APPLIED MICROBIAL AND CELL PHYSIOLOGY

Cell death in a harmful algal bloom causing species Alexandriumtamarense upon an algicidal bacterium induction

Huajun Zhang & Jinglin Lv & Yun Peng & Su Zhang & Xinli An & Hong Xu &

Jun Zhang & Yun Tian & Wei Zheng & Tianling Zheng

Received: 28 April 2014 /Revised: 3 June 2014 /Accepted: 8 June 2014 /Published online: 25 June 2014# Springer-Verlag Berlin Heidelberg 2014

Abstract Harmful algal blooms occur throughout the world,destroying aquatic ecosystems and threatening human health.The culture supernatant of the marine algicidal bacteriaDHQ25 was able to lysis dinoflagellate Alexandriumtamarense. Loss of photosynthetic pigments, accompaniedby a decline in Photosystem II (PSII) photochemical efficien-cy (Fv/Fm), in A. tamarense was detected under bacterialsupernatant stress. Transmission electron microscope analysisshowed obvious morphological modifications of chloroplastdismantling as a part of the algicidal process. The PSII elec-tron transport chain was seriously blocked, with its reactioncenter damaged. This damage was detected in a relative tran-scriptional level of psbA and psbD genes, which encode theD1 and D2 proteins in the PSII reaction center. And the blockin the electron transport chain of PSII might generate exces-sive reactive oxygen species (ROS) which could destroy themembrane system and pigment synthesis and activated enzy-mic antioxidant systems including superoxide dismutase(SOD) and catalase (CAT). This study indicated that marinebacteria with indirect algicidal activity played an importantrole in the changes of photosynthetic process in a harmfulalgal bloom species.

Keywords Photosynthetic responses . Oxidative stress .

Algicidal bacterium . Alexandrium tamarense

Introduction

Harmful algal blooms (HABs), which are usually associatedwith serious damage to marine and freshwater ecosystems, area frequent and worldwide event. There are several approachesto control HABs, such as physical and chemical algicides (Baiet al. 2011; Lee et al. 2008; Zhou et al. 2007; Wang et al.2012), as well as taking advantage of effective biologicalagents. However, the former two methods are considered highcost and can lead to environmental problems (Anderson 1997;Wang et al. 2010b; Zheng et al. 2012). Therefore, manyresearchers turned their attention to the biological control ofHABs, especially to microorganisms with potential algicidalactivity.

The relationship between bacteria and HAB species, in-cluding both the population dynamics and toxin production(Doucette 2006; Zheng et al. 2011), have got considerableattention. Generally, bacteria can inhibit the growth of red tidealgae through direct or indirect attack (Baker and Herson1978; Banin et al. 2001). The former requires physical contactwith target algal cells; however, the indirect attack meansthat a bacterium excretes algicidal or lytic compoundsagainst the harmful algae. In the last two decades, thereare many studies on the marine bacteria with potentialalgicidal activity (Amaro et al. 2005; Mitsutani et al. 1992; Suet al. 2011; Su et al. 2007b). Most of the known bacteriausually belong into the genera Alteromonas, Bacillus,Flavobacterium , Micrococcus , Planomicrobium ,Pseudoalteromonas, Pseudomonas, and Vibrio (Mayali andAzam 2005).

Photosynthesis of microalgal cells in aquatic environmentscontributes greatly to global primary production (Behrenfeldet al. 2006). Photosynthesis plays an important role in thephotoautotrophic algal lifestyle, as well as for red tide algalspecies. Although there are so many effective abiotic andbiotic agents with algicidal activity, the mechanisms of how

Huajun Zhang and Jinglin Lv contributed equally to this work and shouldbe regarded as co-first authors.

H. Zhang : J. Lv :Y. Peng : S. Zhang :X. An :H. Xu : J. Zhang :Y. Tian :W. Zheng (*) : T. Zheng (*)State Key Laboratory of Marine Environmental Science and KeyLaboratory of the Ministry of Education for Coastal and WetlandEcosystems, School of Life Sciences, Xiamen University, 422,Siming Nan Road, Xiamen 361005, Chinae-mail: jedi@xmu.edu.cne-mail: wshwzh@xmu.edu.cn

Appl Microbiol Biotechnol (2014) 98:7949–7958DOI 10.1007/s00253-014-5886-1

they manage to affect the photosynthetic process in algal cellsremain unknown. Many abiotic factors such as UV-B, heat,salinity, excess metal, and allelochemicals can causephotosynthetic damage to planktonic algae (Lesser1996; Sobrino et al. 2008; Takahashi et al. 2004;Warner et al. 1999). Shukla et al. (Shukla and Rai2006) had studied potassium toxicity to Microcystis,and the results showed that Photosystem II (PSII) isthe primary site of action under K+ stress. Recently, itis reported that three chemical algicides (copper sulfate,hydrogen peroxide, and N-phenyl-2-naphthylamine) couldinhibit the transcription of psaB, psbD1, and rbcL genes inMicrocystis aeruginosa cells, and also block the electrontransport chain, destroying pigment synthesis and membraneintegrity (Qian et al. 2010). However, few studies have fo-cused on the damage caused by biotic factors, especiallybacteria, to the photosynthesis of algal cells.

A novel marine algicidal bacterium, the algicidal bacteriumVibrio sp. DHQ25, with indirect algicidal activity against thetoxic dinoflagellate Alexandrium tamarensewas isolated fromthe Donghai Sea (Su et al. 2007b; Wang et al. 2010a). In ourstudy, the effect of this algicidal bacterium on pigment con-centration, electron transport activities, PSII chlorophyll fluo-rescence, the transcriptional abundance of photosynthesis-related genes, and oxidative stress in A. tamarense was inves-tigated during the alga lysis or algicidal process.

Materials and methods

DHQ25 cultures and supernatant preparation

DHQ25 which has been deposited in Marin CultureCollection of China (MCCC) with the accession number ofMCCC 1F01226 was cultured in modified 2216E medium at28 °C for 3 days. (The final cell density was about 3.5×109 mL−1). Then, the cells were removed by centrifugationat 8,000×g for 10min and the supernatant was filtered througha 0.22-μmMillipore membrane. The supernatant was collect-ed and stored at −80 °C.

Algal cultures and treatment

The axenic dinoflagellate A. tamarense ATGD98-006 whichwas supplied by the Algal Culture Collection, Institute ofHydrobiology, Jinan University, Guangzhou, China, was pre-pared as described by Su et al. (Su et al. 2007a). Algal cellswere cultured in f/2 medium at 20±1 °C on a 12:12-h light-dark cycle with a light intensity of 50 μmol photons m−2 s−1.The cell number was counted under light microscope.Exponential phase axenic cultures were used for further ex-periments, and algal cells were collected by centrifugation at2,000×g for 10 min.

The algicidal effect of DHQ25was carried out in triplicate byadding a series of culture supernatant (0.5, 1.0, and 1.5 mL) into100 mL axenic A. tamarense culture (1×104 cells mL−1) (Wanget al. 2010a). The corresponding autoclaved 2216E broth servedas control. To simplify the expression, these volume-dependentadditions were refined as volume fractions, such as 1.0 % (v/v).The algicidal activity was calculated by the formula

Algicidal activiy %ð Þ ¼ Nc − Ntð Þ = Nc � 100%

Nc represents the number of cells in the control group, andNt represents the number of cells in the treatment group.

Photosynthetic pigments content analysis

Pigments in A. tamarense cells were measured using themethod of Li (Li et al. 2000). The pigments in 20 mL algalcultures were extracted with 80% acetone at −20 °C overnightin the dark followed by centrifugation at 4 °C for 10 min at8,000×g. The supernatant was used to measure absorbancevalues at wavelengths of 663, 646, and 470 nm. The pigmentswere calculated according to the formulae that were reportedby Li:

Ca mg=Lð Þ ¼ 12:21*A663−2:81*A646

Cb mg=Lð Þ ¼ 20:13*A646−5:03*A663

Cx;c mg=Lð Þ ¼ 1; 000*A470−3:27*Ca−104*Cbð Þ=229

A663, A646, and A470 represent absorbance values at wave-lengths of 665, 645, and 470 nm. Ca and Cb represent thecontent of chlorophyll a (Chl a) and chlorophyll b (Chl b).Cx,c

represents total content of carotenoids.

Sample preparation and transmission electron microscopy

After supernatant treatment, algal cells were collected bycentrifugation at 2,000×g for 10 min and then fixed overnightat 4 °C in 0.1 M sodium phosphate buffer (pH 7.4) containing4 % glutaraldehyde. The fixed cells were rinsed three times insodium phosphate buffer, post-fixed for 2 h in 1 % bufferedOsO4, washed three times, and then dehydrated in a gradedethanol series. Samples were then embedded in araldite resin,and thin sections, obtained with an ultramicrotome, werestained with uranyl acetate for 30 min and observed with aJEM2100HC transmission electron microscope (JEOL Ltd.,Tokyo, Japan).

Chlorophyll fluorescence measurement

To assay the Photosystem II (PSII) activity in A. tamarensecells, photosynthetic efficiency was measured using fast

7950 Appl Microbiol Biotechnol (2014) 98:7949–7958

chlorophyll fluorescence on pulse-amplitude modulation fluo-rometers (Walz, Effeltrich, Germany). After the algal cellswere incubated in darkness for 15 min, maximum PSII pho-tochemical yield (Fv/Fm), an indicator of photosynthetichealth, was determined under a saturation flash of3,000 μmol photons m−2 s−1.

Assay of electron transport activities

Electron transport activities of intact cells were measured witha Clark-type oxygen electrode (Oxygraph, Hansatech) at200 μmol photons m−2 s−1 and 25 °C as performed withM. aeruginosa in an earlier study, but with somemodifications(Zhou et al. 2006). The whole electron transport activity wasdetermined by monitoring the light-dependent oxygen uptakewith H2O as the electron donor and methyl viologen (MV) asthe electron acceptor in f/2 medium containing 50 mM Tris-HCl (pH 7.8), 1 mMNaN3, and 0.1 mMMV. PSI activity wasmeasured using the light-dependent oxygen uptake in thepresence of 50 mM Tris-HCl (pH 7.8), 0.1 mM 2,6-dichloro-phenol indophenol (DCPIP), 5 mM ascorbate, 0.1 mM MV,1 mM NaN3, and 50 μM 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU). PSII activity was determined usingoxygen evolution with H2O as the electron donor and p-benzoquinone (p-BQ) as the electron acceptor in f/2 mediumwith 50 mM Tris-HCl and 1 mM p-BQ; 0.5 mMdiphenylcarbazide (DPC) was used to measure the wholeelectron transport activity in the absence of the water-splitting complex. Here, NaN3 was used to inhibit respirationwhile DCMU inhibited PSII activity. The concentration ofchlorophyll was determined as described above.

RNA extraction, reverse transcription, and gene clones

A. tamarense cells were harvested and immediately frozen inliquid nitrogen. The total RNA was extracted using theRNAiso Plus kit (TaKaRa, Dalian, China) following the man-ufacturer’s instructions. RNase-free DNase (Fermentas,Canada) was used to digest the DNA in the total RNA. Forreverse transcription, isolated RNA was mixed witholigo(dT)18 primers and reverse transcriptase in accordancewith the instructions of the reverse transcriptase kit(Fermentas, Canada).

The complementary DNA (cDNA) products were ampli-fied using designed primers as shown in Table 1. Then, thePCR products were gel-purified, cloned into pMD18-T vector(TaKaRa), and sequenced (Invitrogen). Sequence analyseswere performed with DNAMAN 6.0 software.

Quantitative real-time PCR (Q-PCR)

One microgram of total RNAwas used for reverse transcrip-tion. Gene-specific primers were designed according to the

above cloned sequences. The real-time PCR primer pairs forpsbA and psbD are listed in Table 1, with the 18S ribosomalRNA (rRNA) gene as the control. Reversed cDNA (1.6 μL)was mixed with 10 μL SYBR Premix Ex TaqTM (TaKaRa),0.8 μL (10 μM) forward primer, and reverse primer respec-tively, and the final volumes were 20 μL. Quantitative real-time PCR was carried out using a Rotor-Gene 6000 (Corbett,QIAGEN, Germany) under the following protocol: 95 °C for20 s, followed by 45 cycles of 95 °C for 10 s, 60 °C for 20 s,and 72 °C for 20 s. The relative quantification of gene expres-sions in each treatment was evaluated using the 2−△△Ct method(Livak and Schmittgen 2001).

Determination of ROS levels, MDA content,and antioxidative enzyme assays

Intracellular reactive oxygen species (ROS) was detectedusing a fluorescent probe, 2′,7′-dichlorofluorescin diacetate(DCFH-DA), according to the report method (Yin et al.2005), but with slight modifications; 0.5 mL DCFH-DA (thefinal concentration in the mixture was 10 μM) was added tothe cell particles, and the mixture was incubated in an incuba-tor at 37 °C in the dark for 1 h and resuspended every 5 minduring this time. Then, the cells were washed three times withsterile f/2 medium immediately and finally suspended with1 mL sterile f/2 medium. The fluorescence intensity wasmonitored using a spectrofluorometer with excitation wave-length at 485 nm and emission wavelength at 525 nm.

Algal cells were collected using centrifugation at 5,000×gfor 5 min then rinsing in 1 mL of PBS (50 mM, pH 7.4). Afterthe cells were resuspended in PBS, cell disruption was con-ducted using Ultrasonic Cell Disruption System (NingBoScientiz Biotechnological Co., Ltd, China) (80 W, 5 s: 5 s,60 times) below 4 °C. Debris was removed using

Table 1 Primer pairs in A. tamarense for gene cloning and Q-PCR

Gene Sequence (5′-3′)

Gene cloning

18S rRNA Forward: TGCATGGCCGTTCTAGTTGGTGG

Reverse: CACCTACGGAAACCTTGTTACGAC

psbA Forward: CGAGATCAGCCTAGCTATTT

Reverse: TTGGTGGCGTACTGTCATTG

psbD Forward: ATCAACACCAGCAAACAG

Reverse: GGACAGCCATACCAAAGAC

Q-PCR

18S rRNA Forward: TGGTGGAGTGATTTGTCTGGTT

Reverse: CCTGTTATTGCCTCAAACTTCCTT

psbA Forward: CTACGATGTGAAATGGATGC

Reverse: CTTTTTCGGCACCTCTT

psbD Forward: ACAAACCTCCAAAAAGAACCCAACG

Reverse: GCAAGATTATCAACACCAGCAAACAG

Appl Microbiol Biotechnol (2014) 98:7949–7958 7951

centrifugation at 10,000×g for 10 min at 4 °C; 1 mL was usedto assay cellular protein which was detected using the“Coomassie brilliant blue protein analysis kit” (NanjingJiancheng Bioengineering Institute, China), using bovine se-rum albumin as the standard. The rest was stored at −80 °Cuntil it was used to analyze the alteration of malondialdehyde(MDA) (a by-product of lipid peroxidation) and the activitiesof superoxide dismutase (SOD) and catalase (CAT). All theanalysis methods followed the kit’s operation manual fromNanjing Jiancheng Bioengineering Institute, China (Zhanget al. 2013; Zhang et al. 2011).

Gene accession numbers

The GenBankTM accession numbers of cloned genes (18SrRNA, psbA, psbD) were JF901327, JF901329, andJF901330, respectively.

Statistics

All data were evaluated using one-way analysis of variancefollowed by the least significant difference test, with p<0.01and p<0.05 (Origin 8.5 for Windows).

Results

Bacterial algicidal assay

Different concentrations of DHQ25 supernatant were addedinto algal cultures to monitor their effect on A. tamarense.Figure 1 showed that 0.5 % (v/v) supernatant could inhibitapproximately 50 % of the algal cell growth after 24-h expo-sure, and 1.0 % (v/v) supernatant treatment had more than80 % algal cells lysed. However, higher supernatant concen-tration exhibited comparative algicidal activity to the 1.0 %(v/v) treatment. The results suggested that the 1.0 % (v/v)supernatant treatment could inhibit most of the A. tamarensecells within 24 h.

Photosynthetic pigments

Changes in the photosynthetic pigments and energymetabolism-related ATPase in A. tamarense are illustrated inFig. 2. The presence of the algicidal bacterium supernatanthad no distinct effect on the major photosynthetic pigmentsover a 9-h period, but subsequently, 52 % reduction in the Chla content was observed after 12 h and 63 % after 24 h incomparison to untreated cells (Fig. 2). A similar response toDHQ25 supernatant was seen in carotenoid concentration.However, there was no remarkable change in thecarotenoids/Chl a ratio (data not shown), which indicated thatthere was no visible alteration in pigment composition.

Morphological and ultrastructural changes

Monitoring the events involved in the algicidal bacterium-induced cell damage in A. tamarense, morphological alter-ations were observed in algal cells after the stress. Comparedto control cells, vacuolization and plasmolysis in the treatedcells became distinct after 6 h of stress (Fig. 3a, b). Also, thosealgal cells subjected to stress showed large modifications intheir chloroplast structure. The chloroplast was intact in con-trol cells (Fig. 3c), while dismantling of the intact chloroplastleaving randomly distributed pyrenoglobuli among the alteredthylakoids was observed in stressed cells (Fig. 3d).

Chlorophyll fluorescence (Fv/Fm)

Within the 24-h treatment, the Fv/Fm ratio of 0.5 % (v/v)stressed cells had the same level as that in control cells

Fig. 1 Impact of volume fraction of the Vibrio sp. DHQ25 supernatant onA. tamarense growth after 24-h exposure. All data were mean±SD (n=3)

Fig. 2 Chlorophyll a and carotenoid contents of A. tamarense exposed to1.0 % (v/v) bacterial supernatant. All data were mean±SD (n=3). Openbars represent chlorophyll a, black bars represent carotenoid

7952 Appl Microbiol Biotechnol (2014) 98:7949–7958

(Fig. 4). In contrast to these cells, where the Fv/Fm valuestended to restore after the first 9 h, a severe decrease inphotosynthetic efficiency (Fv/Fm) was measured in 1.0 and1.5 % (v/v) treated cells after this 9 h (Fig. 4). Variation inthese values showed that Fv/Fm in serious-treated cells couldnot recover to the original ratio even given 24 h to acclimate,which indicated that the PSII electron transport chain wasblocked under DHQ25 supernatant stress.

Photosynthetic electron transport

All components of the electron transport chain showed differ-ent responses to the bacterial supernatant. Compared with PSI,PSII experienced more damage when exposed to DHQ25supernatant. The electron transport activities of the wholechain showed a 50.48 % decrease, while the inhibition rateon PSI (DCPIPH2→MV) was only 35.19 % (Table 2). Incontrast, PSII activity (H2O→p-BQ) decreased about50.48 % when algal cells were treated for 6 h. Therefore,PSII might be the primary location of supernatant stress, orperhaps the electron transport chain between PSII and PSI wasalso suppressed by the treatment.

Transcription of photosynthesis-related genes

DHQ25 supernatant greatly affected the transcription ofphotosynthesis-related genes, including two key genes(psbA and psbD) of the PSII system. The psbA and psbDgenes have been reported to participate in the synthesis of theD1 and D2 protein, respectively, in the reaction center of PSII(Nishiyama et al. 2001). The transcription of 18S rRNA actedas the internal control in the estimation of the expression levelof genes in this study. Indeed, the presence of DHQ25 super-natant significantly downregulated psbA transcription by 73and 82 % at the two time points analyzed in A. tamarense(Fig. 5). The influence of psbD on the transcript abundancewas similar to that of psbA (Fig. 5), which indicated that thephotosynthetic processes in algal cells might already havebeen exposed to bacterial supernatant stress.

Effect of ROS levels, MDA contents, and antioxidativeenzyme activity

Excessive reactive oxygen species (ROS) may cause irrevers-ible oxidative damage to proteins, lipids, and nucleic acids and

Fig. 3 Ultrastructure ofA. tamarense after exposure toDHQ25 supernatant for 6 h withthe concentration of 1.0 %. a, cControl cells. b, d Treatmentcells. cw cell wall, pm plasmamembrane, ch chloroplast

Appl Microbiol Biotechnol (2014) 98:7949–7958 7953

activate signaling pathways ultimately leading to cell death(Apel and Hirt 2004). ROS and lipid peroxidation levels areimportant parameters that can indicate the oxidative damageof the cellular components. Figure 6a showed the fluorescenceintensity of ROS during 3-h treatment. Compared with thecontrol, the ROS level was significantly (p<0.05) increased inresponse to the concentration of 0.5 and 1.0 % after 1-htreatment. ROS level increased more significantly when treat-ment time was 2 h and intracellular ROS levels with concen-trations of 0.5, 1.0, and 1.5 % supernatant were 2.78 (p<0.01),1.74 (p<0.01), and 1.15 times those of the control, respective-ly. After 3-h treatment, ROS levels increased significantly(p<0.05) in the concentration of 1.0 % and ROS levels were2.97 times that of the control. Figure 6b showed the content ofMDA. MDA contents increased as the concentration ofDHQ25 supernatant increased, and MDA contents of algalcells treated with lowest supernatant concentration (0.5 %)had almost no change compared with those of the control,while that of the highest concentration treatment (1.5 %)group had the highest levels. MDA levels after treatment withthe 1.5 % concentration for 9 h was maximum, and it was 5.05times those of the control.

Cellular enzymatic activities including superoxide dismut-ase (SOD) and catalase (CAT) were determined to investigatethe cellular defense response induced by DHQ25 supernatant(Fig. 7). Figure 7a showed that the activities of SOD increasedsignificantly compared with the control after algal cells weretreated for 2 h. The activity values were 1.46 (p<0.05), 1.27(p<0.05), and 1.14 times those of the control when algal cellswere treated with 0.5, 1.0, and 1.5 % of DHQ25 supernatant.When the algal cells were treated for 6 and 9 h, SOD activityhad similar trend with those of 3 h. In the 12- and 24-htreatment group, SOD activity was higher than those of othergroups and it meant that longer exposure times could inducesignificant increase in the SOD activity. CAT activityshowed an obvious difference pattern to SOD activity(Fig. 7b). The maximum CAT activity was about 16.8 times(p<0.01) that of the control, which was observed after 9 h ofexposure to the 1.5 % DHQ25 supernatant. In eachtreatment group, when the concentration of DHQ25 superna-tant was low, the value of CATwas slightly higher than that ofthe control, showing that higher concentration of DHQ25supernatant could induce a significant increase in the CATactivity.

Table 2 Photosynthesis electron transport activities (μmolO2h−1 mg−1chl) of A. tamarense cells under 1.0 % (v/v) treatment

Electron transport activity Time for treatment (h)

0 3 6

PSII (H2O→p-BQ) 584.8±39.7 (100) 430.9±35.1 (26.31) 289.6±28.7 (50.48)

PSI (DCPIPH2→MV) 801.6±66.6 (100) 698.6±34.9 (12.84) 519.5±34.8 (35.19)

Whole chain (H2O→MV) 314.8±21.9 (100) 276.0±10.4 (12.32) 221.9±10.0 (29.50)

Whole chain (DPC→MV) 300.3±20.5 (100) 268.9±11.7 (10.46) 215.7±18.0 (28.18)

All data were mean±SD (n=3). Numbers in parentheses are percentages of the control value

Fig. 5 Relative transcriptional levels of psbA and psbD in A. tamarenseexposed to 1.0 % (v/v) bacterial supernatant for 3 and 6 h. All data weremean±SD (n=3)

Fig. 4 Photosynthetic efficiency (Fv/Fm) of A. tamarense cells treatedwith various bacterial supernatant concentrations. All data were mean±SD (n=3)

7954 Appl Microbiol Biotechnol (2014) 98:7949–7958

Discussion

The dinoflagellate A. tamarense is a toxic HAB species whichcauses paralytic shellfish poison, which is a threat to publichealth. Algae may acquire their nutritional requirements frombacteria (Croft et al. 2005), and sometimes, they can graze onand ingest bacteria (Bird and Kalff 1986). To date, knowledgeof how the bacteria themselves attach to algal cells and pro-duce algicidal activity and how the secretions of bacteria takepart in regulating the intracellular apparatus of the algae islimited (Nakashima et al. 2006). The algicidal bacteriumDHQ25 was a potential controller against A. tamarense inour previous study (Wang et al. 2010a).

Photosynthetic organisms possess the pigments nec-essary for efficient absorption of the light energy re-quired for a normally operating photosynthetic process(Steele 1962). Our results reveal an alteration of chlo-roplast structure (Fig. 3) accompanied by the reductionof photosynthetic pigment contents (Fig. 2) in the pres-ence of DHQ25 supernatant. We noted no significantchange in the carotenoids/Chl a ratio, consistent withthe results of Lu and Vonshak (1999). Recently, manyresearchers have been concerned with the change ofphotosynthetic pigments during various stress condi-tions. Loss of chlorophyll due to metal stress is reportedin M. aeruginosa, where pigment synthesis is inhibited

Fig. 6 Effects of DHQ25supernatant on a ROS, b MDAcontents of A. tamarense. All datawere mean±SD (n=3). *p<0.05represents statistically significantdifference when compared to thecontrol; **p<0.01 representsstatistically significant difference

Appl Microbiol Biotechnol (2014) 98:7949–7958 7955

by a high level of cadmium (Zhou et al. 2006).Variation of the light-harvesting compound, such ascarotenoids in dinoflagellates, is a general acclimationresponse occurring under various stress conditions(Okamoto et al. 2001). Another indicator of photosyn-thesis, Fv/Fm, showed a remarkable decrease after 9-hexposure (Fig. 4), which might be a clue to detectabledamage of the PSII reaction center itself. This variationof Fv/Fm was probably due to the adaptation to a highlevel of bacteria-induced survival stress. The apparent de-crease in photosynthetic performance in A. tamarense duringthe algicidal process and the damage to pigments and to theFv/Fm values noted in our work might point to an adaptivemechanism response to stress conditions.

Interestingly, PSII showed greater sensitivity than PSIwhich suggests that PSII is probably the primary site of actionof the bacterial supernatant. DPC is known to donate electronsto the PSII reaction centers, thereby bypassing the oxidizingside of PSII (Izawa 1980). The response of PSII activity in theabsence and presence of DPC in our study (Table 2) suggestedthat the changes in PSII induced by DHQ25 stress were mostlikely to be located in the reaction center rather than in theoxidizing side of PSII, which is consistent with earlier re-search (Shukla and Rai 2006). Transcription levels of psbAand psbD genes were clearly reduced (Fig. 5), which indicatedthat the bacterial supernatant influenced the key genes of thePSII reaction center. This inhibitive phenomenon of algicidesfurther confirmed that the PSII reaction center was damaged,

Fig. 7 Effects of DHQ25supernatant on a SOD and b CATcontents of A. tamarense. All datawere mean±SD (n=3).*p<0.05represents statistically significantdifference when compared to thecontrol; **p<0.01 representsstatistically significant difference

7956 Appl Microbiol Biotechnol (2014) 98:7949–7958

accompanied by blocked electron transport, ultimatelydisrupting the growth of the algal cells. Yoshitaka et al.(Nishiyama et al. 2004) had reported that singlet oxygen(ROS) stimulated the apparent photodamage to PSII, especial-ly affected the psbA gene expression, and broke the elonga-tion step of D1 protein translation.

ROS including superoxide anion radicals (O2·−), hydrogen

peroxide, and hydroxyl radicals have been historically associ-ated with cell death (Alboresi et al. 2011; Yang et al. 2011).Algal cell contains the chloroplast with an intense electronflow that leads to high rates of ROS production. Superoxideanions, singlet oxygen (1O2), and hydroxyl radicals (

·OH) aregenerated as by-products of photosynthetic electron transportthat can cause oxidative damage in algal cells (Perez-Perezet al. 2012). The indirect damage by ROS includes lipidperoxidation, inhibition of photosynthesis, and the oxidationof photosynthetic pigments such as chlorophylls andphycobilins (He and Häder 2002). Our present studies showedthat DHQ25 supernatant could significantly increase ROScontent in algal cells after exposure to different concentrationsof DHQ25 supernatant (Fig. 6a). If the redundant ROS in algalcells could not be totally cleared by the algal cells, it mighteventually cause serious oxidative damage to the algal cells.MDA content could reflect cellular oxidative damage, andthrough the direct assay of the MDA content, we confirmedthat there was a significant elevation in MDA content accom-panying DHQ25 supernatant concentration and duration ofexposure (Fig. 6b). These results had confirmed theoxidative damage on the cellular membrane system.SOD and CAT act as ROS scavengers in cells and couldprotect against the potential damaging effects of ROS(Kwok et al. 2012). Our present studies indicated that algalcellular antioxidant enzymes were triggered when algal cellswere exposed to DHQ25 supernatant (Fig. 7). SOD and CATactivities were all enhanced in a short treatment time whichimplied that enzymes of SOD and POD were seen to bedirectly involved in resisting DHQ25 supernatant stress inalgal cells.

Based on the findings presented in this study, the adapta-tion of the PSII apparatus to bacterial supernatant stress intoxic A. tamarense cells appeared to involve a decrease inpigment content, the maximum quantum efficiency of PSII(Fv/Fm), and disruption of the chloroplast. A decline in therelative transcription of psbA and psbD genes, which encodedthe D1 and D2 proteins in the PSII reaction center, paralleledthe reduction of PSII activity and might have regulated thelight trapping and energy conversion to maintain the overalltemporarily balanced photosynthetic process in algal cellsagainst bacterial supernatant stress. The block in the electrontransport chain of PSII might generate excessive ROS whichcould destroy cell membrane, pigment synthesis, activationenzymic antioxidant systems, and inducing algal cell deatheventually.

Acknowledgments This work was financially supported by theNational Natural Science Foundation (40930847, 41376119), SpecialFund for PhD Program in the university-priority development area(20120121130001), and the Public Science and Technology ResearchFunds for Ocean Projects (201305016, 201305022). We would like tothank Professor John Hodgkiss of The University of Hong Kong for helpwith English.

References

Alboresi A, Dall’Osto L, Aprile A, Carillo P, Roncaglia E, Cattivelli L,Bassi R (2011) Reactive oxygen species and transcript analysis uponexcess light treatment in wild-type Arabidopsis thaliana vs a pho-tosensitive mutant lacking zeaxanthin and lutein. BMC plant biol11(1):62

Amaro AM, FuentesMS, Ogalde SR, Venegas JA, Suarez-Isla BA (2005)Identification and characterization of potentially algal-lytic marinebacteria strongly associated with the toxic dinoflagellateAlexandrium catenella. J Eukaryot Microbiol 52(3):191–200

Anderson DM (1997) Turning back the harmful red tide. Nature388(6642):513–514

Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidativestress, and signal transduction. Annu Rev Plant Biol 55:373–399

Bai SJ, Huang LP, Su JQ, Tian Y, Zheng TL (2011) Algicidal effects of anovel marine actinomycete on the toxic dinoflagellate Alexandriumtamarense. Curr Microbiol 62(6):1774–81

Baker KH, Herson DS (1978) Interactions between the diatomThallasiosira pseudonanna and an associated pseudomonad in amariculture system. Appl Environ Microbiol 35(4):791–796

Banin E, Khare SK, Naider F, Rosenberg E (2001) Proline-rich peptidefrom the coral pathogen Vibrio shiloi that inhibits photosynthesis ofzooxanthellae. Appl Environ Microbiol 67(4):1536–1541

Behrenfeld MJ, O’Malley RT, Siegel DA, McClain CR, Sarmiento JL,Feldman GC, Milligan AJ, Falkowski PG, Letelier RM, Boss ES(2006) Climate-driven trends in contemporary ocean productivity.Nature 444(7120):752–755

Bird DF, Kalff J (1986) Bacterial grazing by planktonic lake algae.Science 231(4737):493–495

Croft MT, Lawrence AD, Raux-Deery E, Warren MJ, Smith AG (2005)Algae acquire vitamin B12 through a symbiotic relationship withbacteria. Nature 438(7064):90–93

Doucette GJ (2006) Interactions between bacteria and harmful algae: areview. Nat Toxins 3(2):65–74

He YY, Häder DP (2002) Involvement of reactive oxygen species in theUV-B damage to the cyanobacterium Anabaena sp. J PhotochemPhotobiol B 66(1):73–80

Izawa S (1980) Acceptors and donors and chloroplast electron transport.Method Enzymol 69:413–434

Kwok CT, van de Merwe JP, Chiu JM, Wu RS (2012) Antioxidantresponses and lipid peroxidation in gills and hepatopancreas of themussel Perna viridis upon exposure to the red-tide organismChattonella marina and hydrogen peroxide. Harmful Algae 13:40–46

Lee YJ, Choi JK, Kim EK, Youn SH, Yang EJ (2008) Field experimentson mitigation of harmful algal blooms using a Sophorolipid—yel-low clay mixture and effects on marine plankton. Harmful Algae7(2):154–162

Lesser MP (1996) Elevated temperatures and ultraviolet radiation causeoxidative stress and inhibit photosynthesis in symbiotic dinoflagel-lates. Limnol Oceanogr 41(2):271–283

Li HS, Sun Q, Zhao SJ (2000) Principles and techniques of plant phys-iological biochemical experiment. Higher Education, Beijing, pp186–191

Appl Microbiol Biotechnol (2014) 98:7949–7958 7957

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2− ΔΔct method.Methods 25(4):402–408

Lu C, Vonshak A (1999) Characterization of PSII photochemistry in salt-adapted cells of cyanobacterium Spirulina platensis. New phytol141(2):231–239

Mayali X, AzamF (2005) Algicidal bacteria in the sea and their impact onalgal blooms. J Eukaryot Microbiol 51(2):139–144

Mitsutani A, Takesue K, Kirita M, Ishida Y (1992) Lysis of Skeletonemacostatum by Cytophaga sp. isolated from the coastal water of theAriake Sea. Nippon Suisan Gakkaishi 58(11):2159–2169

Nakashima T, Miyazaki Y, Matsuyama Y, Muraoka W, Yamaguchi K,Oda T (2006) Producing mechanism of an algicidal compoundagainst red tide phytoplankton in a marine bacterium γ-proteobacterium. Appl Microbiol Biotech 73(3):684–690

Nishiyama Y, Yamamoto H, Allakhverdiev SI, Inaba M, Yokota A,Murata N (2001) Oxidative stress inhibits the repair of photodamageto the photosynthetic machinery. EMBO J 20(20):5587–5594

Nishiyama Y, Allakhverdiev SI, Yamamoto H, Hayashi H, Murata N(2004) Singlet oxygen inhibits the repair of photosystem II bysuppressing the translation elongation of the D1 protein inSynechocystis sp. PCC 6803. Biochemistry-us 43(35):11321–11330

Okamoto O, Pinto E, Latorre L, Bechara E, Colepicolo P (2001)Antioxidant modulation in response to metal-induced oxidativestress in algal chloroplasts. Arch Environ Con Tox 40(1):18–24

Perez-PerezME, Lemaire SD, Crespo JL (2012) Reactive oxygen speciesand autophagy in plants and algae. Plant Physiol 160(1):156–164

Qian H, Yu S, Sun Z, Xie X, LiuW, Fu Z (2010) Effects of copper sulfate,hydrogen peroxide and N-phenyl-2-naphthylamine on oxidativestress and the expression of genes involved photosynthesis andmicrocystin disposition in Microcystis aeruginosa. Aquat Toxicol99(3):405–12

Shukla B, Rai LC (2006) Potassium-induced inhibition of photosynthesisand associated electron transport chain of Microcystis: implicationfor controlling cyanobacterial blooms. Harmful algae 5(2):184–191

Sobrino C, Ward ML, Neale PJ (2008) Acclimation to elevated carbondioxide and ultraviolet radiation in the diatom “Thalassiosirapseudonana”: effects on growth, photosynthesis, and spectral sen-sitivity of photoinhibition. Limnol Oceanogr:494–505

Steele JH (1962) Environmental control of photosynthesis in the sea.Limnol Oceanogr:137–150

Su J, Yang X, Zheng T, Hong H (2007a) An efficient method to obtainaxenic cultures of Alexandrium tamarense—a PSP-producing dino-flagellate. J Microbiol Methods 69(3):425–430

Su JQ, Yang XR, Zheng TL, Tian Y, Jiao NZ, Cai LZ, Hong HS (2007b)Isolation and characterization of a marine algicidal bacteriumagainst the toxic dinoflagellate Alexandrium tamarense. HarmfulAlgae 6(6):799–810

Su J, Yang X, Zhou Y, Zheng T (2011)Marine bacteria antagonistic to theharmful algal bloom species Alexandrium tamarense(Dinophyceae). Biol Control 56(2):132–138

Takahashi S, Nakamura T, Sakamizu M, van Woesik R, Yamasaki H(2004) Repair machinery of symbiotic photosynthesis as the primarytarget of heat stress for reef-building corals. Plant Cell Physiol 45(2):251–255

Wang B, Zhou Y, Bai S, Su J, Tian Y, Zheng T, Yang X (2010a) A novelmarine bacterium algicidal to the toxic dinoflagellate Alexandriumtamarense. Lett Appl Microbiol 51(5):552–557

Wang X, Li Z, Su J, Tian Y, Ning X, Hong H, Zheng T (2010b) Lysis of ared-tide causing alga, Alexandrium tamarense, caused by bacteriafrom its phycosphere. Biol Control 52(2):123–130

Wang B, Yang X, Zhou Y, Lv J, Su J, Tian Y, Zhang J, Lin G, Zheng T(2012) An algicidal protein produced by bacterium isolated from theDonghai Sea, China. Harmful Algae 13:83–88

Warner ME, Fitt WK, Schmidt GW (1999) Damage to photosystem II insymbiotic dinoflagellates: a determinant of coral bleaching. ProcNatl Acad Sci U S A 96(14):8007–8012

Yang CY, Liu SJ, Zhou SW, Wu HF, Yu JB, Xia CH (2011)Allelochemical ethyl 2-methyl acetoacetate (EMA) induces oxida-tive damage and antioxidant responses in Phaeodactylumtricornutum. Pestic Biochem Phys 100(1):93–103

Yin L, Huang J, HuangW, Li D,Wang G, Liu Y (2005) Microcystin-RR-induced accumulation of reactive oxygen species and alteration ofantioxidant systems in tobacco BY-2 cells. Toxicon 46(5):507–512

Zhang S, Zhang B, Dai W, Zhang X (2011) Oxidative damage andantioxidant responses in Microcystis aeruginosa exposed to theallelochemical berberine isolated from golden thread. J plant physiol168(7):639–643

Zhang H, AnX, ZhouY, ZhangB, Zhang S, Li D, Chen Z, Li Y, Bai S, LvJ, Zheng W, Tian Y, Zheng T (2013) Effect of oxidative stressinduced by Brevibacterium sp. BS01 on a HAB causing species-Alexandrium tamarense. PLoS One 8(5):e63018

Zheng TL, Lv JL, Zhou YY, Su JQ, Yang XR, Tian Y (2011) Discoveryand research on the marine bacteria capable of controlling HABs. JXiamen Univ 50(3):445–454

Zheng X, Zhang B, Zhang J, Huang L, Lin J, Li X, Zhou Y, Wang H,Yang X, Su J (2012) A marine algicidal actinomycete and its activesubstance against the harmful algal bloom species Phaeocystisglobosa. Appl microbiol biotech 97(20):9207–9215

ZhouW, Juneau P, Qiu B (2006) Growth and photosynthetic responses ofthe bloom-forming cyanobacterium Microcystis aeruginosa to ele-vated levels of cadmium. Chemosphere 65:1738–1746

Zhou LH, Zheng TL, Wang X, Ye JL, Tian Y, Hong HS (2007) Effect offive Chinese traditional medicines on the biological activity of a red-tide causing alga—Alexandrium tamarense. Harmful Algae 6:354–360

7958 Appl Microbiol Biotechnol (2014) 98:7949–7958