexins. Nat. Rev. Mol. Cell Biol. 9, 574–582.
Daly, R.J. (2004). Cortactin signalling and dynamic actin networks. Biochem. J.
382, 13–25.
Derivery, E., Sousa, C., Gautier, J.J., Lombard, B., Loew, D., and Gautreau, A.
(2009). The Arp2/3 activator WASH controls the fission of endosomes through
a large multiprotein complex. Dev. Cell 17, 712–723.
Duleh, S.N., and Welch, M.D. (2010). WASH and the Arp2/3 complex regulate
endosome shape and trafficking. Cytoskeleton (Hoboken) 67, 193–206.
Dunn, K.W., and Maxfield, F.R. (1992). Delivery of ligands from sorting endo-
somes to late endosomes occurs by maturation of sorting endosomes.
J. Cell Biol. 117, 301–310.
Farquhar, M.G. (1983). Intracellular membrane traffic: pathways, carriers, and
sorting devices. Methods Enzymol. 98, 1–13.
Fehon, R.G., McClatchey, A.I., and Bretscher, A. (2010). Organizing the cell
cortex: the role of ERM proteins. Nat. Rev. Mol. Cell Biol. 11, 276–287.
Gage, R.M., Matveeva, E.A., Whiteheart, S.W., and von Zastrow, M. (2005).
Type I PDZ ligands are sufficient to promote rapid recycling of G Protein-
coupled receptors independent of binding to N-ethylmaleimide-sensitive
factor. J. Biol. Chem. 280, 3305–3313.
Girao, H., Geli, M.I., and Idrissi, F.Z. (2008). Actin in the endocytic pathway:
from yeast to mammals. FEBS Lett. 582, 2112–2119.
Gomez, T.S., and Billadeau, D.D. (2009). A FAM21-containing WASH complex
regulates retromer-dependent sorting. Dev. Cell 17, 699–711.
Gustafsson, M.G., Shao, L., Carlton, P.M., Wang, C.J., Golubovskaya, I.N.,
Cande, W.Z., Agard, D.A., and Sedat, J.W. (2008). Three-dimensional resolu-
tion doubling in wide-field fluorescence microscopy by structured illumination.
Biophys. J. 94, 4957–4970.
Hanyaloglu, A.C., and von Zastrow, M. (2007). A novel sorting sequence in the
beta2-adrenergic receptor switches recycling from default to the Hrs-depen-
dent mechanism. J. Biol. Chem. 282, 3095–3104.
Hanyaloglu, A.C., and von Zastrow, M. (2008). Regulation of GPCRs by endo-
cytic membrane trafficking and its potential implications. Annu. Rev. Pharma-
col. Toxicol. 48, 537–568.
Hanyaloglu, A.C., McCullagh, E., and von Zastrow, M. (2005). Essential role of
Hrs in a recycling mechanism mediating functional resensitization of cell
signaling. EMBO J. 24, 2265–2283.
Hurley, J.H. (2008). ESCRT complexes and the biogenesis of multivesicular
bodies. Curr. Opin. Cell Biol. 20, 4–11.
Ikonen, E., Parton, R.G., Lafont, F., and Simons, K. (1996). Analysis of the role
of p200-containing vesicles in post-Golgi traffic. Mol. Biol. Cell 7, 961–974.
Kaksonen, M., Peng, H.B., and Rauvala, H. (2000). Association of cortactin
with dynamic actin in lamellipodia and on endosomal vesicles. J. Cell Sci.
113, 4421–4426.
Kaksonen, M., Toret, C.P., and Drubin, D.G. (2005). A modular design for the
clathrin- and actin-mediated endocytosis machinery. Cell 123, 305–320.
Lauffer, B.E., Chen, S., Melero, C., Kortemme, T., von Zastrow, M., and Var-
gas, G.A. (2009). Engineered protein connectivity to actin mimics PDZ-depen-
dent recycling of G protein-coupled receptors but not its regulation by Hrs.
J. Biol. Chem. 284, 2448–2458.
Lefkowitz, R.J., Pitcher, J., Krueger, K., and Daaka, Y. (1998). Mechanisms of
beta-adrenergic receptor desensitization and resensitization. Adv. Pharmacol.
42, 416–420.
Marchese, A., Paing, M.M., Temple, B.R., and Trejo, J. (2008). G protein-
coupled receptor sorting to endosomes and lysosomes. Annu. Rev. Pharma-
col. Toxicol. 48, 601–629.
Marley, A., and von Zastrow, M. (2010). Dysbindin promotes the post-endo-
cytic sorting of G protein-coupled receptors to lysosomes. PLoS ONE 5,
e9325.
Maxfield, F.R., and McGraw, T.E. (2004). Endocytic recycling. Nat. Rev. Mol.
Cell Biol. 5, 121–132.
Mayor, S., Presley, J.F., and Maxfield, F.R. (1993). Sorting of membrane
components from endosomes and subsequent recycling to the cell surface
occurs by a bulk flow process. J. Cell Biol. 121, 1257–1269.
McNiven, M.A., Kim, L., Krueger, E.W., Orth, J.D., Cao, H., and Wong, T.W.
(2000). Regulated interactions between dynamin and the actin-binding protein
cortactin modulate cell shape. J. Cell Biol. 151, 187–198.
Merrifield, C.J., Qualmann, B., Kessels, M.M., and Almers, W. (2004). Neural
Wiskott Aldrich Syndrome Protein (N-WASP) and the Arp2/3 complex are re-
cruited to sites of clathrin-mediated endocytosis in cultured fibroblasts. Eur.
J. Cell Biol. 83, 13–18.
Miesenbock, G., De Angelis, D.A., and Rothman, J.E. (1998). Visualizing secre-
tion and synaptic transmission with pH-sensitive green fluorescent proteins.
Nature 394, 192–195.
Millard, T.H., Sharp, S.J., and Machesky, L.M. (2004). Signalling to actin
assembly via the WASP (Wiskott-Aldrich syndrome protein)-family proteins
and the Arp2/3 complex. Biochem. J. 380, 1–17.
Parton, R.G., Dotti, C.G., Bacallao, R., Kurtz, I., Simons, K., and Prydz, K.
(1991). pH-induced microtubule-dependent redistribution of late endosomes
in neuronal and epithelial cells. J. Cell Biol. 113, 261–274.
Perrais, D., and Merrifield, C.J. (2005). Dynamics of endocytic vesicle creation.
Dev. Cell 9, 581–592.
Piper, R.C., and Katzmann, D.J. (2007). Biogenesis and function of multivesic-
ular bodies. Annu. Rev. Cell Dev. Biol. 23, 519–547.
Pippig, S., Andexinger, S., and Lohse, M.J. (1995). Sequestration and
recycling of beta 2-adrenergic receptors permit receptor resensitization.
Mol. Pharmacol. 47, 666–676.
Pollard, T.D. (2007). Regulation of actin filament assembly by Arp2/3 complex
and formins. Annu. Rev. Biophys. Biomol. Struct. 36, 451–477.
Puthenveedu, M.A., and von Zastrow, M. (2006). Cargo regulates clathrin-
coated pit dynamics. Cell 127, 113–124.
Saksena, S., Sun, J., Chu, T., and Emr, S.D. (2007). ESCRTing proteins in the
endocytic pathway. Trends Biochem. Sci. 32, 561–573.
Schafer, D.A., Weed, S.A., Binns, D., Karginov, A.V., Parsons, J.T., and
Cooper, J.A. (2002). Dynamin2 and cortactin regulate actin assembly and fila-
ment organization. Curr. Biol. 12, 1852–1857.
Scita, G., and Di Fiore, P.P. (2010). The endocytic matrix. Nature 463, 464–473.
Shinozaki-Narikawa, N., Kodama, T., and Shibasaki, Y. (2006). Cooperation of
phosphoinositides and BAR domain proteins in endosomal tubulation. Traffic
7, 1539–1550.
Sorkin, A., and von Zastrow, M. (2009). Endocytosis and signalling: intertwin-
ing molecular networks. Nat. Rev. Mol. Cell Biol. 10, 609–622.
Stamnes, M. (2002). Regulating the actin cytoskeleton during vesicular trans-
port. Curr. Opin. Cell Biol. 14, 428–433.
Steinman, R.M., Mellman, I.S., Muller, W.A., and Cohn, Z.A. (1983). Endocy-
tosis and the recycling of plasma membrane. J. Cell Biol. 96, 1–27.
Traer, C.J., Rutherford, A.C., Palmer, K.J., Wassmer, T., Oakley, J., Attar, N.,
Carlton, J.G., Kremerskothen, J., Stephens, D.J., and Cullen, P.J. (2007).
SNX4 coordinates endosomal sorting of TfnR with dynein-mediated transport
into the endocytic recycling compartment. Nat. Cell Biol. 9, 1370–1380.
772 Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc.
Turunen, O., Wahlstrom, T., and Vaheri, A. (1994). Ezrin has a COOH-terminal
actin-binding site that is conserved in the ezrin protein family. J. Cell Biol. 126,
1445–1453.
Uetrecht, A.C., and Bear, J.E. (2006). Coronins: the return of the crown. Trends
Cell Biol. 16, 421–426.
Weinman, E.J., Hall, R.A., Friedman, P.A., Liu-Chen, L.Y., and Shenolikar, S.
(2006). The association of NHERF adaptor proteins with g protein-coupled
receptors and receptor tyrosine kinases. Annu. Rev. Physiol. 68, 491–505.
Wheeler, D., Sneddon, W.B., Wang, B., Friedman, P.A., and Romero, G.
(2007). NHERF-1 and the cytoskeleton regulate the traffic and membrane
dynamics of G protein-coupled receptors. J. Biol. Chem. 282, 25076–25087.
Whistler, J.L., Enquist, J., Marley, A., Fong, J., Gladher, F., Tsuruda, P., Mur-
ray, S.R., and Von Zastrow, M. (2002). Modulation of postendocytic sorting of
G protein-coupled receptors. Science 297, 615–620.
Williams, R.L., and Urbe, S. (2007). The emerging shape of the ESCRT
machinery. Nat. Rev. Mol. Cell Biol. 8, 355–368.
Xiang, Y., and Kobilka, B.K. (2003). Myocyte adrenoceptor signaling path-
ways. Science 300, 1530–1532.
Yarar, D., Waterman-Storer, C.M., and Schmid, S.L. (2005). A dynamic actin
cytoskeleton functions at multiple stages of clathrin-mediated endocytosis.
Mol. Biol. Cell 16, 964–975.
Yudowski, G.A., Puthenveedu, M.A., and von Zastrow, M. (2006). Distinct
modes of regulated receptor insertion to the somatodendritic plasma
membrane. Nat. Neurosci. 9, 622–627.
Yudowski, G.A., Puthenveedu, M.A., Henry, A.G., and von Zastrow, M. (2009).
Cargo-mediated regulation of a rapid Rab4-dependent recycling pathway.
Mol. Biol. Cell 20, 2774–2784.
Zerial, M., and McBride, H. (2001). Rab proteins as membrane organizers. Nat.
Rev. Mol. Cell Biol. 2, 107–117.
Cell 143, 761–773, November 24, 2010 ª2010 Elsevier Inc. 773
Mechanisms Determining the Morphologyof the Peripheral ERYoko Shibata,1,2 Tom Shemesh,3 William A. Prinz,4 Alexander F. Palazzo,1,5 Michael M. Kozlov,3,*and Tom A. Rapoport1,2,*1Howard Hughes Medical Institute2Department of Cell Biology
Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115, USA3Department of Physiology and Pharmacology, Sackler Faculty of Medicine, Tel Aviv University, Ramat Aviv, 69978 Tel Aviv, Israel4Laboratory of Cell Biochemistry and Biology, National Institute of Diabetes and Digestive and Kidney Disorders,
National Institute of Health, Bethesda, MD 02892, USA5Department of Biochemistry, University of Toronto, 1 King’s College Circle, Toronto, ON M5S 1A8, Canada*Correspondence: [email protected] (M.M.K.), [email protected] (T.A.R.)
DOI 10.1016/j.cell.2010.11.007
SUMMARY
The endoplasmic reticulum (ER) consists of thenuclear envelope and a peripheral network of tubulesand membrane sheets. The tubules are shaped bythe curvature-stabilizing proteins reticulons andDP1/Yop1p, but how the sheets are formed isunclear. Here, we identify several sheet-enrichedmembrane proteins in the mammalian ER, includingproteins that translocate and modify newly synthe-sized polypeptides, as well as coiled-coil membraneproteins that are highly upregulated in cells withproliferated ER sheets, all of which are localized bymembrane-bound polysomes. These results indicatethat sheets and tubules correspond to rough andsmooth ER, respectively. One of the coiled-coilproteins, Climp63, serves as a ‘‘luminal ER spacer’’and forms sheets when overexpressed. More univer-sally, however, sheet formation appears to involvethe reticulons and DP1/Yop1p, which localize tosheet edges and whose abundance determines theratio of sheets to tubules. These proteins maygenerate sheets by stabilizing the high curvature ofedges.
INTRODUCTION
How the characteristic shape of a membrane-bound organelle is
generated is a fundamental question in cell biology. We have
started to address this question for the endoplasmic reticulum
(ER), an organelle that has a particularly intriguing morphology.
It is a continuous membrane system that is comprised of the
nuclear envelope as well as of a peripheral network of tubules
and sheets (Baumann and Walz, 2001; Shibata et al., 2009;
Voeltz et al., 2002). Both the tubules and sheets are dynamic,
i.e., they are continuously forming and collapsing. Previous
work has identified proteins that are responsible for shaping
the tubular ER network (Hu et al., 2008, 2009; Shibata et al.,
2008; Voeltz et al., 2006), but essentially nothing is known about
how ER sheets are generated. In addition, it is unknown whether
proteins specifically segregate into ER sheets and whether there
is a functional significance to the existence of different ER
morphologies.
ER tubules are characterized by high membrane curvature in
cross-section and are shaped by two families of curvature-stabi-
lizing proteins, the reticulons and DP1/Yop1p (Voeltz et al.,
2006). Members of both families are ubiquitously expressed in
all eukaryotic cells. These proteins localize to the ER tubules,
and their depletion leads to the loss of tubules. Conversely, the
overexpression of certain isoforms results in long, unbranched
tubules. Purified members of the two families deform reconsti-
tuted proteoliposomes into tubules (Hu et al., 2008). Together,
these results indicate that the reticulons and DP1/Yop1p are
both necessary and sufficient for ER tubule formation. These
two protein families do not share sequence homology, but
both have a conserved domain containing two long hydrophobic
segments that sit in the membrane as hairpins (Voeltz et al.,
2006). These hairpins may stabilize the high curvature of tubules
in cross-section by forming a wedge in the lipid bilayer. In addi-
tion, oligomerization of these proteins may generate arc-like
scaffolds around the tubules (Shibata et al., 2008).
The peripheral ER sheets vary in size but always consist of two
closely apposed membranes whose distance is approximately
the same as the diameter of the tubules (�30 nm in yeast
[Bernales et al., 2006] and �50 nm in mammals). Consequently,
the edges of sheets have a similarly high curvature as the cross-
section of tubules. In ‘‘professional’’ secretory cells, such as
plasma B cells or pancreatic cells, the ER sheets extend
throughout the entire cell and are studded with membrane-
bound ribosomes. They are stacked tightly with regular
distances between the membranes on both the cytoplasmic
and luminal sides (Fawcett, 1981). By contrast, cells that do
not secrete many proteins contain mostly tubular ER. These
observations have led to the idea that ER sheets correspond to
rough ER (Shibata et al., 2006), the region of the ER that contains
membrane-bound ribosomes, i.e., ribosomes associated with
774 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
the translocons, the sites of translocation and modification of
newly synthesized secretory and membrane proteins. On the
other hand, ER tubules would correspond to smooth ER (Shibata
et al., 2006), the ER region devoid of ribosomes, which may be
specialized in lipid metabolism or Ca2+ signaling. While these
ideas are attractive, the tubular ER clearly contains membrane-
bound ribosomes, and a segregation of rough ER proteins into
sheets has not yet been demonstrated.
Several mechanisms of ER sheet formation have been consid-
ered. One possibility is that integral membrane proteins would
form bridges across the luminal space of the ER (Senda and
Yoshinaga-Hirabayashi, 1998; Shibata et al., 2009). A second
possibility is that proteins form flat cytoplasmic or luminal
scaffolds, as suggested for the formation of flat Golgi cisternae
(Short et al., 2005). It has also been proposed that the membrane
association of ribosomes could directly be responsible for the
generation of ER sheets (Puhka et al., 2007). Finally, given that
the reticulons and DP1/Yop1p generate high curvature
membranes, one might imagine that they generate sheets by
stabilizing the sheet edges, bringing the apposing membranes
in close proximity (Shibata et al., 2009).
Here, we show that rough ER proteins partition into ER sheets.
This includes both proteins involved in translocation and modifi-
cation of newly synthesized polypeptides, as well as coiled-coil
membrane proteins that are highly upregulated in cells contain-
ing proliferated ER sheets. Membrane-bound polysomes are
required for the segregation of these rough ER proteins into
sheets, and one of the coiled-coil proteins, Climp63, serves as
a luminal ER spacer. However, neither the polysomes nor the
coiled-coil proteins are essential for sheet formation per se.
Instead, a major mechanism of sheet formation appears to
involve the reticulons and DP1/Yop1p proteins, which can
stabilize the high membrane curvature at sheet edges. Our
results suggest that, in many cells, their abundance is the major
determinant of ER morphology.
RESULTS
Segregation of Proteins into ER SheetsThe different morphologies of the ER imply that, despite the
continuity of the membrane system, some proteins are likely
enriched in certain domains. So far, the only proteins known
with a specific localization are the tubule-preferring reticulons,
DP1/Yop1p, and atlastins/Sey1p (Hu et al., 2009; Shibata
et al., 2008; Voeltz et al., 2006). These proteins localize to tubules
even when highly overexpressed. By contrast, other overex-
pressed ER proteins distribute indiscriminately throughout the
entire ER, making it impossible to draw conclusions about their
endogenous localizations. We therefore first tested whether
several endogenous ER proteins segregate into different ER
domains using immunofluorescence and confocal microscopy
in BSC1 cells. As expected, the luminal ER protein calreticulin,
which is involved in the folding of glycoproteins, was found in
peripheral ER sheets, which are mostly located close to the
nucleus, as well as in the tubular ER network and the nuclear
envelope (Figure 1A). Calreticulin almost perfectly colocalized
with GFP-tagged Sec61b, stably overexpressed in the same
cell. Endogenous Sec61b is part of the Sec61 complex, the
component forming the protein-conducting channel in the ER,
but due to its tagging with GFP and overexpression,
GFP-Sec61b is not associated with the translocon and distrib-
utes throughout the ER (Shibata et al., 2008). Antibodies recog-
nizing the luminal chaperones BiP and Grp94 (anti-KDEL) also
stained the entire ER (Figure 1C, middle). The integral membrane
proteins calnexin and Bap31 showed a similar ubiquitous local-
ization as overexpressed GFP-Sec61b (Figure 1B and Figure S1
available online). These results suggest that many luminal and
membrane ER proteins do not localize to a specific ER domain,
consistent with the continuity of the membrane system.
Next, we tested the endogenous localization of components of
the translocon. In contrast to overexpressed GFP-Sec61b,
endogenous Sec61b was found concentrated in ER sheets
when compared to the localization of the luminal ER proteins
BiP and GRP94 (Figure 1C), although some weak staining of
the tubular network and nonspecific staining of the cytoplasm
were also seen. Because endogenous Sec61b is contained in
the Sec61 complex, these data suggest that translocons are
enriched in ER sheets. This is supported by the localization of
endogenous TRAPa, a component tightly associated with the
ribosome-bound Sec61 complex (Menetret et al., 2008); TRAPa
was strongly enriched in the peripheral ER sheets (Figure 1D).
Finally, Dad1, a component of the translocon-associated
oligosaccharyl transferase complex that glycosylates nascent
secretory and membrane proteins, also showed a similar locali-
zation; GFP-tagged Dad1 that was stably expressed in Dad1-
deficient cells at a level just sufficient to sustain viability (Nikonov
et al., 2002) showed a clear preference for ER sheets, in contrast
to calreticulin in the same cell (Figure 1E). Together, these data
indicate that translocon components are enriched in ER sheets.
To identify additional sheet-segregating proteins that could
potentially be required for sheet formation, we reasoned that
such proteins would be abundant in highly secretory cells that
contain proliferated ER sheets. We therefore identified by mass
spectrometry the most abundant, integral ER membrane
proteins in dog pancreatic rough microsomes. The 25 most
abundant proteins include translocon components, such as
subunits of the oligosaccharyl transferase complex, signal
peptidase, SRP receptor, components of the TRAP complex,
and the Sec61 complex (Table S1). Of interest, the list also
includes p180 and Climp63. Kinectin, which is sequence related
to p180, is somewhat less abundant. All of these proteins have
a single transmembrane segment and an extended coiled-coil
domain, which is located on the luminal side of the ER membrane
in the case of Climp63 and on the cytoplasmic side in the case of
p180 and kinectin (Figure S2A). The molecular function of these
coiled-coil proteins is not well understood. Climp63 has been
implicated in the interaction of ER membranes with microtubules
(Klopfenstein et al., 1998). P180 was originally proposed to be
a ribosome receptor (Savitz and Meyer, 1990); it also interacts
with microtubules (Ogawa-Goto et al., 2007) and is now thought
to play a role in the differentiation of certain monocytic cells (Be-
nyamini et al., 2009). Kinectin was initially identified as a receptor
for the molecular motor kinesin (Toyoshima et al., 1992).
Another way to identify potential sheet-segregating proteins is
to analyze components that are upregulated during the differen-
tiation of immature B cells to IgG-secreting plasma cells, which
Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc. 775
involves massive ER sheet proliferation. To identify mRNAs
whose abundance is greatly increased, we sorted through
published microarray data (Luckey et al., 2006). The list of the
25 most upregulated mRNAs coding for ER membrane proteins
(Table S2) includes components of the translocon, of the
unfolded protein response, and of the ER protein degradation
Figure 1. Localization of Proteins to Different ER Domains
(A) The localization of endogenous luminal ER protein calreticulin is compared with that of the stably overexpressed membrane protein GFP-Sec61b using
confocal microscopy in BSC1 cells. Calreticulin was detected with specific antibodies by indirect immunofluorescence (left) and Sec61b by GFP fluorescence
(middle). The right panel shows a merged image. Scale bar, 10 mm.
(B) As in (A) but comparing the localization of the ER membrane protein calnexin with that of GFP-Sec61b.
(C) The localization of endogenous Sec61b is compared to that of the endogenous ER luminal proteins BiP and GRP94 (anti-KDEL), using indirect immunoflu-
orescence with specific antibodies and confocal microscopy.
(D) As in (A) but comparing the localization of the translocon membrane protein TRAPawith that of GFP-Sec61b. Also note that TRAPa is noticeably depleted from
the nuclear envelope.
(E) The localization of stably expressed GFP-Dad1 in a BHK cell line lacking endogenous Dad1 is compared with that of endogenous calreticulin.
All insets show a magnified view of the boxed areas highlighting the junctions between ER sheets and tubules. See also Figure S1.
776 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
machinery. It also includes Climp63 and p180 (their mRNAs are
upregulated by a factor of 19–26; kinectin mRNA was not
analyzed). Together with the mass spectrometry data, these
results raise the possibility that the coiled-coil membrane
proteins Climp63, p180, and kinectin localize to ER sheets.
Because these proteins have no known function in protein trans-
location or modification, they are also candidates for being
involved in sheet formation.
Next, we tested whether the coiled-coil proteins are enriched
in ER sheets, using immunofluorescence and confocal micros-
copy. At endogenous levels, all three proteins indeed segregated
to ER sheets, whereas in the same cells, calreticulin distributed
throughout the entire ER (Figures 2A–2C). P180-GFP overex-
pressed at moderate levels was also enriched in ER sheets (Fig-
ure S2B). Thus, in addition to the translocon proteins, at least
three other abundant integral membrane proteins are enriched
in ER sheets. All three proteins were noticeably depleted from
the nuclear envelope (Figure 2 and Figure S2), as reported previ-
ously for Climp63 (Klopfenstein et al., 1998).
A Role for Polysomes in Protein Enrichmentin ER SheetsBecause translocon-associated proteins were found enriched in
ER sheets and are also generally associated with ribosomes, we
tested whether the sheet-preferring proteins are localized by
their association with membrane-bound translating ribosomes.
We treated tissue culture cells with puromycin, a drug that
releases nascent polypeptide chains from ribosomes and
disassembles polysomes; the localization of endogenous
sheet-preferring proteins was subsequently analyzed by immu-
nofluorescence. TRAPa moved into the tubular network (Fig-
ure 3A). Quantification shows that, in untreated cells, TRAPa is
enriched in sheets, as compared to the general ER marker
GFP-Sec61b, but 15 min after puromycin addition, TRAPa was
almost equally abundant in sheets and tubules (Figure 3E). The
disassembly of the polysomes did not abolish the ER sheets,
which in fact occupied a larger surface in many cells (Figure S3A).
To rule out the possibility that inhibition of translation causes the
redistribution of TRAPa, we performed control experiments with
cycloheximide, a drug that inhibits the elongation of polypeptide
chains but leaves polysomes intact. Cycloheximide inhibited
protein synthesis as effectively as puromycin (Figure S4), but
TRAPa stayed in ER sheets (Figures 3B and 3E). All of the other
tested ER sheet-preferring proteins behaved in the same way as
TRAPa (Figures 3C–3E). On the other hand, the localization of
calnexin and Bap31, membrane proteins that did not segregate
into ER sheets, remained unchanged after treatment with either
puromycin or cycloheximide, as was also the case for the luminal
protein calreticulin (Figure 3E and Figures S3B and S3C). Pacta-
mycin, an inhibitor of translation initiation, which allows ribo-
somes to run off the mRNAs, had a similar effect as puromycin
on sheet-segregating proteins, i.e., they were no longer concen-
trated in sheets (Figure S3D). Again, the sheets did not disappear
but often occupied a larger area of the cell (Figure S3E). These
results indicate that polysomes concentrate sheet domains
and localize certain membrane proteins to ER sheets, likely
because these proteins have a direct or indirect affinity for
membrane-bound polysomes.
Climp63 Serves as a ‘‘Luminal ER Spacer’’To test for a possible role of the coiled-coil membrane proteins in
ER morphology, we performed RNAi experiments. The depletion
of Climp63, p180, and kinectin (Figure S5A) either individually or
together did not abolish the existence of ER sheets (Figure 2D
versus 2E). Nevertheless, these proteins have an effect on ER
morphology, as the sheets in depleted cells spread throughout
the cytoplasm (Figures S5B and S5C), similarly to what is
observed when cells are treated with puromycin or pactamycin
(Figure S3). It thus seems that the coiled-coil membrane proteins
are not required for sheet formation per se may but function in
segregating sheet domains close to the cell nucleus.
Thin-section electron microscopy of COS7 cells confirmed
that peripheral ER sheets persist after puromycin treatment or
depletion of Climp63, p180, and kinectin (compare Figures 4B
and 4C with 4A). No bulging of the two membrane sheets was
observed, but of interest, the luminal width was significantly
reduced in triple knockdown cells (from 45–50 nm to 25–30 nm;
Figure 4E). A similar effect was seen when Climp63 alone was
depleted (Figures 4D and 4E), whereas single or double knock-
down of p180 and kinectin had no obvious phenotype (Figure 4E
and data not shown). These results indicate that Climp63 serves
to maintain the normal luminal width of peripheral ER sheets,
likely by forming bridges through their luminal coiled-coil
domains (Klopfenstein et al., 2001). Consistent with a luminal
spacer function, organisms that lack Climp63, including
Drosophila S2 cells (Figure 4E), silkworm (Senda and Yoshi-
naga-Hirabayashi, 1998), and S. cerevisiae (Bernales et al.,
2006), all appear to have narrower ER sheets than mammals. It
should be noted that the distance between the inner and outer
nuclear membranes was unaffected by Climp63 depletion and
was the same in mammalian and insect cells (Figure 4E), consis-
tent with the absence of this protein from the nuclear envelope.
Linking the Formation of ER Sheets and TubulesThe overexpression of Climp63 led to a dramatic proliferation of
ER sheets; we observed a good correlation between the expres-
sion level of a FLAG-tagged version of Climp63 in COS7 cells
and the generation of sheets, an effect that is most strikingly
seen in three-dimensional (3D) reconstructions of the ER (Figures
5A and 5B; quantification in 5C). In thin-section electron micros-
copy, prominent membrane structures were seen that consisted
of anastomosing sheets containing membrane-bound ribo-
somes (Figure 5D). The sheets had a constant luminal width of
�50 nm, and at the highest expression levels, the luminal protein
calreticulin was displaced from areas of Climp63 localization
(Figure S6), consistent with Climp63 filling the luminal space.
We also observed organized smooth ER (OSER) structures in
which the membranes were tightly stacked and the internal
membranes were devoid of ribosomes (Figure S7). Although
these structures are likely caused by oligomerization of the
cytoplasmic GFP tag (Snapp et al., 2003), they differ from normal
OSERs by having a constant luminal spacing of �50 nm.
Given that ER sheet proliferation was also observed when the
curvature-stabilizing reticulons are depleted in mammalian cells
by RNAi (Anderson and Hetzer, 2008) or when the reticulons and
Yop1p are lacking in S. cerevisiae (Voeltz et al., 2006), we tested
whether Climp63 and the reticulons have opposing effects on ER
Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc. 777
sheet formation. Indeed, when the reticulon Rtn4b was overex-
pressed in COS7 cells, peripheral ER sheets became diminished
with increasing expression levels (Figures 5E and 5F; quantifica-
tion in Figures 5G and 5H). Concomitant with the decrease in
sheet structures, the normal tubular network was gradually re-
placed with long, unbranched tubules (quantification in Figure 5I).
Figure 2. Membrane Proteins Enriched in ER Sheets
(A) The endogenous localization of the membrane protein Climp63 is compared with that of the luminal ER protein calreticulin in COS7 cells, using indirect
immunofluorescence with specific antibodies. The far-right panel shows a merged image. Junctions between peripheral ER sheets and tubules are highlighted
in the magnified view of the boxed area (inset). Scale bar, 10 mm.
(B) As in (A) but comparing the localization of kinectin (KTN) and calreticulin.
(C) As in (A) but comparing the localization of p180 and calreticulin.
(D) Climp63, p180, and kinectin were depleted in COS7 cells by RNAi (C/P/K siRNA), and Climp63, TRAPa, and calreticulin were visualized using indirect
immunofluorescence with specific antibodies. Scale bar, 10 mm.
(E) As in (D) but with cells transfected with control siRNA oligonucleotides.
See also Figure S2 and Figure S5.
778 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
When Climp63 and Rtn4a were both highly overexpressed, the
normal ER morphology was almost restored (Figure 5J). Taken
together, these results indicate that Climp63 and the curva-
ture-promoting proteins undergo a ‘‘tug-of-war’’ that determines
the amount of membrane partitioning into these domains.
Curvature-Stabilizing Proteins Localize to Sheet EdgesBecause the reticulons and DP1/Yop1p localize to tubules, one
might expect that they are also found at sheets edges because
these have a similarly high membrane curvature as tubules in
cross-section. Indeed, in many cells, the endogenous reticulons
localized to the edges of sheets, as demonstrated by immunoflu-
orescence using antibodies recognizing both Rtn4a and 4b (Fig-
ure 6A). Similar observations were made in plant cells (Sparkes
et al., 2010). In Climp63-overexpressing cells with proliferated
sheets, Rtn4a/b lined the edges of essentially all sheets in an
even more striking manner (Figure 6B).
To test whether the curvature-stabilizing proteins generally
localize to sheet edges, we tested the localization of a reticulon
in S. cerevisiae. We expressed Rtn1p-GFP from the chromo-
some together with ssRFP-HDEL, a general, luminal ER marker.
Indeed, peripheral ER sheets were generally lined by Rtn1p-GFP
(Figure 6C). The edge localization of Rtn1p-GFP was even more
obvious in cells where ER sheet proliferation was induced by
deletion of the genes encoding the tubule-shaping protein
Yop1p and the GTPase Sey1p (Figure 6D) (Hu et al., 2009).
Similar results were obtained when ER sheets were induced by
deletion of OPI1 (Figure 6E) (Schuck et al., 2009). Thus, as in
mammalian cells, the reticulons localize to the edges of periph-
eral ER sheets. These results indicate that the reticulons stabilize
the high curvature of both tubules in cross-section and of sheet
edges.
A Role for Curvature-Stabilizing Proteinsin Sheet FormationGiven the localization of the curvature-generating proteins to
sheet edges, we considered the possibility that they can
generate sheets by bringing the apposing membranes into close
proximity. In this model, the ratio of sheets and tubules would be
determined by the relative amounts of lipids and curvature-
stabilizing proteins. Indeed, the sheet proliferation seen upon
OPI1 deletion in S. cerevisiae (Figure 6E) is likely caused by an
increase in phospholipid synthesis; Opi1p normally inhibits the
transcription factors Ino2p and Ino4p, which control many
phospholipid synthesis enzymes (Ambroziak and Henry, 1994;
Carman and Henry, 2007). To test whether expression of a curva-
ture-stabilizing protein would convert the sheets into tubules, we
used opi1D cells that express Rtn1p-GFP from the chromosome
as well as the luminal ER marker ssRFP-HDEL. The overexpres-
sion of untagged Rtn1p from a CEN plasmid led to a partial
conversion of sheets into tubules (Figure 6F; quantification in
Figure 6H). When untagged Rtn1p was expressed at a still higher
level from a 2 m plasmid, the sheet-to-tubule ratio converted
back to about the level seen in wild-type cells (Figures 6G
and 6H). These data support the idea that the abundance of
the reticulons determines the relative amounts of sheets and
tubules in the cell.
A Model for the Generation of ER Sheets and TubulesTo test whether the curvature-stabilizing proteins alone could
explain the relative amounts of sheets and tubules in a cell, we
developed a simple theoretical model. We assume that the
reticulons and DP1/Yop1p localize exclusively to tubules and
sheet edges, generating and stabilizing these high curvature
membranes by forming oligomeric scaffolds that are shaped
as rigid arcs. Based on previous estimates, the energetically
optimal distance between the arcs is assumed to be 40 nm (Hu
et al., 2008). The edge membrane can be seen as a half-cylinder,
whose axis bends in the sheet plane forming the sheet circumfer-
ence. The protein-driven formation of a sheet edge enables the
two membranes of a sheet to adopt planar shapes (Figure 7A).
A tubule forms by self-folding of a part of the edge into
a complete cylinder and therefore represents an edge extension
(Figure 7A). We assume negligible bulging between the arc-like
scaffolds, as supported by previous results (Hu et al., 2008),
and a diameter of 30 nm for both sheet edges and tubules (Fig-
ure 4) (Bernales et al., 2006).
Our model calculates for a given membrane surface area the
total length of the tubules and the shape and dimensions of the
sheets in dependence of the number of curvature-stabilizing
proteins, Nc. We characterize the edge length by a parameter
G = Le/ Le0, wherein Le
0 is the circumference of a flat circular
disc with the same overall membrane area (i.e., G = 1 for a flat
disc). G is proportional to Nc (Supplemental Information). In our
calculations, we assume that Nc is at least large enough to
generate a circular sheet (G R 1).
For each G value, we computed the overall membrane shape
by minimizing the energy of the edge bending in the sheet plane
(see Experimental Procedures and Supplemental Information).
The top view of the shapes is presented in Figure 7B. Starting
from the circular disc configuration at G = 1 (Figure 7B, blue
line), the sheet shape elongates with increasing G (and Nc) (light
blue line) and then acquires a flattened dumbbell appearance
with a narrowing neck (aqua and yellow lines) and, finally, at
G�2, splits into two droplet-like sheets with a short tubule
between them (orange line). Further increase of G results in
tubule elongation and a decrease in the sizes of the two sheets
(Figure 7B, dark red line). Eventually, the whole membrane
converts into a tubule (not shown in Figure 7B). Thus, the curva-
ture-producing proteins alone can generate both sheets, and
tubules and their abundance determines the relative amounts
of the two membrane domains.
Next, we extended the model to include the effect of proteins
enriched in sheets. We assume that polysome-bound Climp63,
p180, and kinectin, as well as translocons, can diffuse
throughout the sheets but cannot move into high curvature
membrane areas, i.e., sheet edges and tubules. The number of
all of these ‘‘sheet proteins’’ together is denoted byNs. The sheet
proteins may be considered as generating an ‘‘osmotic pres-
sure’’ on the sheet edges, a force that resists the shrinkage of
a sheet domain. The magnitude of this effect is determined by
the interplay between the effective ‘‘osmotic pressure’’
produced by the sheet proteins and the effective stretching
elasticity of the edge, the latter being determined by the curva-
ture-stabilizing proteins (see Experimental Procedures and
Supplemental Information). Our model does not take into
Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc. 779
Figure 3. Polysome-Dependent Membrane Protein Enrichment in ER Sheets
(A) The localization of the translocon component TRAPa is compared with that of stably expressed GFP-Sec61b after 15 min of treatment with puromycin (PURO).
The far-right panel shows a merged image. Junctions between peripheral ER sheets and tubules are highlighted in the magnified view of the boxed area (inset).
Scale bar, 10 mm.
(B) As in (A) but after 15 min of treatment with cycloheximide (CHX).
(C) As in (A) but comparing the localization of Climp63 with calreticulin after puromycin treatment.
(D) As in (C) but after cycloheximide treatment.
(E) Quantification of sheet enrichment of different ER proteins in untreated cells (blue bars) and in cells treated with puromycin (PURO; green) or cycloheximide
(CHX; red). The ratio of the average fluorescence intensity in sheets versus tubules was determined for calnexin (CNX), Bap31, calreticulin (CRT), TRAPa, and
kinectin and was divided by the sheet-to-tubule fluorescence ratio for stably expressed GFP-Sec61b, a protein that shows no preference for either ER domain.
780 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
account that Climp63 affects sheet formation by serving as a
luminal spacer, and it does not make any assumptions about
the specific roles of p180 and kinectin.
We computed the G values and membrane configurations for
different values of Nc and Ns (Figure 7C). The colored lines on the
bottom plane of the diagram represent the relationship between
Nc and Ns for a given shape of the system, with the colors
corresponding to the shapes as in Figure 7B. Figure 7C demon-
strates that an increase of Nc at a given Ns results in larger G
(blue to red transition) and thus in more tubules, whereas an
increase of Ns at a given Nc results in lower G, i.e., more sheets.
This is further illustrated in Figure 7D, in which the increase of
Ns at a constant Nc converts two small sheet areas connected
by a narrow tubule into a larger sheet area. Thus, the model reca-
pitulates the experimental observation of a tug-of-war between
sheet-promoting Climp63 and curvature-stabilizing proteins.
DISCUSSION
Our results indicate that several mechanisms shape peripheral
ER sheets. The most basic and universal mechanism appears
to involve the previously identified curvature-stabilizing proteins,
the reticulons and DP1/Yop1p. These proteins would stabilize
not only the high curvature of narrow tubules, but also the
Figure 4. Climp63 Affects the Luminal Width of Peripheral ER Sheets
(A) Rough ER sheets in a COS7 cell visualized by thin-section electron microscopy. Scale bar, 0.5 mm.
(B) As in (A) but after treatment with puromycin (PURO) for 15 min.
(C) As in (A) but after RNAi-depletion of Climp63, p180, and kinectin (C/P/K siRNA).
(D) As in (A) but after RNAi-depletion of Climp63.
(E) Quantification of the luminal width of peripheral ER sheets and the nuclear envelope (NE) in differently treated COS7 cells. For comparison, Drosophila S2R+
cells were also analyzed. Shown are the means and standard errors of n cells analyzed for each sample. Kinectin, KTN.
A similar analysis was done for GFP-Dad1 and Climp63 but with calreticulin as reference. Shown are the means and standard errors of data obtained from 7 to
30 cells for each condition.
See also Figure S3 and Figure S4.
Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc. 781
Figure 5. Climp63 and Reticulon Overexpression Change the Abundance of Sheets and Tubules
(A) FLAG-Climp63 overexpressed at relatively high levels in a COS7 cell was visualized by indirect immunofluorescence using FLAG antibodies. A 3D image was
generated from a complete series of z sections (step size 0.25 mm) taken with a confocal microscope. Scale bar, 10 mm.
(B) As in (A) but in a cell expressing FLAG-Climp63 at the highest observed levels.
(C) Quantification of the effect of Climp63 overexpression on ER sheet abundance. Shown are the percentages of cells with normal reticular ER (blue bars), of cells
with both large sheets and reticular ER (red), and of cells with large ER sheets lacking reticular ER (green) at different expression levels of FLAG-Climp63. The cells
were divided into five groups according to their expression levels, as determined by overall average fluorescence intensity.
(D) Thin-section electron micrograph of a COS7 cell overexpressing GFP-Climp63. The inset shows an enlargement of the boxed region. Scale bar, 0.5 mm.
(E) HA-Rtn4b (red) was expressed in COS7 cells at relatively low levels and was localized with HA antibodies by indirect immunofluorescence and confocal
microscopy. Endogenous Climp63 (green) was localized in the same cells with specific antibodies.
(F) As in (G) but with the highest observed expression level of HA-Rtn4b. Note that Climp63 appears in bright punctae and in the nuclear envelope.
782 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
curvature of sheet edges, a mechanism that is sufficient to keep
the two membranes of a sheet closely apposed. The reticulons
and DP1/Yop1p probably stabilize high curvature by two mech-
anisms, ‘‘hydrophobic insertion/wedging’’ and ‘‘scaffolding’’
(Shibata et al., 2009). The conserved segments of these proteins
may form a wedge in the lipid bilayer that occupies more space in
the cytoplasmic leaflet than in the luminal leaflet. Oligomerization
of these proteins may generate scaffolds around curved
membranes, which may take the shape of open arcs, given
that they can localize to sheet edges. Our theoretical model
demonstrates that the reticulons and DP1/Yop1p alone can
generate both tubules and sheets, with their abundance deter-
mining the ratio of these domains. Consistent with the proposed
dual role of the reticulons and DP1/Yop1p in tubule and sheet
formation, they localize to both tubules and sheet edges, their
depletion leads to increased sheet areas, and their overexpres-
sion converts sheets into tubules.
In S. cerevisiae, the amount of membrane surface and the
abundance of the reticulons and Yop1p appear to be the deci-
sive factors determining the ratio of peripheral ER sheets and
tubules. Generating more lipid increases the sheet area, whereas
increasing the abundance of the curvature-stabilizing proteins
increases the number of tubules. The observation of sheets in
cells lacking the reticulons and Yop1p may be explained by
the presence of other low-abundance curvature-promoting
proteins or by the association of the cortical ER with the plasma
membrane. Although we cannot exclude the existence of sheet-
promoting proteins in yeast, the current data are consistent with
a model in which curvature-stabilizing proteins are the major
determinant of peripheral ER morphology.
Our data suggest that, in mammalian cells, there are several
additional factors that determine the morphology of peripheral
ER sheets. This includes the coiled-coil membrane protein
Climp63, which serves as a luminal spacer. After its depletion,
the luminal width of the sheets decreases from �50 to �30 nm,
a spacing that is also seen in organisms that lack the protein.
Climp63 is highly upregulated in mammalian cells with prolifer-
ated ER sheets, and it induces sheets at the expense of tubules
when overexpressed in tissue culture cells. Thus, at high
concentrations, Climp63 appears to generate sheets all by itself,
and the lack of extensive sheet edges may make the contribution
of the curvature-stabilizing proteins less important. However,
with luminal spacers alone, one would expect bulging of the
sheet edges, in contrast to our observations (Figure 4), indicating
that the curvature-stabilizing proteins may have a role even in
cells with proliferated ER sheets. Climp63’s function may be to
optimize the size of the luminal space of peripheral ER sheets,
such that sufficient luminal chaperones can be accommodated
and the sheets are packed into a minimal space.
Our analysis also identified two other coiled-coil membrane
proteins, p180 and kinectin, with a potential role in shaping ER
sheets. These proteins are enriched in sheets and abundant
in cells with proliferated ER sheets. Overexpression of p180
has been reported to induce sheets in S. cerevisiae and in a
monocytic cell line (Becker et al., 1999; Benyamini et al., 2009),
although in our own experiments and those of others, the effects
were smaller (Ueno et al., 2010 and data not shown). The deple-
tion of p180 and kinectin had no effect on ER sheet morphology.
Although the precise role of these proteins remains to be estab-
lished, all coiled-coil membrane proteins could stabilize sheets
simply by being excluded from high-curvature regions, as shown
by our theoretical considerations. They may be considered as
generating an ‘‘osmotic pressure,’’ a force that counteracts the
shrinkage of sheet domains. Consistent with experimental
observations for Climp63, the coiled-coil proteins are predicted
to be in a tug-of-war with the reticulons and DP1/Yop1p, with
the former shifting the balance toward sheets and the latter
toward tubules. In this model, it does not actually matter how
proteins are excluded from tubules and sheet edges. Given
that all identified sheet-promoting proteins contain extended
coiled-coil domains, they all have the propensity to oligomerize,
which may contribute to their exclusion from high-curvature
regions.
The coiled-coil membrane proteins are not essential for sheet
formation per se, as is obvious from our observation that their
depletion by RNAi does not abolish ER sheets. This suggests
that, like in yeast, the reticulons and DP1/Yop1p may provide
the basic mechanism by which both sheets and tubules are
generated. Consistent with this hypothesis, Climp63, p180,
and kinectin are not known in lower organisms, in contrast to
the reticulons and DP1/Yop1p, which are present in all
eukaryotes.
All sheet-enriched proteins tested, including translocon
components and the coiled-coil membrane proteins, appear
to be concentrated by membrane-bound polysomes; upon
polysome disassembly, all of these proteins distribute equally
between sheets and tubules throughout the cell. Thus, these
proteins must have a direct or indirect affinity for membrane-
bound polysomes. Indeed, several of the tested sheet-prefer-
ring proteins are known to be associated with membrane-
bound translating ribosomes, including components of the
Sec61 complex, the TRAP complex, the oligosaccharyl
(G) Quantification of the peripheral ER sheet area relative to the total ER area for different expression levels of HA-Rtn4b. The areas of ER sheets and tubules were
determined from the fluorescence of Climp63 and Rtn4b, respectively, after subtraction of background. The cells were divided into five groups according to their
expression levels of HA-Rtn4b, as determined by overall average fluorescence intensity, and the mean and standard error were calculated for each group.
(H) Quantification of the effect of Rtn4b overexpression on ER sheet morphology, as determined by Climp63 staining. Shown are the percentages of cells with
normal ER sheets (blue bars), of cells with disc-like ER sheets (red), and of cells with punctae (green) at different expression levels of Rtn4b. The cells were divided
into five groups according to their expression levels.
(I) Quantification of the effect of Rtn4b overexpression on ER tubule morphology, as determined by HA-Rtn4b staining. Shown are the percentages of cells with
normal reticular ER (blue bars), of cells with an abnormally dense ER network (red), and of cells with unbranched, long tubules (green) at different expression levels
of Rtn4b. The cells were divided into five groups according to their expression levels.
(J) Myc-Rtn4a and FLAG-Climp63 were both highly expressed in COS7 cells. The far-right panel shows a merged image. Note that the ER morphology is
almost normal.
See also Figure S6 and Figure S7.
Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc. 783
Figure 6. The Reticulons Localize to the Edges of ER Sheets
(A) The localization of endogenous Rtn4a and 4b is compared with that of Climp63 using indirect immunofluorescence with specific antibodies in COS7 cells. The
insets show enlargements of the boxed region. Arrows point to reticulons lining the sheets. The far-right panel shows merged images. Scale bar, 10 mm.
(B) As in (A) but with cells overexpressing FLAG-Climp63.
(C) Rtn1p-GFP (green) and ssRFP-HDEL (red) were coexpressed in wild-type S. cerevisiae cells, and the cortical ER was visualized by fluorescence microscopy.
Scale bar, 5 mm.
(D) As in (C) except that the cells had proliferated ER sheets caused by deletion of SEY1 and YOP1 (sey1Dyop1D).
(E) As in (C) except the cells had proliferated ER sheets caused by deletion ofOPI1 (opi1D). The cells also contained an empty vector as a control for panels (F) and (G).
(F) As in (E) except that untagged Rtn1p was expressed under the endogenous promoter from a CEN plasmid.
(G) As in (E) except that untagged Rtn1p was expressed under the endogenous promoter from a 2 m plasmid.
(H) Quantification of the experiments in (C) and (E–G). The relative area of ER sheets was determined from the area of ssRFP-HDEL fluorescence that did not coloc-
alize with Rtn1p-GFP fluorescence and was divided by the total area of ssRFP-HDEL fluorescence. 14 to 38 cells were analyzed per condition, and the means and
standard errors were calculated.
784 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
transferase complex, and p180 (Gorlich and Rapoport, 1993).
These proteins stay bound to ribosomes upon detergent solu-
bilization of rough ER membranes, but they can be released
from the ribosomes by puromycin/high salt treatment. Climp63
and kinectin are not bound to detergent-solubilized translocons
(data not shown), so how they are recruited remains to be
clarified.
Our results indicate that ER sheets correspond to rough
ER and tubules to smooth ER. We propose that the assembly
of translating membrane-bound ribosomes into polysomes
concentrates the associated membrane-proteins, including
Climp63, p180, and kinectin. Their concentration might facilitate
their higher-order oligomerization, which may be required for
their exclusion from high-curvature areas and thus for their
Figure 7. Modeling of the Effect of Curvature-Stabilizing and Sheet-Promoting Proteins on ER Morphology
(A) The reticulons and DP1/Yop1p (yellow arcs) are assumed to localize exclusively to tubules and sheet edges, generating and stabilizing these high-curvature
membranes. Stabilization of sheet edges enables the upper and lower membranes of the sheet to adopt planar shapes.
(B) Top view of membrane shapes computed by the theoretical model for increasing G values. The computation was performed for a total membrane area cor-
responding to 1 mm radius of the initial disc-like shape, a 15 nm cross-section radius of the tubules and edges, and a 40 nm optimal distance between the arc-like
proteins at the edge (see Supplemental Information). Change ofG from 1 to 2.1(blue to red) corresponds to increasing the number of curvature-stabilizing proteins
Nc from 140 to 290.
(C) G values and membrane shapes were calculated for different numbers of curvature-stabilizing and sheet-promoting proteins, Nc and Ns. The colors corre-
spond to the membrane shapes shown in Figure 7B. The colored lines on the bottom plane of the diagram represent the relationship betweenNc andNs for a given
shape of the system.
(D) G values and membrane shapes were computed for different Ns values at Nc = 290. The shapes refer to Ns = 0, 500, and 1000.
Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc. 785
sheet-promoting function. Once sheets are formed, the
membrane binding of polysomes would be facilitated. Poly-
somes often form spirals that could have an inherent preference
for associating with ER sheets (Christensen and Bourne, 1999);
whereas individual ribosomes or small polysomes can bind
to narrow tubules, it is unlikely that each ribosome of a large
polysome could be efficiently arranged on a narrow tubule. The
binding of large polysomes could therefore be restricted to
membrane sheets. The assembly of membrane-bound poly-
somes would concentrate more coiled-coil membrane proteins,
and these in turn would generate more sheet area by the
‘‘osmotic effect,’’ allowing more polysomes to bind, and so on,
a mechanism that would ultimately lead to a segregated rough
ER domain. This model is consistent with the observation that
the disassembly of polysomes or the depletion of Climp63
increases the mobility of translocons in the plane of the
membrane (Nikonov et al., 2007; Nikonov et al., 2002). It also
agrees with our results showing that the disassembly of poly-
somes leads to the spreading of ER sheets similar to that
seen upon depletion of the sheet-promoting proteins. Our model
explains the classic observation that, in many cells, membrane-
bound ribosomes are not randomly distributed throughout the
ER but, rather, concentrated in a separate membrane domain,
the rough ER. An active sorting of proteins into the rough ER is
consistent with previous cell fractionation experiments, which
demonstrated that general ER proteins indiscriminately
distribute throughout the ER, whereas translocon-associated
proteins are enriched in the rough ER (Hinman and Phillips,
1970; Kreibich et al., 1978; Vogel et al., 1990).
The nuclear envelope is a prominent ER domain whose struc-
ture is determined independently of the peripheral ER. Although
the reticulons have been implicated in the assembly of the
nuclear envelope and in the insertion of nuclear pores (Anderson
and Hetzer, 2008; Dawson et al., 2009), they are nearly absent
from the nuclear envelope, and their depletion or overexpression
has no significant effect on this domain’s morphology. Similarly,
DP1/Yop1p or the coiled-coil membrane proteins Climp63,
p180, and kinectin are also nearly absent from the nuclear enve-
lope and have no obvious effect on its structure. Of interest,
TRAPa was also depleted from the nuclear envelope, raising
the possibility that translocons are preferentially located in
peripheral ER sheets. Thus, distinct mechanisms may determine
the formation and function of the sheet-like domains of the
nuclear envelope and peripheral ER.
In summary, our results lead to a simple model, according to
which the basic morphological elements of the peripheral ER,
the tubules and sheets, are generated by the curvature-
stabilizing proteins. Superimposed on this mechanism, mem-
brane-bound polysomes and associated coiled-coil membrane
proteins may cooperate to form segregated rough ER sheets in
mammalian cells, domains that are functionally specialized in
protein translocation. Other factors probably contribute to the
morphology of the peripheral ER. Microtubules keep the
mammalian ER under tension and stabilize membrane tubules,
but they could also potentially form an additional scaffold that
stabilizes sheets, as suggested by the fact that both Climp63
and p180 are microtubule-binding proteins (Klopfenstein et al.,
1998; Ogawa-Goto et al., 2007). It will be interesting to elucidate
how these factors collaborate with the identified membrane-
shaping principles.
EXPERIMENTAL PROCEDURES
Mammalian Tissue Culture and Transfections
BSC1 cells stably expressing GFP-Sec61b and COS7 cells were grown in
DMEM containing 10% fetal bovine serum at 37�C and 5% CO2 and were
passaged every 2–3 days. GFP-Dad1 BHK cells (M3/18; Nikonov et al., 2002)
were maintained in10%CO2 at 39.5�C todegradeendogenousDad1.For trans-
lation inhibition experiments, cells were treated with 200 mM cycloheximide,
200 mM puromycin, or 100 nM pactamycin in complete media for 15 min.
To deplete Climp63, kinectin, and p180, COS7 cells were plated onto
acid-washed coverslips at 20% confluency and were transfected with
120 nM total siRNA using Oligofectamine (Invitrogen). After1.5 days, cells
were retransfected with the same amount of siRNA oligonucleotides and
then processed for immunofluorescence 1.5 days afterward. Experiments
with control siRNA oligonucleotides (QIAGEN) were done in parallel using
the same conditions. Transient DNA transfections were performed using
Lipofectamine 2000 (Invitrogen). See Supplemental Information for a list of
DNA and siRNA constructs.
Indirect Immunofluorescence and Confocal Microscopy
Indirect immunofluorescence with mammalian cells was done as described
(Shibata et al., 2008). Cells grown on acid-washed coverslips were fixed
with 4% paraformaldehyde (EMS), permeabilized with 0.1% Triton X-100
(Pierce), and immunostained with various primary antibodies and then washed
in PBS and probed with various fluorophore-conjugated secondary anti-
bodies. See Supplemental Information for a list of antibodies used.
Images were captured using a Yokogawa spinning-disk confocal on a Nikon
TE2000U inverted microscope with a 603 or 1003 Plan Apo NA 1.4 objective
lens, a Hamamatsu ORCA ER-cooled CCD camera, and MetaMorph software.
All analyses/quantifications were done on raw 16 bit images using MetaMorph.
For presentation, brightness levels were adjusted across the entire image and
were changed from 16 to 8 bits using Adobe Photoshop. Quantification was
performed as described in Supplemental Information.
Thin-Section Electron Microscopy
Thin-section EM experiments were performed as described previously
(Shibata et al., 2008) except that cells were fixed directly in culture plates.
Quantification was performed as described in Supplemental Information.
Microscopy and Image Quantification of S. cerevisiae Cells
Yeast strains and constructs used are described in Supplemental Information.
Yeast cells were imaged live in complete medium at room temperature using
an Olympus BX61 microscope, UPlanApo 100 3 /1.35 lens, Qimaging Retiga
EX camera, and IVision version 4.0.5 software. To calculate relative peripheral
sheet amounts, cortical ER images of cells expressing ssRFP-HDEL and
Rtn1-GFP were taken. Images were thresholded above background, and the
percentage of sheet area was calculated for each cell as the percentage of
area of ssRFP-HDEL that did not overlap with Rtn1-GFP using Metamorph
software. Means and standard errors were calculated using Microsoft Excel.
For presentation, brightness levels were adjusted across the entire image,
changed from 16 to 8 bits, and cropped using Adobe Photoshop.
Identification of Abundant Coiled-Coil Membrane Proteins
Mass spectrometry of dog pancreatic microsomal proteins and identification
of mRNAs coding for ER membrane proteins that are upregulated during
B cell differentiation (Luckey et al., 2006) were performed as described in
the Supplemental Information.
Modeling of Sheet versus Tubule Generation
To compute the membrane configurations (the length of the tubule as well as
the areas and shapes of the sheets) in dependence of the numbers of the
curvature-producing, Nc, and the sheet-promoting proteins, Ns, we minimize
the system energy, Ftot, for the given total membrane area, Atot. The total
energy Ftot consists of three contributions: the effective stretching energy of
786 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
the edge, Fs; the energy of the effective osmotic pressure of the sheet-
promoting proteins, Fp; and the energy of edge bending in the sheet plane, Fb.
The energy Fs is given by Fs =12kBTNc
hðLe�Ncðl0 + laÞÞ
Ncl0
i2
, wherein, Le is the total
length of the edge including the tubules; l0 is the energetically preferred
distance between the arc-like proteins measured along the edge; la is the width
of one protein arc; and kBTz4$10�21 Joule is the product of the Boltzmann
constant and the absolute temperature. According to this expression, the
length of the edge in a stress-free state is L�e =Ncðl0 + laÞ, and the effective
rigidity of the edge stretching-compression with respect to L�e is
kstr = kBT$Nc. Based on previous estimates, we take l0 = 40nm and la = 4nm
(Hu et al., 2008).
The osmotic pressure energy Fp is given by Fp = kBT$Ns$lnðNsb=AflatÞ,wherein Aflat is the flat area available to the sheet proteins and b is the area
of one sheet protein. The area Aflat is related to the total area and length of
the edge by Aflat =12ðAtot � a$LeÞ, wherein a is the membrane area absorbed
by a unit length of the edge, which can be estimated as a=p$Rez50nm
(Rez15nm is the radius of the edge cross-section), and Atot is the total
membrane area.
The energy Fb is given by Fb =12B#c
2edLe, wherein ce is the in-plane curvature
of the edge, and B is the modulus of the edge in-plane bending, which can be
estimated using the membrane bending modulus kz20kBT (Helfrich, 1973) as
BzpRekz900kBT$nm. The integration is performed over the whole edge
length, including the tubules.
Estimates supported by numerical computations show that the total length
of the edge Le and the corresponding value of the parameter G are determined
by the energies Fs and Fp and are largely independent of Fb. At the same time,
the system configuration resulting from minimization of Fb depends of the
parameter G. Therefore, we determine the system configuration in two steps.
First, we minimize the sum of Fc + Fs with respect to Le for every set of
numbers Nc and Ns and determine the corresponding function G (Nc, Ns).
Second, for every value ofG (Nc,Ns), we minimize Fb with respect to the system
shape and find the equilibrium configuration.
The Supplemental Information gives a more detailed discussion of the
model.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures,
seven figures, and two tables and can be found with this article online at
doi:10.1016/j.cell.2010.11.007.
ACKNOWLEDGMENTS
We thank C. Denison, J. Minsteris, and S. Gygi for mass spectrometry analysis;
J. Baughman for microarray analysis; A. Condon and A. Boye-Doe for
technical assistance; J. Iwasa for help with illustrations; G. Kreibich,
K. Ogawa-Goto, L. Lu, and R. Yan for materials; the Nikon Imaging Center
and the Electron Microscopy facility at HMS for microscopy assistance; and
R. Klemm and A. Osborne for critical reading of the manuscript. Y.S. was sup-
ported by the American Heart Association and is a Howard Hughes Medical
Institute postdoctoral fellow. W.A.P. is supported by the Intramural Research
Program of the National Institute of Diabetes and Digestive and Kidney
Diseases. T.A.R. is a Howard Hughes Medical Institute Investigator. M.M.K.
is supported by the Israel Science Foundation (ISF) and the Marie Curie
network ‘‘Virus Entry.’’
Received: May 19, 2010
Revised: September 3, 2010
Accepted: October 26, 2010
Published: November 24, 2010
REFERENCES
Ambroziak, J., and Henry, S.A. (1994). INO2 and INO4 gene products, positive
regulators of phospholipid biosynthesis in Saccharomyces cerevisiae, form
a complex that binds to the INO1 promoter. J. Biol. Chem. 269, 15344–15349.
Anderson, D.J., and Hetzer, M.W. (2008). Reshaping of the endoplasmic
reticulum limits the rate for nuclear envelope formation. J. Cell Biol. 182,
911–924.
Baumann, O., and Walz, B. (2001). Endoplasmic reticulum of animal cells and
its organization into structural and functional domains. Int. Rev. Cytol. 205,
149–214.
Becker, F., Block-Alper, L., Nakamura, G., Harada, J., Wittrup, K.D., and
Meyer, D.I. (1999). Expression of the 180-kD ribosome receptor induces
membrane proliferation and increased secretory activity in yeast. J. Cell Biol.
146, 273–284.
Benyamini, P., Webster, P., and Meyer, D.I. (2009). Knockdown of p180
eliminates the terminal differentiation of a secretory cell line. Mol. Biol. Cell
20, 732–744.
Bernales, S., McDonald, K.L., and Walter, P. (2006). Autophagy counterbal-
ances endoplasmic reticulum expansion during the unfolded protein
response. PLoS Biol. 4, e423.
Carman, G.M., and Henry, S.A. (2007). Phosphatidic acid plays a central role in
the transcriptional regulation of glycerophospholipid synthesis in Saccharo-
myces cerevisiae. J. Biol. Chem. 282, 37293–37297.
Christensen, A.K., and Bourne, C.M. (1999). Shape of large bound polysomes
in cultured fibroblasts and thyroid epithelial cells. Anat. Rec. 255, 116–129.
Dawson, T.R., Lazarus, M.D., Hetzer, M.W., and Wente, S.R. (2009).
ER membrane-bending proteins are necessary for de novo nuclear pore
formation. J. Cell Biol. 184, 659–675.
Fawcett, D.W. (1981). The Cell (Philadelphia: W.B. Saunders).
Gorlich, D., and Rapoport, T.A. (1993). Protein translocation into proteolipo-
somes reconstituted from purified components of the endoplasmic reticulum
membrane. Cell 75, 615–630.
Helfrich, W. (1973). Elastic properties of lipid bilayers: theory and possible
experiments. Z. Naturforsch. C 28, 693–703.
Hinman, N.D., and Phillips, A.H. (1970). Similarity and limited multiplicity of
membrane proteins from rough and smooth endoplasmic reticulum. Science
170, 1222–1223.
Hu, J., Shibata, Y., Voss, C., Shemesh, T., Li, Z., Coughlin, M., Kozlov, M.M.,
Rapoport, T.A., and Prinz, W.A. (2008). Membrane proteins of the endoplasmic
reticulum induce high-curvature tubules. Science 319, 1247–1250.
Hu, J., Shibata, Y., Zhu, P.P., Voss, C., Rismanchi, N., Prinz, W.A., Rapoport,
T.A., and Blackstone, C. (2009). A class of dynamin-like GTPases involved in
the generation of the tubular ER network. Cell 138, 549–561.
Klopfenstein, D.R., Kappeler, F., and Hauri, H.P. (1998). A novel direct interac-
tion of endoplasmic reticulum with microtubules. EMBO J. 17, 6168–6177.
Klopfenstein, D.R., Klumperman, J., Lustig, A., Kammerer, R.A., Oorschot, V.,
and Hauri, H.P. (2001). Subdomain-specific localization of CLIMP-63 (p63) in
the endoplasmic reticulum is mediated by its luminal a-helical segment.
J. Cell Biol. 153, 1287–1300.
Kreibich, G., Ulrich, B.L., and Sabatini, D.D. (1978). Proteins of rough micro-
somal membranes related to ribosome binding. I. Identification of ribophorins
I and II, membrane proteins characteristics of rough microsomes. J. Cell Biol.
77, 464–487.
Luckey, C.J., Bhattacharya, D., Goldrath, A.W., Weissman, I.L., Benoist, C.,
and Mathis, D. (2006). Memory T and memory B cells share a transcriptional
program of self-renewal with long-term hematopoietic stem cells. Proc. Natl.
Acad. Sci. USA 103, 3304–3309.
Menetret, J.F., Hegde, R.S., Aguiar, M., Gygi, S.P., Park, E., Rapoport, T.A.,
and Akey, C.W. (2008). Single copies of Sec61 and TRAP associate with a non-
translating mammalian ribosome. Structure 16, 1126–1137.
Nikonov, A.V., Hauri, H.P., Lauring, B., and Kreibich, G. (2007). Climp-63-
mediated binding of microtubules to the ER affects the lateral mobility of
translocon complexes. J. Cell Sci. 120, 2248–2258.
Nikonov, A.V., Snapp, E., Lippincott-Schwartz, J., and Kreibich, G. (2002).
Active translocon complexes labeled with GFP-Dad1 diffuse slowly as large
polysome arrays in the endoplasmic reticulum. J. Cell Biol. 158, 497–506.
Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc. 787
Ogawa-Goto, K., Tanaka, K., Ueno, T., Tanaka, K., Kurata, T., Sata, T., and Irie,
S. (2007). p180 is involved in the interaction between the endoplasmic retic-
ulum and microtubules through a novel microtubule-binding and bundling
domain. Mol. Biol. Cell 18, 3741–3751.
Puhka, M., Vihinen, H., Joensuu, M., and Jokitalo, E. (2007). Endoplasmic
reticulum remains continuous and undergoes sheet-to-tubule transformation
during cell division in mammalian cells. J. Cell Biol. 179, 895–909.
Savitz, A.J., and Meyer, D.I. (1990). Identification of a ribosome receptor in the
rough endoplasmic reticulum. Nature 346, 540–544.
Schuck, S., Prinz, W.A., Thorn, K.S., Voss, C., and Walter, P. (2009).
Membrane expansion alleviates endoplasmic reticulum stress independently
of the unfolded protein response. J. Cell Biol. 187, 525–536.
Senda, T., and Yoshinaga-Hirabayashi, T. (1998). Intermembrane bridges
within membrane organelles revealed by quick-freeze deep-etch electron
microscopy. Anat. Rec. 251, 339–345.
Shibata, Y., Hu, J., Kozlov, M.M., and Rapoport, T.A. (2009). Mechanisms
shaping the membranes of cellular organelles. Annu. Rev. Cell Dev. Biol. 25,
329–354.
Shibata, Y., Voeltz, G.K., and Rapoport, T.A. (2006). Rough sheets and smooth
tubules. Cell 126, 435–439.
Shibata, Y., Voss, C., Rist, J.M., Hu, J., Rapoport, T.A., Prinz, W.A., and Voeltz,
G.K. (2008). The reticulon and DP1/Yop1p proteins form immobile oligomers in
the tubular endoplasmic reticulum. J. Biol. Chem. 283, 18892–18904.
Short, B., Haas, A., and Barr, F.A. (2005). Golgins and GTPases, giving identity
and structure to the Golgi apparatus. Biochim. Biophys. Acta 1744, 383–395.
Snapp, E.L., Hegde, R.S., Francolini, M., Lombardo, F., Colombo, S., Pedraz-
zini, E., Borgese, N., and Lippincott-Schwartz, J. (2003). Formation of stacked
ER cisternae by low affinity protein interactions. J. Cell Biol. 163, 257–269.
Sparkes, I., Tolley, N., Aller, I., Svozil, J., Osterrieder, A., Botchway, S., Mueller,
C., Frigerio, L., and Hawes, C. (2010). Five Arabidopsis reticulon isoforms
share endoplasmic reticulum location, topology, and membrane-shaping
properties. Plant Cell 22, 1333–1343.
Toyoshima, I., Yu, H., Steuer, E.R., and Sheetz, M.P. (1992). Kinectin, a major
kinesin-binding protein on ER. J. Cell Biol. 118, 1121–1131.
Ueno, T., Tanaka, K., Kaneko, K., Taga, Y., Sata, T., Irie, S., Hattori, S., and
Ogawa-Goto, K. (2010). Enhancement of procollagen biosynthesis by p180
through augmented ribosome association on the endoplasmic reticulum in
response to stimulated secretion. J. Biol. Chem. 285, 29941–29950.
Voeltz, G.K., Prinz, W.A., Shibata, Y., Rist, J.M., and Rapoport, T.A. (2006).
A class of membrane proteins shaping the tubular endoplasmic reticulum.
Cell 124, 573–586.
Voeltz, G.K., Rolls, M.M., and Rapoport, T.A. (2002). Structural organization of
the endoplasmic reticulum. EMBO Rep. 3, 944–950.
Vogel, F., Hartmann, E., Gorlich, D., and Rapoport, T.A. (1990). Segregation of
the signal sequence receptor protein in the rough endoplasmic reticulum
membrane. Eur. J. Cell Biol. 53, 197–202.
788 Cell 143, 774–788, November 24, 2010 ª2010 Elsevier Inc.
Abortive HIV Infection MediatesCD4 T Cell Depletion and Inflammationin Human Lymphoid TissueGilad Doitsh,1 Marielle Cavrois,1,5 Kara G. Lassen,1,5 Orlando Zepeda,1 Zhiyuan Yang,1 Mario L. Santiago,1,4
Andrew M. Hebbeler,1 and Warner C. Greene1,2,3,*1Gladstone Institute of Virology and Immunology, 1650 Owens Street, San Francisco, CA 94158, USA2Department of Medicine3Department of Microbiology and ImmunologyUniversity of California, San Francisco, CA 94143, USA4Present address: University of Colorado, Denver, Aurora, CO 80045, USA5These authors contributed equally to this work*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.11.001
SUMMARY
The mechanism by which CD4 T cells are depletedin HIV-infected hosts remains poorly understood.In ex vivo cultures of human tonsil tissue, CD4T cells undergo a pronounced cytopathic responsefollowing HIV infection. Strikingly, >95% of thesedying cells are not productively infected but insteadcorrespond to bystander cells. We now show thatthe death of these ‘‘bystander’’ cells involves abor-tive HIV infection. Inhibitors blocking HIV entry orearly steps of reverse transcription prevent CD4T cell death while inhibition of later events in the virallife cycle does not. We demonstrate that the nonper-missive state exhibited by themajority of resting CD4tonsil T cells leads to accumulation of incompletereverse transcripts. These cytoplasmic nucleic acidsactivate a host defense program that elicits a coordi-nated proapoptotic and proinflammatory responseinvolving caspase-3 and caspase-1 activation. Whilethis response likely evolved to protect the host, itcentrally contributes to the immunopathogeniceffects of HIV.
INTRODUCTION
Despite extensive efforts over the past quarter century, the
precise mechanism by which HIV-1 causes progressive deple-
tion of CD4 T cells remains debated. Both direct and indirect
cytopathic effects have been proposed. When immortalized
T cell lines are infected with laboratory-adapted HIV-1 strains,
direct CD4 T cell killing predominates. Conversely, in more
physiological systems, such as infection of lymphoid tissue
with primary HIV-1 isolates, the majority of dying cells appear
as uninfected ‘‘bystander’’ CD4 T cells (Finkel et al., 1995; Jekle
et al., 2003).
Various mechanisms have been proposed to contribute to
the death of these bystander CD4 T cells including the action
of host-derived factors like tumor necrosis factor-a, Fas ligand
and TRAIL (Gandhi et al., 1998; Herbeuval et al., 2005), and viral
factors like HIV-1 Tat, Vpr, and Nef released from infected cells
(Schindler et al., 2006; Westendorp et al., 1995). Considerable
interest has also focused on the role of gp120 and gp41 Env
protein in indirect cell death, although it is not clear whether
death signaling involves gp120 binding to its chemokine
receptor or gp41-mediated fusion. It is also unclear whether
such killing is caused by HIV-1 virions or by infected cells
expressing Env.
Most studies have focused on death mechanisms acting prior
to viral entry. Less is known about the fate of HIV-1-infected CD4
T cells that do not express viral genes, in particular naive CD4
T cells in tissue that are refractory to productive HIV infection
(Glushakova et al., 1995; Kreisberg et al., 2006). In these cells,
infection is aborted after viral entry, as reverse transcription is
initiated but fails to reach completion (Kamata et al., 2009;
Swiggard et al., 2004; Zack et al., 1990; Zhou et al., 2005).
Human lymphoid aggregated cultures (HLACs) prepared from
tonsillar tissue closely replicate the conditions encountered by
HIV in vivo and thus form an attractive, biologically relevant
system for studying HIV-1 infection (Eckstein et al., 2001).
Lymphoid organs are the primary sites of HIV replication and
contain more than 98% of the body’s CD4 T cells. Moreover,
events critical to HIV disease progression occur in lymphoid
tissues, where the network of cell-cell interactions mediating
the immune response deteriorates and ultimately collapses.
Primary cultures of peripheral blood cells do not fully mimic
the cytokine milieu, the cellular composition of lymphoid tissue,
nor the functional relationships that are undoubtedly important
in HIV pathogenesis. Finally, HLACs can be infected with
a low number of viral particles in the absence of artificial mito-
gens, allowing analysis of HIV cytopathicity in a natural and
preserved environment. In this study, we used the HLAC system
to explore the molecular basis for HIV-induced killing of CD4
T cells.
Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc. 789
RESULTS
Selective Depletion of CD4 T Cells by X4-Tropic HIV-1To explore depletion of CD4 T cells by HIV-1, HLACs made from
freshly dissected human tonsillar tissues were infected with
a GFP reporter virus (NLENG1), prepared from the X4-tropic
NL4-3 strain of HIV-1. This reporter produces fully replication-
competent viruses. An IRES inserted upstream of the Nef gene
preserves Nef expression and supports LTR-driven GFP expres-
sion (Levy et al., 2004), allowing simultaneous quantification of
the dynamics of HIV-1 infection and T cell depletion. NL4-3
was selected because tonsillar tissue contains a high per-
centage of CD4 T cells expressing CXCR4 (90%–100%).
Productively infected GFP-positive cells appeared in small
numbers 3 days after infection, peaked on days 6–9, and
decreased until day 12, when few CD4 T cells remained in the
culture (Figure 1). Fluorescence-linked antigen quantification
(FLAQ) assay of HIV-1 p24 (Hayden et al., 2003) confirmed the
accumulation of viral particles in the medium between day 3
and days 8 to 9, when a plateau was reached (data not shown).
Interestingly, when HIV-1 p24 levels plateaued no more than
1.5% of all cells (about 5% of CD4 T cells) were GFP-positive.
Figure 1. Massive Depletion of CD4 T Cells in HLACs Containing Small Number of Productively Infected Cells
Kinetics of spreading viral infection versus depletion of CD4 T cells after infection of HLACs with a replication-competent HIV reporter virus encoding GFP.
CD4 downregulation in GFP-positive cells likely represents the combined action of the HIV Nef, Vpu, and Env proteins expressed by this virus. Ratios of viable
CD4 versus CD8 T cells in HIV-infected and uninfected cultures are also shown. Flow cytometry plots represent live-gated cells, based on the forward-scatter
versus side-scatter profile of the complete culture. These data are the representative results of six independent experiments utilizing tonsil cells from six different
donors.
790 Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc.
However, although the number of CD4 T cells was not markedly
altered in infected cultures through six days, the culture was
almost completely devoid of CD4 T cells by day 9. CD8 T cells
were not depleted in infected cultures, and CD4 T cells were
not depleted in uninfected cultures. These findings reveal
marked and selective depletion of CD4 T cells in HLAC cultures.
However, due to the nature of the assay, we could not definitively
conclude whether the principal mechanism of depletion involved
direct or indirect effects of HIV-1.
Extensive Depletion of Nonproductively Infected CD4 TCells in HLACsTo determine if indirect killing (formerly indicated as ‘‘bystander’’)
of CD4 T cells accounted for most of the observed cellular
depletion, we took advantage of a reported experimental
strategy (Jekle et al., 2003) that unambiguously distinguishes
between the death of productively and nonproductively infected
cells (Figure 2A). After 6 days of coculture, survival analysis
of CFSE-labeled cells by flow cytometry (Figure 2B) showed
Figure 2. CD4 T Cell Depletion in HIV-1-Infected HLACs Predominantly Involves Nonproductively Infected Cells
(A) Experimental strategy to assess indirect cell killing in HIV-1-infected human lymphoid cultures. Fresh human tonsil tissue from a single donor is processed into
HLAC, and then separated into two fractions. One fraction is challenged with HIV-1 and cultured for 6 days, allowing viral spread. On day 5, the uninfected fraction
is treated with AZT (5 mM) and labeled with CFSE (1 mM). On day 6, the infected and CFSE-labeled cultures are mixed and cocultured in the presence of AZT.
Because of its site of action, AZT does not block viral output from the HIV-infected cells but prevents productive infection of CFSE-labeled cells. After 6 days
of coculturing, the number of viable CFSE-positive cells is determined by flow cytometry.
(B) Flow cytometry analysis of the mixed HLACs. Indirect killing is determined by gating on live CFSE-positive cells in the mixed cultures. Effector cells are either
infected or uninfected cells.
(C) Extensive depletion of nonproductively infected CD4 T cells by HIV-1. CFSE-labeled cells mixed with uninfected or infected cells were cultured in the presence
of 5 mM AZT alone or together with 250 nM AMD3100. Data represent live CFSE-positive cells 6 days after coculture with infected or uninfected effector cells. The
absence of productive infection in the CFSE-positive cells was confirmed by internal p24 staining and monitoring GFP expression following infection with the
NLENG1 HIV-1 reporter virus (data not shown).
(D) Preferential depletion of nonproductively infected CD4 T cells by HIV-1. The absolute numbers of viable CFSE-positive CD4 and CD8 T cells and B cells were
determined. Percentages are normalized to the number of viable CFSE-positive cells cocultured with uninfected cells in the presence of AZT, as depicted by an
asterisk. Error bars represent standard deviations of three samples from the same donor. This experiment is representative of more than 10 independent
experiments with more than 10 donors of tonsillar tissues.
See also Figure S1.
Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc. 791
extensive depletion of CD4 T cells in cultures mixed with HIV-
infected cells but not in those mixed with uninfected cells (Fig-
ure 2C). The relative proportion of CD8 T cells was not altered.
CD3+/CD8– T cells were similarly depleted, indicating that the
loss was not an artifact of downregulated surface expression
of CD4 following direct infection. Loss of CFSE-labeled CD4
T cells was prevented by AMD3100, which blocks the engage-
ment of gp120 with CXCR4, but not by the reverse transcriptase
inhibitor AZT. Thus, productive viral replication is not required for
CD4 T cell death.
To estimate the absolute numbers of all CFSE-labeled cell
subsets, we added a standard number of fluorescent beads
to the cell suspensions (Figure 2D). In contrast to the sharp
decline in CD4 T cells, the absolute numbers of CD8 T and
B cells were unaltered. Separating the HLAC into distinct
cell types revealed that cell death occurred in purified popula-
tions of CD4 T cells suggesting that other cell types did not
mediate the killing. (Figure S1 available online). In all in-
stances, CD4-specific killing was prevented by AMD3100
but not AZT. Importantly, the extent of CD4 T cell depletion
in the presence of AZT was similar to that observed when
no antiviral drugs were added (Figure 2C and Figure 1, re-
spectively). Together, these results suggest that indirect
killing is the predominant mechanism for CD4 T cell depletion
in HIV-infected HLACs.
HIV gp41-Mediated Fusion Is Necessary for Depletionof Nonproductively Infected CD4 T CellsStudies with AMD3100 and AZT indicated that indirect CD4 T cell
killing is mediated by events occurring between gp120-CXCR4
binding and reverse transcription. Engagement of the chemokine
coreceptor induces conformational changes in gp41, resulting in
insertion of viral fusion peptide on gp41 into the target T cell
membrane. To determine if the gp120-CXCR4 interaction alone
or later events involving viral fusion are required for indirect
killing, we evaluated the effects of enfuvirtide (T20), a fusion
inhibitor that blocks six-helix bundle formation by gp41, a prereq-
uisite for virion fusion and core insertion.
We first determined the optimal concentrations of T20 that
block viral infection (Figure 3A). In NL4-3-infected cells, T20 began
to inhibit infection at concentrations > 2 mg/ml; complete inhibition
required 10 mg/ml. In cells infected with a primary viral isolate,
WEAU 16-8 (Figure S2), infection was completely inhibited by
0.1 mg/ml of T20. T20 did not inhibit infection with a T20-resistant
mutant, SIM (Rimsky et al., 1998), regardless of concentration.
Next, we investigated the effect of T20 on indirect CD4 T cell
killing (Figure 3B). In the absence of T20, high levels of indirect
killing were observed. T20 concentrations that blocked infection
also greatly inhibited indirect killing. T20 did not inhibit indirect
killing in cultures containing SIM-infected cells. Thus, blocking
gp41-mediated fusion prevents indirect killing.
Figure 3. HIV-1 Fusion Is Necessary to Induce Killing of Nonproductively Infected Cells
(A and C) Concentrations of T20 that block viral infection. HLACs were infected with the indicated clones of HIV-1 in the presence of the indicated concentrations
of T20 or no drugs. One hour before incubation with the virus, cells were pretreated with T20 or left untreated. At 12 hr, cells were washed extensively and cultured
under the same conditions. On day 9, the viral concentration was determined using a p24gag FLAQ assay. The amount of p24gag accumulated in the absence of
drugs by each viral clone (A) or by SKY (C) was defined as 100%.
(B and D) Effect of T20 on indirect killing. CFSE-labeled cells were cocultured with cells infected with the indicated viral clones in the presence of 5 mM AZT and the
indicated concentrations of T20. After 6 days, indirect killing in the mixed cultures was assessed. The number of viable CFSE-positive CD4 T cells cocultured with
uninfected cells in the presence of AZT was defined as 100% (data not shown). To allow successful initial infection we pseudotyped the GIA-SKY mutants with the
VSV-G envelope. NL4-3, WT lab-adapted virus; WEAU 16-8, primary virus; SIM, T20-resistant virus; GIA-SKY, T20-dependent virus; GIA and SKY, single-domain
mutant viruses. Representative data from three independent experiments with different donors are shown.
See also Figure S2.
792 Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc.
We then examined a T20-dependent mutant, GIA-SKY (Bald-
win et al., 2004), which fuses only when T20 is present, but
cannot initiate a spreading infection in the absence of T20 (Fig-
ure 3C). Consistent with its T20 dependency, in the presence
of 1 mg/ml T20, the GIA-SKY mutant readily replicated while
growth was inhibited at higher or lower T20 concentrations.
The single-domain mutants GIA and SKY exhibited a T20-resis-
tance phenotype similar to that of SIM.
GIA-SKY-infected cells did not induce indirect killing of CD4
Tcells in theabsenceofT20 (Figure3D). Indirectkillingwasobserved
in cultures treated with 1 mg/ml T20 but was inhibited at higher or
lower concentrations. Since T20-dependent viruses were bound
to CXCR4 before T20 was added, these findings argue that
CXCR4 signaling is not sufficient to elicit indirect CD4 T cell killing.
Indirect Killing Requires a Close Interaction betweenUninfected and HIV-Infected CellsNext we examined whether indirect killing requires close contact
with HIV-infected cells or instead can be fully supported by
virions accumulating in the supernatants of the infected histocul-
tures. We found that cell-free supernatants from HIV-infected
histocultures were much less efficient at inducing indirect killing
(Figure 4A). To exclude the possibility that the concentration of
virions in the supernatants was too low, we repeated this exper-
iment using a 20-fold concentrated virion supernatants (1 mg
p24/ml) but failed to detect indirect CD4 T cell killing (Figure 4B).
Together, these findings suggest that close cell-cell contact is
likely required for indirect killing.
To further explore the potential requirement of close cell-cell
contact for indirect killing (Sherer et al., 2007; Sourisseau et al.,
2007), we repeated these assays using cells that had been washed
daily with fresh RPMI to prevent accumulation of HIV-1 virions and
soluble factors. Such cell washing did not affect the ability of the
resultant infected cells to mediate indirect CD4 T cell killing (Fig-
ure 4B), suggesting that virions released into the medium do not
participate in indirect killing. We confirmed these findings using
a transwell culture system. CSFE-labeled cells and HIV-infected
cells were mixed or physically separated by a transwell insert with
1 mm pores, which allows free diffusion of virions but not cells. Indi-
rect killing was substantial in the mixed cultures but not in the trans-
well cultures (Figure 4C). Together, these findings indicate that
indirect killing requires close interaction between CFSE-labeled
and HIV-1-infected cells, consistent with in vitro (Garg et al.,
2007; Holm and Gabuzda, 2005) and in vivo studies showing that
apoptotic nonproductively infected cells in human lymph nodes
often cluster near productively infected cells (Finkel et al., 1995).
Indirect Killing Requires Fusion of Virionsfrom Nearby HIV-Producing CellsIndirect killing required gp41-mediated fusion and close interac-
tion with HIV-infected cells, suggesting that cell death may be
caused by the fusion of HIV-1 virions to CD4 T cells, syncytia
formation, or hemifusion (mixing of lipids in the absence of fusion
pore formation) mediated by Env present on HIV-infected cells
interacting with neighboring CD4 T cells. HIV-1 virions (Holm
et al., 2004; Jekle et al., 2003; Vlahakis et al., 2001), cell-medi-
ated fusion (LaBonte et al., 2000; Margolis et al., 1995), and
hemifusion (Garg et al., 2007) have been proposed to be involved
in indirect killing. Therefore, the requirement for cell-cell interac-
tion in indirect killing may be mediated either by effective delivery
of HIV-1 virions or by cell-associated Env.
To discriminate between virion-mediated and cell-associated
Env induction of indirect killing, we tested the effects of HIV
protease inhibitors. These inhibitors act during the budding
process, resulting in immature viral particles that cannot fuse
with target cells (Wyma et al., 2004). We first assessed the effect
of protease inhibitors on viral maturation. NL4-3 viruses carrying
a b-lactamase-Vpr (BlaM-Vpr) reporter protein were produced
in 293T cells in the presence or absence of the HIV protease
inhibitor amprenavir. We also produced a mutant virus, TR712,
encoding a form of gp41 lacking 144 of the 150 amino acids in
the C-terminal cytoplasmic tail. This deletion largely relieves
the impaired fusogenic properties of immature HIV-1 particles
(Wyma et al., 2004). Protein analysis of viral lysates showed
that the NL4-3 and TR712 virions appropriately cleaved gp160
to generate gp120 in the presence and absence of amprenavir.
However, in the presence of amprenavir, an uncleaved form of
p55 Gag polypeptide rather than the mature p24 CA protein
accumulated in both NL4-3 and TR712 virions (Figure 4D). These
results confirm that amprenavir treatment of virus producing
cells results in the accumulation of immature particles containing
normal levels of incorporated Env proteins.
To test the ability of these viruses to fuse with target cells, we
used an HIV virion-based fusion assay that measures b-lacta-
mase (BlaM) activity delivered to target cells upon the fusion
of virions containing BlaM fused to the Vpr protein (BlaM-Vpr)
(Cavrois et al., 2002). Immunoblotting for BlaM confirmed that
NL4-3 and TR712 virions incorporated Blam-Vpr in the presence
or absence of amprenavir (Figure 4D).
Next, SupT1 cells were infected with mature or amprenavir-
treated immature NL4-3 or TR712 virions containing BlaM-Vpr.
Immature NL4-3 viruses displayed a 90% decline in fusogenic
properties (Figure 4E). In contrast, immature TR712 retained
40% fusion capacity, indicating that the impaired fusion is not
a result of a defective BlaM enzyme. Thus, immature virions
generated in the presence of amprenavir display greatly reduced
ability to fuse with target cells. Importantly, protease inhibitors
did not affect the function of Env proteins expressed on infected
cells and did not block cell-cell fusion (Figure S3C).
We next investigated the effect of protease inhibitors on
indirect killing. Remarkably, three different protease inhibitors
inhibited indirect killing as efficiently as AMD3100 (Figure 4F).
These results indicated that HIV-1 virions, not HIV-infected cells,
are responsible for indirect CD4 T cell killing. Additionally, reca-
pitulating the efficient viral delivery of close cell-cell interactions
by spinoculation of free virions resulted in extensive and selec-
tive indirect killing of CD4 T cells while sparing CD8 T cells and
B cells (Figures S3A and S3B). Thus, although indirect killing in
lymphoid cultures requires a close interaction between nonpro-
ductively and productively infected cells, this killing involves
virions rather than cell-associated Env.
Nonpermissive CD4 T Cells Die from Abortive InfectionBased on these findings, we hypothesized that ‘‘indirect killing’’
involves an abortive form of infection, like that which occurs in
nonpermissive resting CD4 T cells. These naive CD4 T cells
Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc. 793
exhibit an early post-entry block to HIV-1 infection that can be
relieved by activation with phytohemagglutinin (PHA) and inter-
leukin-2 (IL-2) (Kreisberg et al., 2006; Santoni de Sio and Trono,
2009; Unutmaz et al., 1999; Zack et al., 1990). To test this
hypothesis, we compared the killing of activated and nonacti-
vated CFSE-labeled cells in HLACs.
Figure 4. Killing of Nonproductively Infected CD4 T Cells Requires Fusion of Virions from Nearby HIV-1-Producing Cells
(A) Supernatants from HIV-infected HLACs are less efficient at inducing indirect killing than mixing of HIV-infected and uninfected HLACs.
(B) HIV-1 virions released into the medium do not participate in indirect killing. Replacing the mixed culture with fresh RPMI every 24 hr did not impair indirect killing.
Challenging HLACs with supernatants containing 20-fold more histoculture-derived virions (1 mg p24/ml) than normally accumulated in mixed cultures containing
infected cells (50 ng p24/ml) did not induce indirect killing. Percentages are normalized to the number of viable CFSE-positive cells depicted by an asterisk.
(C) CFSE-labeled cells are not killed when HIV-infected HLAC is physically separated by a 1 mm –pore transwell system that allows free diffusion of HIV-1 parti-
cles. Values represent the levels of viable CFSE-positive cells after 6 days of culture in the presence of the indicated drugs. Red, HIV-infected cells; blue, unin-
fected cells; green, CFSE-labeled cells.
(D) Mature and immature viruses carry equivalent amounts of envelope protein and Blam-Vpr, but differ in their content of capsid and Gag precursor. NL4-3 and
TR712 viruses were generated in 293T cells with or without amprenavir, lysed and subjected to SDS-PAGE immunoblotting analysis for gp120, p55 Gag, p24 CA,
Blam-Vpr, and free Blam.
(E) Immature viruses have reduced capacity to enter cells. SupT1 cells were mock infected or infected with mature or immature NL4-3 or TR712 virions con-
taining Blam-Vpr. After loading of cells with CCF2 dye, fusion was analyzed by flow cytometry. Percentages are the fraction of cells displaying increased cleaved
CCF2 fluorescence, indicating virion fusion.
(F) Protease inhibitors inhibit indirect killing. CFSE-labeled cells were cocultured with NL4-3-infected or uninfected cells in the presence of AZT (5 mM) alone or
together with AMD3100 (250 nM). To the indicated cultures were added 5 mM of amprenavir, saquinavir, or indinavir. Percentages are normalized to the number
of viable CFSE-positive cells depicted by an asterisk. Error bars represent the SD obtained with three independent samples from the same donor.
See also Figure S3.
794 Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc.
CFSE-labeled cells were activated with PHA and IL-2 two days
before mixing with effector cells, and contained a large
percentage of dividing CD25 and CD69 positive cells. Nonacti-
vated (resting) CFSE-labeled cells did not divide and typically
contained a small percentage of cells expressing CD25 and
CD69 (Figure 5A). Either in the presence or absence of AZT,
killing of resting CFSE-labeled CD4 T cells was robust (Figure 5B,
columns 4 and 5, and 16 and 17). In sharp contrast, activated
Figure 5. Death of Abortively Infected CD4 T Cells Is Due to Impaired Reverse Transcription
(A) Status of mixed HLACs containing either resting or activated CFSE-labeled cells, 4 days after coculturing with effector cells. Activated CFSE-labeled cells
were stimulated with PHA and IL-2 48 hr before mixing, but not during coculturing with effector cells. To avoid direct killing of activated CFSE-labeled cells in
cultures with no drugs, cell killing was terminated and analyzed 4 days after coculturing.
(B) AZT renders activated CFSE-labeled CD4 T cells sensitive to indirect killing. Resting or activated CFSE-labeled cells were cocultured with effector cells in the
presence of no drugs, AZT (5 mM) alone, or AZT and AMD3100 (250 nM). Data are from two independent experiments performed with tonsil cells from two different
donors.
(C) AZT-induced killing is lost when AZT-resistant viruses are tested. Resting or activated CFSE-labeled cells were cocultured with cells infected with NL4-3 or
HIV-1 clones #629 and #964 in the presence of no drugs, AZT (0.5 mM) alone, or AZT and AMD3100 (250 nM). AZT-sensitive and AZT-resistant sub-clones are
depicted. Data are representative of three independent experiments with three different donors.
(D) NNRTIs prevent killing of abortive infected CD4 T cells. Resting or activated CFSE-labeled cells were cocultured with infected or uninfected effector cells, in
the presence of no drugs, AZT (5 mM), AMD3100 (250 nM), the NNRTIs efavirenz (100 nM), and nevirapine (1 mM), or the integration inhibitors raltegravir (30 mM)
and 118-D-24 (60 mM). Killing of resting CFSE-labeled CD4 T cells was blocked with equal efficiency by NNRTIs and AMD3100 (columns 15, 16), but not by
integration inhibitors (columns 17, 18). In combination, NNRTIs prevented cell death induced by AZT in activated CFSE-labeled cells (compare column 38 to
44 and 45). Data are representative of four independent experiments with four different donors.
The absolute numbers of CFSE-labeled CD8 T cells and B cells was unaltered in these experiments (data not shown). Percentages are normalized to the number
of viable CFSE-positive cells depicted by an asterisk.
See also Figure S4.
Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc. 795
Figure 6. Cytoplasmic HIV-1 DNA Triggers Proapoptotic and Proinflammatory Responses in Abortively Infected CD4 T Cells
(A) Critical reactions in HIV-1 reverse transcription as detected by probes monitoring different regions within the Strong stop, Nef, and Env DNA fragments. RDDP,
RNA-dependent DNA polymerase. Adapted from S.J. Flint et al., Principles of Virology, 2000 ASM Press, Washington DC, with permission.
(B) NNRTIs prevent accumulation of DNA elongation products. The amount of viral DNA detected by a particular probe was calculated as a fold change relative
to cells treated with no drugs (i.e., calibrator). A b�actin probe was used as an internal reference. Mean cycle threshold (Ct) values of calibrator samples are
depicted. CD4 T cells were infected with WT NL4-3 produced in 293T cells, or with a Dvif NL4-3 collected from supernatants of infected HLAC, as described
in Figure S4C. Data are representative of two independent experiments performed with cells from two different donors.
(C and D) Abortive HIV-1 infection generates a coordinated proapoptotic and proinflammatory response involving caspase-3 and caspase �1 activation. HLACs
were spinoculated with no virus or with NL4-3 and AZT (5 mM), Efavirenz (100 nM), and T20 (10 mg/ml), as indicated (see Figures S3A and S3B). After 3 days, cells
were assessed by flow cytometry for intracellular levels of proinflammatory cytokines, serine 37 phosporylated p53, and activated caspases as indicated.
Ethidium monoazide was used to exclude dead and necrotic cells from the annexinV binding analysis. Data are representative of three independent experiments
with three different donors.
(E) Death of abortively infected CD4 T cells requires caspase activation. CSFE-labeled cells were cocultured with effector cells in the presence of 20 mM of Z-VAD-
FMK, a general caspase inhibitor,or Z-FA-FMK, a negativecontrol for caspase inhibitors.AZT (5mM); AMD3100 (250 nM).Percentages are normalized to the number
of viable CFSE-positive cells depicted by an asterisk. Error bars represent standard error of the mean of three experiments from three different HLAC donors.
(F) Abortive HIV infection promotes the maturation and secretion of IL-1b in tonsillar CD4 T cells. Isolated tonsillar CD4 T cells were either untreated, or stimulated
with PMA (phorbol-12-myristate-12-acetate, 0.5 mM) and the potassium ionophore nigericin (10 mM), or spinoculated with or without NL4-3 in the presence of
796 Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc.
CFSE-labeled CD4 T cells were not depleted in the absence of
AZT, but were extensively depleted in cultures containing AZT
(Figure 5B, columns 10 and 11 and 22 and 23). Addition of
AMD3100 prevented the AZT-induced killing of activated
CFSE-labeled cells, excluding nonspecific toxic effects of AZT
in the activated cells (Figure 5B, columns 12 and 24).
The ability of AZT to promote indirect killing of activated CD4
T cells suggested that cell death is triggered by impaired reverse
transcription. To investigate this possibility, we repeated the
experiment with two pairs of AZT-resistant HIV-1 clones, 629
and 964 (Larder et al., 1989). We first determined that concentra-
tions of 0.5 mM AZT block viral replication in NL4-3-infected and
AZT-sensitive clones and achieve half maximal inhibitory effect
in AZT-resistant clones (Figures S4A and S4B).
When resting CFSE-labeled cells were used, the extent of
killing by the AZT-resistant HIV-1 viruses was similar to that
obtained with NL4-3 with or without AZT (Figure 5C resting
CFSE-positive cells), demonstrating a redundant function for
endogenous termination of reverse transcription and AZT. Alter-
natively, when activated CFSE-labeled cells were tested, AZT-
resistant HIV-1 clones did not deplete CFSE-labeled CD4
T cells in the presence of AZT (Figure 5C, columns 29 and 35).
Death of Abortively Infected CD4 T Cells Is Triggeredby Premature Termination of Viral DNA ElongationWe next asked what stage of reverse transcription triggers abor-
tive infection cell death. AZT inhibits DNA elongation but not
early DNA synthesis (Arts and Wainberg, 1994). We therefore
examined whether blocking early DNA synthesis with nonnu-
cleoside reverse transcriptase inhibitors (NNRTIs) would have
the same effect as AZT. Impaired reverse transcription may
also lead to abortive integration, causing chromosomal DNA
breaks and a genotoxic response. To exclude this possibility,
we used integrase inhibitors. To discriminate between the cyto-
pathic response induced by endogenous termination of reverse
transcription and the response induced by AZT, we separately
assessed resting and activated CFSE-labeled cells.
Remarkably, the NNRTIs, efavirenz and nevirapine, blocked
indirect killing of resting CD4 T cells as efficiently as AMD3100
(Figure 5D, columns 15 and 16). These findings suggested that
allosteric inhibition of reverse transcriptase induced by these
NNRTI’s interrupts reverse transcription sufficiently early to
abrogate the death response. In contrast, the integrase inhibitors
raltegravir and 118-D-24 did not prevent abortive infection killing
(Figure 5D, columns 17 and 18), suggesting that cell death
involves signals generated prior to viral integration. NNRTIs
also protected activated CFSE-labeled cells from death induced
by AZT (Figure 5D, column 38 versus columns 44 and 45),
demonstrating that a certain degree of DNA synthesis is required
to elicit the cytopathic response.
This notion was further strengthened in findings obtained with
vif-deficient (Dvif) HIV-1 particles where reverse transcription is
inhibited during strong-stop DNA synthesis due to incorporated
APOBEC3G (A3G) (Bishop et al., 2008; Li et al., 2007). Abortively
infected CD4 T cells were not depleted by Dvif NL4-3-infected
cells (Figures S4C and S4D), indicating that termination of
reverse transcription before the completion of strong-stop
DNA synthesis is not sufficient to generate a cytopathic
response. Other HIV-1 mutants containing substitutions in
RNase H and nucleocapsid that promote early defects in reverse
transcription failed to elicit indirect CD4 T cell killing (Figures S4E
and S4F). Together, these findings indicate that accumulation of
reverse-transcribed DNA, rather than any inherent activity of the
HIV-1 proteins, is the key factor that triggers the death response.
Abortively Infected CD4 T Cells Commencebut Do Not Complete Reverse TranscriptionWe next examined the status of HIV-1 reverse transcription in
tonsillar CD4 T cells after infection. Specifically, we investigated
the effect on reverse transcription after treatment with NNRTIs,
such as efavirenz and nevirapine, which prevent the death of
abortively infected CD4 T cells, or with AZT or integrase inhibitor
(raltegravir) that do not prevent CD4 T cell death. Taqman-based
quantitative real-time PCR (QPCR) was used to quantify the
synthesis of reverse transcription products in isolated CD4
T cells from HLAC 16 hr after infection with NL4-3. We designed
specific QPCR primers and probes (Table S1) to monitor
sequential steps in reverse transcription including generation
of strong-stop DNA, first template exchange (Nef), and DNA
strand elongation (Env) (Figure 6A). Reverse transcription
products corresponding to strong-stop DNA were similar in
untreated CD4 T cells or cells treated with AZT, NNRTIs, or
raltegravir but were greatly reduced in cells treated with
AMD3100 or in cultures infected with Dvif NL4-3 where arrest
occurs prior to the completion of strong-stop DNA synthesis
(Figure 6B columns 1–8). In contrast, the accumulation of later
reverse transcription products detected by the Nef and Env
probes were dramatically inhibited by the NNRTIs but not by
raltegravir. Levels of Nef (Figure 6B, columns 10 and 11) and
Env (columns 18 and 19) DNA products were similar in untreated
cells and cells treated with AZT, indicating that reverse transcrip-
tion in most tonsillar CD4 T cells naturally terminates during DNA
chain elongation, coinciding with the block induced by AZT. The
minor inhibition detected by AZT is likely due to a small number
of permissive CD4 T cells in the culture. These results show that
abortively infected CD4 T cells accumulate incomplete reverse
AZT (5 mM), AMD3100 (250 nM), and efavirenz (100 nM) as indicated. After 3 days, half of the cells were lysed and subjected to SDS-PAGE immunobloting anal-
ysis. On day 5, the supernatants from the rest of the cells were collected and subjected to SDS-PAGE immunobloting analysis. The IL-1b antibody detects the
pro-IL-1b (37kD) and the mature cleaved form (17kD). Data are the representative results of five independent experiments using tonsillar CD4 T cells isolated
from five different donors.
(G) DNA reverse transcription intermediates induce an IFN-stimulatory antiviral innate immune response (ISD). ISRE-GFP reporters were transfected with 1 mg of
HIV-1 reverse transcription intermediate products as indicated by numbers (detailed description in Figure S5E), empty DNA plasmid, or polyinosinic:polycytidylic
acid [poly(I:C)], and were analyzed by flow cytometry after 48 hr. Data are representative of three independent experiments; error bars show the SD for three
independent samples from the same experiment.
See also Figure S5 and Figure S6.
Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc. 797
transcription products representative of DNA strand elongation.
Blocking earlier steps of reverse transcription by NNRTIs or by
genetic mutations like deletion of Vif or mutation of RNase H
restricts accumulation of such products, and prevents abortive
infection-induced cell death (Figure S6A).
DNA Reverse Transcription Intermediates Elicita Coordinated Proapoptotic and ProinflammatoryResponse in Abortively Infected CD4 T CellsWe next evaluated whether HIV-mediated indirect killing of CD4
T cells is associated with deregulation of cytokine production or
a DNA damage response. To facilitate a vigorous and synchro-
nized killing effect, HLACs were spinoculated with NL4-3 virions
in the presence of various antiviral drugs. Interestingly, based on
immunostaining after cytokine capture, abortively infected CD4
T cells expressed IFN-b, and high levels of the proinflammatory
interleukin 1b (IL–1b), but not tumor necrosis factor (TNFa)
(Figure 6C). Phosphorylation of S37 p53 was not observed,
suggesting that abortive HIV-1 infection does not induce a
DNA damage cascade. Abortively infected CD4 T cells also
displayed caspase-1 and caspase-3 activity along with appear-
ance of annexin V (Figure 6D). T20 and efavirenz but not AZT
prevented activation of these caspases, indicating that apo-
ptosis was induced by abortive HIV-1 infection. Cell death was
completely prevented by Z-VAD-FMK, a pan-caspase inhibitor,
suggesting that caspase activation is required for the observed
cytopathic response (Figure 6E). Such mode of cytokine produc-
tion and caspase activation was not observed in CD8 T or B cells
(Figures S5B and S5C).
We next examined whether abortive HIV-1 infection signals for
the maturation and secretion of IL-1b. In cells, IL–1b activity is
rigorously controlled. Cells can be primed to express inactive
pro-IL-1b by various proinflammatory signals. However, the
release of bioactive IL-1b requires a second signal leading to
activation of inflammasomes, cleavage of pro-IL-1b by caspase
1 and secretion of the bioactive 17 kDa form of IL-1b (Schroder
and Tschopp, 2010). Interestingly, Western blot analysis re-
vealed high amounts of intracellular pro-IL-1b in untreated CD4
T cells, suggesting that tonsillar CD4 T cells are primed to release
proinflammatory mediators (Figure 6F). Stimulating the CD4
T cells with PMA and nigericin induced further accumulation
of pro-IL-1b and promoted the maturation and release of the
bioactive 17 kDa IL-1b into the supernatant. Remarkably, infec-
tion of CD4 T cells with NL4-3 in the presence of AZT similarly
resulted in maturation and release of the bioactive 17 kDa
IL-1b into the supernatant. This response was completely pre-
vented by efavirenz and AMD3100, suggesting that abortive
HIV-1 infection signals the maturation and release of bioactive
IL-1b in these CD4 T cells.
To identify the nature of the nucleic acid species that trigger
these responses, we used a recently described H35 rat hepato-
cyte cell line containing an IFN-sensitive response element
(ISRE) linked to GFP (Patel et al., 2009). H35 cells were first
infected with pseudotyped VSV-G HIV-1 virions. These virions
induced GFP expression and cell death in the presence or
absence of AZT. Importantly, the expression of GFP and cell
death response were blocked by efavirenz but not raltegravir
(Figure S5D). Thus, the H35 system successfully reconstitutes
the cytokine and cytopathic response observed in tonsillar
CD4 T cells. We next synthesized the various HIV-1 reverse
transcription intermediates and tested their ability to activate
the ISRE-GFP reporter. Interestingly, none of the RNA-contain-
ing oligonucleotides stimulated the ISRE-GFP reporter expres-
sion above baseline. In sharp contrast, ssDNA and dsDNA
oligonucleotides longer than 500 bases in length, which corre-
sponded to reverse transcription intermediates produced during
DNA elongation, evoked a potent ISRE-GFP activation (Fig-
ure 6G). Similarly, when cells were stimulated with poly(I:C), a
synthetic double-stranded RNA known to activate IRF3 via the
RIG-I pathway elicited a comparable ISRE-GFP response. Taken
together, these findings indicate that reverse transcription
intermediates generated during DNA chain elongation induce
a coordinated proapoptotic and proinflamatory innate immune
response involving caspase-3 and caspase-1 activation in
abortively infected CD4 T cells.
DISCUSSION
The mechanism through which HIV-1 kills CD4 T cells, a hallmark
of AIDS, has been a topic of vigorous research and one of the
most pressing questions for the field over the last 28 years
(Thomas, 2009). In this study, we investigated the mechanism
of HIV-1-mediated killing in lymphoid tissues, which carry the
highest viral burdens in infected patients. We used HLACs
formed with fresh human tonsil cells and an experimental strategy
that clearly distinguishes between direct and indirect mecha-
nisms of CD4 T cell depletion. We now demonstrate that indirect
cell killing involving abortive HIV infection of CD4 T cells accounts
for the vast majority of cell death occurring in lymphoid tissues.
No more than 5% of the CD4 T cells are productively infected,
but virtually all the remaining CD4 T cells are abortively infected
ultimately leading to caspase-mediated cell death. Equivalent
findings were observed in HLACs formed with fresh human
spleen (Figures S6B and S6C), indicating this mechanism of
CD4 T cell depletion can be generalized to other lymphoid
tissues.
The massive depletion of nonproductively infected CD4 T cells
is in contrast to their survival after infection of intact blocks of
tonsillar tissue in human lymphoid histoculture (HLH) (Grivel
et al., 2003). This result probably reflects differences between
the HLH and the HLAC experimental systems. In HLH, the com-
plex three-dimensional spatial cellular organization of lymphoid
tissue is preserved, but cellular movement and interaction are
restricted, both of which are required for indirect killing. In
HLAC, the tissue is dispersed, and cells are free to interact, result-
ing in a rapid and robust viral spread. While the mechanism
triggering indirect CD4 T cell death is certainly identical in both
settings, HLH allows only a slow, nearly undetectable progres-
sion of indirect CD4 T cell death. In HLAC, this process is accel-
erated, allowing the outcome to be detected in a few days. Inter-
estingly, indirect killing was also less efficient when peripheral
blood cells were tested (data not shown). It is possible that cellular
factors specifically produced in lymphoid organs are required to
accelerate indirect killing of peripheral blood CD4 T cells.
Several mechanisms have been proposed to explain indirect
CD4 T cell killing during HIV infection. Our finding that CD4
798 Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc.
T cell death is blocked by entry and fusion inhibitors but not by
AZT, strongly suggested that such killing involves nonproductive
infection of CD4 T cells. Therefore, we focused on events that
occur after HIV-1 entry. Our investigations demonstrate that
abortive viral DNA synthesis occurring in nonpermissive, quies-
cent CD4 tonsil T cells, plays a key role in the cell death
response. Conversely, in the small subset of permissive target
cells, reverse transcription is not interrupted, minimizing the
accumulation and subsequent detection of such reverse
transcription intermediates (Figure 7).
Interrupted or slowed reverse transcription may create persis-
tent exposure to cytoplasmic DNA products that elicit an antiviral
innate immune response coordinated by activation of type I IFNs
(Stetson and Medzhitov, 2006). Such activation, termed
IFN-stimulatory DNA (ISD) response, may be analogous to the
type I IFN response triggered by the RIG-I-like receptor (RLR)
family of RNA helicases that mediate a cell-intrinsic antiviral
defense (Rehwinkel and Reis e Sousa, 2010). Our results suggest
that abortive HIV-1 infection also stimulates activation of
caspase-3, which is linked to apoptosis, and caspase-1, which
promotes the processing and secretion of the proinflammatory
cytokines like IL–1b. It is certainly possible that pyroptosis
elicited in response to caspase-1 activation also contributes to
the observed cytopathic response (Schroder and Tschopp,
2010). The release of inflammatory cytokines during CD4 T cell
death could also contribute to the state of chronic inflammation
that characterizes HIV infection. This inflammation may fuel
further viral spread by recruiting uninfected lymphocytes to the
inflamed zone. While this innate response was likely designed
to protect the host, it is subverted in the case of HIV infection
and importantly contributes to the immunopathogenic effects
characteristic of HIV infection and AIDS.
Such antiviral pathways comprise an unrecognized cell-
intrinsic retroviral detection system (Manel et al., 2010; Stetson
Figure 7. Consequences of Inhibiting Early Steps of HIV-1 Infection on CD4 T Cell Death
(A) The nonpermissive state of most CD4 T cells in lymphoid tissue leads to endogenous termination of reverse transcription during DNA chain elongation (i.e.,
‘‘killing zone’’). As a result, DNA intermediates accumulate in the cytoplasm and elicit a multifaceted proapoptotic and proinflammatory innate immune defense
programs, coordinated by IFN-stimulatory DNA (ISD) response, caspase-3, caspase-1, and IL-1b, to restrict viral spread. Different classes of antiretroviral drugs
act at different stage of the HIV life cycle. NNRTIs like efavirenz and nevirapine inhibit early steps of DNA synthesis and therefore prevent such response and the
consequence CD4 T cell death. AZT is less efficient at blocking DNA synthesis and therefore unable to abrogate this response.
(B) In permissive CD4 T cells reverse transcription proceeds, allowing HIV-1 to bypass the ‘‘killing zone’’ and move on to productive (or latent) infection.
Interrupting reverse transcription with AZT traps the virus in the ‘‘killing zone’’ and induces cell death. EFV, efavirenz; NVP, nevirapine; and RTGR, raltegravir.
See also Figure S6.
Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc. 799
et al., 2008). Viral RNA in infected cells is recognized by
members of the RIG-I-like family of receptors that detect specific
RNA patterns like uncapped 50 triphosphate (Rehwinkel and
Reis e Sousa, 2010). Although uncapped RNA intermediates
are generated by the HIV-1 RNase H, they contain a 50 mono-
phosphate and therefore may be not recognized by the RIG-I
system (Figure 6G). In contrast to RNA receptors, intracellular
sensing of viral DNA remains poorly understood. Consequently,
it is unclear how HIV-1 DNA intermediates are detected in the
cytoplasm of abortively infected CD4 T cells. AIM2 (absent in
melanoma 2) was recently identified as a cytoplasmic dsDNA
receptor that induces cell death in macrophages through activa-
tion of caspase-1 in imflammasomes (Hornung et al., 2009). Our
preliminary investigations have not supported a role for AIM2 in
cell death induced by abortive HIV infection (data not shown),
suggesting the potential involvement of a different DNA-sensing
mechanism. We also have not identified a role for TLR9 and
MYD88 signaling in this form of cell death. Additional candidate
sensors recognizing cytoplasmic HIV-1 DNA are now under
study.
In summary, both productive and nonproductive forms of HIV
infection contribute to the pathogenic effects of this lentivirus.
The relative importance of these different cell death pathways
might well vary with the stage of HIV infection. For example,
direct infection and death might predominate during acute
infection where CCR5-expressing memory CD4 T cells in gut-
associated lymphoid tissue are effectively depleted. Conversely,
the CXCR4-dependent indirect killing we describe in tonsil tissue
may reflect later stages of HIV-induced disease where a switch
to CXCR4 coreceptor usage occurs in approximately 50% of
infected subjects.
The current study demonstrates how a cytopathic response
involving abortive viral infection of resting nonpermissive CD4
T cells can lead not only to CD4 T cell depletion but also to the
release of proinflammatory cytokines. The ensuing recruitment
of new target cells to the site of inflammation may fuel a vicious
cycle of continuing infection and CD4 T cell death centrally
contributing to HIV pathogenesis.
EXPERIMENTAL PROCEDURES
Culture and Infection of HLACs
Human tonsil or splenic tissues were obtained from the National Disease
Research Interchange and the Cooperative Human Tissue Network and pro-
cessed as previously described (Jekle et al., 2003). For a detailed description
see Extended Experimental Procedures.
FACS Analysis and Gating Strategy, Preparation of HIV-1 Virions,
and Virion-Based Fusion Assay
Data were collected on a FACS Calibur (BD Biosciences) and analyzed with
Flowjo software (Treestar). HIV-1 viruses were generated by transfection of
proviral DNA into 293T cells by the calcium phosphate method. Virion-based
fusion assay was performed as previously described (Cavrois et al., 2002).
Detailed protocols are provided in the supplemental experimental procedures.
Spinoculation and Taqman-Based QPCR Analysis
of HIV-1-Infected CD4 T Cells
The spinoculation method is described in detail in Figures S3A and S3B.
Isolation of HLAC CD4 T cells and QPCR protocol are described in detail
in supplemental experimental procedures. Primers and probes sequences
used to detect reverse transcription products are provided in Table S1.
QPCR reactions were performed in an ABI Prism 7900HT (Applied
Biosystems).
ISRE-GFP H35 Reporter Cells, Microscopy, and Generation
of Synthetic HIV-1 Reverse Transcription Intermediates
H35 rat hepatic cells containing an ISRE-GFP reporter were maintained as
described (Patel et al., 2009). For microscopy imaging, ISRE-GFP reporter
H35 cells were infected with a replication competent VSV-G pseudotyped
NL4-3 and analyzed using an Axio observer Z1 microscope (Zeiss). Transfec-
tions and generation of synthetic HIV-1 reverse transcription intermediates are
described in detail in Figure S5E and Extended Experimental Procedures.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures,
six figures, and one table and can be found with this article online at
doi:10.1016/j.cell.2010.11.001.
ACKNOWLEDGMENTS
We thank David N. Levy for the NLENG1 plasmid; David Fenard for the NL4-3
variant plasmids SIM, GIA, GIA-SKY, and SKY; George M. Shaw for the WEAU
16-8 env clone; and Suraj J. Patel, Kevin R. King, and Martin L. Yarmush for the
H35 ISRE-GFP reporter cell line. The following reagents were obtained through
the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID,
NIH: AMD3100, T-20, Saquinavir, Amprenavir, Indinavir, Nevirapine, Efavirenz,
and AZT-resistant HIV-1 clones #629 and #964. Special thanks to Dr. Eva
Herker for assistance with fluorescence microscopy; to Dr. Stefanie Sowinski
for help with assessing inflammatory responses in primary immune cells; and
to Jason Neidleman for stimulating discussions and technical advice. We also
thank Marty Bigos for assistance with the flow cytometry; Stephen Ordway
and Gary Howard for editorial assistance; John C.W. Carroll and Alisha Wilson
for graphics; and Robin Givens and Sue Cammack for administrative assis-
tance. Funding for this project was provided by the Universitywide AIDS
Research Program, F04-GIVI-210 (G.D.); the UCSF-GIVI Center for AIDS
Research, NIH/NIAID P30 AI027763 (M.C.); the Francis Goelet Fellowship
(K.G.L.); and the UCSF Medical Scientist Training Program, NIH/NIGMS T32
GM007618-32 (O.Z.).
Received: November 5, 2009
Revised: May 7, 2010
Accepted: October 29, 2010
Published: November 24, 2010
REFERENCES
Arts, E.J., and Wainberg, M.A. (1994). Preferential incorporation of nucleoside
analogs after template switching during human immunodeficiency virus
reverse transcription. Antimicrob. Agents Chemother. 38, 1008–1016.
Baldwin, C.E., Sanders, R.W., Deng, Y., Jurriaans, S., Lange, J.M., Lu, M., and
Berkhout, B. (2004). Emergence of a drug-dependent human immunodefi-
ciency virus type 1 variant during therapy with the T20 fusion inhibitor. J.
Virol. 78, 12428–12437.
Bishop, K.N., Verma, M., Kim, E.Y., Wolinsky, S.M., and Malim, M.H. (2008).
APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathog. 4,
e1000231.
Cavrois, M., De Noronha, C., and Greene, W.C. (2002). A sensitive and specific
enzyme-based assay detecting HIV-1 virion fusion in primary T lymphocytes.
Nat. Biotechnol. 20, 1151–1154.
Eckstein, D.A., Penn, M.L., Korin, Y.D., Scripture-Adams, D.D., Zack, J.A.,
Kreisberg, J.F., Roederer, M., Sherman, M.P., Chin, P.S., and Goldsmith,
M.A. (2001). HIV-1 actively replicates in naive CD4(+) T cells residing within
human lymphoid tissues. Immunity 15, 671–682.
Finkel, T.H., Tudor-Williams, G., Banda, N.K., Cotton, M.F., Curiel, T., Monks,
C., Baba, T.W., Ruprecht, R.M., and Kupfer, A. (1995). Apoptosis occurs
800 Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc.
predominantly in bystander cells and not in productively infected cells of HIV-
and SIV-infected lymph nodes. Nat. Med. 1, 129–134.
Gandhi, R.T., Chen, B.K., Straus, S.E., Dale, J.K., Lenardo, M.J., and
Baltimore, D. (1998). HIV-1 directly kills CD4+ T cells by a Fas-independent
mechanism. J. Exp. Med. 187, 1113–1122.
Garg, H., Joshi, A., Freed, E.O., and Blumenthal, R. (2007). Site-specific
mutations in HIV-1 gp41 reveal a correlation between HIV-1-mediated
bystander apoptosis and fusion/hemifusion. J. Biol. Chem. 282, 16899–16906.
Glushakova, S., Baibakov, B., Margolis, L.B., and Zimmerberg, J. (1995).
Infection of human tonsil histocultures: a model for HIV pathogenesis. Nat.
Med. 1, 1320–1322.
Grivel, J.C., Biancotto, A., Ito, Y., Lima, R.G., and Margolis, L.B. (2003).
Bystander CD4+ T lymphocytes survive in HIV-infected human lymphoid
tissue. AIDS Res. Hum. Retroviruses 19, 211–216.
Hayden, M.S., Palacios, E.H., and Grant, R.M. (2003). Real-time quantitation of
HIV-1 p24 and SIV p27 using fluorescence-linked antigen quantification
assays. AIDS 17, 629–631.
Herbeuval, J.P., Grivel, J.C., Boasso, A., Hardy, A.W., Chougnet, C., Dolan,
M.J., Yagita, H., Lifson, J.D., and Shearer, G.M. (2005). CD4+ T-cell death
induced by infectious and noninfectious HIV-1: role of type 1 interferon-depen-
dent, TRAIL/DR5-mediated apoptosis. Blood 106, 3524–3531.
Holm, G.H., and Gabuzda, D. (2005). Distinct mechanisms of CD4+ and CD8+
T-cell activation and bystander apoptosis induced by human immunodefi-
ciency virus type 1 virions. J. Virol. 79, 6299–6311.
Holm, G.H., Zhang, C., Gorry, P.R., Peden, K., Schols, D., De Clercq, E., and
Gabuzda, D. (2004). Apoptosis of bystander T cells induced by human
immunodeficiency virus type 1 with increased envelope/receptor affinity and
coreceptor binding site exposure. J. Virol. 78, 4541–4551.
Hornung, V., Ablasser, A., Charrel-Dennis, M., Bauernfeind, F., Horvath, G.,
Caffrey, D.R., Latz, E., and Fitzgerald, K.A. (2009). AIM2 recognizes cytosolic
dsDNA and forms a caspase-1-activating inflammasome with ASC. Nature
458, 514–518, Epub 2009 Jan 2021.
Jekle, A., Keppler, O.T., De Clercq, E., Schols, D., Weinstein, M., and
Goldsmith, M.A. (2003). In vivo evolution of human immunodeficiency virus
type 1 toward increased pathogenicity through CXCR4-mediated killing of
uninfected CD4 T cells. J. Virol. 77, 5846–5854.
Kamata, M., Nagaoka, Y., and Chen, I.S. (2009). Reassessing the role of
APOBEC3G in human immunodeficiency virus type 1 infection of quiescent
CD4+ T-cells. PLoS Pathog 5, e1000342.
Kreisberg, J.F., Yonemoto, W., and Greene, W.C. (2006). Endogenous factors
enhance HIV infection of tissue naive CD4 T cells by stimulating high molecular
mass APOBEC3G complex formation. J. Exp. Med. 203, 865–870.
LaBonte, J.A., Patel, T., Hofmann, W., and Sodroski, J. (2000). Importance of
membrane fusion mediated by human immunodeficiency virus envelope
glycoproteins for lysis of primary CD4-positive T cells. J. Virol. 74, 10690–
10698.
Larder, B.A., Darby, G., and Richman, D.D. (1989). HIV with reduced sensitivity
to zidovudine (AZT) isolated during prolonged therapy. Science 243, 1731–
1734.
Levy, D.N., Aldrovandi, G.M., Kutsch, O., and Shaw, G.M. (2004). Dynamics of
HIV-1 recombination in its natural target cells. Proc. Natl. Acad. Sci. USA 101,
4204–4209.
Li, X.Y., Guo, F., Zhang, L., Kleiman, L., and Cen, S. (2007). APOBEC3G
inhibits DNA strand transfer during HIV-1 reverse transcription. J. Biol.
Chem. 282, 32065–32074.
Manel, N., Hogstad, B., Wang, Y., Levy, D.E., Unutmaz, D., and Littman, D.R.
(2010). A cryptic sensor for HIV-1 activates antiviral innate immunity in
dendritic cells. Nature 467, 214–217.
Margolis, L.B., Glushakova, S., Baibakov, B., and Zimmerberg, J. (1995).
Syncytium formation in cultured human lymphoid tissue: fusion of implanted
HIV glycoprotein 120/41-expressing cells with native CD4+ cells. AIDS Res.
Hum. Retroviruses 11, 697–704.
Patel, S.J., King, K.R., Casali, M., and Yarmush, M.L. (2009). DNA-triggered
innate immune responses are propagated by gap junction communication.
Proc. Natl. Acad. Sci. USA 106, 12867–12872.
Rehwinkel, J., and Reis e Sousa, C. (2010). RIGorous detection: exposing virus
through RNA sensing. Science 327, 284–286.
Rimsky, L.T., Shugars, D.C., and Matthews, T.J. (1998). Determinants of
human immunodeficiency virus type 1 resistance to gp41-derived inhibitory
peptides. J. Virol. 72, 986–993.
Santoni de Sio, F.R., and Trono, D. (2009). APOBEC3G-depleted resting CD4+
T cells remain refractory to HIV1 infection. PLoS ONE 4, e6571.
Schindler, M., Munch, J., Kutsch, O., Li, H., Santiago, M.L., Bibollet-Ruche, F.,
Muller-Trutwin, M.C., Novembre, F.J., Peeters, M., Courgnaud, V., et al.
(2006). Nef-mediated suppression of T cell activation was lost in a lentiviral
lineage that gave rise to HIV-1. Cell 125, 1055–1067.
Schroder, K., and Tschopp, J. (2010). The inflammasomes. Cell 140, 821–832.
Sherer, N.M., Lehmann, M.J., Jimenez-Soto, L.F., Horensavitz, C., Pypaert,
M., and Mothes, W. (2007). Retroviruses can establish filopodial bridges for
efficient cell-to-cell transmission. Nat. Cell Biol. 9, 310–315.
Sourisseau, M., Sol-Foulon, N., Porrot, F., Blanchet, F., and Schwartz, O.
(2007). Inefficient human immunodeficiency virus replication in mobile lympho-
cytes. J. Virol. 81, 1000–1012.
Stetson, D.B., Ko, J.S., Heidmann, T., and Medzhitov, R. (2008). Trex1
prevents cell-intrinsic initiation of autoimmunity. Cell 134, 587–598.
Stetson, D.B., and Medzhitov, R. (2006). Recognition of cytosolic DNA
activates an IRF3-dependent innate immune response. Immunity 24, 93–103.
Swiggard, W.J., O’Doherty, U., McGain, D., Jeyakumar, D., and Malim, M.H.
(2004). Long HIV type 1 reverse transcripts can accumulate stably within
resting CD4+ T cells while short ones are degraded. AIDS Res. Hum.
Retroviruses 20, 285–295.
Thomas, C. (2009). Roadblocks in HIV research: five questions. Nat. Med. 15,
855–859.
Unutmaz, D., KewalRamani, V.N., Marmon, S., and Littman, D.R. (1999).
Cytokine signals are sufficient for HIV-1 infection of resting human T lympho-
cytes. J. Exp. Med. 189, 1735–1746.
Vlahakis, S.R., Algeciras-Schimnich, A., Bou, G., Heppelmann, C.J., Villasis-
Keever, A., Collman, R.C., and Paya, C.V. (2001). Chemokine-receptor activa-
tion by env determines the mechanism of death in HIV-infected and uninfected
T lymphocytes. J. Clin. Invest. 107, 207–215.
Westendorp, M.O., Frank, R., Ochsenbauer, C., Stricker, K., Dhein, J.,
Walczak, H., Debatin, K.M., and Krammer, P.H. (1995). Sensitization of
T cells to CD95-mediated apoptosis by HIV-1 Tat and gp120. Nature 375,
497–500.
Wyma, D.J., Jiang, J., Shi, J., Zhou, J., Lineberger, J.E., Miller, M.D., and
Aiken, C. (2004). Coupling of human immunodeficiency virus type 1 fusion to
virion maturation: a novel role of the gp41 cytoplasmic tail. J. Virol. 78,
3429–3435.
Zack, J.A., Arrigo, S.J., Weitsman, S.R., Go, A.S., Haislip, A., and Chen, I.S.
(1990). HIV-1 entry into quiescent primary lymphocytes: molecular analysis
reveals a labile, latent viral structure. Cell 61, 213–222.
Zhou, Y., Zhang, H., Siliciano, J.D., and Siliciano, R.F. (2005). Kinetics of
human immunodeficiency virus type 1 decay following entry into resting CD4+
T cells. J. Virol. 79, 2199–2210.
Cell 143, 789–801, November 24, 2010 ª2010 Elsevier Inc. 801
Sirt3 Mediates Reduction of OxidativeDamage and Prevention of Age-RelatedHearing Loss under Caloric RestrictionShinichi Someya,1,3,5 Wei Yu,2,5 William C. Hallows,2 Jinze Xu,4 James M. Vann,1 Christiaan Leeuwenburgh,4
Masaru Tanokura,3 John M. Denu,2,* and Tomas A. Prolla1,*1Departments of Genetics and Medical Genetics2Department of Biomolecular Chemistry
University of Wisconsin, Madison, WI 53706, USA3Department of Applied Biological Chemistry, University of Tokyo, Yayoi, Tokyo 113-8657, Japan4Department of Aging and Geriatrics and The Institute on Aging, University of Florida, Gainesville, FL 32611, USA5These authors contributed equally to this work*Correspondence: [email protected] (J.M.D.), [email protected] (T.A.P.)
DOI 10.1016/j.cell.2010.10.002
SUMMARY
Caloric restriction (CR) extends the life span andhealth span of a variety of species and slows theprogression of age-related hearing loss (AHL),a common age-related disorder associated withoxidative stress. Here, we report that CR reducesoxidative DNA damage in multiple tissues and pre-vents AHL in wild-type mice but fails to modifythese phenotypes in mice lacking the mitochondrialdeacetylase Sirt3, a member of the sirtuin family.In response to CR, Sirt3 directly deacetylates andactivates mitochondrial isocitrate dehydrogenase 2(Idh2), leading to increased NADPH levels and anincreased ratio of reduced-to-oxidized glutathionein mitochondria. In cultured cells, overexpressionof Sirt3 and/or Idh2 increases NADPH levels andprotects from oxidative stress-induced cell death.Therefore, our findings identify Sirt3 as an essentialplayer in enhancing the mitochondrial glutathioneantioxidant defense system during CR and suggestthat Sirt3-dependent mitochondrial adaptationsmay be a central mechanism of aging retardation inmammals.
INTRODUCTION
It is well established that reducing food consumption by 25%–
60% without malnutrition consistently extends both the mean
and maximum life span of rodents (Weindruch and Walford,
1988; Koubova and Guarente, 2003). Caloric restriction (CR) is
also known to extend life span in yeast, worms, fruit flies,
spiders, birds, and monkeys and delays the progression of
a variety of age-associated diseases such as cancer, diabetes,
cataract, and age-related hearing loss (AHL) in mammals (Wein-
druch and Walford, 1988; Sohal and Weindruch, 1996; Someya
et al., 2007; Colman et al., 2009). Furthermore, CR reduces neu-
rodegeneration in animal models of Parkinson’s disease (Matt-
son, 2000) as well as Alzheimer’s disease (Zhu et al., 1999).
The mitochondrial free radical theory of aging postulates that
aging results from accumulated oxidative damage caused by
reactive oxygen species (ROS), originating from the mitochon-
drial respiratory chain (Balaban et al., 2005). Consistent with
this hypothesis, mitochondria are a major source of ROS and
of ROS-induced oxidative damage, and mitochondrial function
declines during aging (Wallace, 2005). A large body of evidence
suggests that CR reduces the age-associated accumulation of
oxidatively damaged proteins, lipids, and DNA through reduction
of oxidative damage to these macromolecules and/or enhanced
antioxidant defenses to oxidative stress (Weindruch and Wal-
ford, 1988; Sohal and Weindruch, 1996; Masoro, 2000). Yet,
whether the anti-aging action of CR in mammals is a regulated
process and requires specific regulatory proteins such as sir-
tuins still remains unclear.
Sirtuins are NAD+-dependent protein deacetylases that regu-
late life span in lower organisms and have emerged as broad
regulators of cellular fate and mammalian physiology (Donmez
and Guarente, 2010; Finkel et al., 2009). A previous report has
shown that life span extension by CR in yeast requires Sir2,
a member of the sirtuin family (Lin et al., 2000), linking sirtuins
and CR-mediated retardation of aging. In mammals, there are
seven sirtuins that display diverse cellular localization (Donmez
and Guarente, 2010; Finkel et al., 2009). Previous studies have
focused on the role of Sirt1 as the major sirtuin mediating the
metabolic effects of CR in mammals (Chen et al., 2005; Bor-
done et al., 2007; Chen et al., 2008). However, recent studies
indicate that upregulation of Sirt1 in response to CR is not
observed in all tissues examined (Cohen et al., 2004; Barger
et al., 2008), and currently, no study has provided conclusive
evidence that sirtuins play an essential role in CR-mediated
aging retardation in mammals. Sirt3 is a member of the
mammalian sirtuin family that is localized to mitochondria and
802 Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc.
regulates levels of ATP and the activity of complex I of the elec-
tron transport chain (Ahn et al., 2008) and, as such, may play
a role in the metabolic reprogramming mediated by CR. A
recent study has shown that CR increases Sirt3 levels in liver
mitochondria (Schwer et al., 2009). Fasting also increases
Sirt3 protein expression in liver mitochondria, and mice lacking
Sirt3 display the hallmarks of fatty acid oxidation disorders,
indicating that Sirt3 modulates mitochondrial fatty acid oxida-
tion in mammals (Hirschey et al., 2010). Furthermore, CR
increases expression of Sirt3 in primary mouse cardiomyo-
cytes, whereas overexpression of Sirt3 protects these cells
from oxidative stress-induced cell death (Sundaresan et al.,
2008), suggesting a potential role of Sirt3 in the aging retarda-
tion associated with CR in mammals.
AHL is a universal feature of mammalian aging and is the
most common sensory disorder in the elderly (Someya and
Prolla, 2010; Liu and Yan, 2007). AHL is characterized by an
age-associated decline of hearing function associated with
loss of spiral ganglion neurons and sensory hair cells in the
cochlea of the inner ear (Someya and Prolla, 2010; Liu and
Yan, 2007). The progressive loss of neurons and hair cells in
the inner ear leads to the onset of AHL because these postmi-
totic cells do not regenerate in mammals. The onset of AHL
begins in the high-frequency region and spreads toward the
low-frequency region during aging (Keithley et al., 2004; Hunter
and Willott, 1987). This is accompanied by the loss of neurons
and hair cells beginning in the basal region and spreading
toward the apex of the cochlea of the inner ear with age.
A previous study has shown that CR slows the progression of
AHL in CBA/J mice (Sweet et al., 1988), whereas we have
shown previously that CR prevents AHL in C57BL/6J mice,
reduces cochlear degeneration, and induces Sirt3 in the
cochlea (Someya et al., 2007). Both strains of mice have been
extensively used as a model of AHL, although the age of onset
of AHL varies from 12–15 months of age in C57BL/6J mice to
18–22 months of age in CBA/J mice (Zheng et al., 1999). Exper-
imental evidence suggests that oxidative stress plays a major
role in AHL (Jiang et al., 2007; Someya et al., 2009) and that
CR protects cochlear cells through reduction of oxidative
damage and/or by enhancing cellular antioxidant defenses to
oxidative stress (Someya et al., 2007). Yet, the molecular mech-
anisms by which CR reduces oxidative cochlear cell damage
remain unknown.
In this report, we show that the mitochondrial deacetylase
Sirt3 is required for the CR-mediated prevention of AHL in
mice. We also show that Sirt3 is required for the reduction of
oxidative damage in multiple tissues under CR conditions, as
evidenced by DNA damage levels. At the mechanistic level,
Sirt3 directly deacetylates isocitrate dehydrogenase 2 (Idh2),
an enzyme that converts NADP+ to NADPH in mitochondria.
In response to CR, Sirt3 stimulates Idh2 activity in mitochon-
dria, leading to increased levels of NADPH and an increased
ratio of reduced glutathione/oxidized glutathione, the major
redox couple in the cell. In cultured cells, overexpression of
Sirt3 and/or Idh2 increases NADPH levels and protects these
cells from oxidative stress. The data presented here provide
the first conclusive evidence that CR-mediated reduction of
oxidative damage and prevention of a common age-related
phenotype (AHL) require a member of the sirtuin family in
mammals.
RESULTS
Sirt3 Is Required for the CR-Mediated Preventionof Age-Related Cochlear Cell Death and Hearing LossFirst, to investigate whether Sirt3 plays a role in the CR preven-
tion of AHL, we conducted a 10 month CR dietary study using
WT and Sirt3�/� mice that have been backcrossed onto the
C57BL/6J background. The C57BL/6J strain is considered an
excellent model to study the anti-aging action of CR because
this mouse strain is the most widely used mouse model for the
study of aging and responds to CR with a robust extension of
life span (Weindruch and Walford, 1988) and prevention of AHL
(Someya et al., 2007). We reduced the calorie intake of WT and
Sirt3�/� mice to 75% (a 25% CR) of that fed to control diet
(CD) mice in early adulthood (2 months of age), and this dietary
regimen was maintained until 12 months of age. The auditory
brainstem response (ABR), a common electrophysiological test
of hearing function, was used to monitor the progression of
AHL in these mice (Someya et al., 2009). We first confirmed
that aging resulted in increased ABR hearing thresholds at the
high (32 kHz), middle (16 kHz), and low (8 kHz) frequencies in
12-month-old WT mice (Figure 1A), indicating that these mice
displayed hearing loss. As predicted, CR delayed the progres-
sion of AHL at all tested frequencies in WT mice (Figure 1A).
Strikingly, CR did not delay the progression of AHL in Sirt3�/�
mice (Figure 1A), although CR had the same effect on body
weight reduction in both WT and Sirt3�/� mice (Figures S2A
and S2B available online). Neural and hair cell degeneration
are hallmarks of AHL (Keithley et al., 2004). In agreement with
the hearing test results, basal regions of the cochleae from
calorie-restricted WT mice displayed only minor loss of spiral
ganglion neurons (Figures 1J and 1K; see also Figures 1B, 1C,
1F and 1G) and hair cells (Figure S1E; see also Figures S1A
and S1C), whereas CR failed to protect these cells in Sirt3�/�
mice (Figures 1L and 1M; see also Figures 1D, 1E, 1H, and 1I;
Figure S1F; see also Figures S1B and S1D). Collectively, these
results demonstrate that Sirt3 plays an essential role in the CR-
mediated prevention of age-related cochlear cell death and
hearing loss in mice.
Next, to investigate whether Sirt3 plays a role in the metabolic
effects induced by CR, we conducted a 3 month CR dietary
study using WT and Sirt3�/� mice starting at 2 months of age.
Mice lacking the Sirt3 gene appeared phenotypically normal
under basal and CR conditions: Sirt3�/� mice were viable
and fertile, and no significant changes were observed in
body weight (Figures S2A and S2B), bone mineral density (Fig-
ure S2C), body fat (Figure S2D), tissue weight (Figure S2E),
serum glucose levels (Figure S3A), glucose tolerance (Fig-
ure S3B), serum Igf-1 (Figure S3C), and cholesterol (Figure S3D)
levels between control diet WT and Sirt3�/� mice or calorie-
restricted WT and Sirt3�/� mice at 5 months of age. However,
though we found that WT mice displayed lower levels of serum
insulin (Figure S3E) and triglycerides (Figure S3F) in response
to CR, no significant changes were observed in these serum
markers between control diet-fed and calorie-restricted Sirt3�/�
Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc. 803
mice, suggesting a possible role of Sirt3 in metabolic adapta-
tions to CR.
Sirt3 Is Required for the CR-Mediated Reductionof Oxidative Damage in Multiple TissuesHow does Sirt3 reduce cochlear cell degeneration and slow the
progression of AHL in response to CR? It is well established that
CR reduces oxidative damage to DNA, proteins, and lipids in
multiple tissues in mammals (Sohal and Weindruch, 1996;
Masoro, 2000; Hamilton et al., 2001). Hence, we hypothesized
that Sirt3 may play a role in the CR-mediated reduction of oxida-
tive damage in the cochlea and other tissues. To test this hypoth-
esis, we measured oxidative damage to DNA in the cochleae,
brain (neocortex), and liver of control diet and calorie-restricted
WT and Sirt3�/� mice at 12 months of age. We found that CR
reduced oxidative DNA damage in WT mice, as determined by
measurements of 8-hydroxyguanosine and apurinic/aprimidinic
(AP) sites, but failed to reduce oxidative DNA damage in tissues
from Sirt3�/� mice (Figures 2A and 2B). In agreement with the
oxidative damage results, CR increased spiral ganglion neuron
survival (Figure 2C), outer hair cell survival (Figure 2D), and inner
hair cell survival (Figure 2E) in the basal regions of the cochleae of
WT mice, whereas CR failed to protect these cells in Sirt3�/�
Thre
shol
d (d
B SP
L)
WT
Frequency (kHz)
C
MK
E
IG
2 m
o C
D12
mo
CD
12
mo
CR
B
F
J
D
H
L
WT Sirt3-/-WT Sirt3
-/-
A
0
25
50
75
100
8 16 32
2mo CD12mo CD12mo CR
0
25
50
75
100
8 16 32
2mo CD12mo CD12mo CR
Sirt3-/-
**
*
****
**
**
*
Figure 1. CR Prevents AHL and Protects
Cochlear Neurons in WT Mice, but Not in
Sirt3�/� Mice
(A) ABR hearing thresholds were measured at 32,
16, and 8 kHz from control diet and/or calorie-
restricted WT (left) and Sirt3�/� (right) mice at
2 and 12 months of age (n = 9–12). *Significantly
different from 2-month-old WT or Sirt3�/� mice
(p < 0.05), **significantly different from 12-month-
old WT mice (p < 0.05). CD, control diet; CR,
calorie restricted diet.
(B–M) Neurons in the basal cochlear regions from
WT mice in control diet at 2 (B and C) and 12
(F and G) months of age and calorie-restricted
diet at 12 months of age (J and K). Neurons from
control diet Sirt3�/� mice at 2 (D and E) and 12
(H and I) months of age and calorie-restricted
Sirt3�/� mice at 12 months of age (L and M)
(n = 5). Arrows in the lower-magnification photos
indicate neuron regions. Scale bars, 100 mm (B,
F, J, D, H, and L) and 20 mm (C, G, J, E, I, and M).
Data are means ± SEM. See also Figure S1, Fig-
ure S2, and Figure S3.
mice (Figures 2C–2E). Together, these
results provide evidence that Sirt3 plays
an essential role in the CR-mediated
reduction of oxidative DNA damage in
multiple tissues.
Sirt3 Enhances the MitochondrialGlutathione Antioxidant DefenseSystem in Response to CRA previous study has shown that overex-
pression of Sirt3 increased mRNA
expression of the antioxidant genes
manganese superoxide dismutase (MnSOD) and catalase (Cat)
in primary cardiomyocytes and that Sirt3�/� primary cardiomyo-
cytes displayed higher levels of ROS compared to those of WT
cells (Sundaresan et al., 2009), suggesting that Sirt3 may regu-
late the antioxidant systems. Glutathione acts as the major small
molecule antioxidant in cells (Anderson, 1998; Halliwell and Gut-
teridge, 2007; Marı et al., 2009; Rebrin et al., 2003), and NADPH-
dependent glutathione reductase regenerates reduced gluta-
thione (GSH) from oxidized glutathione (GSSG) (Anderson,
1998; Marı et al., 2009). In healthy mitochondria from young
mice, glutathione is found mostly in the reduced form, GSH
(Marı et al., 2009). During aging, oxidized glutathione accumu-
lates, and hence an altered ratio of mitochondrial GSH to
GSSG is thought to be a marker of both oxidative stress and
aging (Rebrin et al., 2003; Schafer and Buettner, 2001; Marı
et al., 2009). Thus, we hypothesized that Sirt3 may regulate the
mitochondrial glutathione antioxidant system under CR condi-
tions. To test this hypothesis, we measured the ratio of
GSH:GSSG in the mitochondria of the inner ear, brain, and liver
of control diet and calorie-restricted WT and Sirt3�/� mice at
5 months of age. Mitochondrial GSSG levels decreased during
CR in the inner ear from WT mice, but not fromSirt3�/� mice (Fig-
ure 3B; see also Figure 3C). We also found that the ratios of
804 Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc.
GSH:GSSG in mitochondria increased during CR in all of the
tested WT tissues (Figure 3A); however, CR failed to increase
the ratios of GSH:GSSG in Sirt3�/� tissues (Figure 3A). These
results are consistent with the histological, cochlear cell count-
ing, and oxidative DNA damage results that demonstrated that
CR reduces oxidative damage in WT tissues, but not in the
Sirt3�/� tissues. Thus, during CR, Sirt3 promotes a more reduc-
tive environment in mitochondria of multiple tissues, thereby
enhancing the glutathione antioxidant defense system.
Sirt3 Stimulates Idh2 Activity and Increases NADPHLevels in Mitochondria in Response to CREnzymes of mitochondrial antioxidant pathways require NADPH
to perform their reductive functions. NADP+-dependent Idh2
from mitochondria converts NADP+ to NADPH, thereby pro-
moting regeneration of GSH by supplying NADPH to glutathione
reductase (Jo et al., 2001). A previous in vitro study suggested
that Idh2 might be a target of Sirt3, as incubation of Sirt3 with iso-
citrate dehydrogenase led to an apparent increase in dehydro-
genase activity (Schlicker et al., 2008). Thus, we hypothesized
that, in response to CR, the mitochondrial deacetylase Sirt3
might directly deacetylate and activate Idh2, thereby regulating
the levels of NADPH and, consequently, the glutathione antioxi-
dant defense system.
To provide initial support for the hypothesis that Sirt3 regulates
Idh2 activity through deacetylation, we measured the acetylation
levels of Idh2 in the liver mitochondria of WT and Sirt3�/� mice
fed control and CR diets. In WT tissues, acetylation of Idh2
was substantial in the control diet fed tissues, but CR induced
an 8-fold decrease in acetylation (Figures 4A and 4B). Robust
acetylation of Idh2 was observed in Sirt3�/� mice from both
A
AP S
ites/
105
bpD
NA
Cochlea Brain
8-ox
odG
uo/1
06dG
uo
B Liver
C
OH
Cel
ls (%
)
D
Basal Region
020406080
100
WT Sirt3-/-
CDCR
020406080
100
WT Sirt3-/-
CDCR
0
8
16
24 CDCR
*
Neu
rons
/mm
2
**
IH C
ells
(%)
E
01000200030004000
WT Sirt3-/-0
1000200030004000
WT Sirt3-/-
CDCR
01000200030004000
Middle Region Apical Region
Basal Region Middle Region Apical Region
0
25
50
75
100
WT Sirt3-/-
CDCR
0
25
50
75
100
WT Sirt3-/-0
25
50
75
100
Basal Region Middle Region Apical Region
0
25
50
75
100 CDCR
0
25
50
75
100
0
25
50
75
100
*
*
*
* *
*
*
WT Sirt3-/- WT Sirt3-/-WT Sirt3-/-
WT Sirt3-/-WT Sirt3-/-WT Sirt3-/-
WT Sirt3-/-WT Sirt3-/-WT Sirt3-/-
WT Sirt3-/-WT Sirt3-/-WT Sirt3-/-
Figure 2. CR Reduces Oxidative DNA Damage and Increases Cell
Survival in the Cochleae from WT Mice, but Not from Sirt3�/� Mice
(A) Oxidative damage to DNA (apurinic/apyrimidinic sites) was measured in the
cochlea and neocortex from control diet and calorie-restricted WT andSirt3�/�
mice at 12 months of age (n = 4–5). AP sites, apurinic/apyrimidinic sites.
*Significantly different from 12-month-old WT mice (p < 0.05).
(B) Oxidative damage to DNA (8-oxodGuo) was measured in the liver from
control diet and calorie-restricted WT and Sirt3�/� mice at 12 months of age
(n = 4–5).
(C) Neuron survival (neuron density) of basal, middle, and apical cochlear
regions was measured from control diet and calorie-restricted WT andSirt3�/�
mice at 12 months of age (n = 4–5).
(D) OH (outer hair) cell survival (%) of basal, middle, and apical cochlear
regions was measured from control diet and calorie-restricted WT andSirt3�/�
mice at 12 months of age (n = 4–5).
(E) IH (inner hair) cell survival (%) of basal, middle, and apical cochlear regions
was measured from control diet and calorie-restricted WT and Sirt3�/� mice at
12 months of age (n = 4–5).
Data are means ± SEM. See also Figures 1B–1M.
A Inner Ear
GSH
:GSS
G
(nm
ole/
mg
prot
ein)
0
40
80
120
WT Sirt3-/-
CDCR*
B
GSS
G
(n
mol
e/m
g pr
otei
n)
Brain Liver
Inner Ear Brain Liver
C
GSH
(n
mol
e/m
g pr
otei
n)
Inner Ear Brain Liver
0
40
80
120
WT Sirt3-/-
*
0
5
10
15
20
0.0
0.3
0.5
0.8
1.0
WT Sirt3-/-
0
5
10
15
20 CDCR
0
40
80
120
0.0
0.3
0.5
0.8
1.0
0
10
20
30
40
*
0.0
0.2
0.4
0.6
WT Sirt3-/-
CDCR
*
WT Sirt3-/-WT Sirt3-/-WT Sirt3-/-
WT Sirt3-/-WT Sirt3-/-WT Sirt3-/-
WT Sirt3-/-WT Sirt3-/-WT Sirt3-/-
Figure 3. Sirt3 Increases the Ratios Of GSH:GSSG in Mitochondria
during CR(A–C) Ratios of GSH:GSSG (A), GSSG (B), and GSH (C) were measured in the
inner ear, brain (neocortex), and liver from control diet and calorie-restricted
WT and Sirt3�/� mice at 5 months of age (n = 4–5). *Significantly different
from 12- or 5-month-old WT mice (p < 0.05). Data are means ± SEM.
Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc. 805
control and CR diet-fed conditions, indicating that Sirt3 is
required for the CR-induced deacetylation of Idh2 (Figures 4A
and 4B). As predicted, CR induced Sirt3 protein levels that
were approximately three times higher than those observed
with control diet tissues in WT mice (Figure 4C).
To establish whether Idh2 activity is stimulated by Sirt3 under
CR conditions, we measured Idh2 activity in the mitochondria
from the liver, inner ear, and brain of control diet and calorie-
restricted WT and Sirt3�/� mice. We found that Idh2 activity
significantly increased during CR in all of the WT tissues (Fig-
ure 4D); however, CR failed to increase Idh2 activity in the
Sirt3�/� tissues (Figure 4D). If CR can induce a Sirt3-dependent
increase in Idh2 activity, we anticipated increased levels of
NADPH, providing the primary source of reducing equivalents
for the glutathione antioxidant system (Jo et al., 2001; Schafer
and Buettner, 2001). To test this hypothesis, we measured
NADPH levels in mitochondria of WT and Sirt3�/� mice. We
found that levels of NADPH increased during CR in all tissues
tested from WT mice (Figure 4E); however, no significant
changes in NADPH levels were observed between control diet
and CR Sirt3�/� tissues. Collectively, these results provide
evidence that, during CR, Sirt3 induces the deacetylation and
activation of Idh2, leading to increased levels of NADPH in
mitochondria of multiple tissues. We note that we observed
a reduction in Idh2 activity in liver from Sirt3�/� mice fed the
control diet and that this correlates with a slightly increased
level of acetylated Idh2 as compared to WT mice (Figure 4B).
However, we did not observe reduced Idh2 activity or reduced
NADPH levels in the inner ear or brain of Sirt3�/� mice. We
postulate that, under basal conditions (control diet fed), addi-
tional factors regulate mitochondrial Idh2 activity and NADPH
levels.
To provide direct evidence that Sirt3 deacetylates Idh2,
a number of biochemical experiments were performed.
Although most enzyme:substrate reactions are necessarily
transient interactions to promote rapid turnover, coimmunopre-
cipitation (co-IP) experiments can sometimes trap these inter-
actions. Co-IP experiments were performed in human kidney
cells (HEK293) cotransfected with Sirt3 and Idh2. We found
that precipitated Idh2-FLAG was able to co-IP Sirt3-HA (Fig-
ure 5A), whereas precipitated Sirt3-FLAG was able to co-IP
Idh2-MYC (Figure 5B), suggesting that a physical interaction
can occur between Sirt3 and Idh2 in human cells. However,
co-IP experiments do not prove a direct functional interaction.
To provide support for a functional interaction between Sirt3
and acetylated Idh2, deacetylation assays were carried out in
HEK293 cells (Figure 5C) and in vitro using purified components
(Figure 5D). Utilizing HEK293 cells, Idh2 was cotransfected with
or without Sirt3, isolated by immunoprecipitation with anti-MYC
antibody followed by western blotting with anti-acetyl-lysine
antibody. Coexpression with Sirt3 induced the deacetylation
of Idh2 to background levels (Figure 5C). For the in vitro anal-
ysis, acetylated Idh2 was prepared (see Figure S4 and Experi-
mental Procedures) and utilized as a substrate for purified
recombinant Sirt3 or Sirt5. Acetylation status was assessed
by western blotting with anti-acetyl-lysine antibody (Figure 5D),
and the resulting change in Idh2 activity was measured sepa-
rately (Figure 5E). We found that Sirt3, but not Sirt5, deacety-
lated IDH2 in an NAD+-dependent fashion (Figure 5E). The
corresponding Idh2 activity measurements indicated that de-
acetylation by Sirt3, but not Sirt5, stimulated Idh2 activity
by �100% (Figure 5E). Together, these data provide strong
biochemical evidence that Sirt3 deacetylates and stimulates
Idh2 activity and increases NADPH levels in mitochondria in
response to CR.
Inner Ear BrainLiver
0.0
0.2
0.4
0.6
WT Sirt3-/-
CDCR
0.0
0.2
0.4
0.6
0.8 CDCR* *
0.0
0.2
0.4
0.6
WT Sirt3-/-
CDCR
*
IDH
2 Ac
tivity
(μ
M/s
/μg
prot
ein)
D
A
NAD
PH/to
tal N
ADP
E Inner Ear BrainLiver
0.0
0.3
0.5
0.8
1.0
0.0
0.3
0.5
0.8
1.0
0.0
0.3
0.5
0.8
1.0 CDCR
*
*
*
Rel
ativ
e ID
H2
Acet
ylat
ion
Leve
l (%
)
C
WT
WB: -IDH2
CD
INPUT
WB: -Sirt3
WB: -IDH2
WB: -AcKIP: -IDH2
CR CD CRSirt3-/-
WT Sirt3-/- WT Sirt3-/-WT Sirt3-/-
WT Sirt3-/- WT Sirt3-/-WT Sirt3-/-
*
Rel
ativ
e Si
rt3 P
rote
in
Leve
l
B
0.01.0
2.03.0
4.0
CD CR
*
WT
0
50
100
150
200
WT Sirt3-/-
CDCR
WT Sirt3-/-
*
*
CD CR
Figure 4. Sirt3 Increases Idh2 Activity and NADPH Levels in Mito-
chondria by Decreasing the Acetylation State of Idh2 during CR
(A) (Top) Western blot analysis of Sirt3 and Idh2 levels in the liver from 5-month-
old WT or Sirt3�/� fed either control or calorie-restricted diet. (Bottom) Endog-
enous acetylated Idh2 was isolated by immunoprecipitation with anti-Idh2
antibody followed by western blotting with anti-acetyl-lysine antibody (n = 3).
(B and C) Quantification of the amounts of total Idh2 acetylation (B) and Sirt3
protein (C) from (A). Western blot was normalized with Idh2 levels or Sirt3 levels
quantified and analyzed by Image software (n = 3).
(D) Idh2 activities were measured in the liver, inner ear (cochlea), and brain
(neocortex) from control diet and calorie-restricted WT and Sirt3�/� mice at
5 months of age (n = 3–5).
(E) Ratios of NADPH:total NADP (NADP+ + NADPH) were measured in the liver,
inner ear, and brain (neocortex) from control diet and caloric restricted WT and
Sirt3�/� mice at 5 months of age (n = 3–5). *Significantly different from control
diet fed WT mice (p < 0.05).
Data are means ± SEM.
806 Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc.
Overexpression of Sirt3 and/or Idh2 Increases NADPHLevels and Protects Cells from OxidativeStress-Induced Cell DeathOur physiological, histological, and biochemical results indicate
that Sirt3 mediates reduction of oxidative damage by deacetyla-
tion and stimulating the activity of Idh2, which increases NADPH
levels for antioxidant systems in mitochondria during CR. To
provide support for this mechanism, we investigated whether
Sirt3 and Idh2 are sufficient to alter the NADPH levels in cultured
cells. HEK293 cells stably transfected with vector, Sirt3, Idh2, or
Sirt3 with Idh2 were generated, and their NADPH levels were
measured. NADPH levels were significantly increased when
either Idh2 or Sirt3 or both proteins were stably overexpressed
in HEK293 cells (Figures 6A and 6B). Importantly, overexpres-
sion of both Sirt3 and Idh2 yielded a greater increase in NADPH
levels than either Sirt3 or Idh2 overexpressed alone (Figure 6A).
Finally, to investigate whether overexpression of Sirt3, Idh2, or
Sirt3 with Idh2 can protect cells from oxidative stress, the four
HEK293 cell lines were treated with oxidants H2O2 (hydrogen
peroxide) (Figure 6C) or menadione (Figure 6D), and cell viability
was measured. Overexpression of Sirt3 or Idh2 was sufficient to
protect cells from oxidative stress induced by both oxidants
(Figures 6C and 6D). Again, overexpression of both Sirt3 and
Idh2 led to higher cell viability than either Sirt3 or Idh2 overex-
pressed alone (Figures 6C and 6D). These results provide strong
biochemical evidence that Sirt3 mediates reduction of oxidative
stress by stimulating Idh2 activity and increasing NADPH levels
under stress conditions.
DISCUSSION
Sirt3 Reduces Oxidative Damage and Enhancesthe Glutathione Antioxidant Defense System underCR ConditionsA widely accepted hypothesis of how aging leads to age-related
hearing loss is through the accumulation of oxidative damage in
the inner ear (Someya and Prolla, 2010; Liu and Yan, 2007). In
support of this hypothesis, oxidative protein damage increases
in the cochlea of CBA/J mice (Jiang et al., 2007), and oxidative
DNA damage increases in the cochlea of C57BL/6J mice during
aging (Someya et al., 2009). Age-related hair cell loss is also
enhanced in mice lacking the antioxidant enzyme superoxide
dismutase 1 (McFadden et al., 1999), whereas the same mutant
animals show enhanced susceptibility to noise-induced hearing
loss (Ohlemiller et al., 1999). We have shown recently that over-
expression of mitochondrially targeted catalase delays the onset
of AHL in C57BL/6J mice, reduces hair cell loss, and reduces
oxidative DNA damage in the inner ear (Someya et al., 2009).
Of interest, overexpression of catalase in the mitochondria leads
to extension of life span in C57BL/6J mice, but overexpression
of catalase in the peroxisome or nucleus does not (Schriner
et al., 2005). Under normal conditions, catalase decomposes
A
IDH2-FLAG -Sirt3-HA +
WB: -HAINPUT
WB: -FLAG
IP
WB: -HA
α-IgG α-FLAG
++ -
+B
Sirt3-FLAG -IDH2-MYC +
WB: -MYCINPUT
WB: -FLAG
IP
WB: -MYC
α-IgG α-FLAG
++ -
+
C
Sirt3-FLAG -IDH2-MYC +
WB: -MYC
INPUT
WB: -AcK
WB: -FLAG
++
IP: α-MYC
NAD+ -IDH2-FLAG +
WB: -FLAG
COOMASSIE BLUE
WB: -AcK
++
IP: α-FLAG
D
SIRTUIN - --+ +
+Sirt3
-+ +
+Sirt5
E
Rel
ativ
e ID
H2
Activ
ity (%
)
Sirt3 Sirt5
050
100150200250
IDH
2
IDH
2+N
AD
IDH
2+Si
rt3
IDH
2+Si
rt3+N
AD
IDH
2+Si
rt5
IDH
2+Si
rt5+N
AD
*
Figure 5. Sirt3 Directly Deacetylates Idh2
and Stimulates Activity
(A and B) Sirt3 interacts with Idh2. Idh2 or Sirt3
were immunoprecipitated from HEK293 cell
lysates with IgG antibody or FLAG beads. Precip-
itated Idh2-FLAG was detected by anti-FLAG anti-
body, and co-IP Sirt3-HA was detected by anti-HA
as indicated (A). Precipitated Sirt3-FLAG was
detected by anti-FLAG antibody, and co-IP Idh2-
MYC was detected by anti-MYC as indicated (B)
(n = 3).
(C) Sirt3 deacetylates Idh2 in HEK293 cells. Idh2
was cotransfected with or without Sirt3, isolated
by immunoprecipitation with anti-MYC antibody
followed by western blotting with anti-acetyl-
lysine antibody (n = 3).
(D) Sirt3, but not Sirt5, deacetylates Idh2 in vitro.
Acetylated Idh2 was prepared as outlined in the
Experimental Procedures and was incubated
with purified recombinant Sirt3 or Sirt5 with or
without NAD+ at 37�C for 1 hr. Acetylation status
was assessed by western blotting with anti-
acetyl-lysine antibody (n = 3). An anti-FLAG
western shows that equivalent Idh2 protein levels
were used, and Coomassie staining shows puri-
fied Sirt3 and Sirt5.
(E) In vitro deacetylation of Idh2 by Sirt3, but not
Sirt5, stimulates Idh2 activity. Acetylated Idh2 in
buffer (Tris [pH 7.5], with or without 1 mM NAD,
and 1 mM DTT) was incubated with purified
50 nM Sirt3 or Sirt5 (Hallows et al., 2006) at
37�C for 1 hr, followed by Idh2 activity assay
(n = 3). *Significantly different from Idh2 alone
(p < 0.05).
Data are means ± SEM. See also Figure S4.
Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc. 807
hydrogen peroxide in the peroxisome, whereas in mitochondria,
hydrogen peroxide is decomposed into water by glutathione
peroxidase or peroxiredoxin (Finkel and Holbrook, 2000; Marı
et al., 2009). Hence, these results suggest that mitochondrial
ROS play a critical role in cochlear aging, AHL, and aging in
general.
We have demonstrated that Sirt3 mediates the CR reduction
of oxidative DNA damage in multiple tissues and that these
effects are likely to arise through an enhanced mitochondrial
glutathione antioxidant defense system. As discussed earlier,
the GSH:GSSG ratio is thought to be a marker of oxidative stress
(Rebrin and Sohal, 2008). Experimental evidence indicates that
aging results in a decrease in the ratio of GSH:GSSG in the mito-
chondria of brain, liver, kidney, eye, heart, and testis from aged
C57BL/6J mice due to elevated levels of GSSG, whereas CR
decreases the ratio of GSH:GSSG in the mitochondria of these
tissues by lowering GSSG levels (Rebrin et al., 2003, 2007).
Our findings demonstrate that CR increases these ratios of
GSH:GSSG in the mitochondria of brain, liver, and inner ear
from WT mice but fails to increase the ratios in the same tissues
from Sirt3�/� mice. Consistent with these results, CR reduced
oxidative DNA damage in tissues from WT mice but failed to
reduce such damage in tissues from Sirt3�/� mice. CR also
increased spiral ganglion neuron and hair cell survival in the
WT cochlea, but not in Sirt3�/� mice. Tissues that are composed
of postmitotic cells such as the brain and the inner ear are partic-
ularly vulnerable to oxidative damage because of their high
energy requirements and inability to undergo regeneration.
Therefore, we speculate that the Sirt3-mediated modulation of
C
Cel
l Via
bilit
y (%
)
B
pCDNA3-Sirt3-FLAG -pBabe-IDH2-FLAG
IDH2-FLAG
Sirt3-FLAG
INPUT
+-
+
WB: α-FLAG
-+-
+
A
[NA
DP
H] (
nmol
/mg
prot
ein)
0
60
120
180
VEC
Sirt3
IDH
2
Sirt3
+ID
H2
**
***
0
30
60
90
120
VEC
VEC
Sirt3
IDH
2
Sirt3
+ID
H2
0
30
60
90
120
VEC
VEC
Sirt3
IDH
2
Sirt3
+ID
H2
**
**
*
**
**
*
+- + + +1 mM H2O2 +- + + +
25 μM Menadione
Cel
l Via
bilit
y (%
)
D
Figure 6. Overexpression of Sirt3 and/or
Idh2 Is Sufficient to Increase NADPH Levels
and Protects HEK293 Cells from Oxidative
Stress
(A and B) (A) NADPH concentrations were sig-
nificantly increased when either Idh2 or Sirt3 or
both were stably overexpressed in HEK293 cells.
Measurements with errors are shown for the four
different stable cell populations from each type
of transfection (vector alone, Sirt3, Idh2, and
Sirt3 with Idh2) (n = 3). *Significantly different
from vector alone (p < 0.05); **Significantly dif-
ferent from Idh2 or Sirt3 (p < 0.05). (B) Western
blotting confirms Idh2 and Sirt3 stable expression.
(C and D) Sirt3 and/or Idh2 overexpression is suffi-
cient to protect HEK293 cells from the exogenous
oxidants hydrogen peroxide (H2O2) (C) and mena-
dione (D). The four different stable cells were tran-
siently exposed to either 1 mM H2O2 or 25 mM
menadione (n = 16).
Data are means ± SEM.
the glutathione antioxidant defense sys-
tem may play a central role in reduction
of oxidative stress in multiple tissues
under CR conditions, leading to aging
retardation. We also note that other mito-
chondrial effects of Sirt3, such as regula-
tion of fatty acid oxidation (Hirschey et al.,
2010) and modulation of complex I
activity (Ahn, et al., 2008), are likely to contribute to the metabolic
adaptations in response to CR.
Idh2 Regulates the Redox State of Mitochondria underCR ConditionsA large body of evidence indicates that the antioxidant defense
systems do not keep pace with the age-related increase in
ROS production, and thus the balance between antioxidant
defenses and ROS production shifts progressively toward
a more pro-oxidant state during aging (Sohal and Weindruch,
1996; Rebrin and Sohal, 2008). This balance is determined in
part by the ratios of interconvertible forms of redox couples,
such as GSH/GSSG, NADPH/NADP+, NADH/NAD+, thioredox-
inred/thioredoxinoxid, and glutaredoxinred/glutaredoxinoxid. The
GSH/GSSH couple is thought to be the primary cellular determi-
nant of the cellular redox state because its abundance is three to
four orders of magnitude higher than the other redox couples
(Rebrin and Sohal, 2008). NADPH is the reducing equivalent
required for the regeneration of GSH and the GSH-mediated
antioxidant defense system, which includes glutathione peroxi-
dases, glutathione transferases, and glutathione reductase,
playing a critical role in oxidative stress resistance (Halliwell
and Gutteridge, 2007). GSH is synthesized in the cytosol and
transported into the mitochondria through protein channels in
the outer mitochondrial membrane (Halliwell and Gutteridge,
2007; Anderson, 1998). Although GSH can cross the outer mito-
chondrial membrane through these channels, GSSG cannot be
exported into the cytosol (Olafsdottir and Reed, 1988). Thus,
GSSG is reduced to GSH by mitochondrial NADPH-dependent
808 Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc.
glutathione reductase, preventing accumulation of GSSG in the
mitochondrial matrix (Schafer and Buettner, 2001; Marı et al.,
2009). We have demonstrated that Sirt3 directly deacetylates
and activates Idh2 under CR conditions. In response to CR,
deacetylated Idh2 displays increased catalytic activity, which is
correlated with increased NADPH levels in the mitochondria of
multiple tissues from WT mice, but not from Sirt3�/� mice.
Hence, we speculate that Idh2 may be a major player in regu-
lating the redox state of mitochondria under CR conditions given
its role in mitochondrial NADPH production. A previous study
has shown that Idh2 is induced in response to ROS in mouse
fibroblasts, whereas decreased levels of Idh2 lead to higher
ROS and accumulation of oxidative damage to DNA and lipids
(Jo et al., 2001). Our in vitro findings demonstrate that overex-
pression of Sirt3 and/or Idh2 increases NADPH levels and
protects cells from oxidative stress-induced cell death. Thus,
these observations underlie a critical role for Idh2 in the genera-
tion of NADPH in mitochondria under conditions of CR, providing
reducing capacity for the glutathione antioxidant system and
increasing oxidative stress resistance.
A Role for Sirt3 in CR-Mediated Prevention of AHLThe mouse is considered a good model for the study of human
AHL because the mouse cochlea is anatomically similar to that
of humans (Steel et al., 1996; Steel and Bock, 1983). Most in-
bred mouse strains display some degree of AHL, and the age
of onset of AHL is known to vary from 3 months in DBA/2J
mice to more than 20 months in CBA/CaJ mice (Zheng et al.,
1999). The C57BL/6J mouse strain, which is the most widely
used mouse model for the study of aging, displays the classic
pattern of AHL by 12–15 months of age (Hunter and Willott,
1987; Keithley et al., 2004). We have previously shown that
AHL in C57BL/6J mice occurs through Bak-mediated apoptosis
and that it can be prevented by the intake of small molecule anti-
oxidants (Someya et al., 2009). We note that C57BL/6J and many
other mouse strains carry a specific mutation (Cdh23753A) in the
Cdh23 gene, which encodes a component of the hair cell tip
link, and this mutation is known to promote early onset of AHL
in these animals (Noben-Trauth et al., 2003). Of interest, the
Cdh23753A allele may increase the susceptibility to oxidative
stress in hair cells because a Sod1 mutation greatly enhances
AHL in mice carrying Cdh23753A, but not in mice wild-type for
Cdh23 (Johnson, et al., 2010). However, oxidative damage
increases with age in the cochlea of both C57BL/6J mice and
the CBA/J mouse strain that does not carry the Cdh23753A allele,
indicating that oxidative stress plays a role in AHL independent
of Cdh23 (Someya et al., 2009; Jiang et al., 2007; Zheng et al.,
1999). In both strains, the loss of hair cells and spiral ganglion
neurons begins in the base of the cochlea and spreads toward
the apex with age (Keithley et al., 2004; Hunter and Willott,
1987). Importantly, CR slows the progression of AHL in both
C57BL/6J and CBA/J strains (Someya et al., 2007; Sweet
et al., 1988). Therefore, the protective effects of Sirt3 in AHL
are likely to be of general relevance to AHL.
It is thought that some of the effects of CR in aging retardation
require significant reduction of body weight through reducing
food consumption. In agreement with this hypothesis, obesity
promotes a variety of age-related diseases, such as cardiovas-
cular disease, diabetes, high blood pressure, hypertension,
and certain cancers (Paeratakul et al., 2002; Poirier et al.,
2006). Obesity is also associated with an increased risk of
mortality (Poirier et al., 2006; Lee et al., 1993). Of interest, CR
failed to reduce oxidative damage in multiple tissues and slow
the progression of AHL in CR Sirt3�/� mice, despite the fact
that these mice were lean (Figures S2A and S2B). Thus, these
results suggest that weight loss may not be sufficient for the
anti-aging action of CR. Instead, we postulate that critical meta-
bolic effectors such as Sirt3 mediate the positive effects of CR.
ConclusionsIn summary, we propose that, in response to CR, Sirt3 activates
Idh2, thereby increasing NADPH levels in mitochondria. This in
turn leads to increased ratios of GSH:GSSG in mitochondria
and decreased levels of ROS, resulting in protection of inner ear
cells and prevention of AHL in mammals (Figure 7). Because we
observed similar effects of CR in the mitochondrial GSH/GSSG
ratios in multiple tissues, we postulate that this may be a major
mechanism of aging retardation by CR. We also postulate that
pharmaceutical interventions that induce Sirt3 activity in multiple
tissues will mimic CR by increasing oxidative stress resistance
and preventing the mitochondrial decay associated with aging.
EXPERIMENTAL PROCEDURES
Animals
Male and female Sirt3+/� mice were purchased from the Mutant Mouse
Resource Centers (MMRRC) at the University of North Carolina-Chapel Hill
Figure 7. A Model for the CR-Mediated Prevention of AHL in
Mammals
In response to CR, SIRT3 activates IDH2, thereby increasing NADPH levels in
mitochondria. This in turn leads to an increased ratio of GSH:GSSG and
decreased levels of ROS, thereby resulting in protection from oxidative stress
and prevention of AHL in mammals.
Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc. 809
(Chapel Hill, NC). In brief, these mice were created by generating embryonic
stem (ES) cells (Omni bank number OST341297) bearing a retroviral promoter
trap that functionally inactivates one allele of the Sirt3 gene (MGI, 2010).
Male and female C57BL/6J mice were purchased from Jackson Laboratory
(Bar Harbor, ME). Sirt3+/� mice have been backcrossed for four generations
onto the C57BL/6J background. All animal studies were conducted at the
AAALAC-approved Animal Facility in the Genetics and Biotechnology Center
of the University of Wisconsin-Madison. Experiments were performed in
accordance with protocols approved by the University of Wisconsin-Madison
Institutional Animal Care and Use Committee (Madison, WI).
Dietary Study
Details on the methods used to house and feed mice have been described
previously (Pugh et al., 1999). Mice are housed individually. Control diet (CD)
groups were fed 86.4 kcal/week of the precision pellet diet AIN-93M (BioServ,
Frenchtown, NJ), and caloric-restricted (CR) groups were fed 64.8 kcal/week
(a 25% CR) of the precision pellet diet AIN-93M 40%DR (BioServ, Frenchtown,
NJ). The schedule of feeding for control diet was 7 g on Mondays and Wednes-
days and 10 g on Fridays, whereas the schedule of feeding for calorie-
restricted diets was 5 g on Mondays and Wednesdays and 8 g on Fridays.
This dietary regimen was maintained from 2 months of age until 5 months of
age for a 3 month CR study and from 2 months of age until 12 months of
age for a 10 month CR study.
ABR Hearing Test
At 12 months of age, ABRs were measured with a tone burst stimulus at 8, 16,
and 32 kHz using an ABR recording system (Intelligent Hearing System, Miami,
FL) as previously described (Someya et al., 2009). Mice were anesthetized
with a mixture of xylazine hydrochloride (10 mg/kg, i.m.) (Phoenix Urology of
St. Joseph, St. Joseph, MO) and ketamine hydrochloride (40 mg/kg, i.m.)
(Phoenix Urology of St. Joseph).
Measurement of DNA Oxidation Levels
At 12 months of age, cochlea and neocortex were collected, and DNA was
extracted with ethanol precipitation. DNA concentrations for each sample
were adjusted to 0.1 mg/ml, and numbers of apurinic/apyrimidinic (AP) sites
were determined using the DNA Damage Quantification Kit (Dojindo, Rockville,
MD) and performed according to the manufacturer’s instructions and as previ-
ously described (Kubo et al., 1992; Meira, et al., 2009; McNeill and Wilson,
2007). Liver was also collected from the same mice, and 8-hydroxyguanosine
levels (8-oxo-7,8-20-deoxyguanosine/106 deoxyguanosine) in the DNA were
determined using a HPLC-ECD method as previously described (Hofer
et al., 2006).
Measurement of Total GSH and GSSG
Just after mitochondrial lysate preparation, 100 ml of the lysate was mixed with
100 ml of 10% metaphosphoric acid, incubated for 30 min at 4�C, and centri-
fuged at 14,000 3 g for 10 min at 4�C. The supernatant was used for the
measurements of mitochondrial glutathione contents. Total glutathione
(GSH + GSSG) and GSSG levels were determined by the method of Rahman
et al. (2006). All samples were run in duplicate. The rates of 2-nitro-5-thioben-
zoic acid formation were calculated, and the total glutathione (tGSH) and
GSSG concentrations in the samples were determined by using linear regres-
sion to calculate the values obtained from the standard curve. The GSH
concentration was determined by subtracting the GSSG concentration from
the tGSH concentration.
Idh2 Acetylation Analysis
Antibodies used for western blotting included anti-Idh2 antibody (Santa Cruz,
Santa Cruz, CA), anti-Sirt3 antibody (gift of Dr. Eric Verdin, UCSF), protein A/G
plus agarose (Santa Cruz, Santa Cruz, CA), and pan-acetylated lysine (gener-
ated following the procedure of Zhao, et al. [2010], GeneTel Laboratories LLC,
Madison, WI). For immunoprecipitation, liver mitochondria lysates were incu-
bated with anti-Idh2 antibody overnight at 4�C. Then protein A/G plus agarose
were added and incubated for 3 hr. After resins were washed, samples were
boiled with SDS loading buffer and subjected to western blotting (Smith
et al., 2009).
Idh2 Activity
Activities of Idh2 were measured by the Kornberg method (Kornberg, 1955). In
brief, 20 ml of the mitochondrial lysate sample was added in each well of a
96-well plate, and then 180 ml of a reaction mixture (33 mM KH2PO4dK2HPO4,
3.3 mM MgCl2, 167 mM NADP+, and 167 mM (+)-potassium Ds-threo-isocitrate
monobasic) was added in each well. The absorbance was immediately read at
340 nm every 10 s for 1 min in a microplate reader (Bio-Rad, Hercules, CA). All
samples were run in duplicate. The reaction rates were calculated, and the
Idh2 activity in the sample was defined as the production of one mmole of
NADPH per sec.
In Vitro Deacetylation Assay
Idh2-FLAG was transfected into HEK293 cells, which were then treated with
5 mM nicotinamide for 16 hr. Nicotinamide is a widely used sirtuin inhibitor.
Nicotinamide treatment leads to increased acetylation of Idh2, with a corre-
sponding decrease in enzymatic activity (Figure S4). Idh2 from cell lysates
was immunoprecipitated with anti-FLAG beads at 4�C for 2 hr, and then
Idh2-FLAG on beads was utilized in 200 ul deacetylation buffer (Tris
[pH 7.5], with or without 1 mM NAD, and 1 mM DTT) and incubated with puri-
fied 50 nM Sirt3 or Sirt5 (Hallows et al., 2006) at 37�C for 1 hr. Aliquots were
removed for Idh2 activity assay and western blotting with anti-FLAG antibody
or anti-acetyl-lysine antibody.
Statistical Analysis
All Statistical analyses were carried out by one-way ANOVA with post-Tukey
multiple comparison tests using the Prism 4.0 statistical analysis program
(GraphPad, San Diego, CA). All tests were two-sided with statistical signifi-
cance set at p < 0.05.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures, four
figures, and one table and can be found at doi:10.1016/j.cell.2010.10.002.
ACKNOWLEDGMENTS
We thank S. Kinoshita for histological processing. This research was sup-
ported by NIH grants AG021905 (T.A.P.) and GM065386 (J.M.D.), the National
Projects on Protein Structural and Functional Analyses from the Ministry of
Education, Culture, Sports, Science, and Technologies of Japan, and Marine
Bio Foundation.
Received: July 19, 2010
Revised: September 3, 2010
Accepted: September 30, 2010
Published online: November 18, 2010
REFERENCES
Ahn, B.H., Kim, H.S., Song, S., Lee, I.H., Liu, J., Vassilopoulos, A., Deng, C.X.,
and Finkel, T. (2008). A role for the mitochondrial deacetylase Sirt3 in regu-
lating energy homeostasis. Proc. Natl. Acad. Sci. USA 105, 14447–14452.
Anderson, M.E. (1998). Glutathione: an overview of biosynthesis and modula-
tion. Chem. Biol. Interact. 111-112, 1–14.
Balaban, R.S., Nemoto, S., and Finkel, T. (2005). Mitochondria, oxidants, and
aging. Cell 120, 483–495.
Barger, J.L., Kayo, T., Vann, J.M., Arias, E.B., Wang, J., Hacker, T.A., Wang,
Y., Raederstorff, D., Morrow, J.D., Leeuwenburgh, C., et al. (2008). A low
dose of dietary resveratrol partially mimics caloric restriction and retards aging
parameters in mice. PLoS ONE 3, e2264.
Bordone, L., Cohen, D., Robinson, A., Motta, M.C., van Veen, E., Czopik, A.,
Steele, A.D., Crowe, H., Marmor, S., Luo, J., et al. (2007). SIRT1 transgenic
mice show phenotypes resembling calorie restriction. Aging Cell 6, 759–767.
Chen, D., Steele, A.D., Lindquist, S., and Guarente, L. (2005). Increase in
activity during calorie restriction requires Sirt1. Science 310, 1641.
810 Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc.
Chen, D., Bruno, J., Easlon, E., Lin, S.J., Cheng, H.L., Alt, F.W., and Guarente,
L. (2008). Tissue-specific regulation of SIRT1 by calorie restriction. Genes Dev.
22, 1753–1757.
Cohen, H.Y., Miller, C., Bitterman, K.J., Wall, N.R., Hekking, B., Kessler, B.,
Howitz, K.T., Gorospe, M., de Cabo, R., and Sinclair, D.A. (2004). Calorie
restriction promotes mammalian cell survival by inducing the SIRT1 deacety-
lase. Science 305, 390–392.
Colman, R.J., Anderson, R.M., Johnson, S.C., Kastman, E.K., Kosmatka, K.J.,
Beasley, T.M., Allison, D.B., Cruzen, C., Simmons, H.A., Kemnitz, J.W., and
Weindruch, R. (2009). Caloric restriction delays disease onset and mortality
in rhesus monkeys. Science 325, 201–204.
Donmez, G., and Guarente, L. (2010). Aging and disease: connections to
sirtuins. Aging Cell 9, 285–290.
Finkel, T., and Holbrook, N.J. (2000). Oxidants, oxidative stress and the
biology of ageing. Nature 408, 239–247.
Finkel, T., Deng, C.X., and Mostoslavsky, R. (2009). Recent progress in the
biology and physiology of sirtuins. Nature 460, 587–591.
Halliwell, B., and Gutteridge, J.M.C. (2007). Free Radicals in Biology and Medi-
cine (New York, NY: Oxford University Press).
Hallows, W.C., Lee, S., and Denu, J.M. (2006). Sirtuins deacetylate and acti-
vate mammalian acetyl-CoA synthetases. Proc. Natl. Acad. Sci. USA 103,
10230–10235.
Hamilton, M.L., Van Remmen, H., Drake, J.A., Yang, H., Guo, Z.M., Kewitt, K.,
Walter, C.A., and Richardson, A. (2001). Does oxidative damage to DNA
increase with age? Proc. Natl. Acad. Sci. USA 98, 10469–10474.
Hirschey, M.D., Shimazu, T., Goetzman, E., Jing, E., Schwer, B., Lombard,
D.B., Grueter, C.A., Harris, C., Biddinger, S., Ilkayeva, O.R., et al. (2010).
SIRT3 regulates mitochondrial fatty-acid oxidation by reversible enzyme
deacetylation. Nature 464, 121–125.
Hofer, T., Seo, A.Y., Prudencio, M., and Leeuwenburgh, C. (2006). A method to
determine RNA and DNA oxidation simultaneously by HPLC-ECD: greater
RNA than DNA oxidation in rat liver after doxorubicin administration. Biol.
Chem. 387, 103–111.
Hunter, K.P., and Willott, J.F. (1987). Aging and the auditory brainstem
response in mice with severe or minimal presbycusis. Hear. Res. 30, 207–218.
Jiang, H., Talaska, A.E., Schacht, J., and Sha, S.H. (2007). Oxidative imbal-
ance in the aging inner ear. Neurobiol. Aging 28, 1605–1612.
Jo, S.H., Son, M.K., Koh, H.J., Lee, S.M., Song, I.H., Kim, Y.O., Lee, Y.S.,
Jeong, K.S., Kim, W.B., Park, J.W., et al. (2001). Control of mitochondrial redox
balance and cellular defense against oxidative damage by mitochondrial
NADP+-dependent isocitrate dehydrogenase. J. Biol. Chem. 276, 16168–
16176.
Johnson, K.R., Yu, H., Ding, D., Jiang, H., Gagnon, L.H., and Salvi, R.J. (2010).
Separate and combined effects of Sod1 and Cdh23 mutations on age-related
hearing loss and cochlear pathology in C57BL/6J mice. Hear. Res. 268, 85–92.
Keithley, E.M., Canto, C., Zheng, Q.Y., Fischel-Ghodsian, N., and Johnson,
K.R. (2004). Age-related hearing loss and the ahl locus in mice. Hear. Res.
188, 21–28.
Kornberg, A. (1955). Isocitric dehydrogenase of yeast (TPN). Methods Enzy-
mol. 1, 705–707.
Koubova, J., and Guarente, L. (2003). How does calorie restriction work?
Genes Dev. 17, 313–321.
Kubo, K., Ide, H., Wallace, S.S., and Kow, Y.W. (1992). A novel, sensitive, and
specific assay for abasic sites, the most commonly produced DNA lesion.
Biochemistry 31, 3703–3708.
Lee, I.M., Manson, J.E., Hennekens, C.H., and Paffenbarger, R.S., Jr. (1993).
Body weight and mortality. A 27-year follow-up of middle-aged men. JAMA
270, 2823–2828.
Lin, S.J., Defossez, P.A., and Guarente, L. (2000). Requirement of NAD and
SIR2 for life-span extension by calorie restriction in Saccharomyces cerevi-
siae. Science 289, 2126–2128.
Liu, X.Z., and Yan, D. (2007). Ageing and hearing loss. J. Pathol. 211, 188–197.
Marı, M., Morales, A., Colell, A., Garcıa-Ruiz, C., and Fernandez-Checa, J.C.
(2009). Mitochondrial glutathione, a key survival antioxidant. Antioxid. Redox
Signal. 11, 2685–2700.
Masoro, E.J. (2000). Caloric restriction and aging: an update. Exp. Gerontol.
35, 299–305.
Mattson, M.P. (2000). Apoptosis in neurodegenerative disorders. Nat. Rev.
Mol. Cell Biol. 1, 120–129.
McFadden, S.L., Ding, D., Reaume, A.G., Flood, D.G., and Salvi, R.J. (1999).
Age-related cochlear hair cell loss is enhanced in mice lacking copper/zinc
superoxide dismutase. Neurobiol. Aging 20, 1–8.
McNeill, D.R., and Wilson, D.M.I.I.I., III. (2007). A dominant-negative form of
the major human abasic endonuclease enhances cellular sensitivity to labora-
tory and clinical DNA-damaging agents. Mol. Cancer Res. 5, 61–70.
Meira, L.B., Moroski-Erkul, C.A., Green, S.L., Calvo, J.A., Bronson, R.T., Shah,
D., and Samson, L.D. (2009). Aag-initiated base excision repair drives alkyl-
ation-induced retinal degeneration in mice. Proc. Natl. Acad. Sci. USA 106,
888–893.
MGI. Sirt3Gt(OST341297)Lex. (2010). Available at http://www.informatics.jax.org/
searches/accession_report.cgi?id=MGI:3529767.
Noben-Trauth, K., Zheng, Q.Y., and Johnson, K.R. (2003). Association of cad-
herin 23 with polygenic inheritance and genetic modification of sensorineural
hearing loss. Nat. Genet. 35, 21–23.
Ohlemiller, K.K., McFadden, S.L., Ding, D.L., Flood, D.G., Reaume, A.G., Hoff-
man, E.K., Scott, R.W., Wright, J.S., Putcha, G.V., and Salvi, R.J. (1999). Tar-
geted deletion of the cytosolic Cu/Zn-superoxide dismutase gene (Sod1)
increases susceptibility to noise-induced hearing loss. Audiol. Neurootol. 4,
237–246.
Olafsdottir, K., and Reed, D.J. (1988). Retention of oxidized glutathione by iso-
lated rat liver mitochondria during hydroperoxide treatment. Biochim. Biophys.
Acta 964, 377–382.
Paeratakul, S., Lovejoy, J.C., Ryan, D.H., and Bray, G.A. (2002). The relation of
gender, race and socioeconomic status to obesity and obesity comorbidities
in a sample of US adults. Int. J. Obes. Relat. Metab. Disord. 26, 1205–1210.
Poirier, P., Giles, T.D., Bray, G.A., Hong, Y., Stern, J.S., Pi-Sunyer, F.X., and
Eckel, R.H. (2006). Obesity and cardiovascular disease: pathophysiology,
evaluation, and effect of weight loss. Arterioscler. Thromb. Vasc. Biol. 26,
968–976.
Pugh, T.D., Klopp, R.G., and Weindruch, R. (1999). Controlling caloric
consumption: protocols for rodents and rhesus monkeys. Neurobiol. Aging
20, 157–165.
Rahman, I., Kode, A., and Biswas, S.K. (2006). Assay for quantitative determi-
nation of glutathione and glutathione disulfide levels using enzymatic recycling
method. Nat. Protoc. 1, 3159–3165.
Rebrin, I., and Sohal, R.S. (2008). Pro-oxidant shift in glutathione redox state
during aging. Adv. Drug Deliv. Rev. 60, 1545–1552.
Rebrin, I., Kamzalov, S., and Sohal, R.S. (2003). Effects of age and caloric
restriction on glutathione redox state in mice. Free Radic. Biol. Med. 35,
626–635.
Rebrin, I., Forster, M.J., and Sohal, R.S. (2007). Effects of age and caloric
intake on glutathione redox state in different brain regions of C57BL/6 and
DBA/2 mice. Brain Res. 1127, 10–18.
Schafer, F.Q., and Buettner, G.R. (2001). Redox environment of the cell as
viewed through the redox state of the glutathione disulfide/glutathione couple.
Free Radic. Biol. Med. 30, 1191–1212.
Schlicker, C., Gertz, M., Papatheodorou, P., Kachholz, B., Becker, C.F., and
Steegborn, C. (2008). Substrates and regulation mechanisms for the human
mitochondrial sirtuins Sirt3 and Sirt5. J. Mol. Biol. 382, 790–801.
Schriner, S.E., Linford, N.J., Martin, G.M., Treuting, P., Ogburn, C.E., Emond,
M., Coskun, P.E., Ladiges, W., Wolf, N., Van Remmen, H., et al. (2005). Exten-
sion of murine life span by overexpression of catalase targeted to mitochon-
dria. Science 308, 1909–1911.
Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc. 811
Schwer, B., Eckersdorff, M., Li, Y., Silva, J.C., Fermin, D., Kurtev, M.V., Gial-
lourakis, C., Comb, M.J., Alt, F.W., and Lombard, D.B. (2009). Calorie restric-
tion alters mitochondrial protein acetylation. Aging Cell 8, 604–606.
Smith, B.C., Hallows, W.C., and Denu, J.M. (2009). A continuous microplate
assay for sirtuins and nicotinamide-producing enzymes. Anal. Biochem. 394,
101–109.
Sohal, R.S., and Weindruch, R. (1996). Oxidative stress, caloric restriction, and
aging. Science 273, 59–63.
Someya, S., Yamasoba, T., Weindruch, R., Prolla, T.A., and Tanokura, M.
(2007). Caloric restriction suppresses apoptotic cell death in the mammalian
cochlea and leads to prevention of presbycusis. Neurobiol. Aging 28, 1613–
1622.
Someya, S., Xu, J., Kondo, K., Ding, D., Salvi, R.J., Yamasoba, T., Rabinovitch,
P.S., Weindruch, R., Leeuwenburgh, C., Tanokura, M., and Prolla, T.A. (2009).
Age-related hearing loss in C57BL/6J mice is mediated by Bak-dependent
mitochondrial apoptosis. Proc. Natl. Acad. Sci. USA 106, 19432–19437.
Someya, S., and Prolla, T.A. (2010). Mitochondrial oxidative damage and
apoptosis in age-related hearing loss. Mech. Ageing Dev. 131, 480–486.
Steel, K.P., and Bock, G.R. (1983). Hereditary inner-ear abnormalities in
animals. Relationships with human abnormalities. Arch. Otolaryngol. 109,
22–29.
Steel, K.P., Moorjani, P., and Bock, G.R. (1996). Mixed conductive and senso-
rineural hearing loss in LP/J mice. Hear. Res. 28, 227–236.
Sundaresan, N.R., Samant, S.A., Pillai, V.B., Rajamohan, S.B., and Gupta,
M.P. (2008). SIRT3 is a stress-responsive deacetylase in cardiomyocytes
that protects cells from stress-mediated cell death by deacetylation of Ku70.
Mol. Cell. Biol. 28, 6384–6401.
Sundaresan, N.R., Gupta, M., Kim, G., Rajamohan, S.B., Isbatan, A., and
Gupta, M.P. (2009). Sirt3 blocks the cardiac hypertrophic response by aug-
menting Foxo3a-dependent antioxidant defense mechanisms in mice.
J. Clin. Invest. 119, 2758–2771.
Sweet, R.J., Price, J.M., and Henry, K.R. (1988). Dietary restriction and pres-
byacusis: periods of restriction and auditory threshold losses in the CBA/J
mouse. Audiology 27, 305–312.
Wallace, D.C. (2005). A mitochondrial paradigm of metabolic and degenerative
diseases, aging, and cancer: a dawn for evolutionary medicine. Annu. Rev.
Genet. 39, 359–407.
Weindruch, R., and Walford, R.L. (1988). The Retardation of Aging and Disease
by Dietary Restriction (Springfield, IL: Charles C Thomas Publishing, LTD).
Zhao, S., Xu, W., Jiang, W., Yu, W., Lin, Y., Zhang, T., Yao, J., Zhou, L., Zeng,
Y., Li, H., et al. (2010). Regulation of cellular metabolism by protein lysine acet-
ylation. Science 327, 1000–1004.
Zheng, Q.Y., Johnson, K.R., and Erway, L.C. (1999). Assessment of hearing in
80 inbred strains of mice by ABR threshold analyses. Hear. Res. 130, 94–107.
Zhu, H., Guo, Q., and Mattson, M.P. (1999). Dietary restriction protects hippo-
campal neurons against the death-promoting action of a presenilin-1 mutation.
Brain Res. 842, 224–229.
812 Cell 143, 802–812, November 24, 2010 ª2010 Elsevier Inc.
FOXO/4E-BP Signaling in DrosophilaMuscles Regulates Organism-wideProteostasis during AgingFabio Demontis1,* and Norbert Perrimon1,2,*1Department of Genetics2Howard Hughes Medical Institute
Harvard Medical School, 77 Avenue Louis Pasteur, Boston, MA 02115, USA
*Correspondence: [email protected] (F.D.), [email protected] (N.P.)DOI 10.1016/j.cell.2010.10.007
SUMMARY
The progressive loss of muscle strength during agingisa commondegenerativeevent of unclearpathogen-esis. Although muscle functional decline precedesage-related changes in other tissues, its contributionto systemic aging is unknown. Here, we show thatmuscle aging is characterized in Drosophila by theprogressive accumulation of protein aggregatesthat associate with impaired muscle function. Thetranscription factor FOXO and its target 4E-BP re-move damaged proteins at least in part via theautophagy/lysosome system, whereas foxo mutantshave dysfunctional proteostasis. Both FOXO and4E-BP delay muscle functional decay and extend lifespan. Moreover, FOXO/4E-BP signaling in musclesdecreases feeding behavior and the release of insulinfrom producing cells, which in turn delays the age-related accumulation of protein aggregates in othertissues. These findings reveal an organism-wideregulation of proteostasis in response to muscleaging and a key role of FOXO/4E-BP signaling in thecoordination of organismal and tissue aging.
INTRODUCTION
Aging of multicellular organisms involves distinct pathogenic
events that include higher mortality, the progressive loss of
organ function, and susceptibility to degenerative diseases,
some of which arise from protein misfolding and aggregation.
Recent genetic studies in the mouse, the nematode Caenorhab-
ditis elegans, and the fruitfly Drosophila melanogaster have
expanded our understanding of the evolutionarily conserved
signaling pathways regulating aging, with the identification of
several mutants that have prolonged or shortened life spans
(Kenyon, 2005). Manipulation of longevity-regulating pathways
in certain tissues is sufficient to extend life expectancy, indi-
cating that some tissues have a predominant role in life span
extension (Libina et al., 2003; Wang et al., 2005; Wolkow et al.,
2000). For example, foxo overexpression in the Drosophila fat
body extends life span, indicating a key role of this tissue in
the regulation of longevity (Giannakou et al., 2004; Hwangbo
et al., 2004). In addition, because most tissues undergo progres-
sive deterioration during aging (Garigan et al., 2002), it is thought
that organismal life span may be linked to tissue senescence.
However, our understanding of the mechanisms regulating
tissue aging and their interconnection to life span is limited. For
example, analysis in Drosophila has revealed that the prevention
of age-dependent changes in cardiac performance does not
alter life span (Wessells et al., 2004), raising the possibility that
functional decline in distinct tissues may have different
outcomes on the systemic regulation of aging.
The Insulin/IGF-1 signaling pathway has been implicated in the
control of aging across evolution via its downstream signaling
component FOXO (DAF-16 in C. elegans), a member of the
fork-head box O transcription factor family (Salih and Brunet,
2008). FOXO regulates the expression of a series of target genes
involved in metabolism, cell growth, cell proliferation, stress
resistance, and differentiation via direct binding to target gene
promoter regions (Salih and Brunet, 2008). Mutations in foxo/
daf-16 reduce life span and stress resistance in both C. elegans
and flies, indicating a key role in organism aging (Junger et al.,
2003; Salih and Brunet, 2008). In addition to regulating life
span, FOXO has been reported to prevent the pathogenesis of
some age-related diseases. For example, FOXO reduces the
toxicity associated with aggregation-prone human mutant
Alzheimer’s and Huntington’s disease proteins (proteotoxicity)
in C. elegans and mice, suggesting that regulating protein
homeostasis (proteostasis) during aging may have a direct effect
on the pathogenesis of human neurodegenerative diseases
(Cohen et al., 2006; Hsu et al., 2003; Morley et al., 2002).
However, little is known on the protective mechanisms induced
in response to FOXO signaling and whether they vary in different
aging tissues and disease contexts.
Among the plethora of age-related pathological conditions,
the gradual decay in muscle strength is one of the first hallmarks
of aging in many organisms, including Drosophila, C. elegans,
mice and, importantly, humans (Augustin and Partridge, 2009;
Herndon et al., 2002; Nair, 2005; Zheng et al., 2005). However,
despite its medical relevance, the mechanisms underlying
muscle aging are incompletely understood. Functional changes
in skeletal muscles temporally precede the manifestation of
Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc. 813
Figure 1. FOXO Signaling in Skeletal Muscles Preserves Proteostasis during Aging
(A–D) Electron micrographs of immunogold-labeled Drosophila skeletal muscles of wild-type flies at one (A and B) and 5 weeks of age (C and D). Protein
aggregates (PA) are detected in the cytoplasm in proximity to mitochondria (Mt) and myofibrils (Myof) in old (C and D) but not young flies (A and B). Numerous
gold particles (indicative of anti-ubiquitin immunoreactivity) localize to filamentous structures at 5 weeks of age (C and D), while only a few are present in muscles
from young flies. Scale bars are 1 mm (A and C) and 500 nm (B and D).
814 Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc.
aging in other tissues (Herndon et al., 2002), and reduced muscle
strength is associated with an increased risk in developing
Alzheimer’s and Parkinson’s diseases (Boyle et al., 2009; Chen
et al., 2005). However, although aging-related changes in
skeletal muscles have been proposed to affect physiological
processes in distal organs (Nair, 2005), whether or not muscle
senescence modulates the pathogenesis of degenerative events
in other tissues is unknown.
The fruit fly Drosophila is an excellent model to study muscle
aging. The progressive decline in muscle strength and function
observed in humans is recapitulated in this system (Rhodenizer
et al., 2008), which is amenable to extensive genetic manipula-
tion. By using this model organism, we have searched for the
molecular mechanisms responsible for muscle aging and
found that decreased protein quality control plays a role in the
pathogenesis of age-related muscle weakness. Interestingly,
increased activity of the transcription factor FOXO and its target
Thor/4E-BP are sufficient to delay this process and preserve
muscle function at least in part by promoting the basal activity
of the autophagy/lysosome system, an intracellular protein
degradation pathway that removes damaged protein aggregates
(Rubinsztein, 2006).
Moreover, we report that FOXO/4E-BP signaling in muscles
extends life span and regulates proteostasis organism-wide by
regulating feeding behavior, release of insulin from producing
cells, and 4E-BP induction in nonmuscle tissues. Thus, we
propose a model by which FOXO/4E-BP signaling in muscles
preserves systemic proteostasis by mimicking some of the
protective effects of decreased nutrient intake.
RESULTS
Loss of Proteostasis during Muscle AgingIs Prevented by FOXOTo detect cellular processes that are responsible for decreased
muscle strength in aging flies, we monitored cellular changes in
indirect flight muscles of wild-type flies by immunogold-electron
microscopy (IEM). In older flies, we detected filamentous cyto-
plasmic structures that were instead absent in muscles from
young flies (Figures 1A–1D). Filamentous materials present in
these structures stained with an anti-ubiquitin antibody (Fig-
ure 1D), a marker for proteins that are polyubiquitinated, sug-
gesting that the cytoplasmic structures are aggregates of
damaged proteins. Aggregates were variable in size and were
detected in both resin-embedded sections (Figure 1) and cryo-
sections (data not shown) of thoracic muscles of the old but
not the young flies, in parallel with an increase in the overall
number of gold particles (Figure 1E). To test the hypothesis
that muscle function during aging may decrease due to defects
in protein homeostasis, we better characterized the age-related
deposition of protein aggregates by immunofluorescence. In
agreement with the IEM analysis (Figures 1A–1E), we observed
that aging skeletal muscles progressively accumulate aggre-
gates of polyubiquitinated proteins (ranging up to several mm)
that colocalize with p62/Ref(2)P, an inclusion body component
(Figures 1F and1I). The cumulative area of protein aggregates
increases during aging (Figure 1L), suggesting that the progres-
sive protein damage, together with a decrease in the turnover of
muscle proteins, may result in the age-related decline of muscle
strength.
To better characterize how protein quality control is linked with
aging in muscles, we analyzed the deposition of protein
aggregates in syngenic flies with foxo overexpression. Foxo
overexpression results in its activation (Giannakou et al., 2004;
Hwangbo et al., 2004) and was achieved specifically in muscles
via the UAS-Gal4 system using the Mhc-Gal4 driver (see Fig-
ure S1 available online). Increased FOXO activity in muscles
did not affect developmental growth and differentiation (as esti-
mated by body weight and sarcomere assembly) (Figure S2), and
resulted in the delayed accumulation of aggregates containing
polyubiquitinated proteins and Ref(2)P during aging (Figures 1G
and 1J, compare with control muscles in Figures 1F and 1I).
Next, we tested whether foxo null animals display accelerated
muscle aging, and found an increased accumulation of protein
aggregates (Figures 1H and1K), indicating that FOXO is both
necessary and sufficient to modulate muscle proteostasis
(Figure 1L).
To further corroborate these findings, we overexpressed
either the wild-type or the constitutive-active foxo transgenes
using the Dmef2-Gal4 muscle driver in combination with the
temperature-sensitive tubulin-Gal80ts transgene to achieve
adult-onset foxo overexpression in muscles (Figure S3). Trans-
gene overexpression significantly preserved muscle proteosta-
sis in both cases, while the controls displayed an increased
accumulation of protein aggregates (Figure S3). All together,
these results indicate that protein homeostasis depends on
FOXO activity during muscle aging.
4E-BP Controls Proteostasis in Responseto Pten/FOXO ActivityTo dissect the stimuli that encroach on FOXO to control proteo-
stasis, we tested whether Pten overexpression phenocopies
FOXO activation. Consistent with its role in activating FOXO,
we found that Pten decreased the accumulation of protein
(E) The number of gold particles, indicative of ubiquitin immunoreactivity, significantly increases in old age (standard error of the mean [SEM] is indicated with n;
**p < 0.01).
(F–L) Immunostaining of indirect flight muscles from flies with (UAS-foxo/+;Mhc-Gal4/+) or without (Mhc-Gal4/+) foxo overexpression at 1 week (F and G) and
5 weeks of age (I and J), and foxo homozygous null (MhcGal4, foxo21/25) flies (H and K). Polyubiquitin (red) and p62/Ref(2)P (green) immunoreactivities reveal
an increased deposition of aggregates containing polyubiquitinated proteins during aging in muscles of control flies (F and I), and, to a lesser extent, in muscles
overexpressing foxo (G and J). Conversely, muscles from foxo null animals display an accelerated deposition of protein aggregates (H and K) in comparison with
controls (F and I). Note the significant increase in the cumulative area of protein aggregates (indicative of both aggregate size and number) in (K) versus (I), and in (I)
versus (J), indicating that the control of protein homeostasis is linked to FOXO activity in muscles (quantification in [L]) (SEM is indicated with n; *p < 0.05, **p <
0.01). Representative polyubiquitin and Ref(2)P immunoreactivities are shown in insets. Phalloidin staining (blue) outlines F-actin, which is a component of muscle
myofibrils. Scale bar is 20 mm (F–K).
See also Figure S1, Figure S2, and Figure S3.
Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc. 815
aggregates during aging (Figures 2B and 2E; see controls in
Figures 2A and 2D).
Next, we examined the responses induced by Pten/FOXO
signaling. First, we examined whether FOXO activity delays
protein damage by inducing chaperones that are key for protein
quality control (Tower, 2009). In response to FOXO activity in
muscles, we detected an increase in the mRNA levels of
Hsp70 and its cofactors involved in protein folding (Hip, Hop,
Hsp40, and Hsp90) but not in protein degradation (Chip and
Chap) (Figure S4 and Table S1). FOXO regulates directly the
expression of Hsp70 and its cofactors, as estimated with Lucif-
erase transcriptional reporters based on the proximal promoter
region of target genes (Figure S4 and Table S2). On this basis,
we tested whether Hsp70 overexpression preserves proteosta-
sis during aging but found little changes in the age-related accu-
mulation of protein aggregates (Figure S4). Thus, we conclude
that additional FOXO-dependent responses are involved.
Among the FOXO-target genes, Thor/4E-BP has a key role
in delaying aging by regulating protein translation (Zid et al.,
2009; Tain et al., 2009). However, the cellular mechanisms that
Figure 2. 4E-BP Preserves Proteostasis in Response to Pten/FOXO Signaling
(A–F) Immunostaining of muscles overexpressing Pten and constitutive active (CA) 4E-BP. In both cases, a decrease in the accumulation of polyubiquitin protein
aggregates is observed at 5 weeks of age in comparison with age-matched controls, suggesting that these interventions can preserve proteostasis in aging
muscles. Scale bar is 20 mm. Hsp70 overexpression has instead limited effects (Figure S4, Table S1, Table S2).
(G) A reduction in the cumulative area of protein aggregates is observed upon increased activity of either Pten or 4E-BP in comparison with controls (SEM is
indicated with n; **p < 0.01, ***p < 0.001).
(H) Relative quantification of Thor/4E-BP mRNA levels from thoraces of syngenic flies at 1 and 5 weeks of age. A significant increase in 4E-BP expression is
detected in response to fasting and Pten and FOXO activity (**p < 0.01, ***p < 0.001; SEM is indicated with n = 4).
816 Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc.
are regulated by 4E-BP are largely unknown. To test whether
4E-BP controls proteostasis during muscle aging, we overex-
pressed a constitutive active form of 4E-BP in muscles and
observed limited accumulation of protein aggregates during
aging (Figures 2C and 2F) compared with controls (Figures 2A
and 2D). All together, increased activity of Pten or 4E-BP sig-
nificantly decreases the cumulative area of protein aggregates
(Figure 2G).
In addition, a significant increase in 4E-BP mRNA levels is
induced in muscles upon Pten, foxo overexpression, and fasting
(Figure 2H). All together, these findings suggest that 4E-BP is key
to control proteostasis in response to Pten/FOXO signaling.
FOXO/4E-BP Signaling Regulates Proteostasis viathe Autophagy/Lysosome SystemWhile FOXO/4E-BP signaling mounts a stress resistance
response that may decrease the extent of protein damage due
to various stressors (Salih and Brunet, 2008; Tain et al., 2009),
we wondered whether it regulates the removal of damaged
proteins via macroautophagy. In this process, entire regions of
the cytoplasm are sequestered in a double membrane vesicle
(autophagosome) that subsequently fuses with a lysosome,
where the autophagic cargo is degraded (Rubinsztein, 2006).
Although the primary role of autophagy is to mount an adaptive
response to nutrient deprivation, its basal activity is required
for normal protein turnover (Hara et al., 2006). In agreement
with this notion, suppression of basal autophagy leads to the
accumulation of polyubiquitin protein aggregates in a number
of contexts (Korolchuk et al., 2009; Rubinsztein, 2006).
To test whether autophagy is regulated in response to FOXO
signaling in muscles, we used a GFP-tagged version of the
autophagosome marker Atg5 (Rusten et al., 2004). While the
number of Atg5-GFP punctae decreases during aging in control
muscles (Figures 3A and 3B), it is in part maintained in response
to foxo overexpression (Figures 3C and 3D, and quantification in
Figure 3E). In addition, given the interconnection between
the lysosome system and autophagy, we monitored a GFP-
tagged version of the lysosome marker Lamp1 (lysosome-asso-
ciated membrane protein 1) and detected an overall increase in
the number of GFP punctae in response to overexpression of the
autophagy inducer kinase Atg1, foxo, and 4E-BP CA in muscles
at both 1 and 5 weeks of age (Figures 3G–3I and 3K–3M in
comparison with controls in Figures 3F and 3J and quantification
in Figure 3N).
Closer inspection revealed that the abundance of Lamp1-GFP
vesicles inversely correlates with the progressive deposition of
polyubiquitin protein aggregates, suggesting that FOXO/4E-BP
signaling regulates proteostasis at least in part via the
autophagy/lysosome system. To further test this hypothesis,
we analyzed the age-related changes in autophagy gene expres-
sion, which have been previously used as a correlative measure-
ment of autophagic activity (Gorski et al., 2003; Simonsen et al.,
2008). Interestingly, the expression of several autophagy genes
involved in autophagosome induction (Atg1), nucleation (Atg6),
and elongation (Atg5, Atg7, and Atg8) progressively declines
during aging in muscles (Figure 3O), suggesting that gene
expression changes likely contribute to the accumulation of
damaged proteins. Conversely, foxo overexpression increased
the basal expression of several Atg genes at both young and
old age, suggesting that their increased expression contributes
to the beneficial effects of FOXO on proteostasis. To test this
hypothesis, we knocked down Atg7 levels in foxo-overexpress-
ing flies and analyzed the deposition of polyuiquitinated protein
aggregates. Interestingly, RNAi treatment brought about a
�50% decrease in Atg7 mRNA levels and resulted in a partial
increase in the buildup of insoluble ubiquitinated proteins at
8 weeks, compared with age-matched, mock-treated flies
(white RNAi) and 1-week-old flies (Figure 3P).
All together, these findings suggest that FOXO/4E-BP
signaling prevents the buildup in protein damage, at least in
part by promoting the basal activity of the autophagy/lysosome
system.
Prevention of Muscle Aging by FOXO and 4E-BPExtends Life SpanTo evaluate whether preserving proteostasis can prevent
functional alterations in aging muscles, we assessed muscle
strength with negative geotaxis and flight assays (see Experi-
mental Procedures). As shown in Figures 4A and 4B, muscle
functionality gradually decreases in aging flies, resulting in
impaired climbing and flight ability. Notably, foxo (Figure 4A)
and 4E-BP activity (Figure 4B) significantly preserve muscle
strength during aging. Thus, FOXO and 4E-BP prevent both
the cellular degenerative events and the functional decay of
aging muscles.
Epidemiological studies in humans have associated muscle
senescence with increased mortality (Nair, 2005), implying that
muscle aging may have organism-wide consequences beyond
muscle function. To ask whether the prevention of muscle aging
affects the organism life span, we manipulated the activity of
components of the Akt pathway in muscles and scored for their
effects on viability. As shown in Figures 4C and 4D, either Pten,
foxo, or 4E-BP CA overexpression in muscles is sufficient to
significantly extend longevity by increasing the median and
maximum life span. 4E-BP increased life span also in foxo
heterozygous null animals (Figure 4D), while Hsp70 overexpres-
sion on the other hand showed little effects (Figure S5). All
together, these findings indicate that the extent of muscle aging
is interconnected with the life span of the organism.
FOXO/4E-BP Signaling in Muscles InfluencesFeeding Behavior and the Release of Insulinfrom Producing CellsConsidering that both fasting and FOXO induce 4E-BP expres-
sion (Figure 2H), we wondered whether the systemic effect of
FOXO signaling on life span extension can result, at least in
part, from reduced food intake.
To test this hypothesis, we examined whether feeding
behavior would be decreased in adults with FOXO and 4E-BP
activation in muscles. We first monitored the amount of
liquid food ingested using the CAFE assay (capillary feeding)
(Ja et al., 2007). Interestingly, feeding was decreased in
response to FOXO/4E-BP signaling in muscles (Figure 5A). To
substantiate this finding, we measured the ingestion of blue-
colored food (Xu et al., 2008) and detected significant differ-
ences in food intake with this assay (Figure 5B), confirming
Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc. 817
818 Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc.
that feeding behavior is affected. Next, to assess whether
decreased feeding behavior arises from developmental defects,
we measured the body weight of adult flies, which is a sensitive
indicator of developmental feeding (Demontis and Perrimon,
2009), but found no significant differences (Figure 5C). Thus,
the behavior of flies overexpressing foxo and 4E-BP CA in
muscles most likely is not caused by developmental defects.
To assess the metabolic status, we monitored the glucose
concentration (glycemia) in the hemolymph. Similar to wild-
type flies starved for 24 hr, we detected a significant decrease
Figure 4. FOXO/4E-BP Signaling Preserves Muscle Function and Extends Life Span
(A) Muscle function gradually decreases during aging as indicated by an increase in the percentage of flies with climbing and flight defects. However, foxo
preserves their function in comparison with controls (flight ability: n[flies] = 10 (week 1 and 5) and 30 (week 8) with n[batch] = 3 (week 1 and 5) and 2 (week 8);
standard deviation (SD) is indicated and *p < 0.05. Climbing ability: (n[Mhc-Gal4/+] = 1264, n[Mhc-Gal4/UAS-foxo] = 966, with n indicating the number of flies
at day 1; p < 0.001).
(B) Similar to FOXO, 4E-BP activity also results in decreased age-related flight and climbing deficits in comparison with controls (flight ability: n[flies] R 10 (week 1
and 5) and 25 (week 8) with n[batch]R 3 (week 1 and 5) and 2 (week 8); SD is indicated and *p < 0.05. Climbing ability: (n[Mhc-Gal4/+] = 204, n[Mhc-Gal4/UAS-4E-
BP CA] = 403, p < 0.001).
(C) Survival of flies during aging. Foxo overexpression in muscles significantly extends the median and maximum life span (median and maximum life span:
Mhc-Gal4/+ = �61 and 82 days (n = 1264); UAS-foxo tr.#1/+;Mhc-Gal4/+ = �73 and 100 days (n = 1184); Mhc-Gal4/UAS-foxo tr.#2 = �76 and 94 days
(n = 966); p < 0.001).
(D) Life span of flies with increased Pten and 4E-BP activity in muscles is extended in comparison with matched controls (median and maximum life span of
4E-BP: Mhc-Gal4/+ = �63 and 78 days (n = 204); Mhc-Gal4/UAS-4E-BP CA = �71 and 84 days (n = 403); Pten: Mhc-Gal4/+ = �55 and 76 days (n = 162);
Mhc-Gal4/UAS-Pten = �66 and 88 days (n = 130); p < 0.001). Similar increase in life span is brought about by 4E-BP CA overexpression in foxo21 heterozygous
null flies.
See also Figure S5 and Figure S7.
Figure 3. FOXO and 4E-BP Regulate Proteostasis at Least in Part via the Autophagy/Lysosome System
(A–E) Immunostaining of muscles expressing the marker of autophagosomes Atg5-GFP reveals a significant increase in their number (E) and maintenance at
1 and 5 weeks of age upon foxo overexpression (C and D) in comparison with controls (A and B). In (E), SEM is indicated with n; *p < 0.05 and **p < 0.01.
(F–N) Immunostaining of muscles expressing the lysosomal marker Lamp1-GFP and overexpressing either Atg1, foxo, or 4E-BP CA. Note an increase in the
number of lysosomes (N) at both 1 (G-I) and 5 weeks of age (K–M), which inversely correlates with polyubiquitin immunoreactivity in comparison with control
muscles (F and J). Scale bar is 10 mm (A–D and F-–M). In (N), SEM is indicated with n; *p < 0.05 and ***p < 0.001.
(O) Relative mRNA levels of autophagy genes from thoraces of 1- and 5-week-old flies decrease during normal muscle aging, while their expression increases and
persists in response to FOXO. SEM is indicated with n = 4; *p < 0.05, **p < 0.01 and ***p < 0.001.
(P) RNAi treatment against Atg7 results in a �50% knockdown of its mRNA levels in muscles and partially impairs FOXO-mediated proteostasis, as indicated by
the increased detection of ubiquitin-conjugated proteins in Triton X-100 insoluble fractions at 8 weeks (old, red) in comparison with mock-treated (white RNAi) and
young flies (1 week old, black). Normalized values based on a-tubulin levels are indicated.
Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc. 819
of glycemia in flies with FOXO and 4E-BP activation in muscles
(Figure 5D). All together, these findings suggest that FOXO and
4E-BP act as a metabolic brake in muscles that, by influencing
Figure 5. FOXO Signaling in Muscles Partially
Mimics Systemic Metabolic Changes Associated
with Fasting by Modulating Feeding Behavior
(A–C) Flies in which FOXO/4E-BP activity has been altered
specifically in muscles consume less food than matched
controls. Food consumption was determined via capillary
feeding CAFE assay over 2 hr periods (A), and by moni-
toring the ingestion of blue colored food in 24 hr (B). Error
bars represent SEM with n[measurements] = 44, 46, 52,
37, 103, and 61 in (A) and n = 2 in (B), with *p < 0.05,
**p < 0.01, ***p < 0.001. Decreased feeding does not result
from developmental defects, as indicated by similar body
weights of flies analyzed (C) (error bars represent SD with
n R 3).
(D) Relative glucose levels (glycemia) in the hemolymph of
flies overexpressing either foxo or 4E-BP CA in muscles,
and matched controls. Manipulation of FOXO/4E-BP
signaling in muscles brings about a reduction of glycemia
similar in part to that of wild-type flies starved for 24 hr, as
estimated with the glucose hexokinase assay (SEM is
indicated with n = 5, and **p < 0.01, ***p < 0.001).
(E–H) Immunostaining of Dilp-producing median neurose-
cretory cells in the brain of starved wild-type flies, flies
overexpressing foxo in muscles, and controls. Increase
in the immunoreactivity of the insulin-like peptide Dilp2
(green) is detected in producing cells in response to either
starvation (F) or foxo overexpression in muscles (H), in
comparison respectively with fed wild-type flies (E) and
controls with no foxo overexpression in muscles (G).
Smaller changes in Dilp5 levels are observed. Phalloidin
staining (blue) detects F-actin (scale bar is 20 mm; images
in [E]–[H] have the same magnification).
(I) Quantification of the intensity of staining indicates
that differences in Dilp2 fluorescence are significant
(SD is indicated with n[measurements] = 35, 69, 37, and
96 from n[brains] = 2, 4, 3, and 4; *p < 0.05).
(J–L) Quantification and immunostaining of adipose tissue
(peripheral fat body of the abdomen) from 2 week old flies.
(J) Note a significant increase in nuclear b-galactosidase
immunoreactivity (red) in the adipose tissue from flies
with a nuclear 4E-BP-lacZ reporter and foxo overexpres-
sion in muscles (L) in comparison with controls (K). F-actin
(green) and DAPI staining (indicative of nuclei, blue) are
shown. Scale bar is 20 mm. In (J), SEM is indicated with
n = 20 and ***p < 0.001.
feeding behavior, mimic at least in part the
physiological changes that are associated with
fasting.
To gain mechanistic insights into the systemic
regulation of aging by FOXO/4E-BP signaling
in muscles, we next monitored the release of
insulin-like peptides (Dilps) from the Dilp-
producing median neurosecretory cells in the
brain, which have been previously shown to
mediate the response of life span to nutrition
in Drosophila (Broughton et al., 2010). We
detected a significant accumulation of the
insulin-like peptide Dilp2 (and to a lesser extent,
Dilp5) in starved wild-type flies in comparison with fed flies
(Figures 5E and 5F). Increased immunoreactivity indicates
decreased release of Dilps and has been previously shown to
820 Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc.
occur in response to starvation (Geminard et al., 2009). Next, we
tested whether similar changes would occur upon FOXO
signaling in muscles and found a partial accumulation of Dilps
(Figures 5G–5I).
Assuming that decreased Dilps secretion may result in
systemic FOXO activation, we monitored its activity using a
nuclear 4E-BP-lacZ transcriptional reporter. By immunostaining
adipose tissues with anti-b-galactosidase antibodies, we
detected higher 4E-BP expression upon foxo activation in
muscles in comparison with controls (Figures 5J–5L). Thus,
FOXO signaling in muscles appears to systemically activate
4E-BP expression in other tissues by regulating food intake
and insulin release.
FOXO/4E-BP Signaling in Muscles RegulatesProteostasis in Other Aging TissuesOur demonstration that FOXO/4E-BP signaling in muscles
extends life span in Drosophila and induces a systemic fasting-
like response, along with the observation that muscles undergo
age-related structural and functional changes precociously in
comparison with other tissues (Herndon et al., 2002; Zheng
et al., 2005), raises the possibility that muscle senescence may
influence the progression of age-related degenerative events in
the entire organism.
To test this hypothesis, we examined whether, in addition to
life span extension, FOXO signaling in muscles can affect protein
homeostasis in other tissues. As in the case of muscles (Figure 1
and Figure 2), we found that Ref(2)P/polyubiquitin aggregates
progressively accumulate in aging retinas (Figures 6A and 6D),
brains (Figures 6B and 6E), and adipose tissue (Figures 6C and
6F) (peripheral fat body of the abdomen). However, foxo overex-
pression in muscle resulted in decreased accumulation of
protein aggregates in other aging tissues (Figures 6D–6F; quan-
tification in Figure 6G). Similar changes were observed in
response to 4E-BP activity in muscles in comparison with
syngenic controls (Figure 6H). Importantly, this regulation is
muscle nonautonomous, as Mhc-Gal4 drives transgene expres-
sion only in muscles (and not in the retina, brain or adipose
tissue) (Figure S1). To further test the finding that FOXO/4E-BP
signaling in muscles delays the systemic impairment of proteo-
stasis in other tissues (Figures 6A–6H), we analyzed by western
blot the ubiquitin levels of Triton X-100 insoluble fractions, which
included protein aggregates, from either thoraces (which mainly
consist of foxo-overexpressing muscles) or heads and abdo-
mens (which are enriched in nonmuscle tissues and muscles
with little foxo overexpression) (Figure S1), at 1 and 8 weeks of
age. In agreement with the increased deposition of protein
aggregates observed during aging by immunofluorescence
(Figure 1, Figure 2, and Figures 6A–6F), ubiquitin levels were
dramatically increased in the Triton X-100 insoluble fractions
from control thoraces, and head and abdominal extracts at
8 weeks of age, in comparison with 1 week of age (Figure 6I).
However, ubiquitin levels were only partially increased in old
foxo-overexpressing flies in both thoracic and head and abdom-
inal extracts. No substantial differences were instead detected in
the Triton X-100 soluble fractions (data not shown). Similar
results were obtained by 4E-BP CA but not Hsp70 overexpres-
sion in muscles (Figure 6I; Figure S5), indicating that 4E-BP
activity in muscles also confers systemic protection from the
age-related decline in proteostasis. To test whether this effect
is muscle-specific, we overexpressed foxo in the adipose tissue
(abdominal fat body) with the S106GS-Gal4 driver, and analyzed
the deposition of polyubiquitinated proteins in Triton X-100
insoluble fractions from thoraces. Under these conditions, we
seemingly detected no differences (Figure S6), suggesting that,
although other tissues may be involved, muscles may play a
key role in this regulation. Altogether, these observations sug-
gest that FOXO and 4E-BP activity in muscles mitigates the
loss of proteostasis nonautonomously by influencing feeding
behavior, insulin release from producing cells, and 4E-BP activity
in other tissues.
DISCUSSION
By using a number of behavioral, genetic, and molecular assays,
we have described a mechanism in the pathogenesis of muscle
aging that is based on the loss of protein homeostasis (proteo-
stasis) and the resulting decrease in muscle strength (Figure 7).
Increased activity of Pten and the transcription factor FOXO is
sufficient to delay this process, while foxo null animals experi-
ence accelerated loss of proteostasis during muscle aging.
Pten and FOXO induce multiple protective responses, including
the expression of folding chaperones and the regulator of protein
translation 4E-BP that has a pivotal role in preserving proteosta-
sis. FOXO and 4E-BP preserve muscle function, at least in part
by sustaining the basal activity of the autophagy/lysosome
system, which removes aggregates of damaged proteins.
However, additional mechanisms may be involved. For example,
the proteasome system may degrade damaged proteins and
thus avoid their accumulation in aggregates (Rubinsztein,
2006). Thus, perturbation in proteasome assembly and subunit
composition may contribute to muscle aging in response to
FOXO activity. In addition, whereas overexpression of a single
chaperone had limited effects, interventions to effectively limit
the extent of protein damage are likely to delay the decay in
proteostasis by decreasing the workload for the proteasome
and autophagy systems (Tower, 2009).
By comparing the accumulation of polyubiquitinated proteins
in aggregates of aging muscles, retinas, brains, and adipose
tissue, we have found that reduced protein homeostasis is a
general feature of tissue aging that is particularly prominent in
muscles (Figure 1, Figure 6, and Figure S6). The observation
that muscle aging is characterized by loss of proteostasis further
suggests some similarity between muscle aging and neurode-
generative diseases, many of which are characterized by the
accumulation of protein aggregates (Rubinsztein, 2006).
Mechanical, thermal, and oxidative stressors occur during
muscle contraction (Arndt et al., 2010), and therefore muscle
proteins may be particularly susceptible to damage in compar-
ison with other tissues. While our findings refer to the loss of
proteostasis in the context of normal aging, it is likely that a better
understanding of this process will help cure muscle pathologies
associated with aging, as some of the underlying mechanisms of
etiology may be shared. For example, most cases of inclusion
body myositis (IBM) arise over the age of 50 years, defining
aging as a major risk factor for the pathogenesis of this disease.
Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc. 821
Figure 6. Systemic Proteostasis Is Remotely Controlled by FOXO/4E-BP Signaling in Muscles
(A–F) Aggregates of polyubiquitinated proteins accumulate during aging in the retina (A and D), brain (B and E), and the adipose tissue (C and F) of control flies
(Mhc-Gal4/+), but to a lesser extent in tissues from flies overexpressing foxo in muscles (UAS-foxo/+;Mhc-Gal4/+), as indicated by polyubiquitin (red) and p62/Ref
(2)P (green) stainings. Phalloidin staining (blue) outlines F-actin. Note that Mhc-Gal4 does not drive transgene expression in these tissues (Figure S1). Scale bar is
10 mm.
(G and H) The age-related increase in the cumulative area of protein aggregates is significantly less prominent in tissues from flies overexpressing foxo (G) or
4E-BP CA (H) in muscles in comparison with controls (SEM is indicated with n; *p < 0.05. **p < 0.01, and ***p < 0.001).
(I) Ubiquitin levels (indicative of protein aggregates) are detected in Triton X-100 insoluble fractions from thoraces, and head and abdominal tissues from flies
overexpressing foxo in muscles or control flies at 1 (young, black) and 8 (old, red) weeks of age. Ubiquitin levels are increased in old flies in comparison with young
822 Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc.
Interestingly, muscle weakness in patients with IBM is character-
ized by the accumulation of protein aggregates (Needham and
Mastaglia, 2008), which we have now described as occurring
in the context of regular muscle aging in Drosophila. Thus,
FOXO may interfere with the pathogenesis of muscle degenera-
tive diseases in addition to muscle aging. Studies in animal
disease models of IBM will be needed to test this hypothesis.
There is an apparent contradiction between our findings and
the data describing the FOXO-dependent induction of muscle
atrophy in mice (Bodine et al., 2001; Sandri et al., 2004), a serious
form of muscle degeneration that results in decreased muscle
strength (Augustin and Partridge, 2009). The observation that
different degrees of FOXO activation can promote stress resis-
tance, or rather cell death (Salih and Brunet, 2008), could explain
why FOXO activity can be protective or rather detrimental during
muscle aging. In particular, while physiologic FOXO activation
can preserve protein homeostasis and muscle function, its
excessive activation may lead to decreased muscle function
due to hyperactivation of the protein turnover pathways. Consis-
tent with this view, the autophagy pathway has also been
involved in both muscle atrophy (Mammucari et al., 2007;
Zhao et al., 2007) and in the preservation of muscle sarcomere
organization (Arndt et al., 2010; Masiero et al., 2009), high-
lighting the importance of fine-tuning the degree of activation
of stress resistance pathways to maintain muscle homeostasis.
In addition, the output of FOXO activity may radically differ in
growing versus preexisting myofibers. In particular, our present
study indicates that FOXO protects preexisting myofibers
Figure 7. FOXO/4E-BP Signaling in Muscles
Controls Proteostasis and Systemic Aging
Muscle aging is characterized by protein damage
and accumulation of cytoplasmic aggregates.
Loss of protein homeostasis (proteostasis) associ-
ates with the progressive decrease in muscle
strength and can affect the life span of the
organism. Pten/FOXO signaling induces multiple
targets including several folding chaperones
and the regulator of protein translation 4E-BP.
FOXO/4E-BP activity regulates muscle proteosta-
sis at least in part via the autophagy/lysosome
pathway of protein degradation, preserves muscle
function, and extends life span. In addition, FOXO/
4E-BP signaling in muscles decreases feeding
behavior that, similar to fasting, results in reduced
insulin release from producing cells. This in turn
promotes FOXO and 4E-BP activity in other
tissues, preserving proteostasis organism-wide
and mitigating systemic aging.
flies in extracts from both muscles (thoraces) and nonmuscle tissues (heads and abdomens). However, flies overexpressing foxo in muscles have reduced
deposition of protein aggregates at 8 weeks of age in both muscles and nonmuscle tissues. Similar results are obtained in response to increased 4E-BP activity
in muscles (I), but not Hsp70 (Figure S5). Quantification of ubiquitin-conjugated proteins normalized to a-tubulin or histone H3 levels is indicated.
See also Figures S1, Figure S5, and Figure S6.
against age-dependent changes in pro-
teostasis while also blunting develop-
mental muscle growth in flies (Demontis
and Perrimon, 2009), as observed in
mammals (Kamei et al., 2004). Thus,
deleterious effects of FOXO activation as observed in mamma-
lian muscles may result from the inhibition of the growth of novel
myofibers in postnatal development and adulthood, a process
which is thought to be limited to development in Drosophila
(Grefte et al., 2007).
An interesting observation of our study is that interventions
that decrease muscle aging also extend the life span of the
organism. In particular, our work raises the prospect that the
extent of muscle aging may be a key determinant of systemic
aging (Figure 7). Reduced muscle proteostasis may be detri-
mental per se for life expectancy, presumably due to the involve-
ment of muscles in a number of key physiological functions.
Consistent with this view, overexpression in muscles of aggrega-
tion-prone human Huntington’s disease proteins is sufficient to
decrease life span (Figure S7). Moreover, FOXO signaling in
muscles regulates proteostasis in other tissues, via the inhibition
of feeding behavior and the decreased release of insulin from
producing cells, which in turn promote 4E-BP activity systemi-
cally. Thus, we propose that FOXO/4E-BP signaling in muscles
regulates life span and remotely controls aging events in other
tissues by bringing about some of the protection associated
with decreased food intake.
In mammals, muscles produce a number of cytokines involved
in the control of systemic metabolism (Nair, 2005; Pedersen and
Febbraio, 2008). For example, interleukin-6 (IL-6) is produced by
muscles and has been proposed to control glucose homeostasis
and feeding behavior through peripheral and brain mechanisms
(Febbraio and Pedersen, 2002; Plata-Salaman, 1998). Thus,
Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc. 823
a muscle-based network of systemic aging as observed in flies
may occur in humans.
This study supports the common belief that preserving muscle
function is beneficial for overall aging (Boyle et al., 2009; Chen
et al., 2005), and the notion that muscles are central tissues
to coordinate organism-wide processes, including aging and
metabolic homeostasis (Nair, 2005). Moreover, the observation
that FOXO signaling in muscles influences aging events in other
tissues suggests that the systemic regulation of aging relies on
tissue-to-tissue communication (Russell and Kahn, 2007), which
may provide the basis for interventions to extend healthy life
span.
EXPERIMENTAL PROCEDURES
Drosophila Strains and Life Span Analysis
Details on fly strains can be found in Extended Experimental Procedures.
For longevity measurement, male flies were collected within 24 hr from
eclosion and reared at standard density (20 flies per vial) on cornmeal/soy
flour/yeast fly food at 25�C. Dead flies were counted every other day and
food changed. For each genotype, at least two independent cohorts of flies,
raised at different times from independent crosses, were analyzed. For starva-
tion treatments, flies were kept in normal vials with 1.5% agar as a water
source for the period of time indicated. For all experiments, Mhc-Gal4 females
were mated with male transgenic and syngenic control flies, and the resulting
male offspring analyzed in parallel by comparing transgene expressing
flies with matched controls flies having the same genetic background. For
transgene expression with the Gal4-UAS system, flies were reared at 25�C.
Behavioral and Metabolic Assays
Flight ability was scored according to Park et al. (2006), and negative geotaxis
assays were performed as previously described (Rhodenizer et al., 2008). In
brief, flies were gently tapped to the bottom of a plastic vial, and the number
of flies that could climb to the top of the vial after 20 s was scored. Quantifica-
tion of the glucose concentration in the hemolymph, and capillary (CAFE) and
blue-colored food feeding assays were done as previously described
(Geminard et al., 2009; Xu et al., 2008) and are described in detail in Extended
Experimental Procedures.
Immunostaining, Confocal and Electron Microscopy,
and Image Analysis
For whole-mount immunostaining of the fly tissues, indirect flight muscles, and
peripheral fat body of the abdomen, retinas, and brains were dissected from
male flies and fixed for 30–40 min in PBS with 4% paraformaldehyde and
0.2% Triton X-100. After washing, samples were incubated overnight with
appropriate primary and secondary antibodies. Image analysis was done
with ImageJ and Photoshop. Immuno-gold electron microscopy was done
similar to Nezis et al., (2008). See Extended Experimental Procedures for
further information and a list of the antibodies used.
Quantitative Real-Time RT-PCR
qRT-PCR was done as previously described (Demontis and Perrimon, 2009).
Total RNA was prepared from fly thoraces and qRT-PCR was performed
with the QuantiTect SYBR Green PCR kit (QIAGEN). Alpha-Tubulin 84B was
used as normalization reference. Relative quantification of mRNA levels was
calculated using the comparative CT method.
Statistical Analysis
Statistical analysis was performed with Excel (Microsoft) and p values were
calculated with Student’s t tests and log-rank tests.
Western Blot and Biochemical Analysis of Detergent-Insoluble
Fractions
Western blot and biochemical analysis of detergent-insoluble fractions were
done substantially as previously described (Nezis et al., 2008). In brief,
dissected flies were homogenized in ice-cold PBS with 1% Triton X-100 and
protease inhibitors, and the resulting unsoluble pellet resuspended in RIPA
buffer with 5% SDS and 8M urea. See Extended Experimental Procedures
for a complete protocol.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures,
seven figures, and two tables and can be found with this article online at
doi:10.1016/j.cell.2010.10.007.
ACKNOWLEDGMENTS
We are grateful to Andreas Brech, Didier Contamine, Ernst Hafen, Pierre
Leopold, Susan Lindquist, Ioannis Nezis, Amita Sehgal, Marc Tatar, Robert
Tjian, John Tower, the DRSC/TRiP, and members of the Perrimon lab for fly
stocks, reagents, and advice. We thank Maria Ericsson for assistance with
electron microscopy, Christians Villalta for embryo injection, and Chris Bakal,
Rami Rahal, and Jonathan Zirin for critically reading the manuscript. This work
was supported by the NIH (1P01CA120964-01A1) and a Pilot Project Grant
from the Paul F. Glenn Labs for the Molecular Biology of Aging. F.D. is an
Ellison Medical Foundation/AFAR postdoctoral fellow. N.P. is an investigator
of the Howard Hughes Medical Institute.
Received: February 3, 2010
Revised: June 24, 2010
Accepted: October 1, 2010
Published: November 24, 2010
REFERENCES
Arndt, V., Dick, N., Tawo, R., Dreiseidler, M., Wenzel, D., Hesse, M., Furst,
D.O., Saftig, P., Saint, R., Fleischmann, B.K., et al. (2010). Chaperone-assisted
selective autophagy is essential for muscle maintenance. Curr. Biol. 20,
143–148.
Augustin, H., and Partridge, L. (2009). Invertebrate models of age-related
muscle degeneration. Biochim. Biophys. Acta 1790, 1084–1094.
Bodine, S.C., Stitt, T.N., Gonzalez, M., Kline, W.O., Stover, G.L., Bauerlein, R.,
Zlotchenko, E., Scrimgeour, A., Lawrence, J.C., Glass, D.J., and Yancopoulos,
G.D. (2001). Akt/mTOR pathway is a crucial regulator of skeletal muscle hyper-
trophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 3, 1014–1019.
Boyle, P.A., Buchman, A.S., Wilson, R.S., Leurgans, S.E., and Bennett, D.A.
(2009). Association of muscle strength with the risk of Alzheimer disease
and the rate of cognitive decline in community-dwelling older persons. Arch.
Neurol. 66, 1339–1344.
Broughton, S.J., Slack, C., Alic, N., Metaxakis, A., Bass, T.M., Driege, Y., and
Partridge, L. (2010). DILP-producing median neurosecretory cells in the
Drosophila brain mediate the response of lifespan to nutrition. Aging Cell 9,
336–346.
Chen, H., Zhang, S.M., Schwarzschild, M.A., Hernan, M.A., and Ascherio, A.
(2005). Physical activity and the risk of Parkinson disease. Neurology 64,
664–669.
Cohen, E., Bieschke, J., Perciavalle, R.M., Kelly, J.W., and Dillin, A. (2006).
Opposing activities protect against age-onset proteotoxicity. Science 313,
1604–1610.
Demontis, F., and Perrimon, N. (2009). Integration of Insulin receptor/Foxo
signaling and dMyc activity during muscle growth regulates body size in
Drosophila. Development 136, 983–993.
Febbraio, M.A., and Pedersen, B.K. (2002). Muscle-derived interleukin-6:
mechanisms for activation and possible biological roles. FASEB J. 16, 1335–
1347.
Garigan, D., Hsu, A.L., Fraser, A.G., Kamath, R.S., Ahringer, J., and Kenyon, C.
(2002). Genetic analysis of tissue aging in Caenorhabditis elegans: a role for
heat-shock factor and bacterial proliferation. Genetics 161, 1101–1112.
824 Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc.
Geminard, C., Rulifson, E.J., and Leopold, P. (2009). Remote control of insulin
secretion by fat cells in Drosophila. Cell Metab. 10, 199–207.
Giannakou, M.E., Goss, M., Junger, M.A., Hafen, E., Leevers, S.J., and
Partridge, L. (2004). Long-lived Drosophila with overexpressed dFOXO in adult
fat body. Science 305, 361.
Gorski, S.M., Chittaranjan, S., Pleasance, E.D., Freeman, J.D., Anderson, C.L.,
Varhol, R.J., Coughlin, S.M., Zuyderduyn, S.D., Jones, S.J., and Marra, M.A.
(2003). A SAGE approach to discovery of genes involved in autophagic cell
death. Curr. Biol. 13, 358–363.
Grefte, S., Kuijpers-Jagtman, A.M., Torensma, R., and Von den Hoff, J.W.
(2007). Skeletal muscle development and regeneration. Stem Cells Dev. 16,
857–868.
Hara, T., Nakamura, K., Matsui, M., Yamamoto, A., Nakahara, Y., Suzuki-
Migishima, R., Yokoyama, M., Mishima, K., Saito, I., Okano, H., and
Mizushima, N. (2006). Suppression of basal autophagy in neural cells causes
neurodegenerative disease in mice. Nature 441, 885–889.
Herndon, L.A., Schmeissner, P.J., Dudaronek, J.M., Brown, P.A., Listner,
K.M., Sakano, Y., Paupard, M.C., Hall, D.H., and Driscoll, M. (2002). Stochastic
and genetic factors influence tissue-specific decline in ageing C. elegans.
Nature 419, 808–814.
Hsu, A.L., Murphy, C.T., and Kenyon, C. (2003). Regulation of aging and age-
related disease by DAF-16 and heat-shock factor. Science 300, 1142–1145.
Hwangbo, D.S., Gershman, B., Tu, M.P., Palmer, M., and Tatar, M. (2004).
Drosophila dFOXO controls lifespan and regulates insulin signalling in brain
and fat body. Nature 429, 562–566.
Ja, W.W., Carvalho, G.B., Mak, E.M., de la Rosa, N.N., Fang, A.Y., Liong, J.C.,
Brummel, T., and Benzer, S. (2007). Prandiology of Drosophila and the CAFE
assay. Proc. Natl. Acad. Sci. USA 104, 8253–8256.
Junger, M.A., Rintelen, F., Stocker, H., Wasserman, J.D., Vegh, M.,
Radimerski, T., Greenberg, M.E., and Hafen, E. (2003). The Drosophila
forkhead transcription factor FOXO mediates the reduction in cell number
associated with reduced insulin signaling. J. Biol. 2, 20.
Kamei, Y., Miura, S., Suzuki, M., Kai, Y., Mizukami, J., Taniguchi, T., Mochida,
K., Hata, T., Matsuda, J., Aburatani, H., et al. (2004). Skeletal muscle FOXO1
(FKHR) transgenic mice have less skeletal muscle mass, down-regulated
Type I (slow twitch/red muscle) fiber genes, and impaired glycemic control.
J. Biol. Chem. 279, 41114–41123.
Kenyon, C. (2005). The plasticity of aging: insights from long-lived mutants.
Cell 120, 449–460.
Korolchuk, V.I., Mansilla, A., Menzies, F.M., and Rubinsztein, D.C. (2009).
Autophagy inhibition compromises degradation of ubiquitin-proteasome
pathway substrates. Mol. Cell 33, 517–527.
Libina, N., Berman, J.R., and Kenyon, C. (2003). Tissue-specific activities of
C. elegans DAF-16 in the regulation of lifespan. Cell 115, 489–502.
Mammucari, C., Milan, G., Romanello, V., Masiero, E., Rudolf, R., Del Piccolo,
P., Burden, S.J., Di Lisi, R., Sandri, C., Zhao, J., et al. (2007). FoxO3 controls
autophagy in skeletal muscle in vivo. Cell Metab. 6, 458–471.
Masiero, E., Agatea, L., Mammucari, C., Blaauw, B., Loro, E., Komatsu, M.,
Metzger, D., Reggiani, C., Schiaffino, S., and Sandri, M. (2009). Autophagy
is required to maintain muscle mass. Cell Metab. 10, 507–515.
Morley, J.F., Brignull, H.R., Weyers, J.J., and Morimoto, R.I. (2002). The
threshold for polyglutamine-expansion protein aggregation and cellular
toxicity is dynamic and influenced by aging in Caenorhabditis elegans. Proc.
Natl. Acad. Sci. USA 99, 10417–10422.
Nair, K.S. (2005). Aging muscle. Am. J. Clin. Nutr. 81, 953–963.
Needham, M., and Mastaglia, F.L. (2008). Sporadic inclusion body myositis:
a continuing puzzle. Neuromuscul. Disord. 18, 6–16.
Nezis, I.P., Simonsen, A., Sagona, A.P., Finley, K., Gaumer, S., Contamine, D.,
Rusten, T.E., Stenmark, H., and Brech, A. (2008). Ref(2)P, the Drosophila
melanogaster homologue of mammalian p62, is required for the formation of
protein aggregates in adult brain. J. Cell Biol. 180, 1065–1071.
Park, J., Lee, S.B., Lee, S., Kim, Y., Song, S., Kim, S., Bae, E., Kim, J., Shong,
M., Kim, J.M., and Chung, J. (2006). Mitochondrial dysfunction in Drosophila
PINK1 mutants is complemented by parkin. Nature 441, 1157–1161.
Pedersen, B.K., and Febbraio, M.A. (2008). Muscle as an endocrine organ:
focus on muscle-derived interleukin-6. Physiol. Rev. 88, 1379–1406.
Plata-Salaman, C.R. (1998). Cytokines and feeding. News Physiol. Sci. 13,
298–304.
Rhodenizer, D., Martin, I., Bhandari, P., Pletcher, S.D., and Grotewiel, M.
(2008). Genetic and environmental factors impact age-related impairment of
negative geotaxis in Drosophila by altering age-dependent climbing speed.
Exp. Gerontol. 43, 739–748.
Rubinsztein, D.C. (2006). The roles of intracellular protein-degradation
pathways in neurodegeneration. Nature 443, 780–786.
Russell, S.J., and Kahn, C.R. (2007). Endocrine regulation of ageing. Nat. Rev.
Mol. Cell Biol. 8, 681–691.
Rusten, T.E., Lindmo, K., Juhasz, G., Sass, M., Seglen, P.O., Brech, A., and
Stenmark, H. (2004). Programmed autophagy in the Drosophila fat body is
induced by ecdysone through regulation of the PI3K pathway. Dev. Cell 7,
179–192.
Salih, D.A., and Brunet, A. (2008). FoxO transcription factors in the mainte-
nance of cellular homeostasis during aging. Curr. Opin. Cell Biol. 20, 126–136.
Sandri, M., Sandri, C., Gilbert, A., Skurk, C., Calabria, E., Picard, A., Walsh, K.,
Schiaffino, S., Lecker, S.H., and Goldberg, A.L. (2004). Foxo transcription
factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal
muscle atrophy. Cell 117, 399–412.
Simonsen, A., Cumming, R.C., Brech, A., Isakson, P., Schubert, D.R., and
Finley, K.D. (2008). Promoting basal levels of autophagy in the nervous system
enhances longevity and oxidant resistance in adult Drosophila. Autophagy 4,
176–184.
Tain, L.S., Mortiboys, H., Tao, R.N., Ziviani, E., Bandmann, O., and Whitworth,
A.J. (2009). Rapamycin activation of 4E-BP prevents parkinsonian dopami-
nergic neuron loss. Nat. Neurosci. 12, 1129–1135.
Tower, J. (2009). Hsps and aging. Trends Endocrinol. Metab. 20, 216–222.
Wang, M.C., Bohmann, D., and Jasper, H. (2005). JNK extends life span and
limits growth by antagonizing cellular and organism-wide responses to insulin
signaling. Cell 121, 115–125.
Wessells, R.J., Fitzgerald, E., Cypser, J.R., Tatar, M., and Bodmer, R. (2004).
Insulin regulation of heart function in aging fruit flies. Nat. Genet. 36, 1275–
1281.
Wolkow, C.A., Kimura, K.D., Lee, M.S., and Ruvkun, G. (2000). Regulation of
C. elegans life-span by insulinlike signaling in the nervous system. Science
290, 147–150.
Xu, K., Zheng, X., and Sehgal, A. (2008). Regulation of feeding and metabolism
by neuronal and peripheral clocks in Drosophila. Cell Metab. 8, 289–300.
Zhao, J., Brault, J.J., Schild, A., Cao, P., Sandri, M., Schiaffino, S., Lecker,
S.H., and Goldberg, A.L. (2007). FoxO3 coordinately activates protein
degradation by the autophagic/lysosomal and proteasomal pathways in
atrophying muscle cells. Cell Metab. 6, 472–483.
Zheng, J., Edelman, S.W., Tharmarajah, G., Walker, D.W., Pletcher, S.D., and
Seroude, L. (2005). Differential patterns of apoptosis in response to aging in
Drosophila. Proc. Natl. Acad. Sci. USA 102, 12083–12088.
Zid, B.M., Rogers, A.N., Katewa, S.D., Vargas, M.A., Kolipinski, M.C., Lu, T.A.,
Benzer, S., and Kapahi, P. (2009). 4E-BP extends lifespan upon dietary restric-
tion by enhancing mitochondrial activity in Drosophilia. Cell 139, 149–160.
Cell 143, 813–825, November 24, 2010 ª2010 Elsevier Inc. 825
Reelin and Stk25 Have OpposingRoles in Neuronal Polarizationand Dendritic Golgi DeploymentTohru Matsuki,1 Russell T. Matthews,1 Jonathan A. Cooper,3 Marcel P. van der Brug,2,4 Mark R. Cookson,2
John A. Hardy,2,5 Eric C. Olson,1 and Brian W. Howell1,*1Department of Neuroscience and Physiology, SUNY Upstate Medical University, Syracuse, NY 13210, USA2Laboratory of Neurogenetics, National Institute on Aging, National Institutes of Health, Bethesda, MD 20892, USA3Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA4Present address: Department of Neuroscience, The Scripps Research Institute, Jupiter, FL 33458, USA5Present address: Department of Molecular Neuroscience and Reta Lila Weston Laboratories, University College, Queens Square House,
London WC1 3BG, UK*Correspondence: [email protected]
DOI 10.1016/j.cell.2010.10.029
SUMMARY
The Reelin ligand regulates a Dab1-dependent sig-naling pathway required for brain lamination andnormal dendritogenesis, but the specific mecha-nisms underlying these actions remain unclear. Wefind that Stk25, a modifier of Reelin-Dab1 signaling,regulates Golgi morphology and neuronal polariza-tion as part of an LKB1-Stk25-Golgi matrix protein130 (GM130) signaling pathway. Overexpression ofStk25 induces Golgi condensation and multipleaxons, both of which are rescued by Reelin treat-ment. Reelin stimulation of cultured neurons inducesthe extension of the Golgi into dendrites, which issuppressed by Stk25 overexpression. In vivo, Reelinand Dab1 are required for the normal extension of theGolgi apparatus into the apical dendrites of hippo-campal and neocortical pyramidal neurons. Thisdemonstrates that the balance between Reelin-Dab1 signaling and LKB1-Stk25-GM130 regulatesGolgi dispersion, axon specification, and dendritegrowth and provides insights into the importance ofthe Golgi apparatus for cell polarization.
INTRODUCTION
The development of the exquisite morphology of neurons is
a carefully orchestrated process that optimizes the ability of indi-
vidual neurons to receive signals, integrate them, and transmit
the output to target cells. Neuronal polarization, first observed
as the rapid growth of a process that will ultimately become an
axon, followed by the asymmetrical development of dendrites
are key steps in morphological and functional maturation
(Arimura and Kaibuchi, 2005). Interestingly, the Golgi apparatus
has been implicated in these different aspects of neuronal
polarity. In the nascent neuron, the position of the Golgi and
the adjoined centrosome correlates with the site of axon emer-
gence, which becomes the future basal side of a mature pyra-
midal neuron (de Anda et al., 2005, 2010; Zmuda and Rivas,
1998). Later, the Golgi apparatus is positioned on the apical
side of pyramidal neurons, proximal to the major apical dendritic
tree and opposite to the axon and minor basal dendrites (Horton
et al., 2005). Dispersion of the Golgi apparatus away from
the apical pole leads to a loss of dendrite asymmetry in these
cells, with equal-sized apical and basal dendrites (Horton et al.,
2005). Furthermore, specialized Golgi outposts, which populate
dendrites, promote the elaboration of dendritic branches (Ye
et al., 2007). However, it remains to be determined how Golgi
positioning within neurons is regulated.
Mutations in the genes encoding the Reelin-Dab1 signaling
pathway lead to profound defects in neuronal positioning and
dendritogenesis during brain development (Niu et al., 2004;
Rice et al., 2001). The lamination of the cerebral cortex, hippo-
campus, and cerebellum is disorganized and appears approxi-
mately inverted compared to normal. Reelin is a secreted ligand
that is produced in discreet layers in the developing brain
(D’Arcangelo et al., 1995; Ogawa et al., 1995). Genetic and
biochemical studies have shown that it regulates a signal trans-
duction pathway requiring the ApoE receptors ApoER2 and
VLDLR (D’Arcangelo et al., 1999; Hiesberger et al., 1999;
Trommsdorff et al., 1999), the cytoplasmic adaptor protein
Dab1 (Howell et al., 2000), and Src family kinases (Arnaud
et al., 2003; Bock and Herz, 2003). Disparate functions have
been proposed for Reelin-Dab1 signaling, though a clear biolog-
ical response to clarify its role in brain development is lacking
(Chai et al., 2009; Cooper, 2008; Forster et al., 2010; Sanada
et al., 2004).
The severity of dab1-dependent phenotypes depends on the
genetic background (Brich et al., 2003). We have recently identi-
fied stk25 as a modifier of dab1 mutant phenotypes (unpublished
data). Here we characterize the role of Stk25 (also YSK1, Sok1) in
nervous system development. Previous work has implicated
Stk25 in regulating Golgi morphology through the Golgi matrix
protein GM130 (Preisinger et al., 2004), which we confirm here.
826 Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc.
GM130 regulates the fusion of ER-to-Golgi vesicles with the
Golgi cisternae and the fusion of Golgi cisternae into elongated
ribbons (Barr and Short, 2003; Puthenveedu et al., 2006). Deple-
tion or mitotic phosphorylation of GM130 leads to Golgi frag-
mentation and reduced efficiency of biosynthetic processing
(Lowe et al., 1998; Marra et al., 2007; Puthenveedu et al., 2006).
The protein kinase LKB1 and its associated factors STRAD
and MO25 are known to be important for neuronal polarization,
axon specification, and dendrite growth (Asada et al., 2007;
Barnes et al., 2007; Shelly et al., 2007). In this study, we find
that Stk25 is part of an LKB1 cell polarization pathway. Stk25,
LKB1, and GM130 are shown to regulate Golgi morphology
and axon initiation. In addition, we show that Stk25 and Reelin-
Dab1 signaling have antagonistic effects on neuronal polariza-
tion and the morphology and subcellular distribution of the
Golgi. As the position of the Golgi plays roles in cell polarization,
process extension, and cell migration (Fidalgo et al., 2010;
Horton et al., 2005; Yadav et al., 2009; Ye et al., 2007), this
evidence is fundamental for understanding the molecular control
of neuronal morphogenesis and provides new insights into the
biological role of Reelin-Dab1 signaling.
RESULTS
Stk25 Regulates Neuronal PolarityStk25 has previously been shown to regulate the polarized
migration of epithelial cells. As other Ste20-like kinases have
roles in neuronal polarization (Jacobs et al., 2007; Preisinger
et al., 2004), we sought to assess a role for Stk25 in neuronal
polarization by using hippocampal neuronal cultures (Dotti and
Banker, 1987). These neurons have a stereotypic morphology
and program of differentiation and respond to Reelin-Dab1
signaling (Matsuki et al., 2008). Soon after plating, they extend
short uniform processes that have the potential to develop
into either axons or dendrites (Arimura and Kaibuchi, 2007). By
stage III, 48 to 72 hr later, one of the processes can be identified
as an axon whereas the other processes differentiate into
dendrites.
We reduced Stk25 levels by infection with a lentivirus carrying
GFP and Stk25 shRNA and identified axons 6 days later using
SMI-312, a pan-axonal neurofilament marker. Depletion of
Stk25 inhibited axon specification. At least 30% of the Stk25
shRNA lentivirus-infected, GFP-positive neurons lacked an
axon (Figures 1B and 1F, lane 2), whereas axons were detected
in all neurons infected with either empty vector (EV) or control
shRNA vectors (Figures 1A and 1F, lanes 1 and 3 and insets).
The longest process in Stk25 shRNA-expressing cells was also
much shorter than the long axons of control cells (Figures 1A,
1B, and 1F, lane 2), consistent with a failure to induce an axon.
To assess whether axon absence was specifically caused by
reduced Stk25 expression, we tested for rescue by Stk25 over-
expression. Both kinase-active and kinase-inactive versions of
an shRNA-resistant Stk25 (Stk25*) were expressed as red fluo-
rescent protein (RFP) fusion proteins in cultures that were also
infected with the GFP-expressing, Stk25 shRNA virus (Figures
S1A–S1D available online). Both kinase-active and kinase-inac-
tive Stk25*-RFP rescued the axon-less phenotype caused by
Stk25 knockdown (Figure 1F, lanes 7–9). This suggests that
the axon-less phenotype in Stk25 shRNA-expressing cells was
the specific result of reducing Stk25 expression and that Stk25
kinase activity is not required for axon production.
To investigate whether Stk25 affected axon initiation or main-
tenance, we examined stage III hippocampal neurons (Figures
1D and 1E). We found that 56% ± 5% of Stk25 knockdown
neurons lacked an axon compared to only 7% ± 8% of control
samples (Figure 1G). The longest neurite in Stk25 knockdown
neurons was also significantly shorter than the incipient axon in
control cultures. Moreover, overexpression of Stk25 induced
multiple axons. Expression of either the wild-type or kinase-inac-
tive Stk25*-RFP fusion proteins, or an Stk25-green fluorescent
protein (GFP) fusion that has previously been shown to be bio-
logically active (Preisinger et al., 2004), induced multiple SMI-
positive axons in approximately 45%–50% of neurons as
compared to 15% ± 3% in GFP-alone expressing controls
(Figures 1C and 1F, lanes 5, 6, 8, and 9). Stk25 overexpression
did not increase axon length (Figure 1F). Taken together, the
results show that Stk25 regulates axon initiation but not axon
growth in cultured neurons.
Reelin-Dab1 Signaling Suppresses Multiple AxonProductionStk25 is expressed at relatively high levels in Reelin-Dab1
responsive cells in the developing cortical plate (Figure S1E)
and in the adult hippocampus and cerebellar Purkinje cells (Fig-
ure S1F). Because we identified stk25 in a screen for modifiers of
dab1 mutant phenotypes (unpublished data), we examined
whether Reelin-Dab1 signaling might have an undiscovered
role in axon initiation. Hippocampal neurons were cultured
from dab1�/� mutant embryos and infected with GFP-express-
ing lentiviruses to survey their morphology. Surprisingly, approx-
imately 30% of the dab1�/� mutant neurons produced multiple
axons as compared to approximately 15% of the wild-type
neurons (Figure 1H). To determine whether the multiple axon
phenotype in dab1�/� mutant neurons was sensitive to Stk25
expression level, we examined the effect of knocking down
Stk25. Significantly fewer dab1�/� mutant neurons infected
with the Stk25 shRNA-expressing lentivirus produced multiple
axons than the GFP-expressing control sample (Figure 1H). In
addition, a significant number of the Stk25 shRNA-expressing
neurons completely lacked axons. This shows that Reelin-
Dab1 signaling regulates axon initiation and that the multiple
axon phenotype in dab1�/� mutant mice is dependent upon
Stk25 expression.
Congruent with this result, growth of neurons in the presence
of Reelin suppressed the multiple axon phenotype caused
by Stk25 overexpression (Figure 1I). This treatment did not,
however, lead to the loss of axon production, which would be ex-
pected if Stk25 function was abolished. None of these treat-
ments affected axon length. Therefore, Reelin-Dab1 signaling
appears to counteract the effects of high Stk25 expression
without completely blocking its function in axon induction.
Stk25 Regulates Axon Formation and DendriteAsymmetry In VivoTo investigate whether Stk25 regulates neuronal differentiation
in vivo, we electroporated the Stk25 shRNA-expressing vector
Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc. 827
into the hippocampi of fetal mice. The brains of these mice were
analyzed for GFP expression and neuronal polarization of Ctip2-
positive, pyramidal neurons in the CA1 region of the hippo-
campus at postnatal day 7 (P7). Stk25 shRNA did not interfere
with the positioning of neurons, but their apical dendrites were
Figure 1. Stk25 Expression Regulates Axon
Differentiation in Culture
(A) Primary hippocampal neurons (E17.5) infected
with the GFP-expressing EV-control virus had
typical pyramidal neuron morphologies, including
a long SMI-positive axon (inset a) and shorter
dendrites.
(B) Neurons infected with the Stk25 shRNA virus
had shorter processes and frequently lacked
long (>250 mm) SMI-positive processes that met
the criteria for axons (inset b). An SMI-positive
process (arrowhead) from a noninfected neuron
runs parallel to the GFP-positive process (arrow).
(C) Cells overexpressing Stk25 wild-type (WT)-
GFP had multiple SMI-positive axons (insets c, c0 ).(D) At stage III (2DIV), EV-control infected neurons
had one dominant SMI-positive axon.
(E) In contrast, Stk25 shRNA-expressing neurons
often lacked SMI-positive, axon-like processes.
(F) The number of neurons with 0, 1, 2, or more
axons and the length of the longest processes
were determined for neurons infected with
the indicated viruses. For rescue experiments,
neurons were coinfected with the Stk25 shRNA
(GFP-positive) and either RFP, Stk25* WT-RFP,
or Stk25* K49R-RFP expressing viruses (lanes
7–9, Figure S1).
(G) At stage III (2DIV), many Stk25 shRNA-
expressing neurons lacked axons as compared
to a small percentage of EV-control infected
neurons.
(H) The number of neurons with multiple axons
was increased in dab1�/� (lane 2) compared to
wild-type neurons (lane 1, duplicated from F),
and this was reduced by Stk25 shRNA expression
(lanes 3).
(I) Primary hippocampal neurons that were in-
fected with either GFP- or Stk25 WT-GFP-ex-
pressing viruses were split into three groups and
grown in either neurobasal (NB), control-condi-
tioned (CCM), or Reelin-conditioned (RCM) media
for 6 days.
Statistical significance (*,**,***p < 0.0001,
Student’s t test, compared between the sample
pairs: (F) 1:2; 4:5,6,7; 7:8,9; (G) 1:2; (H) 1:2, 2:3;
n > 60; (I) 5:6; n indicated in bars). Bars: (C)
50 mm; (a) 10 mm; (c0) 5 mm; and (E) 20 mm. See
also Figure S1.
significantly longer (Figures 2A, 2B, and
2E). In addition, approximately 40% of
the strongly GFP-positive, Stk25 shRNA-
expressing neurons lacked identifiable
axon initial segments, detected using
anti-phospho-IkBa antibodies, suggest-
ing that axons were either absent or failed
to mature normally (Figures 2D and 2F;
Movie S1). By comparison, all of the GFP-positive, EV-control
electroporated neurons examined had axon initial segments
(Figures 2C and 2F; Movie S1). This suggests that Stk25 regulates
axon specification and dendrite growth in hippocampal pyra-
midal neurons in vivo.
828 Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc.
In addition to having longer apical dendrites, the basal
dendrites of Stk25 shRNA-expressing neurons were also atyp-
ical. Normal pyramidal neurons have long, thick apical dendrites
and much thinner and shorter basal dendrites (Horton et al.,
2005; Figures 2G and 2K; Movie S2). The apical dendrites of
Stk25 shRNA-expressing neurons had normal thickness, but
the basal dendrites were thicker than normal (Figures 2H and
2K; Movie S2). We were not able to measure the length of the
basal dendrites. Therefore, there is evidence for growth of both
apical and basal dendrites, and this reduced the distinction
between apical and basal dendrites in terms of thickness. This
suggests that Stk25 is needed for normal axon production and
dendrite asymmetry in vivo.
Stk25 Interacts with STRADa and Acts on the LKB1Signaling PathwayThe functions of Stk25 resemble those reported for LKB1-
STRAD signaling (Barnes et al., 2007; Kishi et al., 2005; Shelly
et al., 2007). This pathway has a prominent role in cell polarity
control across numerous cell types from Caenorhabditis elegans
to man. LKB1 is partially regulated by binding STRAD, which
both shuttles it from the nucleus to the cytoplasm and stabilizes
it. We therefore investigated whether Stk25 associates with the
LKB1-STRAD signaling complex. By immunoprecipitating
tagged fusion proteins coexpressed in HEK293T cells, we found
that both wild-type and kinase-inactive HA-Stk25 coimmuno-
precipitated with myc-STRADa (Figure S2A). Identifying Stk25
Figure 2. Stk25 Regulates Neuronal Polarity during Brain Development
(A) EV-control vector (GFP-positive, green) electroporated at E16.5 in utero was expressed in Ctip2-positive (red), hippocampal-pyramidal neurons at P7.
(B) Stk25 shRNA-expressing neurons (GFP-positive) were appropriately positioned in the CA1 layer, and their apical dendrites extended further than EV-control.
(C) GFP-expressing, EV-control transfected CA1 neurons had the typical pyramidal shape and phospho-IkBa- (red), GFP-positive (green) axon initial segments
(Sanchez-Ponce et al., 2008) (Movie S1).
(D) In contrast, a high percentage of strongly GFP-positive, Stk25 shRNA-expressing neurons were often misshapen and lacked axon initial segments (Movie S1).
(E) Quantification of apical dendrite length in EV-control and Stk25 shRNA hippocampi.
(F) Quantification of the number of GFP-, Ctip2-positive pyramidal neurons that had axon initial segments (n indicated in bar.)
(G) In EV-control neurons, the Golgi apparatus (trace of GRASP65 signal) is concentrated on the apical side of the neuron (Movie S2).
(H) In Stk25 shRNA-expressing neurons, the Golgi apparatus is broadly distributed throughout the neuron (Movie S2).
(I) Scheme used to determine Golgi distribution in (J).
(J) The Golgi distribution in apical, lateral (combined), or basal quadrants was quantified.
(K) The diameters of the largest apical and basal processes were determined (*p < 0.0005, Student’s t test, n R 12, neurons from three animals).
Bars: (B) 200 mm; (D and H) 10 mm. Error bars indicate standard error of the mean (SEM) in all figures.
Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc. 829
as a direct or indirect STRAD-binding protein suggests a poten-
tial role for Stk25 on the LKB1 pathway.
To investigate whether Stk25 is important for LKB1 function,
we took two approaches. We examined whether (1) Stk25 is
required for LKB1-STRAD-regulated epithelial cell polarization
and (2) Stk25 overexpression rescues the LKB1 knockdown
phenotype in neurons.
We first tested whether reduced Stk25 expression would
inhibit the LKB1-STRAD-dependent polarization of W4 intestinal
epithelial cells. These cells have been engineered to constitu-
tively express LKB1 and express STRAD in response to doxycy-
line, which leads to their polarization (Baas et al., 2004). Most W4
cells infected with EV and control shRNA lentiviruses became
polarized within 24 hr of doxycycline treatment (Figures S2C
and S2E). In contrast, only 20% of cells infected by the human-
ized (h) Stk25 shRNA lentivirus were polarized by doxycycline
treatment (Figures S2C and S2E).
Furthermore, expression of either wild-type or kinase-inactive
Stk25*-RFP rescued STRAD-induced polarization in Stk25
shRNA-expressing W4 epithelial cells (Figure S2F). Collectively,
these experiments show that the Stk25 protein, not its kinase
activity, is required for LKB1-STRAD-regulated epithelial cell
polarization.
We then confirmed that LKB1 knockdown leads to a loss of
axon initiation in cultured hippocampal neurons (Figure 3A;
Barnes et al., 2007; Shelly et al., 2007). We tested whether
Stk25 can rescue or bypass the LKB1 requirement by overex-
pressing Stk25* wild-type (WT)-RFP in LKB1 shRNA-expressing
neurons (Figure 3B). Ninety-two percent of LKB1 knockdown
neurons that expressed Stk25* WT-RFP produced at least one
axon compared to only 48% of RFP-, LKB1 shRNA-coexpress-
ing neurons (Figure 3E). These results are consistent with a role
of Stk25 on the LKB1 pathway to regulate axon induction.
GM130 Interacts with Stk25 and Regulates AxonInductionThe Golgi matrix protein GM130, which has critical roles in regu-
lating Golgi dynamics, was identified in a yeast two-hybrid
screen as an Stk25 binding partner (Preisinger et al., 2004). We
confirmed this interaction by coimmunoprecipitating tagged
Figure 3. Stk25-RFP Overexpression Rescues the Neuronal Polarization Defect Caused by LKB1 but Not by GM130 Knockdown
(A) Expression of LKB1 shRNA (GFP-positive, green) in hippocampal neurons led to an increase in the number of neurons that lack an axon at 6DIV in cells also
expressing RFP (red). (a) Longest process lacks SMI immunoreactivity.
(B) In contrast, overexpressing Stk25* WT-RFP in LKB1 knockdown neurons rescued axon production. (b) Long, axon-like process is SMI positive.
(C) GM130 knockdown (GFP-positive) also caused a reduction in axon production in RFP-positive cells. (c) No SMI imunoreactivity was detected in processes of
the GFP-, RFP-positive neuron.
(D) Stk25* WT-RFP expression did not rescue axonogenesis in GM130 knockdown neurons. (d) Longest process is SMI negative.
(E) Axon number and the length of the longest processes were quantified for the indicated treatment groups. (Lane 1 was duplicated from Figure 1F lane 1.)
(*p < 0.005 compared to lane 1, **p = 0.01 compared to lane 2, Student’s t test.)
Bars: (D) 50 mm; (d) 5 mm. See also Figure S2.
830 Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc.
fusions of GM130 and Stk25 (Figure S2B). Interestingly, kinase-
inactive Stk25 consistently immunoprecipitated with GM130
more efficiently than wild-type, suggesting that Stk25-depen-
dent phosphorylation may destabilize the complex.
Stk25 colocalizes with GM130 at the Golgi apparatus of HeLa
cells (Preisinger et al., 2004). To determine whether Stk25 local-
izes to the Golgi complex in neurons, we raised an antibody to
a region of Stk25 that is divergent from the close relatives
Mst3 and Mst4 (Extended Experimental Procedures). Endoge-
nous Stk25 expression overlapped with the GM130-positive
cis-Golgi in neurons at stage III, coincident with axon specifica-
tion (Figure S2D).
To asses whether GM130 plays a role in neuronal differentia-
tion, we examined GM130 shRNA-expressing neurons for
defects in polarity. Similar to Stk25 and LKB1 knockdown
neurons, knockdown of GM130 reduced axon number at 6DIV
(Figure 3C). GM130 knockdown also caused a significant reduc-
tion in axon initiation in stage III (2DIV) neurons (data not shown).
Stk25*-RFP overexpression in GM130-deficient cells did not
rescue axon number at 6DIV (Figure 3D), which suggests that
GM130 is required for neuronal polarization downstream of
Stk25.
Figure 4. Golgi Apparatus Morphology Is
Regulated by Stk25, LKB1, and GM130
Expression and Reelin Signaling
(A) Stage III neurons that were infected with the
EV-control virus had typical cis-Golgi ribbons
(GRASP65, Movie S3). In contrast, the cis-Golgi
in Stk25 shRNA-, LKB1 shRNA-, or GM130
shRNA-expressing neurons was fragmented
(Movie S3). GFP signal was omitted for clarity.
(B) Significantly more Stk25 knockdown neurons
had fragmented Golgi complexes compared to
the EV-control and the control shRNA (n, as indi-
cated). LKB1 and GM130 knockdown also
caused significant Golgi fragmentation as com-
pared to EV-control infected neurons. Stk25*-
RFP expression rescued Golgi fragmentation in
LKB1 shRNA but not GM130 shRNA-expressing
neurons.
(C) Neurons overexpressing either Stk25 WT-GFP
or Stk25 K49R-GFP had condensed cis-Golgi
(GRASP65 signal) compared to EV-controls when
grown in either neurobasal or control-CM. Growth
in Reelin-CM partially rescued the Golgi appear-
ance in Stk25-overexpressing cells. GM130 and
GRASP65 colocalized under all conditions (not
shown).
(D) Golgi volume (upper panel) and the length of
the longest Golgi ribbon (lower panel) were deter-
mined (*p < 0.0001, Student’s t test, n indicated in
bars).
Bars: 5 mm. See also Figure S3.
Stk25, GM130, and LKB1 RegulateGolgi DistributionPreviously it was shown that GM130
regulates Golgi morphology in HeLa cells
(Puthenveedu et al., 2006). Given that
Stk25, LKB1, and GM130 regulate axon
initiation, and the position of the Golgi apparatus early in differen-
tiation normally coincides with axonal localization (de Anda et al.,
2005, 2010), we examined whether Stk25, LKB1, and GM130
regulate Golgi morphology (Figure 4). Individually knocking
down Stk25, LKB1, and GM130 in stage III primary hippocampal
neurons resulted in dispersion of Golgi elements in a high
percentage of cells, in contrast to the typical elongated
morphology observed in the EV-control neurons (Figures 4A
and 4B; Movie S3).
Interestingly, the Golgi fragmentation caused by LKB1 knock-
down was rescued by Stk25*-RFP overexpression (Figure 4B),
suggesting that Stk25 overexpression can compensate for
reductions in LKB1 signaling. In contrast, Golgi fragmentation
in GM130 shRNA-expressing cells was not rescued by Stk25
overexpression (Figure 4B). Overexpression of either Stk25
WT-GFP or Stk25 K49R-GFP led to the condensation of the
Golgi into a smaller volume (Figure 4C, neurobasal). Therefore,
increasing or decreasing Stk25 expression from endogenous
levels has different consequences for Golgi morphology, in addi-
tion to having the opposite effects on axon production. These
results suggest an LKB1-Stk25-GM130 pathway for Golgi regu-
lation in cultured neurons.
Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc. 831
Importantly, Stk25 knockdown in hippocampal pyramidal
neurons also caused Golgi fragmentation in vivo, as determined
by use of in utero electroporation. Normally, the Golgi is strictly
localized to the apical side of the soma and forms outposts in
the apical dendrite (Horton et al., 2005; Figures 2G and 2J; Movie
S2). However, in Stk25 shRNA-expressing, Ctip2-positive
neurons, the Golgi apparatus was often broadly distributed
throughout the soma (Figures 2H and 2J; Movie S2).
In summary, these results indicate that Stk25, LKB1, and
GM130 are required for normal Golgi morphology in neurons at
a time when axons are first appearing. Furthermore, the frag-
mented Golgi phenotype correlated with the loss of axon
production in neurons, and both phenotypes were rescued by
Stk25 overexpression in LKB1 knockdown cells.
Reelin Signaling Regulates Golgi MorphologyAs Stk25 and Reelin have opposing effects on axon initiation
(Figure 1H) and Stk25 affects Golgi morphology (Figures 4A
and 4B), we investigated the role of Reelin in regulating Golgi
morphology.
First we examined the appearance of the Golgi apparatus in
hippocampal and neocortical pyramidal neurons of reelin�/�
and dab1�/� mutant mice. In the pyramidal layer of the wild-
type CA1 zone and in developing neocortical layers, the Golgi
apparati were linearly organized and extended tens of microns
into the apical processes (Figure 5D; Figures S4D and S4G,
insets). The Golgi of the reelin�/� and dab1�/� mutants often
appear convoluted near the nucleus rather than extended into
a dendrite (Figures 5E and 5F; Figures S4E and S4F, insets).
The distance from the Ctip2-positive nucleus to the tip of
the Golgi ribbon was significantly decreased in reelin�/� and
dab1�/� mutants as compared to wild-type (Figure 5G and Fig-
ure S4G), indicating that the reelin and dab1 genes either directly
or indirectly regulate Golgi extension into the apical process of
pyramidal neurons.
As reelin and dab1 also regulate the proper layering of hippo-
campal pyramidal neurons (Caviness and Sidman, 1973; Goffi-
net, 1984; Rice et al., 2001) (Figures 5B and 5C), the effects of
reelin and dab1 on Golgi deployment may be indirect. Therefore,
we tested whether Reelin-Dab1 signaling acutely induces
changes in Golgi morphology or localization by treating hippo-
campal neuron cultures with Reelin for 30 min. Hippocampal
pyramidal neurons were infected with a low titer GFP-expressing
lentivirus to help visualize individual neurons. The Golgi was
largely localized close to the nucleus in control-conditioned
media (CM) and neurobasal-treated Ctip2-positive pyramidal
neurons (Figures 6A and 6C). However, in approximately
80% ± 5% of Reelin-CM-treated neurons, the Golgi apparati
extended into the largest dendritic process (Figures 6A and
6C). The distance between the nucleus and the most distal
portion of the Golgi ribbon from randomly selected Ctip2-posi-
tive neurons was significantly larger in the Reelin-CM-treated
samples compared to the control-CM- and neurobasal-treated
samples (Figure 6B). The Golgi apparatus is therefore rapidly
deployed into dendrites in response to Reelin stimulation.
We next evaluated whether the Golgi response to Reelin was
sensitive to elevated Stk25 expression levels. Hippocampal
neurons were infected with Stk25 WT-GFP or Stk25 K49R-GFP
expressing viruses after 72 hr in culture and treated analogously
to experiments described above. Expression of either Stk25
WT-GFP and Stk25 K49R-GFP reduced but did not eliminate
the Golgi extension in response to Reelin (Figures 6B and 6C).
Under these conditions, linear Golgi ribbons were observed
extending into the dendrites, but on average this was approxi-
mately 50% the distance observed in the Reelin-treated, GFP-
expressing cells (Figure 6B). Furthermore, Reelin signaling
suppressed Golgi compaction induced by Stk25 overexpression
(Figures 4C and 4D). In cultures that were grown in Reelin-CM for
2 days (Figure 4), we did not observe Golgi deployment into
dendrites. This is not surprising as components of the Reelin-
Dab1 pathway begin to be degraded within a few hours. In
60-day-old animals, Golgi extension into dendrites was also
reduced (data not shown). Therefore, Golgi deployment appears
Figure 5. The Golgi Apparatus Extends into an Apical Process in
Neonatal Hippocampus in a reelin- and dab1-Dependent Manner
(A) Ctip2-positive CA1 neurons are organized into a tight lamella in wild-type
brain.
(B) Homozygous disruption of reelin or (C) dab1 causes dispersion of these
neurons.
(D) Confocal imaging through the CA1 region of the wild-type hippocampus
revealed that the Golgi apparatus (white or green, inset) extends radially into
the presumptive apical dendrite of Ctip2-positive neurons (red, inset).
(E) In equivalent reelin�/� or (F) dab1�/� mutant sections, the Golgi is more
often convoluted proximal to the nucleus (inset). Insets were selected from
regions where isolated cells could be distinguished.
(G) The Golgi phenotype was quantified by measuring the distance from the
nucleus to the furthest tip of the Golgi ribbon. (*p < 0.0001, Student’s t test,
n indicated in bar from three animals per group.)
Bar: 200 mm in (C), 20 mm in (F), and 2 mm in inset. See also Figure S4.
832 Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc.
to be a transient, developmental phenomenon. Thus, similar to
the manifestation of the multiple axon phenotype caused by
Stk25 overexpression or loss of dab1 gene function, the degree
of Golgi extension seems to be determined by a competition
between Reelin-Dab1 signaling and Stk25 levels.
DISCUSSION
In this study, we find that Reelin-Dab1 signaling acts in an
opposing manner to LKB1, GM130, and Stk25 to regulate the
polarization of axons, dendrites, and Golgi apparati of hippo-
campal neurons, as shown in Figure 7. Knocking down these
three proteins led to Golgi fragmentation and inhibited axon
initiation (Figure 1, Figure 3, and Figure 4). In contrast, Stk25
overexpression caused Golgi condensation and the formation
of multiple axons (Figure 1 and Figure 4). It also rescued axon
production and Golgi fragmentation caused by LKB1 knockdown
but did not rescue either phenotype caused by reduced GM130
expression (Figure 3 and Figure 4), suggesting that Stk25 func-
tions as an intermediary between LKB1 and GM130. Stk25
directly or indirectly binds to the LKB1-STRAD complex and
GM130 and may play a scaffolding role to link LKB1 signaling
to GM130 and Golgi regulation (Figure S2). Reelin-Dab1 signaling
antagonizes the effects of Stk25 overexpression on Golgi
morphology and neuronal polarization as well as inducing polar-
ized deployment of the Golgi into the apical dendrite (Figure 1,
Figure 4, and Figure 6). Together this implicates the LKB1
pathway, GM130, Stk25, and Reelin-Dab1 signaling in Golgi
regulation during neuronal polarization.
Involvement of the Golgi Apparatus in NeuronalPolarizationThe Golgi apparatus and centrosomes reorient as neurons
migrate into the cortical plate (de Anda et al., 2010; Nichols and
Olson, 2010). At the time of axon initiation, the centrosome is
near the basal pole (rear) of the cell. It then moves to the opposite
pole (front) and is important for extending an apical process that
is used for radial migration (de Anda et al., 2010). The apical
process subsequently transforms into the apical dendritic tree,
with the Golgi and centrosomes at its base (Barnes et al., 2008;
Horton et al., 2005). The same events presumably occur during
migration of hippocampal pyramidal neurons in vivo. When
hippocampal neurons are cultured, the centrosome position
determines which neurite becomes an axon (de Anda et al.,
2005). Later, the apical localization of the Golgi apparatus pro-
motes the asymmetric growth of the apical compared to the basal
dendrites (Horton et al., 2005). Consistent with this, Stk25 knock-
down led to Golgi disorganization, inhibited axon induction, and
lessened the asymmetry between the long, thick apical dendrite
and short, slender basal dendrites (Figures 2F, 2H, 2J, and 2K).
The Golgi may influence axon initiation through nucleating
microtubules, regulating secretory trafficking, or interacting
Figure 6. Reelin Stimulation Leads to Rapid Golgi Extension into Dendrites
Primary hippocampal neurons were infected with GFP-expressing viruses after 3DIV and stimulated 3 days later.
(A) The Golgi apparati in Reelin-CM-treated neurons extended tens of microns into dendrites, compared to little or no extension into dendrites of control-CM or
neurobasal-treated neurons.
(B) The distance between the nucleus and the tip of the Golgi was measured for GFP-, Ctip2-positive neurons. Expression of Stk25 WT-GFP and Stk25 K49R-GFP
caused a significant reduction in Reelin-induced Golgi extension.
(C) The Golgi of most GFP-, Ctip2-positive Reelin-CM-treated neurons extended at least 10 mm from the nucleus into or toward a dendrite. Significantly fewer
Golgi were observed in the processes of control-treated samples or Reelin-CM-treated samples that also overexpressed Stk25.
Yellow arrows indicate furthest tip of Golgi ribbon from nucleus. (*p < 0.0001, **p = 0.0002, ***p < 0.05, Student’s t test, between Reelin-CM- and control-treated
samples and between GFP- and Stk25-expressing samples treated with Reelin-CM.) Bars: 10 mm.
Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc. 833
with the centrosome (Efimov et al., 2007; Pfenninger, 2009;
Rosso et al., 2004; Sutterlin and Colanzi, 2010). It seems less
likely that the Golgi is required to supply materials to sustain
axon growth, as none of our manipulations affected axon length,
only axon number. Therefore, the Golgi probably has a signaling
or microtubule nucleation role in axon specification. Indeed,
microtubule stabilization has been shown to enhance axon
formation (Witte et al., 2008), and inhibiting post-Golgi trafficking
disrupts axo-dendritic polarization (Bisbal et al., 2008; Yin et al.,
2008). In dendrites, however, the Golgi may have a role in
supplying materials for dendrite growth, as we detected effects
on dendrite thickness and length (Figures 2E and 2K). Deploy-
ment of the Golgi into the apical dendrite may initiate the forma-
tion of dendritic Golgi outposts, which have been shown to
promote dendrite growth and branching (Horton et al., 2005;
Ye et al., 2007).
We found that Stk25 functions in Golgi morphology and axon
specification as part of an LKB1 pathway (Figure 3 and Figure 4).
LKB1, the mammalian Par-4 homolog, is an evolutionarily
conserved cell polarity protein that is known to regulate axo-
dendritic polarity in neurons (Barnes et al., 2008). LKB1 is acti-
vated upon binding STRAD and MO25 (Alessi et al., 2006).
STRAD stabilized LKB1 in processes prior to axon production
and in the nascent axon, suggesting a role in axon specification
(Shelly et al., 2007). As a master kinase, LKB1 activates several
downstream kinases that regulate various aspects of cell
polarity. These include the Sad A and Sad B kinases, which
are required for neuronal polarization (Barnes et al., 2007; Kishi
et al., 2005). Mst4, another downstream kinase, is closely related
to Stk25. Like Stk25, it binds to GM130 and is enriched in the
Golgi apparatus (Preisinger et al., 2004). Both Mst4 and Stk25
are required downstream of LKB1-STRAD induction for polar-
ized brush border formation in epithelial cells (ten Klooster
et al., 2009; Figure S2). However, although Mst4 kinase activity
is required during this process, the kinase activity of Stk25 is
not needed to induce polarized brush border formation, regulate
Golgi morphogenesis, or polarize hippocampal neurons (Fig-
ure 1F and Figures 4C and 4D). This suggests a kinase-indepen-
dent scaffolding function for Stk25 (Figure 7), which is reminis-
cent of the pseudokinase STRAD (Lizcano et al., 2004). GM130
appears to be necessary for Stk25 effects on Golgi and neuronal
polarization; however, it may not be sufficient. By linking LKB1
signaling to GM130, Stk25 may directly regulate GM130 or indi-
rectly modulate the activity of other Golgi proteins.
Reelin-Dab1 Signaling Regulates Neuronal Polarizationand Golgi DeploymentOur work also shows that Reelin-Dab1 signaling, acting in oppo-
sition to LKB1-Stk25-GM130, affects Golgi morphology and
axon formation. The absence of Reelin or Dab1 inhibited Golgi
deployment into the apical dendrite in vivo (Figure 5 and
Figure S4), and long-term growth in Reelin opposed Golgi
condensation induced by Stk25 overexpression in vitro (Fig-
ure 4). Similarly, Dab1 absence induced supernumerary axons
in vitro (Figure 1H), the opposite effect to depleting Stk25.
However, Reelin-Dab1 and LKB1-Stk25-GM130 do not fit into
a simple epistatic relationship. For example, Stk25 depletion
reduces axon number even when Dab1 is absent, suggesting
that Stk25 does not require Dab1 to regulate axon number (Fig-
ure 1). This indicates that LKB1-Stk25-GM130 and Reelin-Dab1
act on the Golgi and axon initiation through different pathways,
and the balance between the two pathways determines the
outcome. In this respect, Golgi distribution is a quantitative trait,
not all or none, and may be influenced by other factors. Indeed,
extended Golgi were observed in a subset of neurons in reelin�/�
and dab1�/� mutant brains (Figure 5 and Figure S4). One possi-
bility is that Reelin-Dab1 and LKB1-Stk25-GM130 regulate
different aspects of Golgi morphology through different mecha-
nisms. For example, Reelin-Dab1 may regulate ER-Golgi vesicle
movement, and LKB1-Stk25-GM130 may affect vesicle fusion.
In sum, we have characterized Stk25, a modifier of the Reelin-
Dab1 pathway, and shown that it acts on the LKB1-STRAD
pathway to regulate Golgi morphology and neuronal polariza-
tion. Stk25 may play a scaffolding role to link LKB1-STRAD to
Golgi regulation through binding GM130, as the kinase activity
was shown to be dispensable for neuronal polarization and Golgi
morphogenesis. We find that Reelin-Dab1 signaling regulates
Golgi morphology and deployment into dendrites in a competi-
tive manner with Stk25. Golgi position has been shown to
enhance local secretory trafficking (Horton et al., 2005; Ye
et al., 2007); thus, this competition may regulate membrane
and protein cargo flow into proximal dendrites. Our findings
provide new insights into the regulation of morphogenic changes
in neurons that drive neuronal polarization and brain lamination.
EXPERIMENTAL PROCEDURES
Expression Vectors
The lentiviral vectors used in this study were based on pLentiLox 3.7 (pLL3.7)
vectors (Rubinson et al., 2003) with the following substitutions: (1) for shRNA
experiments, instead of the CMV promoter, the CMV enhancer/chicken b-actin
Figure 7. Model of Stk25 as a Scaffolding Protein Acting Competi-
tively with Reelin-Dab1 Signaling
LKB1 is known to act in complex with STRAD to regulate cellular polarity
(Alessi et al., 2006). Reelin, the receptors ApoER2 and VLDLR, and Dab1
also form a signaling complex (Hiesberger et al., 1999; Trommsdorff et al.,
1998). STK25 coimmunoprecipitates with STRAD and GM130 (Figure 2S).
Overexpression of LKB1 and STRAD is known to induce the formation of
multiple axons (Barnes et al., 2007; Shelly et al., 2007). Independent of its
kinase activity, STK25 does so also and induces Golgi condensation (Figure 1F
and Figure 4A). Knocking down LKB1, Stk25, or GM130 causes Golgi frag-
mentation/dispersion and lost axon production, the opposite to Golgi conden-
sation and multiple axon formation (Figure 1, Figure 3, and Figure 4) (Barnes
et al., 2007; Shelly et al., 2007). The overexpression phenotypes are sup-
pressed by Reelin stimulation. Dab1�/� neurons (Reelin signaling deficient)
have multiple axons and shorter dendrites (Figure 1F) (Niu et al., 2004). Reelin
stimulation induces Golgi deployment and dendrite growth, phenotypes sup-
pressed by Stk25 expression/overexpression (Figure 2 and Figure 6).
834 Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc.
promoter (Niwa et al., 1991) directs GFP expression; (2) for fusion protein
experiments, instead of the U6 promoter the CMV enhancer/chicken b-actin
promoter directs expression. The shRNA constructs include Stk25 shRNA AG
GAGCTCCTGAAGCACAAAT and control shRNA AGTAGCTCCTAAAGCACA
CAT. The lentivirus production was as previously described (Matsuki et al.,
2008). The knockdown viruses were confirmed to reduce expression of either
Stk25, LKB1, or GM130 (Figure S1 and Figure S3). The Stk25 K49R mutant has
previously been reported to be kinase inactive, which we confirmed (Preisinger
et al., 2004 and data not shown).
Animals
All animals were used in accordance with protocols approved by the Animal
Care and Use Committees of SUNY Upstate Medical University, National Insti-
tutes of Neurological Disorders and Stroke, and the Fred Hutchinson Cancer
Research Center, following NIH guidelines. Time pregnant mice (C57BL/6
for in vitro experiments and Swiss Webster for in utero electroporations) and
rats (Sprague Dawley) were purchased from Charles River Laboratories and
Taconic. The dab1�/� (Howell et al., 1997) and reelin�/� (Jackson Labs)
mice were on the C57BL/6 strain.
Immunocytochemistry
Immunocytochemistry was done according to published methods (Matsuki
et al., 2008) and is detailed in the Extended Experimental Procedures along
with a list of the antibodies used. To measure Golgi volumes and length of
the longest Golgi ribbon, we immunostained the neurons with anti-GRASP65,
anti-GFP, and anti-Ctip2, which recognizes a CA1 and layer V pyramidal
neuron-specific transcription factor. The area of the Golgi apparatus was
calculated for each Z-plain (Image Examiner, Zeiss), multiplied by the thick-
ness of the section, and summed to determine the volume.
Cell Culture
Hippocampal neuronal cultures were isolated from embryonic day (E) 17.5
mice or E18.5 rats and grown in neurobasal samples supplemented with 2%
B27 (Invitrogen, Matsuki et al., 2008). For polarity studies, neurons (1 3 104
cells per cm2) were infected with the respective viruses on the day of culturing
and replated 2 days later on poly-L-lysine coated coverslips placed over
a monolayer of astrocytes. Axons were quantified at 2 days in vitro (DIV) or
6DIV as indicated, following standard criteria (Shelly et al., 2007). For Golgi
deployment assays, rat cultured neurons (3 3 105 cells per cm2) were infected
with low titer virus on day 3 and treated and fixed on day 6 in culture. Similar
results were obtained with mouse neurons (data not shown). The control-
and Reelin-conditioned media were collected and concentrated as previously
described (Matsuki et al., 2008).
Analysis of In Utero Electroporated Brains
To knock down Stk25 expression, DNA was injected into the lateral ventricle of
E17.5 embryos of Swiss Webster mice in utero and electroporated (70 mV) as
previously described (Olson et al., 2006) with the electrode paddles oriented to
direct the DNA into the hippocampus. Perfused brains were processed for
analysis on P7. Floating sections (70–100 mm) were immunostained with anti-
bodies described in the figure legends. Confocal images were collected with
overlapping optical sections through 30 mm, which were flattened for display.
We assessed whether axon initial segments or Golgi elements belonged to
a particular GFP-positive neuron (Figure 2), by examining movies of either
3D-rendered images or Z sections (Movie S1 and Movie S2). Golgi areas
(Figures 2G and 2H) were produced by thresholding (Adobe Photoshop) flat-
tened, 2D-negative images to match the GRASP65 signal channel in the orig-
inal and discarding the signal extraneous to the GFP-positive cells (Movie S2).
Process diameters were measured 12 mm from the nucleus (Figure 2K). These
measurements were done using Image Examiner (Zeiss). Measurement of
dendrite lengths was done using the softWoRx (AppliedPrecision).
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures, four
figures, and three movies and can be found with this article online at doi:
10.1016/j.cell.2010.10.029.
ACKNOWLEDGMENTS
We would like to thank Zainab Mansaray and Kristin Giamanco for experi-
mental assistance, Michael Zuber for comments on the manuscript, Hans
Clevers for cell lines, Louis Cantley and Jun-ichi Miyazaki for DNA vectors,
Arvydas Matiukas and Melissa Pepling for assistance with confocal micros-
copy, and Bonnie Lee Howell for editing. This work was supported by funds
from the NINDS intramural program and SUNY Upstate Medical University
to B.W.H.; NIH grants NS066071 to E.C.O., NS069660 to R.T.M., and
CA41072 to J.A.C.; and NIA intramural funds for M.R.C.
Received: May 3, 2010
Revised: August 27, 2010
Accepted: October 20, 2010
Published: November 24, 2010
REFERENCES
Alessi, D.R., Sakamoto, K., and Bayascas, J.R. (2006). LKB1-dependent
signaling pathways. Annu. Rev. Biochem. 75, 137–163.
Arimura, N., and Kaibuchi, K. (2005). Key regulators in neuronal polarity.
Neuron 48, 881–884.
Arimura, N., and Kaibuchi, K. (2007). Neuronal polarity: from extracellular
signals to intracellular mechanisms. Nat. Rev. Neurosci. 8, 194–205.
Arnaud, L.,Ballif,B.A., Forster, E., andCooper, J.A. (2003). Fyn tyrosine kinase is
a critical regulator of disabled-1 during brain development. Curr. Biol. 13, 9–17.
Asada, N., Sanada, K., and Fukada, Y. (2007). LKB1 regulates neuronal migra-
tion and neuronal differentiation in the developing neocortex through centro-
somal positioning. J. Neurosci. 27, 11769–11775.
Baas, A.F., Kuipers, J., van der Wel, N.N., Batlle, E., Koerten, H.K., Peters, P.J.,
and Clevers, H.C. (2004). Complete polarization of single intestinal epithelial
cells upon activation of LKB1 by STRAD. Cell 116, 457–466.
Barnes, A.P., Lilley, B.N., Pan, Y.A., Plummer, L.J., Powell, A.W., Raines, A.N.,
Sanes, J.R., and Polleux, F. (2007). LKB1 and SAD kinases define a pathway
required for the polarization of cortical neurons. Cell 129, 549–563.
Barnes, A.P., Solecki, D., and Polleux, F. (2008). New insights into the molec-
ular mechanisms specifying neuronal polarity in vivo. Curr. Opin. Neurobiol.
18, 44–52.
Barr, F.A., and Short, B. (2003). Golgins in the structure and dynamics of the
Golgi apparatus. Curr. Opin. Cell Biol. 15, 405–413.
Bisbal, M., Conde, C., Donoso, M., Bollati, F., Sesma, J., Quiroga, S., Dıaz
Anel, A., Malhotra, V., Marzolo, M.P., and Caceres, A. (2008). Protein kinase
d regulates trafficking of dendritic membrane proteins in developing neurons.
J. Neurosci. 28, 9297–9308.
Bock, H.H., and Herz, J. (2003). Reelin activates SRC family tyrosine kinases in
neurons. Curr. Biol. 13, 18–26.
Brich, J., Shie, F.S., Howell, B.W., Li, R., Tus, K., Wakeland, E.K., Jin, L.W.,
Mumby, M., Churchill, G., Herz, J., and Cooper, J.A. (2003). Genetic modula-
tion of tau phosphorylation in the mouse. J. Neurosci. 23, 187–192.
Caviness, V.S.J., Jr., and Sidman, R.L. (1973). Retrohippocampal, hippo-
campal and related structures of the forebrain in the reeler mutant mouse.
J. Comp. Neurol. 147, 235–254.
Chai, X., Forster, E., Zhao, S., Bock, H.H., and Frotscher, M. (2009). Reelin
stabilizes the actin cytoskeleton of neuronal processes by inducing n-cofilin
phosphorylation at serine3. J. Neurosci. 29, 288–299.
Cooper, J.A. (2008). A mechanism for inside-out lamination in the neocortex.
Trends Neurosci. 31, 113–119.
D’Arcangelo, G., Miao, G.G., Chen, S.C., Soares, H.D., Morgan, J.I., and
Curran, T. (1995). A protein related to extracellular matrix proteins deleted in
the mouse mutant reeler. Nature 374, 719–723.
D’Arcangelo, G., Homayouni, R., Keshvara, L., Rice, D.S., Sheldon, M., and
Curran, T. (1999). Reelin is a ligand for lipoprotein receptors. Neuron 24,
471–479.
Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc. 835
de Anda, F.C., Pollarolo, G., Da Silva, J.S., Camoletto, P.G., Feiguin, F., and
Dotti, C.G. (2005). Centrosome localization determines neuronal polarity.
Nature 436, 704–708.
de Anda, F.C., Meletis, K., Ge, X., Rei, D., and Tsai, L.H. (2010). Centrosome
motility is essential for initial axon formation in the neocortex. J. Neurosci.
30, 10391–10406.
Dotti, C.G., and Banker, G.A. (1987). Experimentally induced alteration in the
polarity of developing neurons. Nature 330, 254–256.
Efimov, A., Kharitonov, A., Efimova, N., Loncarek, J., Miller, P.M., Andreyeva,
N., Gleeson, P., Galjart, N., Maia, A.R., McLeod, I.X., et al. (2007). Asymmetric
CLASP-dependent nucleation of noncentrosomal microtubules at the trans-
Golgi network. Dev. Cell 12, 917–930.
Fidalgo, M., Fraile, M., Pires, A., Force, T., Pombo, C., and Zalvide, J. (2010).
CCM3/PDCD10 stabilizes GCKIII proteins to promote Golgi assembly and cell
orientation. J. Cell Sci. 123, 1274–1284.
Forster, E., Bock, H.H., Herz, J., Chai, X., Frotscher, M., and Zhao, S. (2010).
Emerging topics in Reelin function. Eur. J. Neurosci. 31, 1511–1518.
Goffinet, A.M. (1984). Events governing organization of postmigratory
neurons: studies on brain development in normal and reeler mice. Brain Res.
319, 261–296.
Hiesberger, T., Trommsdorff, M., Howell, B.W., Goffinet, A., Mumby, M.C.,
Cooper, J.A., and Herz, J. (1999). Direct binding of Reelin to VLDL receptor
and ApoE receptor 2 induces tyrosine phosphorylation of disabled-1 and
modulates tau phosphorylation. Neuron 24, 481–489.
Horton, A.C., Racz, B., Monson, E.E., Lin, A.L., Weinberg, R.J., and Ehlers,
M.D. (2005). Polarized secretory trafficking directs cargo for asymmetric
dendrite growth and morphogenesis. Neuron 48, 757–771.
Howell, B.W., Hawkes, R., Soriano, P., and Cooper, J.A. (1997). Neuronal posi-
tion in the developing brain is regulated by mouse disabled-1. Nature 389,
733–737.
Howell, B.W., Herrick, T.M., Hildebrand, J.D., Zhang, Y., and Cooper, J.A.
(2000). Dab1 tyrosine phosphorylation sites relay positional signals during
mouse brain development. Curr. Biol. 10, 877–885.
Jacobs, T., Causeret, F., Nishimura, Y.V., Terao, M., Norman, A., Hoshino, M.,
and Nikoli�c, M. (2007). Localized activation of p21-activated kinase controls
neuronal polarity and morphology. J. Neurosci. 27, 8604–8615.
Kishi, M., Pan, Y.A., Crump, J.G., and Sanes, J.R. (2005). Mammalian SAD
kinases are required for neuronal polarization. Science 307, 929–932.
Lizcano, J.M., Goransson, O., Toth, R., Deak, M., Morrice, N.A., Boudeau, J.,
Hawley, S.A., Udd, L., Makela, T.P., Hardie, D.G., and Alessi, D.R. (2004).
LKB1 is a master kinase that activates 13 kinases of the AMPK subfamily,
including MARK/PAR-1. EMBO J. 23, 833–843.
Lowe, M., Rabouille, C., Nakamura, N., Watson, R., Jackman, M., Jamsa, E.,
Rahman, D., Pappin, D.J., and Warren, G. (1998). Cdc2 kinase directly phos-
phorylates the cis-Golgi matrix protein GM130 and is required for Golgi
fragmentation in mitosis. Cell 94, 783–793.
Marra, P., Salvatore, L., Mironov, A., Jr., Di Campli, A., Di Tullio, G., Trucco, A.,
Beznoussenko, G., Mironov, A., and De Matteis, M.A. (2007). The biogenesis of
the Golgi ribbon: the roles of membrane input from the ER and of GM130. Mol.
Biol. Cell 18, 1595–1608.
Matsuki, T., Pramatarova, A., and Howell, B.W. (2008). Reduction of Crk and
CrkL expression blocks reelin-induced dendritogenesis. J. Cell Sci. 121,
1869–1875.
Nichols, A.J., and Olson, E.C. (2010). Reelin promotes neuronal orientation and
dendritogenesis during preplate splitting. Cereb. Cortex 20, 2213–2223.
Niu, S., Renfro, A., Quattrocchi, C.C., Sheldon, M., and D’Arcangelo, G. (2004).
Reelin promotes hippocampal dendrite development through the VLDLR/
ApoER2-Dab1 pathway. Neuron 41, 71–84.
Niwa, H., Yamamura, K., and Miyazaki, J. (1991). Efficient selection for high-
expression transfectants with a novel eukaryotic vector. Gene 108, 193–199.
Ogawa, M., Miyata, T., Nakajima, K., Yagyu, K., Seike, M., Ikenaka, K.,
Yamamoto, H., and Mikoshiba, K. (1995). The reeler gene-associated antigen
on Cajal-Retzius neurons is a crucial molecule for laminar organization of
cortical neurons. Neuron 14, 899–912.
Olson, E.C., Kim, S., and Walsh, C.A. (2006). Impaired neuronal positioning
and dendritogenesis in the neocortex after cell-autonomous Dab1 suppres-
sion. J. Neurosci. 26, 1767–1775.
Pfenninger, K.H. (2009). Plasma membrane expansion: a neuron’s Herculean
task. Nat. Rev. Neurosci. 10, 251–261.
Preisinger, C., Short, B., De Corte, V., Bruyneel, E., Haas, A., Kopajtich, R.,
Gettemans, J., and Barr, F.A. (2004). YSK1 is activated by the Golgi matrix
protein GM130 and plays a role in cell migration through its substrate 14-3-
3zeta. J. Cell Biol. 164, 1009–1020.
Puthenveedu, M.A., Bachert, C., Puri, S., Lanni, F., and Linstedt, A.D. (2006).
GM130 and GRASP65-dependent lateral cisternal fusion allows uniform
Golgi-enzyme distribution. Nat. Cell Biol. 8, 238–248.
Rice, D.S., Nusinowitz, S., Azimi, A.M., Martınez, A., Soriano, E., and Curran, T.
(2001). The reelin pathway modulates the structure and function of retinal
synaptic circuitry. Neuron 31, 929–941.
Rosso, S., Bollati, F., Bisbal, M., Peretti, D., Sumi, T., Nakamura, T., Quiroga,
S., Ferreira, A., and Caceres, A. (2004). LIMK1 regulates Golgi dynamics, traffic
of Golgi-derived vesicles, and process extension in primary cultured neurons.
Mol. Biol. Cell 15, 3433–3449.
Rubinson, D.A., Dillon, C.P., Kwiatkowski, A.V., Sievers, C., Yang, L., Kopinja,
J., Rooney, D.L., Zhang, M., Ihrig, M.M., McManus, M.T., et al. (2003). A lenti-
virus-based system to functionally silence genes in primary mammalian cells,
stem cells and transgenic mice by RNA interference. Nat. Genet. 33, 401–406.
Sanada, K., Gupta, A., and Tsai, L.H. (2004). Disabled-1-regulated adhesion of
migrating neurons to radial glial fiber contributes to neuronal positioning during
early corticogenesis. Neuron 42, 197–211.
Sanchez-Ponce, D., Tapia, M., Munoz, A., and Garrido, J.J. (2008). New role of
IKK alpha/beta phosphorylated I kappa B alpha in axon outgrowth and axon
initial segment development. Mol. Cell. Neurosci. 37, 832–844.
Shelly, M., Cancedda, L., Heilshorn, S., Sumbre, G., and Poo, M.M. (2007).
LKB1/STRAD promotes axon initiation during neuronal polarization. Cell
129, 565–577.
Sutterlin, C., and Colanzi, A. (2010). The Golgi and the centrosome: building
a functional partnership. J. Cell Biol. 188, 621–628.
ten Klooster, J.P., Jansen, M., Yuan, J., Oorschot, V., Begthel, H., Di Giacomo,
V., Colland, F., de Koning, J., Maurice, M.M., Hornbeck, P., and Clevers, H.
(2009). Mst4 and Ezrin induce brush borders downstream of the Lkb1/Strad/
Mo25 polarization complex. Dev. Cell 16, 551–562.
Trommsdorff, M., Borg, J.P., Margolis, B., and Herz, J. (1998). Interaction of
cytosolic adaptor proteins with neuronal apolipoprotein E receptors and the
amyloid precursor protein. J. Biol. Chem. 273, 33556–33560.
Trommsdorff, M., Gotthardt, M., Hiesberger, T., Shelton, J., Stockinger, W.,
Nimpf, J., Hammer, R.E., Richardson, J.A., and Herz, J. (1999). Reeler/
Disabled-like disruption of neuronal migration in knockout mice lacking the
VLDL receptor and ApoE receptor 2. Cell 97, 689–701.
Witte, H., Neukirchen, D., and Bradke, F. (2008). Microtubule stabilization
specifies initial neuronal polarization. J. Cell Biol. 180, 619–632.
Yadav, S., Puri, S., and Linstedt, A.D. (2009). A primary role for Golgi posi-
tioning in directed secretion, cell polarity, and wound healing. Mol. Biol. Cell
20, 1728–1736.
Ye, B., Zhang, Y., Song, W., Younger, S.H., Jan, L.Y., and Jan, Y.N. (2007).
Growing dendrites and axons differ in their reliance on the secretory pathway.
Cell 130, 717–729.
Yin, D.M., Huang, Y.H., Zhu, Y.B., and Wang, Y. (2008). Both the establishment
and maintenance of neuronal polarity require the activity of protein kinase D in
the Golgi apparatus. J. Neurosci. 28, 8832–8843.
Zmuda, J.F., and Rivas, R.J. (1998). The Golgi apparatus and the centrosome
are localized to the sites of newly emerging axons in cerebellar granule
neurons in vitro. Cell Motil. Cytoskeleton 41, 18–38.
836 Cell 143, 826–836, November 24, 2010 ª2010 Elsevier Inc.
Resource
A Human Genome Structural VariationSequencing Resource Reveals Insightsinto Mutational MechanismsJeffrey M. Kidd,1,4 Tina Graves,2 Tera L. Newman,1,5 Robert Fulton,2 Hillary S. Hayden,1 Maika Malig,1 Joelle Kallicki,2
Rajinder Kaul,1 Richard K. Wilson,2 and Evan E. Eichler1,3,*1Department of Genome Sciences, University of Washington School of Medicine, Seattle, WA 98195, USA2Washington University Genome Sequencing Center, School of Medicine, St Louis, MO 63108, USA3Howard Hughes Medical Institute, Seattle, WA 98195, USA4Present address: Department of Genetics, Stanford University, Stanford, CA 94305, USA5Present address: iGenix, Seattle, WA 98110, USA
*Correspondence: [email protected] 10.1016/j.cell.2010.10.027
SUMMARY
Understanding the prevailing mutational mecha-nisms responsible for human genome structural vari-ation requires uniformity in the discovery of allelicvariants and precision in terms of breakpoint delinea-tion. We develop a resource based on capillary endsequencing of 13.8 million fosmid clones from 17human genomes and characterize the completesequence of 1054 large structural variants corre-sponding to 589 deletions, 384 insertions, and 81inversions.We analyze the 2081 breakpoint junctionsand infer potential mechanism of origin. Threemechanisms account for the bulk of germline struc-tural variation: microhomology-mediated processesinvolving short (2–20 bp) stretches of sequence(28%), nonallelic homologous recombination (22%),and L1 retrotransposition (19%). The high qualityand long-range continuity of the sequence revealsmore complex mutational mechanisms, includingrepeat-mediated inversions and gene conversion,that are most often missed by other methods, suchas comparative genomic hybridization, single nucle-otide polymorphism microarrays, and next-genera-tion sequencing.
INTRODUCTION
Despite significant advances in the discovery and genotyping of
human genome structural variation, only a small fraction of
common structural variation has been resolved at the sequence
level (Conrad et al., 2010b; Freeman et al., 2006; Itsara et al.,
2009; Kidd et al., 2008; Lam et al., 2010; McCarroll et al.,
2008b; Redon et al., 2006). The majority of human genome struc-
tural variation has been discovered with single nucleotide poly-
morphism (SNP) microarrays and array comparative genomic
hybridization (arrayCGH), approaches that provide limited infor-
mation about the precise structure and location of identified vari-
ants. Because of their dependence on the reference genome,
array-based approaches preferentially detect deletions over
insertions and are unable to directly detect copy-number-neutral
events such as inversions. Higher-density array platforms give
a better estimation of variant sizes, but most breakpoints cannot
be resolved at a scale finer than 50 bp regions (Conrad et al.,
2010b), while targeted next-generation sequencing approaches
have difficulty resolving breakpoints within homologous
segments (Conrad et al., 2010a).
These methodological biases threaten to skew our under-
standing of the underlying mechanisms responsible for the
formation of structural variation and limit our ability to compre-
hensively discover and genotype this form of genetic variation.
We resolve the breakpoints of 1054 structural variants based
on capillary sequencing of clone inserts. The high-quality
sequence of contiguous variant haplotypes allows alternative
structures to be included in future human genome assemblies
and provides the breakpoint resolution necessary to accurately
genotype these variants in sequence data generated from
next-generation sequencing platforms. The sequences and the
associated clones also provide a resource for assessing future
methods for structural variation discovery.
RESULTS
The Human Genome Structural Variation CloneResourceThe high quality of the reference human genome is due, in large
part, to the fact that it was assembled based on capillary
sequencing of individual large insert clones whose complete
sequence was resolved prior to final genome assembly. This
strategy allowed complex duplicated and repetitive regions to
be incorporated that were missed by other approaches (Istrail
et al., 2004; She et al., 2004). Since genome structural variation
is similarly biased to these regions, we proposed that developing
clone libraries for a modest number of additional genomes would
serve as a valuable resource for characterizing complex and
difficult-to-assay regions of genome structural variation (Eichler
Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc. 837
et al., 2007). The overall strategy involved the construction of
individual genome libraries using a fosmid cloning vector
(40 kb inserts) and capillary sequencing of the ends of the inserts
to generate a high-quality end-sequence pair (ESP). Discrep-
ancies in the length and orientation of these mapped ESPs
with respect to the reference genome serve as signatures of
copy-number variation and inversion, respectively. Since the
underlying clones can be retrieved, the complete sequence
context of the discovered structural variant can also be obtained.
Previously, we discovered and cloned 1695 structural variants
with fosmid libraries derived from nine individuals and presented
sequence of 261 structural variants (Kidd et al., 2008; Tuzun
et al., 2005). We expand this resource to include capillary end
sequencing of 4.1 million additional fosmid clones from eight
additional human genomes (Table S1, available online).
The combined set includes 13.8 million clones derived from the
genomes of six Yoruba Nigerians, five CEPH Europeans, three
Japanese, two Han Chinese, and one individual of unknown
ancestry.
Structural Variant AllelesUsing this resource, we searched for clusters of clones that
suggest a structural difference when compared to the reference.
We discovered a total of 2051 discordant regions (Table S1)
having support from multiple clones for a structure different
from the reference genome. The size distribution of the fosmid
clone inserts limited us to the detection of structural variants
greater than 5 kb in length. Inversions also tend to be biased to
larger events because of the probability of capturing a breakpoint
by a pair of end sequences. While there is no upper bound in the
detection of deletions and inversions, the direct capturing of
insertions larger than the insert size of the clone (40 kb) requires
specialized approaches. For example, new tandem duplications
may be identified with an everted clone mapping signature (Fig-
ure S1) (Cooper et al., 2008) and insertions of novel human
sequence may be identified by read pairs for which only one
end maps (Kidd et al., 2010).
We targeted 1054 structural variants (Table S1) from nine
human genomes and completely sequenced the inserts of
1167 fosmid clones (46.4 Mb of sequence). We identified 81
loci for which breakpoints could not be resolved because of diffi-
culty in clone assembly and the limits of 40 kb fosmid inserts (see
Supplemental Experimental Procedures). We defined break-
points relative to the reference genome assembly following
a two-stage procedure (Kidd et al., 2010) (Figure 1 and Table
S2). We initially distinguished copy-number changes (n = 973
insertion and/or deletions) from balanced genome structural
variants (81 inversions) (Figure 2). The analyzed variants altered
95 gene structures. We estimate that 1.04% (11/1054) of the
sequenced alleles are already known risk factors for common
and rare human diseases (Figure 3 and Table S3).
Breakpoint FeaturesUsing the 40 kb of clone-based sequence, we examined the
sequence features and inferred potential mechanism of origin
for these variants (Table 1). We identified 30 variants associated
with the expansion or contraction of a variable number of
tandem repeats (VNTRs) (Buard et al., 2000; Jeffreys et al.,
1994; Richard et al., 2008). VNTR repeat units ranged from
17 bp to 6.5 kb with copy numbers ranging from 1 to 319
copies. We identified 198 events (20% of the total insertions
and deletions) that we classified as being the result of L1
retrotransposition. Each of the 198 L1 elements associated with
the retrotransposition events has a sequence identity of at least
97.5% when compared to the L1.3 reference sequence, and
152 are at least 6 kb in size, consistent with full-length elements
that may be capable of subsequent retrotransposition (Beck
et al., 2010). We find evidence for transduction of flanking
sequence for 20% (40/198) of the sites, with the transduced
segment size ranging from 45 to 968 nucleotides (median of
81.5) (Goodier et al., 2000; Moran et al., 1999; Pickeral et al.,
2000). Using the transduced sequence as a marker, we identi-
fied the potential donor location for 30 of these retrotransposi-
tions (20 insertions in the fosmid source sample and 10
insertions in the reference genome). We identified three posi-
tions that have each given rise to multiple LINE insertions (Fig-
ure 2B), suggesting the presence of L1 donor hotspots. We
note that 11 of the 20 L1 insertions in the fosmid source
(including the three recurrent L1 donors) correspond to
elements that have been functionally determined to represent
hot L1s, according to assays performed by Beck et al. (2010).
We found two events consistent with the insertion of an intact
HERV-K element: one insertion in the reference sequence (as
indicated by clone AC209281) and an insertion contained in
clone AC226770. Both events showed less than 1% divergence
from the HERV-K sequence (Dewannieux et al., 2006) and were
flanked by long terminal repeats (Tristem, 2000). Our discovery
size thresholds (>5 kb) preclude the identification of smaller ret-
rotransposition events arising from SVA or Alu repeats that are
common when smaller structural variants are considered (Ben-
nett et al., 2008; Korbel et al., 2007; Lam et al., 2010; Mills et al.,
2006).
We divided the remaining 824 structural variants into two
broad categories. Class I consists of variants with no additional
sequence at the breakpoint junction (Figures 4A–4D and
Figure S2). Class II variants contain an additional sequence,
found across the variant junction, that is not present at either
of the other variant breakpoints (Figures 4E–4G). We also
assessed the presence of extended sequence homology
and the extent of matching sequence at the breakpoints. We
note that microhomology is a qualitative term without clear delin-
eation as 1 or 2 bp matches are expected to occur often by
chance (Figure 4) and a range of homologous match lengths is
observed (Conrad et al., 2010a; Lam et al., 2010). Similarly, there
is ambiguity in assigning events to potential mechanisms based
solely on the length of homologous segments. Consequently, we
categorize events based on observed ranges of homology and
consider assignment to specific mechanisms as speculative.
Among the class I events, 49% (289/590) of copy-number
variants contain 2–20 bp of matching sequence, indicating that
microhomology-mediated mechanisms, such as microhomol-
ogy-mediated end joining (MMEJ), contribute to a substantial
fraction (30%) of human structural variation (Table 1) (Hastings
et al., 2009; McVey and Lee, 2008; Payen et al., 2008; Roth
and Wilson, 1986). Although there is large overlap in the variant
size when broken down by extent of homologous sequence
838 Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc.
(Figure 4C), we find that, as a class, the mean size of events
associated with microhomology (2–20 bp of matching sequence,
n = 289, mean size is 9.7 kb) is significantly smaller (p = 0.02926,
two sample t test) than those showing a hallmark of nonallelic
homologous recombination (NAHR) (R200 bp of matching
sequence, n = 177, mean size is 21.0 kb). The analyzed inver-
sions are overwhelming driven by large homologous segments
with 69% (56/81) of all analyzed inversions containing stretches
of matching sequence at least 200 bp in length. In contrast, only
30% (177/590) of the class I copy-number variants contain
matching breakpoint sequences of at least that length. It is
important to note, however, that our clone end-sequence
mapping strategy is biased toward the detection of larger inver-
sions when compared to copy-number variants. This is a direct
consequence of the probability of capturing a breakpoint that
diminishes when inversions become smaller than the clone insert
size. Overall, we find that younger Alu events and segmental
duplications contribute most significantly to the process of
NAHR (Table S4), as expected because of their higher levels of
sequence identity. The strongest enrichment is found for paired
Alu repeats at each breakpoint (5.2-fold enrichment). If each
breakpoint is treated separately, rather than requiring that an
element of the same subfamily be present at both breakpoints
of a variant, then AluY also shows a substantial degree of enrich-
ment (2.6-fold, Table S4). Since AluY is the most recently active
Alu family, dispersed AluY elements are expected to have
a higher degree of sequence identity than other Alu families (Bat-
zer and Deininger, 2002; Cordaux and Batzer, 2009). Closer
examination of the distribution of breakpoints within individual
Alus reveals a nonuniform pattern of breakpoint density (Fig-
ure 3D). The highest density of breakpoints occurs near the posi-
tion of a sequence motif (CCNCCNTNNCCNC) that has been
Align against common junction sequence
| |----| || ||||||||
|||||||| |||--||--||
| |----| || |||| ||||
|||||||| |||--||--||
| |----| || |||| |||| |||||||| |||--||--||
*1*1111* **122** **22
|||||||| |||||||||||| ||||
|| ||
| |----| || |||| |||| |||||||| |||--||--||
Combine pairwise alignments Assess identity
10 kb deletion
break 1 break 2
deletion junction
A
B
C
Figure 1. Sequence and Breakpoint Analyses
Variant breakpoints were defined based on alignments of sequences from the sequenced insertion and deletion alleles. For example, (A) the sequence of fosmid
clone AC207429 is compared with sequence from the corresponding region on chr2. A 10 kb deletion, relative to the reference sequence, is readily apparent
(indicated by the red bracket). The position of segmental duplications, common repeats (LINEs are green, SINEs are purple, and LTR elements are orange),
and RefSeq exons are shown. Sequence segments corresponding to three different breakpoint regions (red, green, and purple bars) are extracted for further
analysis.
(B) The sequence across the variant junction is aligned against each of the other two sequences and the resulting pairwise alignments are merged. The pattern of
sequence identity is assessed to identify the positions where the junction sequence switches from being a better match to the first breakpoint to being a better
match to sequence from the second breakpoint. The breakpoint coordinates correspond to the innermost positions that can be confidently assigned to be before
and after the variant boundary.
(C) The result of aligning the three segments depicted in (A). Alignment columns where the junction sequence matches the sequence from the first (leftmost)
breakpoint are indicated by a 1 while alignment columns where the junction sequence matches the second (rightmost) breakpoint are indicated by a 2. Positions
where all three sequences are the same are indicated by an asterisk (*). The red square highlights the position of the breakpoint coordinates (highlighted in red and
green text). The two breakpoints are separated by seven nucleotides found at both breakpoints with perfect identity (blue text). Highlighted in gray is a 293 bp
segment present at both breakpoints with a sequence identity of 91%. See also Tables S2 and S7.
Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc. 839
associated with meiotic recombination hotspots, is found in
some Alu elements (Myers et al., 2008), and has also been
observed for rearrangements between human and chimpanzee
(Han et al., 2007; Sen et al., 2006).
We find that 16% (153/973) of the insertion and deletion vari-
ants and 9% (7/81) of the inversions contain additional
sequence at the variant breakpoints (class II events; Figure 4).
Many of the additional insertion sequences are relatively short
in length, consistent with nontemplate-directed repair associ-
ated with nonhomologous end joining (Figure 4B). For these
shorter sequences, no inference could be made as to the source
of the additions. However, 41% of all class II variants (66/160)
contain additional sequence at the junction at least 20 bp in
length. Of these longer fragments, 88% (58/66) map to another
location within the human genome. Since we are limited in this
study to directly capturing the breakpoints of insertions smaller
than 40 kb, we repeated this comparison with only deletions
relative to the assembly where we expect to have less of
a bias in terms of variant size. We find that the additional junction
sequences for 30 of 39 class II deletion events at least 20 bp
long map elsewhere in the genome. Seventy-three percent
(22/30) are found on the same chromosome as the variant.
In fact, eight of the insertions map less than 1 kb away from
the variant breakpoint (Figure 4G and Table S5) and all 22 are
less than 250 kb from the breakpoint. This pattern suggests
the action of a replication-associated process that involves
template switching or strand invasion (Hastings et al., 2009;
Lee et al., 2007; Smith et al., 2007). In contrast to the class I
events, only 2% of the class II events (3/160) contained
stretches of homologous sequence flanking the breakpoint
insertion confirming they arose by mechanisms other than
NAHR. Interestingly, if we examine the sequence context of
these regions, we find that 20% (30/153) of class II events
map within 5 kb of a segmental duplication. This represents
a significant enrichment for proximity to duplicated sequence
(p < 0.002 based on comparisons with randomly sampled
sequences) indicating that regions flanking segmental duplica-
tions may be generally more unstable and susceptible to
multiple mutational processes such as template switching
during replication (Itsara et al., 2009; Lee et al., 2007; Payen
et al., 2008).
Gene Conversion and Structural VariationDuring our analysis of putative NAHR events, we identified
10 structural variants having a complex pattern of exchange
inconsistent with a simple model of unequal crossover. The
breakpoint region contains an interleaved pattern of alternating
patches of sequences from flanking homologous segments
(Figure 5). These patterns are reminiscent of multiple rounds of
gene conversion, although each of these events was also asso-
ciated with a copy-number variant event. Using paralogous
sequence variants that distinguish the 50 and 30 homologous
segments, we investigated the overall extent of this nonallelic
exchange (referred to as the conversion tract length), and the
number of switches before unambiguous homology to the 50 or
30 end was re-established. We determined that most (6/10) of
the conversion tracts were relatively short (200–600 bp in length)
with a relatively consistent number (4–6) and length (30–40 bp) of
A B
Figure 2. Sequenced Structural Variant Alleles
(A) Size distribution for 1054 sequenced structural variants. Insertions, deletions, and inversions relative to the genome reference assembly are depicted sepa-
rately. Note that the bins are not of equal sizes. The mean size of the sequenced variants is 14.9 kb for deletions, 6.1 kb for insertions, and 196 kb for inversions.
Our variant selection methodology largely identifies deletions greater than �5 kb and insertions from �5 kb to �40 kb in size and is biased against inversions
smaller than �40 kb.
(B) The relationship between the donor site of transduced sequences and LINE insertion position are given for 30 events with a match to hg18 using BLAT. Rela-
tionships are shown for 20 LINE insertions in library source individuals relative to the reference (blue lines) and for 10 insertions in the genome reference (red lines).
The blue circles represent three different loci associated with multiple distinct LINE insertions. See also Figure S1 and Table S1.
840 Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc.
switches before clear boundaries at the 50 and 30 could be re-es-
tablished (Figure S3). Seven of these events have breakpoints
that map within segmental duplications, and the remaining three
have breakpoints that map within LINEs. Three of the variants
contained at least ten switches. One variant (AC212911) showed
the largest associated conversion tract with a remarkable 182
switches extending over 7.9 kb (Figure 5D). We sequenced the
deletion allele with fosmids derived from three different individ-
uals for one event (AC226182). Each of the three deletion haplo-
types contained identical patterns of interleaved sequence,
a finding that is consistent with the creation of the pattern at
the time of variant formation, or shortly thereafter, rather than
as a result of a continual conversion process between deletion
and insertion alleles leading to a diverse set of related molecules
over time (Figure S3). It is also possible that the conversion
pattern arose before the formation of the structural variant and
that the pattern we observe in sequenced variants is merely
incidental or the result of a series of mismatch repair processes
prior to variant formation. Nevertheless, the observed switch
pattern is reminiscent of patterns of toggling previously
observed at some LINE insertions (Gilbert et al., 2005, 2002;
Symer et al., 2002) and suggests a mechanism of serial strand
invasion/repair during the rearrangement process.
Comparison with Other Genome-wide Studiesand Ascertainment BiasesIn this study we focused on systematically characterizing large
structural variants at the single base-pair level. In order to identify
events that may have been missed by the fosmid ESP approach,
we compared our set of structural variants to other studies that
have discovered and genotyped copy-number variants in the
same DNA samples. We focused on five individuals analyzed
by fosmid end sequencing (Kidd et al., 2008), Affymetrix 6.0 mi-
croarray (McCarroll et al., 2008b), and high-density oligonucleo-
tide arrayCGH (Conrad et al., 2010b). A comparison of the three
studies shows that 11%–65% of discovered variants are unique
to a single study and corresponding experimental platform (Fig-
ure 6). The limited overlap should not be surprising since each
approach preferentially identifies a subset of the total collection
of genomic variation. For example, the fosmid ESP mapping
approach can detect insertions of sequence not represented in
the genome assembly (Kidd et al., 2008, 2010), as well as
balanced events such as inversions (not depicted in Figure 6),
whereas array approaches can more readily detect copy-
number variation caused by large duplications.
Differences in ascertainment extend to the resolution of break-
point sequences. The sequenced variants described in this
chr1
TMEM50A
C1orf63 RHD
AC196511
chr1
LCE3DLCE3ELCE3ALCE3C LCE3B
Repeats
SegDupMasker
0.0
AC196522
AC207974
chr5
MST150 IRGMNEGR1
Repeats
SegDupMasker
AC210916
chr1
10 20 30 40 kb
10 20 30 40 kb10 20 30 40 kb
10 20 30 40 kb
A
B
C
D
Figure 3. Examples of Sequenced VariantsExamples of the complete sequence of structural variant alleles that have been associated with disease risk, including (A) a 45.5 kb deletion upstream of NEGR1,
(B) a 72 kb deletion of RHD, (C) a 3.9 kb and a 20.1 kb deletion upstream of IRGM, and (D) a 32 kb deletion of LCE3C. See also Table S3.
Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc. 841
manuscript include 237 of the regions targeted for array capture
and 454 sequencing (Conrad et al., 2010a). Seventy of these
targeted events were successfully resolved by breakpoint
array-capture experiments (Table S6), with none of the events
containing extended breakpoint homology successfully resolved
by next-generation sequencing.
We also reassessed regions discovered by other studies that
were missed by the fosmid ESP approach. With the standard
fosmid analysis criteria (two or more discordant clones with suffi-
cient quality) (Tuzun et al., 2005), an overlapping deletion site is
only identified for 53% (631/1193) of the corresponding deletion
genotypes reported by Conrad et al. (2010b). The intersection
rate increases to 75% (900/1193 sample-level genotypes) if indi-
vidual deletion clones are considered with reduced quality
thresholds. This suggests that much of the variation missed by
the fosmid ESP approach is a result of random fluctuations in
the level of clone coverage and the quality of individual
sequencing reads (Cooper et al., 2008).
Experimental approaches to discover structural variation can
have reduced sensitivity in regions of segmental duplication
because of difficulty in uniquely mapping reads or designing
array probes (Cooper et al., 2008; Kidd et al., 2008; Tuzun
et al., 2005). We compared the validated structural variants
from Kidd et al. (2008) with those found by read-depth
approaches (Alkan et al., 2009). Alkan et al. (2009) identified
113 genes that differ in copy number among three individuals.
Only 38% of the genes greater than 5 kb (26/69) and identified
as copy-number variable by read-depth intersect with a struc-
tural variant (reported in Kidd et al.[2008]). This result indicates
that even the fosmid ESP approach has underascertained
copy-number variation associated with the most variable dupli-
cated sequences.
We identified 81 loci during our sequence analysis with
evidence for a nonreference structure for which we could not
unambiguously define the variant breakpoint (see Supplemental
Experimental Procedures). Of these 81 loci, 63 are associated
with segmental duplications, including ten examples of tandem
duplications. We note that 23 of these duplication-containing
loci map near gaps in the National Center for Biotechnology
Information (NCBI) build36 genome assembly or to sequences
that have been assigned to a chromosome but not fully inte-
grated into the genome reference sequence. Duplication-medi-
ated copy-number variation remains underascertained in terms
of sequence-level resolution of variant haplotypes and muta-
tional mechanism analysis. If we adjust for these biases, we esti-
mate that the fosmid ESP approach has minimally missed at
least 106 structural variants associated with segmental
duplications.
DISCUSSION
We describe a clone resource from 17 human DNA samples that
provides 135-fold physical coverage of the human genome. The
corresponding catalog and clones can be used to further charac-
terize almost any segment of human euchromatin. We used this
resource to assess breakpoint characteristics of 1054 events.
The nature of our experimental design permitted us to discover
more events mediated by larger segments of homology, providing
a more complete assessment of human genetic variation. Of
particular interest are complex events whose sequence features
have been difficult to previously assess at a genome-wide level.
The high quality and length of the sequenced fosmids combined
with defined paralogous sequence events allowed us to quantify
alternating sequence matches suggestive of interlocus gene
conversion (Bayes et al., 2003; Lagerstedt et al., 1997; Reiter
et al., 1997; Visser et al., 2005).
Using this resource, we obtained the complete structure of
several alleles that have been associated with disease, including
a deletion variant upstream of the NEGR1 gene associated with
increased body mass index (Willer et al., 2009) (clone
AC210916), two deletion polymorphisms upstream of the
IRGM gene associated with Crohn’s disease (Barrett et al.,
Table 1. Summary of Events and Inferred Mechanisms
Event Classification Insertions and Deletions Inversions Potential Mechanisms
Retroelements
L1 198 (20.3%) NA Retrotransposition
HERV-K 2 (0.2%) NA Retrotransposition
VNTR 30 (3.1%) Minisatellite, NAHR
Class I (no additional sequence at breakpoint) 590 (60.6%) 74 (91.3%)
0 or 1 matching nucleotides 82 (8.4%) 10 (12.3%) NHEJ
2–20 matching nucleotides 289 (29.7%) 8 (9.9%) NHEJ, MMEJ
21–100 matching nucleotides 28 (2.9%) 0 NAHR, other
101–199 matching nucleotides 14 (1.4%) 0 NAHR, other
R200 (NAHR) 177 (18.2%) 56 (69.1%) NAHR
Class 2 (additional sequence at breakpoint) 153 (15.7%) 7 (8.6%)
1–10 additional nucleotides 76 (7.8%) 2 (2.5%) NHEJ
>10 additional nucleotides 77 (7.9%) 5 (6.2%) NHEJ, FoSTeS,template switching
Total 973 81
The number of events that fall into each breakpoint class is given. The following abbreviations are used: NHEJ, nonhomologous end joining; FoSTeS,
fork stalling and template switching. See also Table S6.
842 Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc.
50 100 150 200 250 300
0.02
0.04
0.06
0.08
0.10
0.12
Position in Alu
Bre
akpo
int D
ensi
ty
A B
C D
5’bkpnt CAAATGCAATGTTTATTAAGCAGGTACTTTGTGCTCAAGAGTATGATACAGAGCACTATAC209239 CAAATGCAATGTTTATTAAGCAGGTACTTTGTGCTCAAGAGTATGATACAGAGCACTAT
5’bkpnt GCTGGGAC209239 GCTGGGATTTGGCAGAGGGGGATTTGGCAGGGTCATAGGACAACAGCGGAGGGAAGGTC
AC209239 AGCTCAGGAGGCTTAGGCATGAGAATCACTTGAACCTGGTAGGCA3’bkpnt CTCAGGAGGCTTAGGCATGAGAATCACTTGAACCTGGTAGGCA
E
F
G
Figure 4. Variant Breakpoint Analyses
(A–D) Class I variants are defined as those without additional nucleotides at the breakpoint. (A) A histogram of the extent of matching breakpoint sequence (black)
and extended breakpoint homology (gray) is shown for 590 class I copy-number events. The red line corresponds to the expected distribution of breakpoint
match lengths found from 100 random permutations. Note that bin sizes are not equal. The increase in extended homology segments 250–299 bp in length corre-
sponds to variants having Alus at their breakpoints. (B) As in (A) zoomed in to show variants having a matching sequence of 20 bp or less. (C) Box plot of variant
size partitioned by length of extended breakpoint homology for 590 class I copy-number variants (red line: median; blue box: interquartile range; whiskers: within
1.53 interquartile range). (D) Breakpoint density map within a consensus Alu repeat sequence based on 269 copy-number variant events (blue box: RNA pol III
promoter; black boxes: AT-rich segment between the two monomers that make up the Alu element and the poly A tail; purple box: position of motif
(CCNCCNTNNCCNC) found in some Alus and associated with recombination hotspots [Myers et al., 2008]).
(E–G) Class II variants contain additional sequence across the breakpoint junction. (E) A class II variant containing a 55 nucleotide-long stretch of additional
sequence (in blue) that is not found at either breakpoint. (F) Histogram of the length of additional sequence found at variant breakpoints (black) and the length
of detected extended homology between breakpoint sequences (gray) for 153 class II copy-number variants. (G) Genomic location for class II unmatched
sequences (>20 bp) associated with deletions. The black lines connect the positions of a class II deletion variant (relative to the genome assembly) and the cor-
responding location where the additional sequence across the variant breakpoint can be found. The relationship for 31 deletion variants is depicted. One event
involves a match to unlocalized sequence on chromosome 1 (chr1_rand). See also Figure S2 and Tables S4 and S5.
Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc. 843
2008; Bekpen et al., 2009; McCarroll et al., 2008a) (clone
AC207974), and the deletion of the LCE3B and LCE3C genes.
In total, we conservatively estimate that 1.04% (11/1,054) of
the discovered variants are associated with disease. This yield
of disease-causing alleles rivals that found by genome-wide
association studies using SNPs, which have identified 779
genome-wide associations based on genotyping of at least
100,000 SNPs (http://www.genome.gov/multimedia/illustrations/
GWAS2010-3.pdf).
Although the functional significance of many of the other struc-
tural variants remains to be determined, the clone resource and
availability of the complete sequence of variant haplotypes will
facilitate future disease association through the rapid design of
assays to test for association with disease (Abe et al., 2009; An
et al., 2009; Kidd et al., 2007) or direct comparison with short
sequencing reads from next-generation sequence platforms
(Kidd et al., 2010; Lam et al., 2010).
We investigated this approach for 1024 non-VNTR sequenced
structural variants (Table S7) and found that 71% (726/1024) of
InsertionAllele
DeletionAllele
AC216822
AC216064
1 200 400 600 800 1000
A
B
AC225624
1 200 400 600 800 1000 1200 1400 1600 1800
AC225305
AC203608
C
AC206476
AC212994
1 1000 2000 3000 4000 5000 6000 7000 8000
AC212911D
AccessionNumber of
switches
Conversion
tract (bp)
Variant
Size (kb)
AC225832 4 2,632 27.6AC225305 4 632 6.7AC216797 4 250 8.7AC215992 4 116 16.2AC211399 6 211 10.1AC212994 6 205 3.9AC226182 6 122 108.7AC203608 10 1,249 20.6AC225624 14 454 5.9AC212911 182 7,899 30.7
E
Figure 5. Breakpoint Assessment Using Paralogous
Sequence Variants
(A) Schematic comparison of the structures of the insertion
and deletion haplotypes of a putative NAHR variant. The blue
and red boxes represent homologous sequences present at
the breakpoints, which mediate the rearrangement. The blue
and red vertical lines identify paralogous sequence variants
that distinguish the 50 and 30 copy of the matching sequence.
Scanning along the deletion allele, which is missing the inter-
vening sequence, one observes single nucleotides specific
with the 50 breakpoint, followed by a stretch of sequence
that matches both, then sequences that match the 30 break-
point.
(B) Representation for three variants showing a classic NAHR
pattern. Each line represents the deletion allele corresponding
to the indicated variant. We note a single unexpected paralo-
gous sequence variant mismatch located 145 bp past the 30
breakpoint, which could correspond to a SNP, short gene
conversion, or alignment artifact because of the placement
of indels between 50 and 30 segments.
(C) Representation of four variants having breakpoints that
show a pattern of alternating sequences that match the 30
then 50 breakpoints.
(D) An extreme pattern of alternating matches that contains
182 switches spanning over a 7.9 kb interval.
(E) Rearrangements associated with gene conversion. See
also Figure S3.
the variants are uniquely identifiable with a read
length of 36 bp and uniqueness threshold permit-
ting up to one substitution. This includes 32 inver-
sions—balanced events that are invisible to array-
based genotyping approaches. As read lengths
increase to 100 bp, we estimate that 88% (902/
1024) of these variants could be genotyped. The
construction of complete alternative haplotypes
then facilitates the use of read-pair information to
distinguish among distinct structural configurations
(Antonacci et al., 2010).
Although, short read technologies may miss
some of the breakpoint sequences, there are
many advantages to the application of short read technology
to genome structural variation. This includes the detection of
thousands more events per individual genome, especially vari-
ants below the detection threshold of the fosmid ESP approach.
The dynamic range response and the sequence specificity of
next-generation sequencing allow absolute copy number and
the identity of duplicated genes to be accurately predicted.
One of the strengths of this clone resource, however, is that it
permits the iterative assessment of predicted variants. Clones
may be retrieved corresponding to structural variants discovered
by other methods applied to these 17 individuals, including
newly developed approaches such as methods for identifying
transposon insertions (Huang et al., 2010; Witherspoon et al.,
2010). Sequencing would provide complete information
regarding the structure of additional events, thereby providing
a resource set of sequenced variant haplotypes. The availability
of the underlying clones and potential location of the variant
within a specific DNA sample provides an approach for more
fully exploring the genetic architecture and mutational properties
844 Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc.
of these regions. Thus, we predict that such a resource will be
a valuable complement for understanding the true complexity
of human genetic variation as human genomes become routinely
sequenced using short read sequencing technology.
EXPERIMENTAL PROCEDURES
Identifying and Sequencing Variant Clones
Sites of structural variation, relative to the reference genome assembly, were
identified through fosmid ESP mapping. Briefly, genomic DNA was obtained
from transformed lymphoblastoid cell lines (available from the Coriell Cell
Repository) and approximately 1 million 40 kb fragments from each individual
were cloned into fosmid vectors. Paired end sequences were obtained from
both ends of each fragment with standard capillary sequencing. The resulting
ESPs were mapped onto the reference assembly to identify clusters of multiple
clones from a single individual showing the same type of discordancy (Tuzun
et al., 2005). We previously identified 1695 structural variants that have been
experimentally validated (Kidd et al., 2008). In this manuscript, we focus on
1054 events for which complete, finished clone sequence is available. High-
quality finished sequence was obtained for all fosmid inserts with capillary-
based shotgun sequencing and assembly with the procedures established
for sequencing clones as part of the Human Genome Project. Some sequenced
clones contain gaps in simple sequence repeats that are not related to the
detected structural variants. For one individual, NA18956, additional clones
were selected with a relaxed threshold of two standard deviations larger or
smaller than the observed mean insert. In some cases, multiple clones were
sequenced for a single event, whereas in other loci a single clone sequence
appeared to contain multiple distinct variants relative to the genome reference.
Identifying Variant Breakpoints
Sequences of individual fosmid inserts were initially compared to the NCBI
build36 (UCSC hg18) genome reference assembly with the program miropeats
(Parsons, 1995) with a match threshold of �s 400. Images summarizing these
comparisons that included annotations of the repeat content, predicted and
observed segmental duplications (with DupMasker [Jiang et al., 2008]), and
RefSeq exons were prepared and examined to identify clones harboring
a structural difference relative to the build36. Clones that mapped to unas-
signed or random parts of the reference genome or that do not contain an
entire event (such as clones that contain one edge of a tandem duplication)
were omitted from analysis. Approximate variant breakpoints were determined
utilizing the context provided by long stretches of contiguous matching
sequence. In many cases, the pattern of common repeats or segmental dupli-
cations was a useful aid in this assessment.
For each variant, three sequences were extracted and aligned. In the case of
a deletion, two sequences at the variant boundaries are extracted from the
genome assembly and one sequence (termed the deletion junction sequence)
is extracted from the clone. For insertions, the junction sequence is extracted
from the genome assembly and two sequences corresponding to the variant
boundaries in the fosmid clone are extracted. For inversions, a single break-
point is directly captured in the sequenced clone. However, the position of
the other breakpoint can be inferred based on a comparison with the genome
assembly. Thus, for inversions, two sequences are extracted from the
assembly at the edges of the inferred inversion and the third sequence is
extracted from the clone. For inversion analysis, one of the chromosome-
derived segments is reverse-complimented prior to alignment.
An alignment is then constructed from the extracted breakpoint segments
(Kidd et al., 2010). First, an optimal global alignment is computed between
the junction fragment and each of the other two fragments with the program
needle with default parameters (Rice et al., 2000). These alignments are then
merged to yield a single, three-sequence alignment. From this alignment,
the innermost positions that can be confidently assigned to be before and after
the structural variant are identified. The resulting positions are used to define
membership as a class I or class II variant and correspond to the breakpoint
match length depicted in Figure 4. Extended breakpoint homology was deter-
mined with both cross_match (http://www.phrap.org/, -minmatch 4 -max-
match 4 -minscore 20 -masklevel 100 -raw -word_raw) without complexity-
adjusted scoring (Chiaromonte et al., 2002) and bl2seq (-W 7 -g F -F F -S 1
-e 20) to identify the longest extent and identity of additional matching
sequence (termed extended breakpoint homology) that included the two
breakpoints. For putative NAHR events, we additionally determined the
longest stretch of 100% perfect identity as well as a parsimonious matching
metric to account for mutations after the time of variant formation (Figure S2).
VNTR and Retroelement Analysis
Events associated with tandem repeats were characterized with the output
from miropeats (Parsons, 1995), tandem repeats finder (Benson, 1999),
DupMasker (Jiang et al., 2008), and RepeatMasker (Smit et al., 1996–2004).
Potential L1 insertions were characterized with both the TSDfinder program
(Szak et al., 2002) and the results of the breakpoint identification and charac-
terization process.
Genotyping Structural Variants with Diagnostic K-mers
Diagnostic k-mers were identified for each variant (Table S7) by extracting
overlapping k-mers of the indicated size across each sequenced breakpoint.
K-mers were then searched against the build36 genome sequence and a set
of sequenced fosmids with mrsFAST (http://mrfast.sourceforge.net/). To be
considered diagnostic, a k-mer must be unique (within the given edit distance
threshold) to the allele variant from which it was derived (Kidd et al., 2010).
ACCESSION NUMBERS
All sequence data have been deposited in GenBank under project ID 29893.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures,
three figures, and eight tables and can be found with this article online at
doi:10.1016/j.cell.2010.10.027.
790 283
128
5
634
278
84 132
25
76
130
5
Kidd et al. N=1,206
Conrad et al. N=1,128
McCarroll et al. N=236
Figure 6. Comparison of Events Detected from Three Studies
Only variants estimated to be >5 kb are included. The Kidd et al. (2008) set
includes sites of insertion or deletion in one of the five samples relative to
the genome assembly; the Conrad et al. (2010b) set includes gains and losses
in at least one of the five samples relative to a reference arrayCGH sample; and
the McCarroll et al. (2008b) set includes CNVs that were successfully geno-
typed on the Affymetrix 6.0 platform and are variable among the five included
samples. Prior to comparison, the variant sets within each study were merged
into a single, nonredundant interval set, and any overlap among regions
between studies was sufficient regardless of which sample a variant was
detected in.
Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc. 845
ACKNOWLEDGMENTS
We thank D. Smith and the staff at Agencourt Biosciences for library produc-
tion, E. Kirkness and staff of the J. Craig Venter Institute for end-sequence data
from the JVCI library, and L. Chen for computational assistance in the mapping
of end-sequence data. We thank S. Girirajan, J. Moran, and C. Payen for
thoughtful discussion; T. Brown for manuscript preparation assistance; and
members of the University of Washington and Washington University Genome
Centers for assistance with data generation. J.M.K. is supported by a National
Science Foundation Graduate Research Fellowship. This work was supported
by the National Institutes of Health Grant HG004120 to E.E.E., who is an inves-
tigator of the Howard Hughes Medical Institute. E.E.E is on the scientific
advisory board for Pacific Biosciences. T.L.N. is an employee and founder of
iGenix Inc.
Received: July 6, 2010
Revised: September 15, 2010
Accepted: October 15, 2010
Published: November 24, 2010
REFERENCES
Abe, H., Ochi, H., Maekawa, T., Hatakeyama, T., Tsuge, M., Kitamura, S., Ki-
mura, T., Miki, D., Mitsui, F., Hiraga, N., et al. (2009). Effects of structural vari-
ations of APOBEC3A and APOBEC3B genes in chronic hepatitis B virus infec-
tion. Hepatol. Res. 39, 1159–1168.
Alkan, C., Kidd, J.M., Marques-Bonet, T., Aksay, G., Antonacci, F., Hormoz-
diari, F., Kitzman, J.O., Baker, C., Malig, M., Mutlu, O., et al. (2009). Personal-
ized copy number and segmental duplication maps using next-generation
sequencing. Nat. Genet. 41, 1061–1067.
An, P., Johnson, R., Phair, J., Kirk, G.D., Yu, X.F., Donfield, S., Buchbinder, S.,
Goedert, J.J., and Winkler, C.A. (2009). APOBEC3B deletion and risk of HIV-1
acquisition. J. Infect. Dis. 200, 1054–1058.
Antonacci, F., Kidd, J.M., Marques-Bonet, T., Teague, B., Ventura, M., Girira-
jan, S., Alkan, C., Campbell, C.D., Vives, L., Malig, M., et al. (2010). A large and
complex structural polymorphism at 16p12.1 underlies microdeletion disease
risk. Nat. Genet. 42, 745–750.
Barrett, J.C., Hansoul, S., Nicolae, D.L., Cho, J.H., Duerr, R.H., Rioux, J.D.,
Brant, S.R., Silverberg, M.S., Taylor, K.D., Barmada, M.M., et al; NIDDK IBD
Genetics Consortium; Belgian-French IBD Consortium; Wellcome Trust
Case Control Consortium. (2008). Genome-wide association defines more
than 30 distinct susceptibility loci for Crohn’s disease. Nat. Genet. 40,
955–962.
Batzer, M.A., and Deininger, P.L. (2002). Alu repeats and human genomic
diversity. Nat. Rev. Genet. 3, 370–379.
Bayes, M., Magano, L.F., Rivera, N., Flores, R., and Perez Jurado, L.A. (2003).
Mutational mechanisms of Williams-Beuren syndrome deletions. Am. J. Hum.
Genet. 73, 131–151.
Beck, C.R., Collier, P., Macfarlane, C., Malig, M., Kidd, J.M., Eichler, E.E.,
Badge, R.M., and Moran, J.V. (2010). LINE-1 retrotransposition activity in
human genomes. Cell 141, 1159–1170.
Bekpen, C., Marques-Bonet, T., Alkan, C., Antonacci, F., Leogrande, M.B.,
Ventura, M., Kidd, J.M., Siswara, P., Howard, J.C., and Eichler, E.E. (2009).
Death and resurrection of the human IRGM gene. PLoS Genet. 5, e1000403.
Bennett, E.A., Keller, H., Mills, R.E., Schmidt, S., Moran, J.V., Weichenrieder,
O., and Devine, S.E. (2008). Active Alu retrotransposons in the human genome.
Genome Res. 18, 1875–1883.
Benson, G. (1999). Tandem repeats finder: a program to analyze DNA
sequences. Nucleic Acids Res. 27, 573–580.
Buard, J., Shone, A.C., and Jeffreys, A.J. (2000). Meiotic recombination and
flanking marker exchange at the highly unstable human minisatellite CEB1
(D2S90). Am. J. Hum. Genet. 67, 333–344.
Chiaromonte, F., Yap, V.B., and Miller, W. (2002). Scoring pairwise genomic
sequence alignments. Pacific Symposium on Biocomputing 7, 115–126.
Conrad, D.F., Bird, C., Blackburne, B., Lindsay, S., Mamanova, L., Lee, C.,
Turner, D.J., and Hurles, M.E. (2010a). Mutation spectrum revealed by break-
point sequencing of human germline CNVs. Nat. Genet. 42, 385–391.
Conrad, D.F., Pinto, D., Redon, R., Feuk, L., Gokcumen, O., Zhang, Y., Aerts,
J., Andrews, T.D., Barnes, C., Campbell, P., et al; Wellcome Trust Case Control
Consortium. (2010b). Origins and functional impact of copy number variation in
the human genome. Nature 464, 704–712.
Cooper, G.M., Zerr, T., Kidd, J.M., Eichler, E.E., and Nickerson, D.A. (2008).
Systematic assessment of copy number variant detection via genome-wide
SNP genotyping. Nat. Genet. 40, 1199–1203.
Cordaux, R., and Batzer, M.A. (2009). The impact of retrotransposons on
human genome evolution. Nat. Rev. Genet. 10, 691–703.
Dewannieux, M., Harper, F., Richaud, A., Letzelter, C., Ribet, D., Pierron, G.,
and Heidmann, T. (2006). Identification of an infectious progenitor for the
multiple-copy HERV-K human endogenous retroelements. Genome Res. 16,
1548–1556.
Eichler, E.E., Nickerson, D.A., Altshuler, D., Bowcock, A.M., Brooks, L.D.,
Carter, N.P., Church, D.M., Felsenfeld, A., Guyer, M., Lee, C., et al; Human
Genome Structural Variation Working Group. (2007). Completing the map of
human genetic variation. Nature 447, 161–165.
Freeman, J.L., Perry, G.H., Feuk, L., Redon, R., McCarroll, S.A., Altshuler,
D.M., Aburatani, H., Jones, K.W., Tyler-Smith, C., Hurles, M.E., et al. (2006).
Copy number variation: new insights in genome diversity. Genome Res. 16,
949–961.
Gilbert, N., Lutz-Prigge, S., and Moran, J.V. (2002). Genomic deletions created
upon LINE-1 retrotransposition. Cell 110, 315–325.
Gilbert, N., Lutz, S., Morrish, T.A., and Moran, J.V. (2005). Multiple fates of L1
retrotransposition intermediates in cultured human cells. Mol. Cell. Biol. 25,
7780–7795.
Goodier, J.L., Ostertag, E.M., and Kazazian, H.H., Jr. (2000). Transduction of
30-flanking sequences is common in L1 retrotransposition. Hum. Mol. Genet.
9, 653–657.
Han, K., Lee, J., Meyer, T.J., Wang, J., Sen, S.K., Srikanta, D., Liang, P., and
Batzer, M.A. (2007). Alu recombination-mediated structural deletions in the
chimpanzee genome. PLoS Genet. 3, 1939–1949.
Hastings, P.J., Ira, G., and Lupski, J.R. (2009). A microhomology-mediated
break-induced replication model for the origin of human copy number varia-
tion. PLoS Genet. 5, e1000327.
Huang, C.R., Schneider, A.M., Lu, Y., Niranjan, T., Shen, P., Robinson, M.A.,
Steranka, J.P., Valle, D., Civin, C.I., Wang, T., et al. (2010). Mobile interspersed
repeats are major structural variants in the human genome. Cell 141, 1171–
1182.
Istrail, S., Sutton, G.G., Florea, L., Halpern, A.L., Mobarry, C.M., Lippert, R.,
Walenz, B., Shatkay, H., Dew, I., Miller, J.R., et al. (2004). Whole-genome
shotgun assembly and comparison of human genome assemblies. Proc.
Natl. Acad. Sci. USA 101, 1916–1921.
Itsara, A., Cooper, G.M., Baker, C., Girirajan, S., Li, J., Absher, D., Krauss,
R.M., Myers, R.M., Ridker, P.M., Chasman, D.I., et al. (2009). Population anal-
ysis of large copy number variants and hotspots of human genetic disease.
Am. J. Hum. Genet. 84, 148–161.
Jeffreys, A.J., Tamaki, K., MacLeod, A., Monckton, D.G., Neil, D.L., and
Armour, J.A.L. (1994). Complex gene conversion events in germline mutation
at human minisatellites. Nat. Genet. 6, 136–145.
Jiang, Z., Hubley, R., Smit, A., and Eichler, E.E. (2008). DupMasker: a tool for
annotating primate segmental duplications. Genome Res. 18, 1362–1368.
Kidd, J.M., Newman, T.L., Tuzun, E., Kaul, R., and Eichler, E.E. (2007). Popu-
lation stratification of a common APOBEC gene deletion polymorphism. PLoS
Genet. 3, e63.
Kidd, J.M., Cooper, G.M., Donahue, W.F., Hayden, H.S., Sampas, N., Graves,
T., Hansen, N., Teague, B., Alkan, C., Antonacci, F., et al. (2008). Mapping and
sequencing of structural variation from eight human genomes. Nature 453,
56–64.
846 Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc.
Kidd, J.M., Sampas, N., Antonacci, F., Graves, T., Fulton, R., Hayden, H.S., Al-
kan, C., Malig, M., Ventura, M., Giannuzzi, G., et al. (2010). Characterization of
missing human genome sequences and copy-number polymorphic insertions.
Nat. Methods 7, 365–371.
Korbel, J.O., Urban, A.E., Affourtit, J.P., Godwin, B., Grubert, F., Simons, J.F.,
Kim, P.M., Palejev, D., Carriero, N.J., Du, L., et al. (2007). Paired-end mapping
reveals extensive structural variation in the human genome. Science 318,
420–426.
Lagerstedt, K., Karsten, S.L., Carlberg, B.M., Kleijer, W.J., Tonnesen, T., Pet-
tersson, U., and Bondeson, M.L. (1997). Double-strand breaks may initiate the
inversion mutation causing the Hunter syndrome. Hum. Mol. Genet. 6,
627–633.
Lam, H.Y., Mu, X.J., Stutz, A.M., Tanzer, A., Cayting, P.D., Snyder, M., Kim,
P.M., Korbel, J.O., and Gerstein, M.B. (2010). Nucleotide-resolution analysis
of structural variants using BreakSeq and a breakpoint library. Nat. Biotechnol.
28, 47–55.
Lee, J.A., Carvalho, C.M., and Lupski, J.R. (2007). A DNA replication mecha-
nism for generating nonrecurrent rearrangements associated with genomic
disorders. Cell 131, 1235–1247.
McCarroll, S.A., Huett, A., Kuballa, P., Chilewski, S.D., Landry, A., Goyette, P.,
Zody, M.C., Hall, J.L., Brant, S.R., Cho, J.H., et al. (2008a). Deletion polymor-
phism upstream of IRGM associated with altered IRGM expression and
Crohn’s disease. Nat. Genet. 40, 1107–1112.
McCarroll, S.A., Kuruvilla, F.G., Korn, J.M., Cawley, S., Nemesh, J., Wysoker,
A., Shapero, M.H., de Bakker, P.I., Maller, J.B., Kirby, A., et al. (2008b). Inte-
grated detection and population-genetic analysis of SNPs and copy number
variation. Nat. Genet. 40, 1166–1174.
McVey, M., and Lee, S.E. (2008). MMEJ repair of double-strand breaks (direc-
tor’s cut): deleted sequences and alternative endings. Trends Genet. 24,
529–538.
Mills, R.E., Luttig, C.T., Larkins, C.E., Beauchamp, A., Tsui, C., Pittard, W.S.,
and Devine, S.E. (2006). An initial map of insertion and deletion (INDEL) varia-
tion in the human genome. Genome Res. 16, 1182–1190.
Moran, J.V., DeBerardinis, R.J., and Kazazian, H.H., Jr. (1999). Exon shuffling
by L1 retrotransposition. Science 283, 1530–1534.
Myers, S., Freeman, C., Auton, A., Donnelly, P., and McVean, G. (2008).
A common sequence motif associated with recombination hot spots and
genome instability in humans. Nat. Genet. 40, 1124–1129.
Parsons, J.D. (1995). Miropeats: graphical DNA sequence comparisons. Com-
put. Appl. Biosci. 11, 615–619.
Payen, C., Koszul, R., Dujon, B., and Fischer, G. (2008). Segmental duplica-
tions arise from Pol32-dependent repair of broken forks through two alterna-
tive replication-based mechanisms. PLoS Genet. 4, e1000175.
Pickeral, O.K., Maka1owski, W., Boguski, M.S., and Boeke, J.D. (2000).
Frequent human genomic DNA transduction driven by LINE-1 retrotransposi-
tion. Genome Res. 10, 411–415.
Redon, R., Ishikawa, S., Fitch, K.R., Feuk, L., Perry, G.H., Andrews, T.D., Fie-
gler, H., Shapero, M.H., Carson, A.R., Chen, W., et al. (2006). Global variation
in copy number in the human genome. Nature 444, 444–454.
Reiter, L.T., Murakami, T., Koeuth, T., Gibbs, R.A., and Lupski, J.R. (1997). The
human COX10 gene is disrupted during homologous recombination between
the 24 kb proximal and distal CMT1A-REPs. Hum. Mol. Genet. 6, 1595–1603.
Rice, P., Longden, I., and Bleasby, A. (2000). EMBOSS: the European Molec-
ular Biology Open Software Suite. Trends Genet. 16, 276–277.
Richard, G.F., Kerrest, A., and Dujon, B. (2008). Comparative genomics and
molecular dynamics of DNA repeats in eukaryotes. Microbiol. Mol. Biol. Rev.
72, 686–727.
Roth, D.B., and Wilson, J.H. (1986). Nonhomologous recombination in
mammalian cells: role for short sequence homologies in the joining reaction.
Mol. Cell. Biol. 6, 4295–4304.
Sen, S.K., Han, K., Wang, J., Lee, J., Wang, H., Callinan, P.A., Dyer, M.,
Cordaux, R., Liang, P., and Batzer, M.A. (2006). Human genomic deletions
mediated by recombination between Alu elements. Am. J. Hum. Genet. 79,
41–53.
She, X., Jiang, Z., Clark, R.A., Liu, G., Cheng, Z., Tuzun, E., Church, D.M.,
Sutton, G., Halpern, A.L., and Eichler, E.E. (2004). Shotgun sequence
assembly and recent segmental duplications within the human genome.
Nature 431, 927–930.
Smit, A., Hubley, R., and Green, P. (1996–2004). RepeatMasker Open-3.0.
http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker.
Smith, C.E., Llorente, B., and Symington, L.S. (2007). Template switching
during break-induced replication. Nature 447, 102–105.
Symer, D.E., Connelly, C., Szak, S.T., Caputo, E.M., Cost, G.J., Parmigiani, G.,
and Boeke, J.D. (2002). Human l1 retrotransposition is associated with genetic
instability in vivo. Cell 110, 327–338.
Szak, S.T., Pickeral, O.K., Makalowski, W., Boguski, M.S., Landsman, D., and
Boeke, J.D. (2002). Molecular archeology of L1 insertions in the human
genome. Genome Biol. 3, research0052.
Tristem, M. (2000). Identification and characterization of novel human endog-
enous retrovirus families by phylogenetic screening of the human genome
mapping project database. J. Virol. 74, 3715–3730.
Tuzun, E., Sharp, A.J., Bailey, J.A., Kaul, R., Morrison, V.A., Pertz, L.M.,
Haugen, E., Hayden, H., Albertson, D., Pinkel, D., et al. (2005). Fine-scale
structural variation of the human genome. Nat. Genet. 37, 727–732.
Visser, R., Shimokawa, O., Harada, N., Kinoshita, A., Ohta, T., Niikawa, N., and
Matsumoto, N. (2005). Identification of a 3.0-kb major recombination hotspot
in patients with Sotos syndrome who carry a common 1.9-Mb microdeletion.
Am. J. Hum. Genet. 76, 52–67.
Willer, C.J., Speliotes, E.K., Loos, R.J., Li, S., Lindgren, C.M., Heid, I.M.,
Berndt, S.I., Elliott, A.L., Jackson, A.U., Lamina, C., et al; Wellcome Trust
Case Control Consortium; Genetic Investigation of ANthropometric Traits
Consortium. (2009). Six new loci associated with body mass index highlight
a neuronal influence on body weight regulation. Nat. Genet. 41, 25–34.
Witherspoon, D.J., Xing, J., Zhang, Y., Watkins, W.S., Batzer, M.A., and Jorde,
L.B. (2010). Mobile element scanning (ME-Scan) by targeted high-throughput
sequencing. BMC Genomics 11, 410.
Cell 143, 837–847, November 24, 2010 ª2010 Elsevier Inc. 847
Scientific Editor, Cell PressCell Press seeks to appoint three Scientific Editors with dual roles covering scientific editing and the review material. These positions will be associated with the Cell Press titles Cancer Cell, Current Biology, Developmental Cell, and Neuron, and expertise in any of the relevant areas covered by these journals will be considered. Working closely with the research community, you will be acquiring, managing, and developing new editorial content for the Cell Press research titles. These positions will also work closely with other aspects of the business, including production, business development, marketing, and commercial sales, and, therefore, provide an excellent entry opportunity to science publishing. You will work as part of a highly dynamic and collaborative editorial group in the Cambridge, MA office. These positions are an exciting opportunity to stay at the forefront of the latest scientific advances while developing a new career in an exciting publishing environment.
Minimum qualifications are a PhD in a relevant life science discipline, and additional postdoctoral or other experience is a plus. Ideal candidates would have a strong scientific background and broad research interests, excellent writing and communica-tion skills, strong organizational and interpersonal skills, as well as creative energy and enthusiasm for science and science communication. Prior publishing or editorial experience is an advantage but is not a requirement.
To apply Please submit to the url below a CV and cover letter explaining your interest in an editorial position and describing your qualifications, research interests, and reasons for pursuing a career in scientific publishing. Applications will be accepted on an ongoing basis through December 1, 2010.
http://reedelsevier.taleo.net/careersection/51/jobdetail.ftl?lang=en&job=SCI00063.
No phone inquiries. Elsevier-Cell Press is an Equal Opportunity Employer.
C
M
Y
CM
MY
CY
CMY
K
EditorAd_CP.pdf 1 10/12/10 4:40 PM
Scientific Editor, Molecular CellMolecular Cell is seeking a full-time scientific editor to join its editorial team. We will consider qualified candidates with scientific expertise in any area that the journal covers. The minimum qualification for this position is a PhD in a relevant area of biomedical research, although additional experience is preferred. This is a superb opportunity for a talented individual to play a critical role in the research community away from the bench.
As a scientific editor, you would be responsible for assessing submitted research papers, overseeing the refereeing process, and choosing and commissioning review material. You would also travel frequently to scientific conferences to follow develop-ments in research and establish and maintain close ties with the scientific community. The key qualities we look for are breadth of scientific interest and the ability to think critically about a wide range of scientific issues. The successful candidate will also be highly motivated and creative and able to work independently as well as in a team.
This is a full-time in-house editorial position, based at the Cell Press office in Cambridge, Massachusetts. Cell Press offers an attractive salary and benefits package and a stimulating working environment. Applications will be held in the strictest of confidence and will be considered on an ongoing basis until the position is filled. To apply Please submit a CV and cover letter describing your qualifications, research interests, and reasons for pursuing a career in scientific publishing, as soon as possible, to our online jobs site:http://www.elsevier.com/wps/find/job_search.careers. Click on “search for US jobs” and select “Massachusetts.” Or:http://reedelsevier.taleo.net/careersection/51/jobdetail.ftl?lang=en&job=SCI0005X.
No phone inquiries, please. Cell Press is an equal opportunity/affirmative action employer, M/F/D/V.
C
M
Y
CM
MY
CY
CMY
K
EditorAd_MC.pdf 1 10/12/10 4:44 PM
Scientific Editor, Cell MetabolismCell Metabolism is seeking a full-time scientific editor to join its editorial team. Cell Metabolism publishes metabolic research with an emphasis on molecular mechanisms and translational medicine. The minimum qualification for this position is a PhD in a relevant area of biomedical research, although additional postdoctoral and/or editorial experience is preferred. This is a superb opportunity for a talented individual to play a critical role in promoting science by helping researchers shape and disseminate their findings to the wider community.
The scientific editor is responsible for assessing submitted research papers, overseeing the refereeing process, and choosing, commissioning, and editing review material. The scientific editor frequently travels to scientific conferences to follow developments in research and establish and maintain close ties with the scientific community. The key qualities we look for are breadth of scientific interest, the ability to think critically about a wide range of scientific issues, and strong communication skills. The successful candidate will also be highly motivated and creative and able to work independently as well as in a team and should have opportunities to pioneer and contribute to new trends in scientific publishing.
This is a full-time in-house editorial position, based at the Cell Press office in Cambridge, Massachusetts. Cell Press offers an attractive salary and benefits package and a stimulating working environment that encourages innovation.
Please submit a CV and cover letter describing your qualifications, general research interests, and motivation for pursuing a career in scientific publishing. Applications will be considered on an ongoing basis until the closing date of November 15th, 2010.
To apply, visit http://reedelsevier.taleo.net/careersection/51/jobdetail.ftl?lang=en&job=SCI0005Y.
No phone inquiries. Elsevier-Cell Press is an Equal Opportunity Employer.
C
M
Y
CM
MY
CY
CMY
K
CellMetEditorAd.pdf 1 10/8/10 2:05 PM
Scientific Editor, NeuronNeuron is seeking an additional full-time scientific editor to join its editorial team based in Cambridge, Massachusetts. Neuron publishes across a range of disciplines includ-ing developmental, molecular, cellular, systems, and cognitive neuroscience.
As a scientific editor, you would be responsible for assessing submitted research manuscripts, overseeing the review process, and commissioning and editing review material for the journal. You would also travel frequently to scientific conferences to follow developments in research and to establish and maintain close ties with the scientific community.
The minimum qualification for this position is a PhD in a relevant area of biomedical research, although previous editorial experience is beneficial. This is a superb opportu-nity for a talented individual to play a critical role in the research community away from the bench. The key qualities we are looking for are breadth of scientific interest and the ability to think critically about a wide range of scientific issues. The successful candi-date will also be highly motivated and creative, possess strong communication skills, and be able to both work independently and as part of a team.
This is a full-time, in-house editorial position, based at Cell Press headquarters in Cambridge, Massachusetts. Cell Press offers an attractive salary and benefits package and a stimulating work environment. Applications will be held in the strictest of confi-dence and will be considered on an ongoing basis.
To apply Please submit a cover letter describing your background, interests, and a candid appraisal of the strengths and weaknesses of Neuron, along with your CV, to http://reedelsevier.taleo.net/careersection/51/jobdetail.ftl?lang=en&job=SCI0006F. Applications will be accepted through December 1st, 2010.
C
M
Y
CM
MY
CY
CMY
K
Neuron_editorAD.pdf 1 11/2/10 12:20 PM
The American Society of Human Genetics is seeking an Editor for The American Journal of Human Genetics. The Editor leads one of the world’s oldest and most prestigious journals publishing pri-mary human genetics research.
Among the Editor’s responsibilities are determining the scope and direction of the scientific con-tent of The Journal, overseeing manuscripts submitted for review and their publication, selecting and supervising a staff consisting of an Editorial Assistant and doctoral-level Deputy Editor, direct-ing interactions with the publisher (currently Cell Press), reviewing quarterly reports provided by the publisher, evaluating the performance of the publisher, and if required, supervising the process of the selection a new publisher. The Editor serves as a member of the Board of Directors of the Ameri-can Society of Human Genetics (ASHG), as well as the ASHG Finance Committee, and presents semiannual reports to the Board. All Associate Editors of The Journal are appointed by the Editor, who also determines their duties. At the ASHG annual meeting, the Editor presides over a meeting of the Associate Editors and presents an annual report to the ASHG membership.
The term of the appointment is five years and includes a yearly stipend. The new Editor will be selected by the end of 2010 and will begin receiving manuscripts approximately in September 2011; there will be partial overlap with the Boston office. Applicants should be accomplished scientists in the field of human genetics and should have a broad knowledge and appreciation of the field. Nominations, as well as applications consisting of a letter of interest and curriculum vitae, should be sent to:
AJHG Editorial Search CommitteeAmerican Society of Human Genetics9650 Rockville PikeBethesda, MD 20814
The American Journal of Human Genetics Editor Position Available
editorad.indd 1 5/7/2010 12:25:11 PM
Editor: Trends in Molecular MedicineWe are seeking to appoint a new Editor for Trends in Molecular Medicine, to be based in the Cell Press offices in Cambridge, Massachusetts.
As Editor of Trends in Molecular Medicine, you will be responsible for the strategic development and content management of the journal. You will be acquiring and devel-oping the very best editorial content, making use of a network of contacts in academia plus information gathered at international conferences, to ensure that Trends in Molecular Medicine maintains its market-leading position.
This is an exciting and challenging role that provides an opportunity to stay close to the cutting edge of scientific advances while developing a new career away from the bench. You will work in a highly dynamic and collaborative publishing environment that includes 14 Trends titles and 12 Cell Press titles. You will also collaborate with your Cell Press colleagues to maximize quality and efficiency of content commissioning and participate in exciting new non-journal-based initiatives.
The minimum qualification is a doctoral degree in a relevant discipline, and post-doctoral training is an advantage. Previous publishing experience is not necessary—we will make sure you get the training and development you need. Good interpersonal skills are essential because the role involves networking in the wider scientific commu-nity and collaboration with other parts of the business.
To apply Please submit a CV and cover letter describing your qualifications, research interests, current salary, and reasons for pursuing a career in publishing at http://reedelsevier.taleo.net/careersection/51/jobdetail.ftl?lang=en&job=SCI0006D. No phone inquiries, please. Cell Press is an equal opportunity employer.
Applications will be considered on an ongoing basis until the closing date of November 26th, 2010.
C
M
Y
CM
MY
CY
CMY
K
TMM_editorAD.pdf 1 11/2/10 12:19 PM
Cell Press is seeking a Business Project Editor to plan, develop, and implement projects that have commercial or sponsorship potential. By drawing on existing content or developing new material, the Editor will work with Cell Press’s commercial sales group to create collections of content in print or online that will be attractive to readers and sponsors. The Editor will also be responsible for leverag-ing new online opportunities for engaging the readers of Cell Press journals.
The successful candidate will have a PhD in the biological sciences, broad scientific interests, a
fascination with technology, good commercial instincts, and a true passion for both science and science communication. They should be highly organized and dedicated, with excellent written and oral communication skills, and should be willing to work to tight deadlines.
The position is full time and based in Cambridge, MA. Cell Press offers an attractive salary and
benefits package and a stimulating work environment. Applications will be considered on a rolling basis. For consideration, please apply online and include a cover letter and resume. To apply, visit the career page at http://www.elsevier.com and search on keywords “Business Project Editor.”
Cell Press Business Project Editor Position Available
businessprojecteditor.indd 1 8/4/2010 3:00:21 PM
23Brain Research take another look
www.elsevier.com/locate/brainres
One re-unified journal, nine specialist sections, 23 receiving Editors ←Authors receive first editorial decision within 30 days of submission ←
“Young Investigator Awards” for innovative work by a new generation of researchers ←
1
EDITOR-IN-CHIEFF.E. Bloom
La Jolla, CA, USA
SENIOR EDITORSJ.F. Baker
Chicago, IL, USAP.R. Hof
New York, NY, USAG.R. Mangun
Davis, CA, USAJ.I. Morgan
Memphis, TN, USAF.R. Sharp
Sacramento, CA, USAR.J.Smeyne
Memphis, TN, USAA.F. Sved
Pittsburgh, PA, USA
ASSOCIATE EDITORSG. Aston-Jones
Charleston, SC, USAJ.S. Baizer
Buffalo, NY, USAJ.D. Cohen
Princeton, NJ, USAB.M. Davis
Pittsburgh, PA, USAJ. De Felipe
Madrid, SpainM.A. Dyer
Memphis, TN, USAM.S. Gold
Pittsburgh, PA, USAG.F. Koob
La Jolla, CA, USA
T.A. Milner New York, NY, USA
S.D. Moore Durham, NC, USA
T.H. Moran Baltimore, MD, USA
T.F. Münte Magdeburg, Germany
K-C. Sonntag Belmont, MA, USA
R.J. Valentino Philadelphia, PA, USA
C.L. Williams Durham,NC, USA
Twenty-three tothe Power of One.
BresAd23_212X276:Ad 6/3/08 9:15 AM Page 1
cell1435cla.indd 1cell1435cla.indd 1 11/18/2010 10:06:05 PM11/18/2010 10:06:05 PM
Announcements/Positions Available
Columbia University’s CCTI is seeking a qualified Associate Research Scientist who will have significant research responsibilities which include directing the large animal operations/facility. Incumbent will be responsible for the research infrastructure of the CCTI. Will monitor and develop standard operating procedures for the research operation. The candidate is required to have a MD. or Ph.D. in biology with significant research experience in transplantation immunology. Salary offered is $84,000 but will commensurate with experience. Interested applicants should send a CV, letter of interest and names of three references to:
Mayra Marte-MirazColumbia University Medical Center
630W. 168th Street New York, NY 10032
or via email at [email protected].
CUMC is an EOE.
cell1435cla.indd 2cell1435cla.indd 2 11/18/2010 10:06:12 PM11/18/2010 10:06:12 PM
Positions Available
Bowes Research Fellows
University of California Berkeley
The Bowes Research Fellows Program at the University of California, Berkeley, is seeking nominations of outstanding recent or imminent Ph.D. and M.D. graduates to be given the freedom to establish an independent research program as an alternative to the traditional postdoctoral experience. Bowes Fellows must have demonstrated exceptional promise and maturity in their graduate careers and be eager to engage the frontiers of biomedical and life sciences. Fellows will receive funding and space sufficient to maintain a laboratory of two to three members for a term of up to five years, free from the need to obtain grant support or the distractions of classroom teaching. Fellows will have principal investigator status, making them eligible to obtain outside funding from grants or other sources as their research programs expand.
Bowes Fellows benefit from the mentorship of our faculty, as well as from the exceptional breadth of our scientific resources and the highly interactive nature of the Berkeley community. In turn, our community benefits from the creative approaches Bowes Fellows take to solving important problems. Because interdisciplinary interactions are key to innovation, we seek to attract individuals who have broad interests in the life sciences and who have diverse expertise in experimental, theoretical and/or computational approaches.
Candidates must be nominated by their current mentor or by another senior investigator who can provide an in-depth analysis of their accomplishments and future potential. Refer potential reviewers to the UC Berkeley Statement of Confidentiality found at: http://apo.chance.berkeley.edu/evalltr.html.
Selected candidates will be asked to submit a brief research plan and to arrange for additional letters of recommendation. Finalists will be invited to interview on the UC Berkeley campus. Nominations must be received by December 15, 2010 and should be sent to (email submissions are preferred):
Michael EisenChair, Bowes Research Fellows Selection Committee
Department of Molecular & Cell BiologyUniversity of California, Berkeley
Stanley Hall 304BBerkeley CA [email protected]
The University of California is an affirmative action, equal opportunity employer.
cell1435cla.indd 3cell1435cla.indd 3 11/18/2010 10:06:16 PM11/18/2010 10:06:16 PM
EuPA now has its own journal!
To receive more information register at:http://www.elsevier.com/locate/jprot
http://www.eupa.org/
Covered byPubMed
Editor in Chief:Juan J. Calvete, Valencia, Spain
Executive Editors:Proteomics in Cell BiologyJean-Jacques Diaz, Lyon, France
Proteomics in MicrobiologyConcha Gil, Madrid, Spain
Proteomics in Plant SystemsJesus V. Jorrín, Córdoba, Spain
Proteomics in Animal ModelsDario Neri, Zürich, Switzerland
Proteomics in Protein ScienceJasna Peter-Katalinic, Münster,Germany
Biomedical Applications ofProteomics and CongressProceedingsJean-Charles Sanchez, Geneva,Switzerland
Proteomics of Body Fluids andProteomic TechnologiesPier Giorgio Righetti, Milan, Italy
Bioinformatics in ProteomicsPeter Højrup, Odense, Denmark
For a complete listing of theeditorial board, visit thejournal’s homepage
Submitting AuthorsManuscripts can be submitted to the
Journal of Proteomics athttp://ees.elsevier.com/jprot
See online version for legend and references.848 Cell 143, November 24, 2010 ©2010 Elsevier Inc. DOI 10.1016/j.cell.2010.11.026
SnapShot: The SUMO SystemSandrine Creton and Stefan JentschMax Planck Institute of Biochemistry, Martinsried 82152, Germany
Jenstch.indd 1 11/18/10 1:43 PM
careers.cell.com
Reach Your Ideal Candidate!
ORDER 888.999.1371 • TECH 888.810.6168 • INQUIRIES [email protected]
full spectrum cell analysis
Nanocrystal Vision
Add the power of nanocrystals to your research. New eFluor® Nanocrystal Conjugation Kits allow you to create your own nanocrystal-conjugated proteins more quickly and simply thanever before.
eFluor® Nanocrystal Conjugation Kits o� er:• Intrinsic Brightness – photostable
� uorophore-conjugated proteins
• Streamlined Protocols – under 30 min hands-on time
• Maximum Versatility – label both polyclonal and monoclonal antibodies
• Flexibility – use eFluor® reagents for ICC, IF, IHC and Flow Cytometry
Conjugate your protein in the morning …See results in the afternoon.
Make your data nanocrystal clear today and see more results. Visit www.eBioscience.com.
MCF-7 cells stained with eFluor® Nanocrystals. Top: Cytokeratin-605NC (pseudocolor green) and Tubulin-650NC (red) conjugated using eFluor® NC Conjugation Kit – Sulfhydryl Reactive. Ki67 staining also shown (blue). Bottom: Cytokeratin-605NC (pseudocolor green) and Tubulin-650NC (blue) conjugated using eFluor® NC Conjugation Kit – Amine Reactive. Ki67 staining also shown (red).