University of Calgary

PRISM: University of Calgary's Digital Repository

Graduate Studies Restricted Theses

1999

Characterization of the hydrophobic domain of PilS, A

pseudomonas aeruginosa pilin gene trascriptional

regulator

Ethier, Julie

Ethier, J. (1999). Characterization of the hydrophobic domain of PilS, A pseudomonas aeruginosa

pilin gene trascriptional regulator (Unpublished master's thesis). University of Calgary, Calgary,

AB. doi:10.11575/PRISM/11876

http://hdl.handle.net/1880/25002

master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their

thesis. You may use this material in any way that is permitted by the Copyright Act or through

licensing that has been assigned to the document. For uses that are not allowable under

copyright legislation or licensing, you are required to seek permission.

Downloaded from PRISM: https://prism.ucalgary.ca

UNIVERSITY OF CALGARY

Characterization of the Hydrophobic Domain of PilS, A Pseudomonas aemginosa

Pilin Gene Transcriptional Regulator

Julie Ethier

A THESIS SUBMllTED TO THE FACULTY OF GRADUATE STUDIES [N

PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

DEPARTMENT OF MICROBIOLOGY AND INFECTIOUS DISEASES

CALGARY, ALBERTA

DECEMBER, 1999

0 Julie Ethier 2999

National Library u*l of Canada Biblioth&que nationde du Canada

Acquisitions and Acquisitions et Bibliographic S e ~ ~ c e s services bibliographiques

395 Wellington Street 395, cue Wellington OtEawaON KIA- -ON KIAOW Canada Canada

Your& Vomd-

owe, Morrw~mrsnco

The author has granted a non- L'auteur a accorde une licence non exclusive licence allowing the exclusive pennettant a la National h'brary of Canada to Bibliotheque nationale du Canada de reproduce, Ioan, dktri'bute or sell reproduke, preter' distri'buer ou copies of this thesis in microform, vendre des copies de cette these sous paper or electronic formats. Ia fome de mrmcrofiche/f3m, de

reproduction sar papier ou sur format electronique.

The author retains ownership of the L'auteur conserve la propriete du copyright in this thesis. Neither the droit #auteur qui protege cette these. thesis nor substantid extracts fiom it Ni Ia these ni des extraits substantiels may be printed or otherwise de ceIIe-ci ne doivent &re imprim& reproduced without the author's on autrement reproduits sans son permission. autorisation.

ABSTRACT

In Pseudomas aemgimsa, synthesis of pilin, the major protein subunit in pili,

is regulated by a two-component signal transdudion system in which PilS is the

sensor kinase. PilS is composed of three domains: an N-terminal hydrophobic

domain, a central cytoplasmic linker region and the C-terminal transmitter region

conserved among many other sensor kinases. The signal that activates PilS and

consequently pilin transcription remains unknown. The membrane topology of

the hydrophobic domain was determined using the lac2 and phoA gene fusion

method. We propose a model in which the hydrophobic domain forms six

transmembrane helices, while the N- and C-termini of PilS are cytoplasmic. We

also provide evidence that shows that all six transmembrane segments are

required for PilS function and signal transduction, but not for membrane

anchoring or polar targeting.

iii

ACKNOWLEGOEMENTS

1 would first like to thank Dr. Boyd, my supervisor. 1 a m very grateful for her

confidence in me, her patience and for the opportunities she has given me. I

also wish to thank the members of my supervisory committee, Drs Woods,

Schryvers and Turner, for their advice and expertise. I must also acknowledge

Dr. Schryven for generously allowing me use equipment and material from his

laboratory. I thank Dr. Boyd, Guillaume Gagnon and Michael Shepel for

constructing some of the plasmids used in this study; Michael Schoel for his

technical assistance with the fluorescent microscope and Dr. Mike Surette for

allowing me to use his fluonmeter.

I also thank my fellow students in Dr. Schryvers' laboratory, Leanne. Henry and

Shane as well as the other members of his laboratory for making the past three

years a lot of fun. Finally, on a more personal note, I want to thank my mother,

my brother, my friends and famiIy and Kurt.

TABLE OF CONTENTS

Approval page ..... ........................ .. ... ..... . . . . ................................. ii

*.. Abstract ...............................................-........... C ~ . ~ ~ ~ ~ ~ ~ ~ . ~ ~ C ~ . ~ ~ C ...-.......*......... III

Acknowledgments .....................................~........................................... iv

Table of content ................................ . C . . C ~ C . ~ . ~ C .........................-...*...-......... v

List of Tables .... .... C.C...C .....................--. . C C C C C C C ....... CIC.... x

List of Figures ...................... ........... . . ..... . .....................*..... . ............ .. xi

. . List of abbrev~atlons ........ .. ........... ..... ................................ xiv

Chaoter 1. INTRODUCTION ................... .t..~~~C~C.~.~~.C.... ........................ 1

Cha~ter 2. LITERATURE REVIEW ................................................... 4

2.1 Pseudomonas aemginosa virulence and pathogenesis .............. 4

2.1 .I Extraceliular virulence factors ................... .. ..... CC....CCC..... 4

2.1.2 Adherence and colonization . ..... ...... .... ......*... ... -.-- ...--. -. . . . 5

2.1.2.1 Non-pilus adhesins ..........- .... ....................... 5

2.1 1.2 Type N piii as an adhesin .....................-....*...-......... 6

2.1.3 Cytotoxicity, invasion and immune response ....-...-............ 8

2.1 -4 Model of P. aeruginosa infection in CF lungs ..... ... ...... .. . . . . 1 0

*.

2.2 Type IV prl~ ........................................ CCCC. ..................................... 12

2.2. I Biogenesis .-................................................... C.C...C. ...........- 12

22.2 Function .................................. .-.--. ....................... 14

2.2.3 Regulation ........................................................................ 18

2.3 Twocomponent signal transduction systems ............................. 19

2.3.1 Definition. structural characteristics and mechanism ......... 19

2.3.2 Use of two-component systems in bacteria ................... .... 22

2.3.2.1 EnvZ-OmpR and osmoregulation ............................. 22

2.3.2.2 The chernotaxis system ............................................ 26

2.3.2.3 NW-NtrC and nitrogen regulation ............................ 27

2.3.3 The PiIS-PilR system of P . aemginosa .............................. 29

2.3.3.1 PilR, the response regulator ..................................... 29

2.3.3.2 Function of PilS, the sensor kinase .......................... 30

2.3.3.3 Structural features of PilS ......................................... 31

......................................... 2.4 Structure of inner membrane proteins 32

2.4.1 Topology: definition and classification ............................... 32

2.4.2 Implications of sequence modifications ............................. 34

........................................ 2.4.3 Mechanisms of protein insertion 35

2.4.3.1 Secdependent pathway ........................................... 35

2.4.3.2 Signal recognition particle pathway .......................... 37

........................................ 2.4.3.3 Sec-independent pathway 38

2.5 Topological study of inner membrane proteins ........................... 39

2.5.1 Statistical prediction of a protein's topology ....................... 39

2.5.1 -1 Amino acid distribution and the positive inside rule .. 39

2.5.1 -2 Hydrophobicity plots and prediction .......................... 41

2.5.2 Experimental determination of a topology .......................... 42

25.2 . e n fusions ....................................................... 42

2.5.2.2 Other approaches ..................................................... 43

Chapter 3 . MATERIALS & METHODS .............................................. 45

3.1 Media and supplements ....................... ... ................................ 45

3.2 DNA manipulations ..................................................................... 45

3.2.1 DNA linker insertion ........................................................ 46

3.2.2 Alkaline phosp hatase treatment ........................................ 46

3.2.3 DNA transformation in P . aenrginosa ................................ 47

................. .........*.*.*................................ 3.3 Mutagenesis of pits .. 47

3.3.1 PCR mutagenesis ........... .. .......................................... 4 8 .

3.3.2 Quikchangem mutagenesis ....................................... 40

3.4 Construction of the pilS internal deletions ................................... 50

3.4. I Full-length deletions ........................................................... 50

3.4.2 Truncated deletions ........................................................... 51

3.5 Construction of the gene fusions ................................................. 52

3.5.1 The reporter vectors .......................................................... 52

................................ 3.5.2 Fusions of piIS to lacZ, phoA and gfp 53

............................................ 3.6 Construction of the promoter fusion 53

3.7 Hybrid protein analysis ................................................................ 54

3.7.1 Western immunoblotting of the hybrid proteins .................. 54

3 7.2 Alkaline p hos p hatase and 8-9 alactosidase assays ............ 55

3.7.3 Fluorescence assays ................... .... ........................... 55

.............. 3.8 Cell fractionation .. ......................................................... 56

3.9 Microscopy .................................................................................. 57

.......................................... Cha~ter 4 . TOPOLOGICAL MODEL OF PilS 58

4.1 Results ............................................... ......... ......... 58

4.1 -1 Topological predictions .................................................. 58

....................................... 4.1 -2 Construction of the gene fusions 58

4.1.3 Analysis of the hybrid proteins ........................................... 59

............................ 4.1 -4 Enzymatic activity of the hybrid proteins 61

4.1 -5 PilS possesses six TM segments ...................................... 62

4.1 -6 Orientation of the TM segments ......................................... 64

4.1 .6.1 FulClength deletion hybrid proteins ........... .. ............ 64

................. 4.1.6.2 Truncated deletion hybrid proteins ........ 67

4.1 -7 Cellular localization of the PilS-LacZ hybrids ..................... 68

................................................................................ 4.2 Discussion 6 9

.................................... Cha~ter 5 . ROLE OF THE PilS TM SEGMENTS 79

5.1 Results ........................................................................................ 79

............................................. . 5.1 1 Construction of the plasmids 79

5.1 -1 . 1 The internal helix deletions ....................................... 79

.......................................... 5.1 .1.2 The piM promoter frrsion 79

5.1 .1.3 The PilS-GFP fusions .. ....... ,. .................................... 80

5.1 -2 CelIular localization of the PIS-GFP hybrid proteins ................ 81

5.1.2.1 Ep ifiuorescence microscopy ................................... 8 1

5.1.2.2 Cell fractionation of the nonpolar PilS-GFP ........... .. 83

5.1.3 PilS hrnction assays ........................................................... 85

.................................... 5.1 .3.1 Experimental considerations 85

5.1.3.2 Kinase and phosphatase function of mutant PilS ..... 87

5.2 Discussion .,,.. .............................................................................. 91

Chapter 6 . CONCLUSlONS AND FUTURE DIRECTIONS ..................... 98

........................................................ Cha~ter 7 . TABLES AND FIGURES 100

Chaoter 8 . LITERATURE CITED ............................................................. 175

Table I.

Table 2.

Table 3-

Table 4.

Table 5.

Table 6.

Table 7.

Table 8.

Oligonucleotide primers used in this study

Strains and plasmids used in this study

Enzymatic activity of the PiIS-Lac2 and PilS-PhoA

hybrid proteins

Colony phenotype of the fuIClength deletion hybrid

proteins

Enzymatic activity of the PilS-Lac2 and PilS-PhoA

deletion hybrid proteins

Effect of the presence of the translational initiation

region FIR) on GFP fluorescence

Phosphatase activity of the PilS mutants

Kinase activity of the PilS mutants

LIST OF FIGURES

Figure f.

Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 6.

Figure 7.

Figure 8.

Figure 9.

Figure 10.

Figure 11.

Figure 12.

Figure 13.

Figure 14.

Schematic representation of the mechanism of pilA

-gene transcriptional activation

Predicted top0 logical model of PilS

Classification of inner membrane proteins

Sec-dependent translocation and insertion mechanism

The signal recognition particle (SRP) pathway

Sec-independent insertion of the M I 3 procoat protein

Theoretical principle of the gene fusion approach to

study topology

Rationale for the construction of the fusion pfasmids

Diagram of the reporter vectors

Schematic representation of the PilS-Lac2 and PilS-

PhoA hybrid proteins

Schematic representation of the Pits-Lac2 and PilS-

PhoA deletion hybrid proteins

Schematic representation of the fulClength deletions of

PilS and PIS-GFP hybrid proteins

Hydrophobicity profile of PilS as determined by the

Km and DoolittIe scale

Amino acid sequence of PiIS

Figure 15. Western imrnunoblot of the PilS-La& and PilS-PhoA

hybrid proteins

Figure 16. Qualitative pilin assay in strains carrying the fusions to

full length PiIS

Figure 17. Enzymatic activity of the PilSLacZ and PilS-PhoA

hybrids in P. aemginosa

Figure 18. Enzymatic activity of the PilSLacZ and PilS-PhoA

hybrids in E. coli

Figure 19. Summary of the gene fusion results and topological

model of PiIS

Figure 20. Enzymatic activity of the fusions TM1, TM1 C and

TMl Alinker

Figure 2q. Western immunoblot of the fusions TM1, TMIC and

TMI Alinker

Figure 22. Enzymatic activity of the PiiS-Lac2 and PilS-PhoA

deletion hybrids in P. aenrginosa

Figure 23. Enrymatic act-vity of the PilS-Lac2 and PilS-PhoA

deletion hybrids in E. coii

Figure 24. Predicted topological models of the ATMI and ATM2

deletions

Figure 25. Cell fiactrionation of the PilSLacZ hybrids showing

positive activity

xii

Figure 26. Sequence comparison of the junction of the pilA

promoter and g@ gene in pGG103A and pJE411 ?61

Figure 27. Epifl uorescence microscopy images of the Piis-GFP

fusion proteins 163

Figure 28. Cell fractionation of the non-polar PilS-GFP hybrids 165

Figure 29. Summary of the cellular localization, kinase and

phosphatase assay results of the PilS mutants 1 67

Figure 30. Preliminary testing of the kinase and phosphatase

functions of PilS mutants under different induction

conditions

Figure 31. Phosphatase assay of the PilS mutants

Figure 32. Kinase assay of the PilS mutants

LIST OF ABBREVIATIONS

a. a.

AlF

Amp plac

bp Carb CF

CFTR

CIAP

GFP

GSP

IL

CPTG

K

kDa

LacZ

M

MCP P

PBS

PCR

PhoA

PMN

RBS

S

SD

SDS-PAGE

Amino acids

Anti-internalization factor

Ampicillin

beta-lacbmase

Base pairs

Cahenicillin

Cystic fibrosis

Cystic fibrosis transmembrane regulator

Calf intestinal alkaline phosphatase

Green fluorescent protein

General secretory pathway

I nte rteu kin

Isopropy CP-D-thiogalactoside

Kinase

Kilodaltons

Pgalactosidase

Membrane

Methyl-accepting chemotaxis protein

P hosphatase

P hosp hate-buffered saline

Polymerase chain reaction

Alkaline phosphatase

Polymorphonuclear

Ribosome-binding site

Soluble

Sodium dodecyl sulFate polyacrylarnide gel electrophoresis

SRP Signal recognition particle

str

TBS

Tet

TIR

TM UAS

Xg al

XP

Streptomycin

Tris-buffered saline

Tetracycline

Translational initiation region

Transmembrane

Upstream activation sequence

5-b rom~chloro-3-indoly l g alacto pyranoside

5-brom~chloro-3-indoIylphosp hate

Chanter f . lNTRODUCT10N

Pseudomonas aemginosa is an ubiquitous Gram-negative bacillus capable of

surviving in harsh and nutritionally scarce environments. Despite its wide and

varied array of colonizing and virulence factors, P. aenrginosa rarely infects

healthy individuals where the body's immune system is able to efficiently clear

the bacterium before initiation of an infection. However, P. aeruginosa is an

important nosocomial and opportunistic pathogen and should be considered a

great threat for individuals with an imrnunocompromized immune system, such

as AIDS, cancer, transplant and bum patients (1 50). Cystic fibrosis (Cf) patients

are particularly susceptible to chronic, and eventually fatal, lung infections by P.

aemghiosa (59).

The type 1V pili produced by P. aemginosa are the principle agents responsible

for bacterial adhesion to epithelial cells (164). More than 30 gene products are

required for the synthesis, assembly, function and regulation of these polar

appendages [reviewed in (I, 30,97)]. Transcriptional regulation of pilA, the gene

encoding the structural subunit pilin, is mediated by two factors: RpoN, the

alternative sigma factor 054 (75,146), and a two-component signal transduction

system composed of PilS and PilR (t6,66,76).

The sensor histidine kinase of a two-cumponent regulatory system senses an

environmental activating signal and stimulates the response regulator through a

phosphorelay mechanism. The activated response regulator then stimulates the

appropriate adaptive response by activating gene transcription or chemotaxis

(42). Two-component systems have been identified in several organisms where

they regulate many viruience factors and survival mechanisms. Signals detected

by bacterial sensor proteins include changes in osmolarity, salinity, temperature,

pH, availability of nutrients and levels of nitrogen or oxygen (41, 134).

PilS and PilR form a two-component system required for pilin expression in P.

aemqiiosa. PilS senses an unknown signal and autophosphorylates, PilR

receives the phosphate from PilS and binds to four upstream activating

sequences (UAS) upstream of the pilA transcriptional start (79). The PilR

complex then interacts with RpoN and the RNA polymerase to initiate piiin

transcription (Figure 1 ).

PilS is both a PilR kinase in the presence of the activating signal, and a phospho-

PilR phosphatase when the signal is missing (17). The signal(s) that determine

whether PilS will be a kinase or a phosphatase are unknown, but the

phosphatase activity can be mimicked by overexpression of PBS. Also, high

concentrations of PiIS in the cell inhibit pilin expression in a dose-dependent

manner (17). PilS is a polarfy Iocalked protein composed of three regions

(Figure 2): an N-terminal hydrophobic domain, a central linker domain and a C

terminal kinase domain. The N-terminal 177 amino acids of PilS are predicted to

form six transmembrane (TM) helices that anchor the 59 kDa protein to the inner

membrane. The TM helices are connected by short hydrophilic periplasmic and

cytoplasmic loops. The stimulus is detected via the N-terminal domain or the

central linker region, or possibly both domains.

The specific aims of this study are two-fold. First, 1 intend to prove or disprove

that the N-terminal hydrophobic moiety of PilS is embedded within the membrane

and composed of six TM helices as predicted by computer analysis. Second,

with the topological mode[ of PilS elucidated, I will determine which helices, if

any, are required for PilS function, membrane anchoring and polar localization.

Determination of the accurate topological model of PilS would provide valuable

information concerning the activating signals with which it interacts to stimulate

pilin transcription. Internal helix deletion studies of PilS would contribute to our

understanding of its ftrnction as a kinase and phosphatase as well as the

implications of cellular localization on function. Wrth a better understanding of

the signal transduction event leading to initiation or repression of pilin

transcription, it may eventualIy be possible to control pilin expression. A non-

piliated strain of P. aemghosa would be less efficient at colonizing the lungs of

CF patients and delay or prevent the onset of a chronic infection.

Chapter 2. LlTERATURE REVIEW

2.1 Pseudomonas aemainosa virulence and pathoaenesis

2.1 .I ExtracelIular virulence factors

The virulence factors produced by P. aemginosa can be divided into two

categories: secreted or extracellu lar virulence factors, and cell-associated factors

or adhesins. The extracellular products secreted by P. aenrginosa include

exotoxin A, exoenzyme S (ExoS), exoenzyme T (ExoT), exoenzyme U (ExoU),

phospholipase C, rharnnolipid, elastase, alkaline protease and the siderophores

pyochelin and pyocyanin. Exotoxin A and ExoS are ADP-ribosyl transferases

that inhibl protein synthesis and cause local tissue damage. These two toxins

are also involved in bacterial invasion and dissemination. ExoT is also an ADP-

ribosyI €ransferase, but its activity is much weaker than that of ExoS. ExoU is a

potent cytotoxin responsible for acute cytotoxicity and epitheliai injury, however

its mechanism of adion remains unknown. Phospholipase C and rharnnolipid

are hemolysins that break down lecithin and other phospholipids found in the

lung surfactant and epithelial cell membranes. Phospholipase activity and

cellular injury fadfitate adherence to epithelial cells by exposing new receptors to

bacteria[ adhesins. Elastin, a component of blood vessels and lung tissue, is

destroyed by elastase resuking in pulmonary hemorrhage. In addition to elastin.

elastase also degrades fibrin, collagen, human immunogIobulins A and G and

5

other components of the immune response. Alkaline protease, better known for

its involvement in eye infections, also degrades immunoglobulins and neutralizes

polymorphonuclear leukocytes (PMNs). For reviews on the virulence factors of

P. aemginosa, see references (50,55,61, 126, 150, 163).

The exopolysaccharide alginate is another important virulence factor secreted by

P. aemginosa. The conversion of a non-mucoid phenotype to an alginate-

producing rnuwid phenotype and the formation of microcolonies are

unmistakable characteristics of the presence of a chronic respiratory infection.

Alginate plays many roles in the pathogenesis of P. aeruginosa [reviewed in

(6011. Briefly, it reduces the proficiency of the immune response towards the

intruding pathogen by blocking the phagocytic activity of macrophages and

neutrophits and suppressing opsonization and neutrophil chemotaxis. Alginate

also efficiently neutralizes reactive oxygen intermediates and hypochlorite

released from phagocytic cells. Although alginate is not considered a major

adhesin, it does facilitate attachment of bacteria to the epithelium and solid

surfaces aiding in the formation of biofilms.

2-1.2 Adherence and cotonitation

2.1.2.1 Non-pilus adhesins

The first step in establishing an infedion is adherence of the bacteria to the

epithelial cells which, with P. ae~gfnosa, is mediated by type N piii and other

non-pilus adhesins. The abnormally thick mucus and deficient mucociliary

clearance in CF lungs as well as epithelial cell damage also promote colonization

at this site (168).

The flagellum is the main non-pilus adhesin although its principal functions are

motility and chemotaxis. Mutants defective in fliC, the flagellin structural gene.

show reduced binding to human airway epithelial cells and decreased virulence

in a mouse model of pulmonary infection (49). Purified flagellin binds to the

gangliotetraosyl ceramide GM1 and its asialylated form, asialoGM1, commonly

found on epithelial cell membranes (49). Adherence to purified respiratory mucin

is not impaired in mutants lacking Ragellin andlor pilin (1 19, 131) suggesting that

other adhesins, in addition to pilin and flagellin, are responsible for binding to

mucin. Like pilin and flagellin, these non-pilus adhesins are under the regulatory

control of RpoN (119). The flagellar cap protein FIiD and other proteins involved

in the regulation and assembly of the flagellar apparatus were also shown to be

required for bacterial binding to respiratory much (5, 117). The

exopolysaccharide produced by muwid strains is also considered a non-pilus

adhesin (95, 118).

2.1.2.2 Type N pili as an adhwin

The primary adhesin in P. aeruginosa is the type 1V pilus. Although pili do not

play a major rok in adhesion to mucin, their role in adherence to epithelial cells

has been well documented (38.1 19.120.164).

2.1.3 Cytotoxicity, invasion and immune response

P. aemghnosa is generally considered an extracellular pathogen, however

bacterial internalization by epithelial cells has been reported in tissue culture and

animal models (24.27,53. l lo, 11 I). These experiments were conducted using

various cell lines and both clinical isolates and laboratory strains of P.

aeruginosa.

P. aeruginosa is capable of both invasion and cellular killing. It is possible that

epithelial cell damage is a prerequisite for invasion and dissemination of P.

aemgimsa to deeper tissues. It was proposed that the presence or absence of

an invasion inhibitor determine if the bacterium will kill or invade, respectively

(27,63). The Type Ill secretion system is required for cytotoxicity as mutants

with defects in some components of the Type Ill secretion machinery are non-

cytotoxic but internalized by epithelial cells (63). It is likely that this system is

required for secretion of cytotoxins and the still unidentified anti-internalization

factor (AIF) (63). A defective Type III system would prevent secretion of the

cytotoxins and AIF, leading to bacterial internalization and non-cytotoxicify.

Invasion may be independent of or negatively regulated by ExsA, since ExsA

mutants are noncytotoxic and internalized (52). ExsA is a transcriptional

acfivafor that regulates expression of the exoenzyme S regulon, which encodes

the components and secrekd products (ExoS, EoT, ExoU) of Type Ill secretion

9

(55). The Type Ill machinery of P. aemginosa is very homologous to that of the

well described Yersinia Type Ill system.

Factors responsible for macrophage apoptosis are also secreted via the Type Ill

secretion system. Bacterial ingestion is not required for induction of apoptosis

(62). ExoU, a cytotoxin regulated by ExsA and expressed in the absence of

ExoS and ExoT (51), is not involved in induction of macrophage apoptosis but

causes necrotic death of macrophages (62).

Interaction of P. aemginosa pili with the receptor asialoGM1 was recently shown

to promote either cytotoxicity or internalization of the bacterium into epithelial

cells, depending on the strain type (27). It is likely that pili-mediated adherence

to epithelial cells and Trpe Ill secretion act together to promote epithelial cell

damage. It is possible that the initial binding of the pilus to the cell and

subsequent retraction of the piIus would allow a close and tight contact between

the pathogen and the epithelial cell, thus activating Type Ill secretion of cytotoxic

substances (ExoS, ExoT, ExoU) and AIF. In addition, mutants lacking PilT, a

protein proposed to catalyze pilus retraction, show reduced epithelial cell

cytotoxicity in vitb (26).

In a healthy lung, potentially infectious P. aemginosa can be cleared by cellular

ingestion and desqrramation. However, in cells lacking a functional CFTR, this

20

defense mechanism fails and the bacteria remain in the airway lumen where they

secrete their virulence factors, cause tissue damage and elicit an inflammatory

response (1 10)- This damaging inflammation is characterized by increased

numbers of PMNs and elevated production of interleukin-8 (11-8) as well as the

presence of other proinflammatory cytokines in the bronchoaiveolar lavage fluid.

The inflammatory response persists even after reduction in bacterial load

because of the accumulated exoproducts (1 01). 11-8 production by epithelial

cells and complement activation attract PMNs to the respiratory epithelium.

These cells release lysosornal enzymes and proteases such as elastase which

break down immunoglobulins and immune complexes (70).

2.1.4 Model of P. aemginosa infection in CF lungs

P. aemginosa needs to break the host first-line defenses in order to initiate

infection. The impaired mumciliary clearance mechanism and altered mucus

composition of CF lungs provide the break needed for colonization by the

bacteria. The flagellum may be important in the first stage of colonization by

mediating motility toward the susceptible epithelium and facilitating dissemination

of the organism (49). Non-mucoid P. aemgiiosa adhere to host respiratory

epithelial cells and rnucin by the type N pili and other non-pilus adhesins.

Proteases and phospholipase C promote adhesion by damaging the epithelium

thereby exposing more receptors to the adhesins (39, t 50).

A chronic infection is established soon after the initial step of colonization.

Secretion of the many extracellular virulence factors helps the bacteria obtain

nutrients and evade the immune system. Siderophores are secreted to increase

intake of iron, an essential nutrient Exotoxin AT ExoS and elastase also

contribuie to nutrient intake by mediating host cell destruction and consequently

release of iron and nutrients (61). Protease and elastase inactivate the cytokines

g amma-interferon and tumor necrosis factor, as well as break down complement

components and immunoglobulins (39). Host production of 11-8 induced by

bacterial adherence to epithelial cells increases the number of neutrophils in lung

tissue (1 01). The prolonged inflammatory response and secretion of proteases

and oxidative radicals by neutrophils is responsible for most of the tissue damage

observed in CF lungs (70).

Once the infection is well established, a number of adaptive changes occur to the

colonizing strains. Most notable is the conversion ftom the non-mucoid colony

phenotype to the mucoid phenotype characterzed by the production of the

exopolysaccharide afginate. Alginate takes over as the primary adhesin and is

very effective at protecting the bacteria1 cell from the immune system and its

environment by allowing the formation of microcolonies (60). Other changes

sometimes include loss of flagellum and pili, production of a rough

IipopoIysaccharide and reduction in exoproduct secretion. All of these

phenotypic modifications render the cell non-rnotiie, more resistant to

p hagocytosis and serum-sensitive (non-typeable).

2.2.1 Biogenesis

Type IV pili are long fibrous organelles localized to one pole of the bacterial cell.

They are primarily composed of one major subunit, pilin, assembled in a helical

structure with approximately five subunits per turn (54). P. aeruginosa pilin

belongs to the type IV family of bacterial pilins, which also includes pilins from

Neissenia gononhoeae, N. meningBdis, Moraxelia sp., Myxococcus xanthus,

Legionella pneumophila, Aemmonas hydrophila and Dichelobacter nodosus

(138). This class of pilin is characterized by a conserved hydrophobic N-

terminus and a unique C-terminal domain where the antigenic and functional

differences among species reside (97, 138). Like all pilins of this class, P.

aemginosa pilin (PiIA) is first synthesized as a prepilin precursor. The

bifunctional enzyme PilD then cleaves off a short leader peptide from the

precursor and methylates the first amino acid of the mature protein, a

phenylalanine (87, 104). Therefore, type IV pili are sometimes referred to as N-

methylphenylaianine (MePhe) pili.

13

Similarities between the type IV pili produced by various bacterial species are not

limited to the amino acid sequence of the pilin protein. Indeed, homologies and

similarities are seen in many other pilus assernbLy and functional components

such as the leader peptidase, putative nucleotide-binding proteins, outer

membrane proteins and regulatory components.

As well, many pilus synthesis components have hornologues in the Type I1

secretion system (general secretion pathway, GSP), most notable being PilD,

also described as XcpA, a protein required for Type I1 secretion (67). P.

aeruginosa utilizes the Type II secretion pathway to deliver its exotoxins,

elastase and alkaline protease to the extracellular milieu. Type I1 secretion is a

two-step process where the protein first traverses the inner membrane with the

help of the Sec apparatus and then crosses the outer membrane by a separate

mechanism (1 16) For P. aenrginosa, the second translocation step is mediated

by the Xcp proteins. Five of the Xcp proteins (XcpT, U, V, W and X) contain an

N-terminal sequence (including a cleavable signal peptide) homologous to that of

the pilin subunit and are therefore referred to as pseudo-piiins. Other

components of the GSP also show homoiogy to pilus synthesis components,

suggesting that the mechanism of pilus assembly may be related to that of

protein secretion (88, 123).

The toxin-coreg ulated pili of Vibrio cholerae and the b und le-forming pili of

enteropathogenic Eschefichia coli are examples of the group B of type IV pilins

characterized by a longer leader sequence and less conserved cleavage site

(1 38).

The synthesis, assembly, function and regulation of pili involves more than 30

gene products [reviewed in (1,30,97)]. These genes are organized in a number

of foci of different sizes located throughout the genome. In P. aemginosa, there

are approximate[y 19 biosynthesis genes @iM, 8, C, D, E, F, M, N, 0, P, Q, V,

W, X, Y7, Y2, Z, fimTand fimU). two functional genes (pilland pi/@, eight

chernotaxis gene homologues @ilG, H, I, J, K, L, chpA and chpB) and fve

regulatory genes ON, pilS, piiRp fimS and aIgR). The exact role of many of

these proteins in the production and assembly of a functional pilus remains

unknown or unclear. The better studied and characterized products are PiIA, the

structural component, and PI'ID, the leader peptidase.

2,2.2 Funcfion

P I play many different roles in the biological processes of bacteria and host-

pathogen interactions. As mentioned in a previous section, one of the primary

functions of pili is adherence to epithelial cells. Other equally important roles

assigned to pili include interference with the immune system. DNA uptake

(natural competence) and movement through Mching motifity and social gliding.

15

A new role for type N pili was recently described for pathogenic Neisseria.

Kallstrom et a1 showed that binding of Neisseria pili to its eukaryotic cell receptor

leads to release of Ca* from host intracelluiar stores (80). This increase in

cytosolic levels of Ca* is needed for tighter association of the bacterium to the

host cell and possibly internalization of the bacterium into the host cell.

In a site where antibody and complement levels are low such as the

bronchopulmonary tract, non-opsonic phagocytosis may be an important

mechanism of defense against pathogens like P. aenrginosa. However, non-

piliated or depiliated strains of P. aenrginosa are resistant to phagocytosis by

neutrophils and macrophages in a serum free environment (89, 132). Also,

piliated strains induce production of the neutrophil chemoattractant 11-8, which

contributes to the damaging lung inflammation seen in CF patients (37). In a

mouse model of pulmonary infection, piliated strains are more virulent and

invasive than non-piliated strains and are better capable of initiating a massive

inflammatory response (141).

HorizontaI exchange of chromosomal material is an important factor in the

evolution and epidernioiogy of Neisseria species. One consequence of genetic

exchange between bacterial cells is the antigenic variation observed for pilin and

Opa proteins. This phenomenon represents an important mechanism for

evading the immune system and modming the adherence properties of the

bacteria. The natural ability of N. gononhoeae to transform DNA and its link to

type IV pili synthesis has been well studied. All of the gene products involved in

type IV pilus synthesis, including the pilin gene pilE, are required for DNA uptake

and translocation of DNA into the cytoplasm (57). A similar association between

natural competence and pilus synthesis was recently reported in L. pneumophila

(1 36). However, P. aemginosa is unable to naturally transform DNA regardless

Twitching motility allows bacteria like P. aemginosa and N. gononfioeae to move

on solid surfaces or on top of agar. Social gliding, best described in M. xanthus,

is a motion smoother than twitching motility and is directed along the axis of the

bacterium. These motility characteristics make it possible to determine if a strain

is piliated or not by observing colony morphology on soft agar plates. The

presence of a large growth diameter and swarming pattern on an agar plate is a

sign of the organism's motility.

In M. xanthus, two sets of genes control the gliding motion, the adventurous (A)

motiIi&y genes and the social (S) motility genes. Type lV pili are required for S-

motility but not for A-motility (165). As well, close cell proximity and high cell

density are important for S-motility. Defects at any stage of pilin synthesis and

pilus an assembly result in a non-motile phenotype (157). In addition, the PiK

protein. not required for pilus assembly, is essential for social motility (t66).

97

In a fashion similar to social gliding in M. xanfhus, type IV pili are required for

twitching motility in P. aemginosa (1 8), but the presence of a structurally normal

pilus is not the only criteria for the bacterium to exhibit twitching motility.

Mutations in the p i r gene lead to the synthesis and assembly of a normal but

inactive, or non-retractile, pilus and the presence of a non-rnotiie phenotype.

Pilus extension and retraction is therefore proposed as the mechanism for

twitching motility. The PilT and PilB proteins contain nucleotide-binding domains

that could provide the energy necessary for retraction and extension of the pilus,

respectively [reviewed in (1 57)]. Also, p i ' mutants exhibit reduced virulence in

mouse models of acute pneumonia, suggesting a role for twitching motility in the

infection process (26). The pi= H, It J, K, L locus encodes homologues of the

chemotaxis (Che) proteins of enteric bacteria. Defects in one of these genes can

block the production of pili or modify the Witching motility patterns, suggesting

the presence of a signal transduction system similar to the chemotaxis system in

the regulation of twitching motility [reviewed in (30, 1 5771. Another regulatory

system composed of AlgR and FimS is involved in regulation of twitching motility

and pilus production, but not pilin transcription. AlgR is a response regulator

involved in alginate regulation, and FimS is one of the sensor kinases that

p hosphorylate AlgR (88).

2.2.3 Regulation

In P. aemginosa, transcription of pilA, the structural component, is regulated by

two factors: RpoN, the alternative sigma factor a54 (75, 146); and a two-

component signal transduction system composed of PilS and PilR, a a540

dependent transcriptional activator (16,66,76). Absence of either RpoN or the

transcriptional regulatory factors PilS and PilR results in a strain unable to

express pilin (76).

The E d 4 complex formed by a54 and the RNA polymerase core enzyme

recognizes and binds to -24-12 bacterial promoters to initiate transcription.

E d 4 forms a closed promoter complex but is isomerization incompetent and

unable to form open transcriptional complexes wlhout a positive regulator.

Sigma-Mependent regulators possess a nucleotide-binding domain and

ATPase activity. ATP hydrolysis provides the necessary energy for isomerization

of the promoter complex (I 30).

Similar regulatory systems have been described for M. xanfhus (1 66). MoraxeIla

sp- (64) and N. gononfioeae (1 39,140) pilin transcription. Indeed, homologues

of PilS and PilR of P. aemginosa have been identifed as transcriptional

activators of the m e p e n d e n t promoter of the pifA homologue in M. xanfhus

($65,166)- In addition, PilS and PilR of P. aemginosa can replace the

transcriptional actbatom of Moraxella lacunafa to activate pi1 in transcription (64).

19

Interestingly, some strains isolated from chronically infected CF patients are

nonmotile and resistant to phagocytosis by macrophages due to €he loss of

flagellum or piii (89). This change in phenotype suggests that pili are no longer

necessary or advantageous to the organism at this stage of infection since the

bacteria are well established on the mucosa. It is possible that other agents such

as the exopolysaccharide alginate take over the role of primary adhesin after

conversion to a muwid phenotype (120)-

2-3 Two-corn~onent sianal transduction svstems

2.3.1 Definition, structural characteristics and mechanism

In order to survive and proliferate, bacteria must constantly be aware of their

environment and adapt to various nutritional and environmental stresses such as

osmolarity, salinity, temperature, pH, availability of notrients and levels of

nitrogen or oxygen. One common response to these changes is chernotaxis

towards more favorable surroundings by modification of the organism's motility.

Another adaptive response is amation or repression of genes coding for

adaptive or virulence facton. Bacteria can sense external stresses by three

systems: the classical Alpdependent metabolite regulated kinaselp hosp hatase

system; the phosphoenolpyruvate:sugar phosphotransferase system; and the

sensor kinase-response regulator system [reviewed in (I 2411. Sensor kinase-

20

response regulator systems are commonly referred to as two-component

systems or histidyl-aspartyl phosphorelay systems.

Sensor kinases generally are composed of two domains: a variable N-terminal

region that serves as the input or sensing domain; and a highly conserved C-

terminal catalyti-c region known as the transmitter domain. The input domain of

many histidine kinases is characterized by hydrophobic segments that span the

inner membrane. This would suggest that these sensors are membrane

receptors that perceive external or transmembrane signals. In many cases, two

TM segments are connected by a Iarge periplasmic loop through which the

external stimulus is sensed. In other cases, however, four, six and even eight

TM segments joined by cytoplasmic and periplasmic loops of varying length can

be found. The input domain is quite variable and its sequence and structure are

likely related to its specific sensory function. On the other hand, the transmitter

domain features four extremely conserved motifs (the N, GI, G2 and F boxes) in

addition to the H block, which carries the histidine residue that is the site of

phosphorylation. Blocks GI (DXGXG) and G2 (GXGXG) are glycine-rich

segments resembling those found in nucleotidebinding proteins and other

kinases. The F box is commonly found between the two G boxes, and the N box

is found upstream ofthe first G box.

21

Like the sensor kinase, the response regulator component of a two-component

system can be divided in Wo functional domains. First, the N-terminal receiver

domain is the most conserved region of the protein. It is characterized by an

aspartate residue that is phosphorylated, two other aspartate residues located N-

terminal of the site of phosphorylation, a threonine and a lysine. All of these

conserved amino acids are located within an acidic pocket that is essential for

phosphorylatian. second; the C-terminal effector or output domain contains the

DNA-binding or regulatory domains of the regulator. Similarities within this

region are also the criteria for assigning a response regulator to a particular

subfamily. For example, members of the NtrC subfamily of response regulators

possess a central ATPase domain. For reviews on the structural and functional

features of histidine sensor kinases and response regulators see references (42,

108, 134,135).

Detection of a specific environmental stimulus by the input domain of the sensor

leads to the dirnerization and autophosphorylation of the transmitter domain. The

catalytic domain of one monomer mediates transfer of the gamma-phosphate

group from ATP to the conserved histidine residue of the other monomer. The

phosphate group is then transferred from the phosphohistidine to the conserved

aspartate residue on the regulator. The phosphotmnsfer event causes a

conformational modification of €he response regulator that allows the effector

domain to exert the appropriate response. The dephosphoryiated receiver

domain exists in such a conformation that it prevents interaction of the effector

with its target, but this inhibition is relieved by the phosphorylation-induced

conformational change. Phosphotransfer between low-molecular-weight

phosphodonors, such as acetyl phosphate, carbamyl phosphate or

phosphoramidate, and the aspartate residue of the receiver can occur with low-

affinity in the absence of a phosphohistidine. This suggests that response

regulators are themselves enzymes capable of catalyzing the phosphotransfer

reaction. The regulator continues to deliver the output signal until

dephosphorylation of the receiver module. In some systems, auxiliary proteins

are required for phosphatase activity, while in other systems the kinase

component is capable of exerting this phosphatase activity [reviewed in (42,

1 35)J.

2.3.2 Use of two-component systems in bacterial v i~ lence and survival

Two-component systems have been identified in several microorganisms where

they regulate many virulence factors and survival mechanisms. As mentioned

previously, signals detected by bacterial sensor proteins may include changes in

osmolarity, salinity, temperature, pH, availability of nutrients and levels of

nitfogen or oxygen [reviewed in (41,134)).

2.3.2.1 Envt-OmpR and osmoregulation

E. cuii responds to variations in medium osmohrity by modifying the porin

content of its outer membrane. In a low-osmolam environment, the porin OmpF

23

predominates in the outer membrane, while in a highosmolarity milieu, the

smaller-sized pon'n OmpC dominates. Regulation of ompF and ompC gene

expression is mediated by the two-component system composed of the histidine

kinase EnvZ and the response regulator OmpR (42,100). EnvZ is an inner

membrane protein that senses external osmotic changes. In response to those

changes, EnvZ autophosphorylates and is then capable of phosphorylating

OmpR. In addition to its autokinase and OmpR kinase activities, EnvZ acts an

OmpR phosphatase (42). The levels of phosphorylated OmpR (OmpR-P)

determine which gene will be activated. When OmpR-P levels are [ow,

transcription of ompF is activated by binding of OmpR-P to high affinity sites in

the ompF promoter. However when OmpR-P levels are high, ompF transcription

is repressed and ompC transcription is activated (42).

EnvZ possesses two TM helices that anchor the protein into the inner membrane,

a large periplasmic domain that perceives the activating signal, a cytoplasmic

linker region and a cytoplasmic transmitter domain that contains the

phosphorylation site (His-243) (42). Depending on the osmolarity conditions,

EnvZ is present either in the phosphatase-dominant or kinasedominant

conformational states (1 14). Under low-osmolari€y conditions, the phosphatase

activity prevails leading to dephosphorylation of OrnpR-P and subsequent

activation of ompFgene transcription. In contrast, in a high osmotic

environment. EnvZ exists in the kinasedominant state and increases the

24

phosphoryfation rate of OmpR thereby causing ompF repression and ompC

activation.

The osmolarity stimulus induces a conformational change of the periplasmic and

TM domains that is transduced through the TM helices to the cytoplasmic

domain, which in turn adopts one of two functional conformations (143). In one

form, His-243 is accessible to ATP bound to the nucfeotide-binding regions of the

kinase domain for autophosphorylation; phosphorylated EnvZ therefore acts as

an OmpR kinase. In the other conformation, EnvZ autokinase activity is reduced

because His-243 is inaccessible to ATP. Non-phosphorylated EnvZ then acts as

an OmpR-P p hosphatase (71). The ratio of these two enzymatic activities

determines the amount of OmpR-P present in €he cell and consequently which

porin gene will be transcriptionally activated or repressed.

Mutations in the conserved motifs of the cata(ytic domain (H. N, F, GI and G2

boxes) alter either or both kinase and phosphatase activities (71). The active

sites for both functions are proposed to overlap and be centered on the H box.

Although His-243 is essential for kinase function, it is important but not essential

for phosphatase activity (71,72). Mutations and deletions within the linker region

do not affect dimer formation or EnvZ function if the cytoplasmic domain is

detached from the membrane, but has negative effects on activity when

connectad to the transmembrane portion of EnvL The linker region is therefore

25

proposed to help bring two EnvZ monomers together and to communicate the

signal from the sensing domain to the kinase domain (107).

The external stimulus sensed by the periplasmic loop of EnvZ has not been

precisely identified. Recently, a 13 amino acid segment conserved among EnvZ

homologues of other enteric bacteria has been identified and named the identity

or 1 box (158). This I box is located at the junction of the first TM and the

periplasmic region and was proposed to be directly involved in signal sensing

and regulation of the kinase-phosphatase ratio (1 58).

Dimerization is a common event for sensor kinases and EnvZ is no exception.

EnvZ dimerization occurs in both the periplasmic and cytoplasmic portions of the

protein and is thought to be ligand-independent (65). The same region

encompassing the I box is proposed to form a leucine zipper-like structure

involved in dimetiration of the periplasmic domain and signal transduction (167).

The intramolecular and intermolecular interactions between the two TMs is

essential for signal transduction since the effects of mutations in one TM can be

suppressed by mutations in the other (144). In support of the EnvZ dimer model,

Yang and lnouye (171) have shown that co-expression of EnvZ lacking the

catalytic domain but possessing the phosphorylation site (His-243) and EnvZ with

His-243 substituted for a valine but containing the kinase domain is capable of

activating ompC transcription. Separately, each of these modified proteins lacks

26

kinase and phosphatase ac3vity. However, when co-expressed, the autokinase

and OmpR kinase activities are restored suggesting that one EnvZ monomer

transphosphorylates the other monomer.

2.3.2.2 The chemotuh system

Motile bacteria alter their swimming pattern in search of a more favorable

environment in E. coli and Salmonella typhimurium, four inner membrane

sensory receptors (Tsr, Tar, Trg and Tap) bind or interact with a specific

attractant (sen'ne, alanine, glycine, aspartate, glutamate, maltose, ribose,

galactose, various dipeptides) or repellent (acetate, indole, leucine, cobalt,

nickel). These receptors are meth y I-acce pting chemotaxis proteins (MCPs)

localized to the poles of the bacterial cell. Six soluble proteins (CheA, CheB,

CheR, CheW, CheY and CheZ) are involved in transducing the signal from the

receptors to the flagellar motor to cause a change in swimming direction

(tumble). CheA is a histidine sensor kinase that undergoes trans-

autophosphorylation when a repellent is perceived by the MCPs. CheA then

phosphorylates CheB, a methylesterase, or CheY, which then interacts with the

components of the flagellar switch (FIiG, FliM and FBN) to induce tumbling

motion. Binding of an attractant inhibits CheA phosphorylation leading to low

levels o f phospftoryfated CheY and a smooth swimming motion towards the

attractant. CheW monomers serve as bridges between MCP dimers and CheA

dimers and are necessary for CheA autophosphorylation. CheZ acts as a

phosphatase and reduces the levels of phosphorylated CheY in order to restore

27

a smooth swimming motion. CheR, a methyltransferase, and phosphorylated

CheB control receptor sensitivity by monitoring the levels of receptor methylation

[reviewed in (2, 1 I, 1 34) 1.

2.3.2.3 NtrB-NtrC and nitrogen regulation

Enteric bacteria like E. coli and S. typhimunum respond to conditions of nitrogen

starvation or excess by increasing or decreasing, respectively, the amount of

glutamine synthetase (product of glnA) in the cell. A two-component regulatory

system composed of the soluble histidine kinase NtrB (or NRII) and the response

regulator NtrC (or NRI) regulates transcriptional expression of glnA. The PII

protein (product of glnB) is also involved in transcriptional control of glnA by

exerting a regulatory function on NlrC-P dephosphorylation. Under nitrogen

limited conditions, NtrB autophosphorylates at His4 39 and transfers that

phosphate group to the Asp-54 of NtrC, which, once activated, binds sequences

upstream of the glnA promoter to activate gene transcription. NtrB, in

conjunction with unmodified or deuridylylated PI[, acts as phosphatase and

facilitates dephosphorylation of NtrC-P under nitrogen excess conditions (1 34).

NtrB shares many features with EnvZ. Like EnvZ, NtrB forms a dimer and one

monomer is phosphorylated in trans by the other monomer (1 03). Also, the

phosphorylatian site (His-139) is not required for phosphatase adivity (el), but

the H box is important for both kinase and phosphatase activities (81.82).

Conformational changes in the transmitter region in response to a stimulus allow

or prevent the interaction of the H box with the N and G domains, therefore

determining which enzymatic activity will predominate (82).

NtrC is a dimeric cytoplasmic protein composed of three domains. First, the N-

terminal receiver domain contains Asp-54, the residue that receives the

phosphate from NtrB, and the other conserved residues of response regulators.

Second, the central output domain possesses nucleotide-binding motifs. This

region exhibits ATPase activity and is likely to be the region that interacts with

the 054 holoenzyme. Third, the C-terminal helix-turnhelix DNA binding domain

binds to enhancer sequences of the glnA promoter (129).

The glnA promoter possesses -241-12 sequences characteristic of a54-

dependent promoters. NtrC dimers bind cooperatively to an enhancer sequence

containing Wo binding sites (upstream activation sequences. UAS) found

upstream of the glnA promoter and interact to form an otigorner (I 13).

Cooperative binding to UAS is the result of proteingrotein interaction between

NtrC dimers, is increased by phosphorylation of NtrC and is not mediated by the

Gterrninal DNA-binding domain (1 13, 160). Tetramerization, cooperative binding

to UAS and phosphorylation of NtrC are required for ATP hydrolysis (7, 113,

159). ATPase activity of each NtrC dimer in the oligomer is essential for

activation of transcription (1 59). The energy provided by ATP hydrolysis

29

catalyzes a conformational change in Ea54 and formation of an open promoter

complex leading to initiation of gene transcription.

2.3.3 The PilS-PilR system of P.' aemginosa

2.3.3.1 PiIR, the response regulator

As mentioned previously, pilin expression in P. aemginosa is regulated by RpoN,

the alternative sigma factor, and the Wo-cornponent system PilS and PilR. PilR

is a transcriptional activator required for initiation of transcription from the a54

dependent pilA promoter. PilR is a 50 kDa cytoplasmic protein that shares great

homology (62% similarity across the entire molecule and 71 % over the central

region) with the NtrC family of response regulators (76). It contains the

conserved aspartate and lysine residues (Asp-1 1, Asp-54 and Lys-104) as well

as the central ATPase domain characteristic of this family. The C-terminal helix-

turn-helix DNA-binding domain, however, shows less similarity to NtrC and is

iikeIy specific for the piIA promoter. Deletion of pilR has no effect on ff agellin

expression (which also requires RpoN) or on the ability of the bacteria to grow in

the absence of glutamine, but results in a strain unable to synthesize pilin (76).

DNA footprinting analyses have shown that PilR binds to four UAS located

between position -74 to -122 relative to the piM transcriptional start All four of

these consensus sequences are necessary for transcription since pilin gene

expression is abolished when any of the PilR-binding sites are mutated or

30

deleted (79). An earlier study had already shown that deletion of a 48 bp

fragment upstream of the pilA promoter greatly reduced pilin expression (109).

PilR purified from E. coli in the absence of PilS retains its specific DNA-binding

abilities (79). This suggests that phosphorylation does not directly confer DNA

binding capabilities to the response regulator, but might improve affinlty of the

regulator for DNA and be necessary for the next steps of transcriptional

activation. Also, overexpression of pilR in the absence of PilS leads to pilin

transcription suggesting that PilR can be phosphorylated by low-molecular weight

phosphodonors or by cross-talk with another kinase, or that high levels of

unphosphocylated PilR can stimulate transcription (17).

2.3.3.2 Function of PiIS, the sensor kinase

Many lines of evidence suggest that like many other sensor kinases, PilS exhibits

two contrasting functions (17). First, it is an autokinase and PilR kinase and

second, it is a PiIR-P phosphatase. In the presence of the activating signal, the

kinase-dominant state prevails and PilS autophosphorylates and transfers the

phosphate to PiIR. PiIR-P then binds to the UAS and interacts with RpoN and

RNA polymerase which leads to activation of pilA transcription and synthesis of

pilin (Figure i ). However, when the signal is absent, the phosphatase activity of

PilS dominates and the rate of PIRmP dephosphorylation is increased so that

piiin transcription is stopped, The signal(@ to which PilS responds remains

unknown, but is likely to be present in small amounts because overexpression of

PilS results in phosphatasedominant state and inhibition of pilin expression.

Also, high concentrations of PilS in the cell inhibit pilA transcription in a dose-

dependent manner (17).

2.3.3.3 Stnrctural features of PilS

PiIS is an inner membrane protein localized to the poles of the bacterial cell (15).

Structurally, the 59 kDa protein consists of three regions: an N-terminal

hydrophobic domain, a central linker domain and a C-terminal kinase domain

(Figure 2) (17). The hydrophobic domain is required to anchor the protein to the

inner membrane, but is not sufficient to target PilS to the poles, the entire linker

region must be present for polar localization of PilS (15).

Based on computer analysis measuring hydrophobicity (25), the N-terminal176

amino acids of PilS are predicted to form six TM helices spanning the inner

membrane connected by short hydrophilic periplasmic and cytoplasmic loops.

The other two regions (linker and transmitter) are predicted to reside in the

cytoplasm. A similar topological arrangement is also considered for other

kinases, such as DivJ of Caulobacfer crescentus (l05), LytS (20) and AgrC (86)

of Sfaphyfococcus aureus and PrtB of Rhodobacter sphaeroides (1 06).

TypicalIy, the signal to which sensor kinases respond is perceived via the N-

terminal portion of the protein. In the case of PiIS, the stimulus could be detected

either by the fM domain or the linker region or both, which does not exclude the

possibilRy of two activating signals. Since most of the TM domain is predicted to

be localized within the inner membrane, it is quite possible that the activating

signal is also located within the membrane.

The function of the linker region (residues 177 to 296) in this signal transduction

system has yet to be clearly determined. However, this region shows weak

sequence homology to PAS domains. In prokaryotes, PAS domains are mostly

found in histidine kinases where they monitor variations in light, redox potential,

oxygen and energy levels in the cell. These domains are cytoplasmic and

usually found adjacent to the TM regions of membrane-associated sensor

kinases. Cofactors such as heme and Ravin adenine dinucleotide (FAD) can

attach to PAS domains. PAS domains are involved in regulation of bacterial

behavior (aerotaxis) and cellular metabolism and development (742). The C-

terminal catawc domain of PilS (residues 297 to 530) contains the

phosphorylation site, His-319, and other conserved motifs of sensor proteins and

is required for kinase activity (I 7).

2.4 Structure of inner membrane proteins -

2.4.1 Topology: definition and classification

The topology of a protein can be defined as the arrangement of the polypeptide

chain relative to the membrane, more specifically the location and orientation of

hydrophobic membranespanning segments. Hydrophobic segments within a

33

membrane protein either function as export signals (signal peptides) that target

the protein to the membrane and promote insertion or translocation of the

polypeptide, or as stop-transfer sequences that terminate translocation of the

protein. Start-sto ptransfer sequences are hydrophobic segments that initiate as

well as block insertion of the protein. These three different types of hydrophobic

domains are similar in composition, but differ in the upstream and downstream

hydrophilic flanking regions (1 56).

The orientation of a hydrophobic segment is determined by the distribution of

positive charges around it and the orientation of the preceding segment When

positively charged residues (arginine, lysine) precede a hydrophobic domain, this

domain will act as an export signal; alternatively a hydrophobic segment followed

by basic residues will act as a stop-transfer sequence (3, 169, 170). Interactions

between hydrophilic regions or between hydrophobic TM segments, as well as

the speed and stability of protein folding may also play a role in the way a protein

inserts into the membrane (147).

lnner membrane proteins are divided into four classes according to their

orientation and the type of sequence that drives the protein to the membrane

(19,133, 156) (Figure 3). Every membrane protein possesses an N-terminal

signaf peptide that targets the protein to the membrane. The signaI peptide

remains embedded in the membrane whether or not it is cleaved by a leader

34

peptidase. Class I proteins possess a signal peptide and a stop-transfer

sequence. The signal peptide is cleaved to generate a mature protein with its N-

terminus located in the periplasm and the stop-transfer sequence alone anchors

the protein into the membrane. Class If proteins contain only an uncleaved

signal peptide, while class Ill proteins possess an N-terminal start-stoptransfer

sequence that targets and anchors the protein to the membrane. The difference

between these two classes is the location of the N- and C-termini. Polytopic

proteins (class IV) have multiple TM segments and represent a succession of

export signals and stop-transfer sequences. The location of the N-terminus is

dictated by the first export signal, if the signal peptide is cleaved off, the N-

terminus will be periplasrnic otherwise it will remain in the cytoplasm. The N- and

C-termini of polytopic proteins can be located on the same side of the

membrane, either the cytoplasm or penplasm, or on opposite sides (133,156).

2.4.2 Structural and functional implications of sequence modifications

The native topology of a membrane protein is fairly resilient, only substantial

sequence modifications wilI alter the topology of some proteins. In many

instances a single amino acid change or deletionhnsertion of a membrane-

spanning segment will result in a relativejy " n ~ n a [ ~ insertion (9,22,43,58,94).

However, mutations that introduce positiveIy &arged residues can block

translocation or insertion of the polypeptide into the membrane or cause an

inversion in the topologicat model of the protein (3.133. 169,170). The topoiogy

35

of a protein can also be affected by defects in the secretion mechanism, such as

mutations in the protein SecY (I 7 5). One possible explanation for this tolerance

is that export signals are present throughout the protein and that each of these

signals can independently promote insertion of a segment of the protein into the

membrane (22,43). lnw rred membrane insertion or folding of a protein can

result in disruption of the protein's fundion. leading to possible defects in

secretion and uptake mechanisms as well as other essential systems (9,94).

2.4.3 Mechanisms of protein insertion

2.4.3.1 Secdependent pathway

The Secdependent translocation pathway is the first step of the general

secretory pathway. The Sec system is also used for membrane insertion of inner

membrane proteins. This system is composed of seven proteins: SecA, B. D, E,

F, G and Y (Figure 4) (36,127,161), SecA is a peripheral membrane/

cytoplasmic protein essential for cell viabili. SecA possesses two nucleotide

binding sites, it is the only Sec protein that exhibits ATPase activity (36, 145).

SecB is a cytoplasmic chaperone that escorts the newly synthesized peptide

from the cytoplasm to the membrane where it meets SecA and the translocase

complex. SecB prevents premature folding and aggregation of the preprotein

and promotes interaction with SecA (127,161). SecE, G and Y are integral

membrane proteins that form a complex called the translocon or translocase

complex. These three proteins are proposed to form a channel through which

the preprotein traverses the bilayer (36). Finally. SecD and SecF are also

membrane proteins, but their role in the translocation process is not well

understood. It is thought that these proteins are involved in the late stages of this

process, probably in the release and proper folding of the protein in the

periplasm, or in regulation (36).

The first step of the See pathway is recognition and binding of SecB, the

chaperone, to the newly formed peptide as it emerges from the ribosome or later

in the translation process. This SecB-precursor complex then interacts with

SecA. The threecomponent complex then moves to the membrane and SecB is

released and recycled. SecA interacts with the anionic phospholipids of the

membrane and the SecYEG translocon. Binding of ATP to S e w s high-affinity

nucleotide-binding site and interaction with SecY stimulate the insertion of the

SecA-preprotein complex into the membrane (96). Interaction of SecA with the

translocon stimulates ATP hydrolysis, which. causes the release of the prep rotein

into the translocation channel (145,151). SecA is withdrawn from the membrane

after a second A T binding and hydrolysis reaction at its low-affinity nucleotide-

binding site (151). At this stage, the leader peptidase will cleave off the signal

peptide (if necessary).

In the case of a periplasmic, outer membrane or extracellular protein being fully

transiocated across the membrane, the proton motive force wmIl drive the

37

translocation of the protein to completion (145, q51). In the absence of a proton

motive force, repeated cycles of SecA insertion, ATP binding and hydrolysis and

SecA withdrawal will complete the movement of the protein across the

membrane (I 45, 15 1 ). Alternatively, the proton motive force-mediated

translocation of a membrane protein will continue until a stop-tansfer sequence

is encountered and the precursor is released from the translocon and integrated

into the membrane (40). SecA will then interact with the next hydrophobic

segment (a start-stop-transfer sequence) and insert it into the translocon through

another cycle of ATP hydrolysis. These cycles will be repeated until the protein

is completely insetted into the membrane.

2.4.3.2 Signal recognition particle pathway

The signal recognition particle (SRP) pathway provides targeting assistance to

secreted or integral membrane proteins, much like the chaperone SecB. The

bacterial SRP is a ribonucleoprotein composed of a 4.5s RNA and a 48 kDa

GTPase named Ffh or P48, and is very homologous to the eukaryotic 7s RNA

and 54 kDa GTPase (34). SRPdependent protein insertion also requires the

translocase complex, suggesting that the SRP and Seedependent pathways

converge at the inner membrane (33,149). The requirement of SRP rather than

SecB for targeting is primarily determined by the hydrophobicity of the signar

sequences, therefore it is speculated that SRP is the targeting system of choice

for polytopic inner membrane proteins (34,148). Secreted proteins may use

SRP if the Sec machinery is deficient Hydrophobicity, muftiple TMs and large

hydrophilic periplasmic domains all contribufe to determining the SRP-

dependence of a protein (I 02).

In contrast to SecB, which recognizes the nascent chain at a post-translational or

late co-translational stage, SRP binds to the signal peptide as soon as it emerges

from the ribosome, causing a pause in the translation process (Figure 5). The

complex formed by the ribosome-bound nascent chain and SRP is then picked

up by the SRP receptor FtsY. FtsY and SRP are released from the nascent

chain after the complex interacts with the membrane at an unknown site, most

likely near the translocon. This event is preceded or accompanied by GTP

binding to both SRP and FtsY. The peptide chain is now free to insert into the

SecYEG translocon for translocation into the periplasm or insertion into the

membrane. Following GTP hydrolysis, FtsY and SRP dissociate from each other

and are recycled (48, 149).

2.4.3.3 Sec-independent pathway

The Mi3 procoat protein is the prototype of the Seoindependent membrane

insertion pathway. It possesses a typical signal peptide but does not require the

Sec apparatus to be correctly inserted into the membrane (162). In Sec-

independent insertion, it appears that a protein spontaneously inserts into the

membrane without the help of the translocase complex, but does require the

membrane electrochemical potentiat (4.29) (Figure 6). The number of k g and

Lys in a hydrophilic domain as well as the length of the segment to be

39

translocated determine if the Sec proteins are needed for protein insertion (155).

Hydrophobic segments pair up and form a helical hairpin that would insert into

the lipid bilayer. If a segment is sufficiently hydrophobic, it will remain in the

membrane and translocation will be stopped, however if a helix is polar,

translocation will continue until a stop-transfer sequence is encountered. Multiple

hairpins can insert into the membrane to generate polytopic proteins (44).

2.5 To~oloeical studv of inner membrane ~roteins

2.5.1 Statistical prediction of a protein's topology

2.5.1.1 Amino acid distribution and the positive-inside rule

The distribution of the positively charged amino acids in the loops connecting the

TM a-helices is considered the major determinant of a protein's topology. This

rule, first described by von Heijne (153) as the positiveinside rule, states that

cytoplasmic loops contain a higher number of the positively charged amino acids

arginine and lysine. In addition, the occurrence of the negatively charged

residues (aspartate and glutamate) is not increased in the periplasmic loops and

should not be considered when defining the topology of a membrane protein.

Although histidine carries a weak positive net charge at a neutral pH, it is not

considered a major topological determinant However, under slightly more acidic

cytoplasmic conditions, the effec2 of its positive charge is accentuated and His

becomes a topological facbr (3). Other studies all agree that the number of Arg

and Lys in the cytoplasmic segments is the most important factor in

determination of the topology. while His, Asp and Glu only have a very weak

effect on topology (3. 1 54. 1 56).

The positive-inside rule holds true for connecting segments shorter than 70 to 80

residues (1 56). The Arg and Lys distribution bias is observed for every

connecting loop of a polytopic protein (1 54). All cytoplasmic segments possess a

larger number of Arg and Lys than periplasmic domains independently of their

position in the protein sequence.

Other amino acids in addition to Arg and Lys appear to be asymmetrically

distributed across the membrane. Proline residues are more prevalent in the

periplasrnic loops compared to the cytoplasmic segments (1 53). As expected,

the hydrophobic residues phenylalanine, isoleucine, valine, methionine and more

importantly leucine are enriched in the membrane-spanning segments as

opposed to the connecting [oops (153). The aromatic residues tryptophan,

tyrosine and phenylalanine are more prevalent at the ends of the TM helices at

the junction of the membrane and the intra- or extracellular environments (321).

As weli, glycine residues are commonly found at the Gterminal end of a helix,

white prolines tend to occur immediately upstream of the N-terminal end of a

helk (121).

41

The concentration of anionic phospholipids in the membrane was shown to be a

determining factor of membrane topology by blocking translocation of positively

charged residues (152). This effect is independent of the mode of protein

insertion.

2.5.1.2 Hydrophobicity plots and secondary structure prediction

Many hydrophobicity scales and algorithms have been developed over the last

30 years to help in the prediction of a membrane protein's topological

arrangement (28). Two of the better known and most widely used scales were

developed by Kyte and Doolittle (83), and Engelman, Steitz and Goldman (GES)

(45). In general. each amino acid is given a hydrophobicity value based on its

structure, solubility, interadion with the lipid bilayer, ability to form a a-helix and

other chemical and physical characteristics. Although these algorithms are

similar, the parameters used in the calculations vary from one index to another,

hence their accuracy is the subject of much discussion (35,45,47,77, 112).

A hydrophobicity plot can be obtained by measuring the average hydrophobicity

and net charge of a moving window of amino acids along the sequence. A peak

of hydrophobicity suggests that a region may form an alpha helix and be inserted

into the membrane. Some DNAlprotein analysis computer programs like

DNASIS(B (v2.0, Hitachi Sofhnrare Engineering Co. Ltd.) and Gene Inspectorm

Vextco Inc.) can generate a hydrophobicity p[ot using different scales and

window size. Other sofhvare, like TopPredlI (25) and TMPred (69), go further in

42

their topoIogical predictions and consider the probability of helix formation as well

as the hydrophobicity of a series o f residues. These programs also suggest the

most likely orientation of the predicted helices and provide a possible topological

mode[ of the protein based on the sequence submitted. Secondary structure

programs are also available on the internet. The results obtained from these

p rograrns represent only a prediction of the protein structure, therefore

experimental testing must confirm the topology.

2.5.2 ExperimentP1 determination of a topology

2.5.2.1 Genes fusions

Statistical topological prediction methods are fairly accurate, but they only

represent a theoretical model and should be confirmed experimentally. The best

described and most widely used experimental system for confirming the topology

of an inner membrane protein is the gene fusion method (14.68, 92,93, 147).

This method takes advantage of the fact that certain enzymes require a specific

environment to fold property and be active. Alkaline phosphatase (PhoA) and

lactamase are only active when translocated into the periplasm, whereas P

galactosidase (La@ is only active in the cytoplasm. These three proteins are

commonly used as reporter enzymes for this system.

A promoterless gene coding for a reporter enzyme lacking its start codon and

export signal is introduced at various random or planned Locations within the

43

gene of interest, thus creating a hybrid protein where the C-terminus of the

protein of study is replaced by a reporter. ~evels of enzymatic activity of the

fusion protein indicate the cellular location of the fusion site. A PhoA hybrid

protein will show high PhoA enzymatic activity if the fusion site is periplasmic,

while low PhoA activity will suggest a cytoplasmic fusion site. Alternatively, high

Lac2 activity generated by a Lac2 hybrid protein is an indication of a cytoplasmic

fusion site, while low activity signifies that the fusion site is periplasmic (Figure 7).

This method has been used by many researchers to determine the topology of a

variety of inner membrane proteins such as MalF (? Z), MalG (1 3), KdpD (172)

and Lacy (21) of E. coli, DotA of L. pneumophila (122), XcpP, Y and Z (10) and

PilD (137) of P. aeruginosa.

2.5.2.2 Other approaches

Other biochemical and immunological methods are also used to determine a

protein's membrane topology. These include vectorial labeling, hydrophobic

labeling, in situ proteolysis and imrnunoblotting (78, 147). Briefly, radioactive or

ff uorescent hydrophilic reagents and spin-labefed small moIecules can be used

as labeling agents to identify sequences found outside the permeability barrier of

sealed membrane preparations. Similarly, membrane-spanning segments can

be identified using hydrophobic labels, Segments of a protein may be

susceptible to proteoIytic cleavage depending on their cellular location. Mutant

proteins with inverted or modified topologies react to proteases, detergents or

44

other chemicals differently than the wildtype protein. This approach is well

described for the E. coli leader peptidase (Lep), this protein is widely used to

study insertion mechanisms and topological determinants. Finally, binding of

antibodies raised to specific epitopes on the protein can be tracked to the

cytoplasmic or extracellular side of a sealed membrane preparation.

Other methods that take advantage of the biochemical and functional properties

of the protein of interest have also been described (147). Topological changes

may be monitored by inhibition or modification of phosphorylation or N-linked

glycwylation of the mutant protein compared to the wildtype protein. A protein's

nonal function may also be modified by topological changes.

Chanter 3. MATERIALS & METHODS

3.1 Media and su~~lements

Bacteria were grown in Luria (LB) broth or agar (10 gR NaCI, 10 g1L tryptone, 5

g/L yeast extract) and Lennox LB (5 gR NaCI). Ampicillin (Amp) and tetracycline

(Tet) were used at a concentration of 100 pg/ml and 20 pg/mI, respectively, for E.

COIL Carbenicillin (Carb, 150 pglml), streptomycin (Str, 200 pg/ml) and Tet (80

Clglml) were used for P. aervginosa. 5-bromo-4-chloro-3-indolylphosphate (XP,

40 pglml), 5-bromo-4-chloro-3-indoIyl galactopyranoside (Xgal, 40 pgfml) and

isopropyl-$-D-thiogalactoside (IPTG) were also added when required.

3.2 DNA mani~ulations

Standard recombinant DNA techniques were used (8,90). Plasmid DNA was

isolated from bacterial cells by the alkaline lysis method using the QlAprep Spin

Miniprep Kit (QIAGEN, Hilden, Germany). DNA was purified from agarose gels

using the QlAquick Gel Exhadion Kit (QIAGEN, Hilden. Germany). Enzymes

were purchased from Gteco BRL (Gaithenburg, MD), unless otherwise stated.

3.2.q DNA linker insertion

Single-stranded selfcomplementary DNA linker oligonucleotides were

synthesized by the University of Calgary DNA Services. The linker preparation

was diluted to I pg/pI in sterile dH20 and annealed by incubating at 72% for 5

minutes, cooled to 65OC and incubated 5 minutes at 65OC. The solution was then

slowly cooled to room temperature. Two microliters of the solution (2 pg linker

DNA) were used in a ligation reaction containing 0.1 pg vector DNA. The vector

DNA was digested with EcoRI, for insertion of the KpnRBS linker, or Bglll, for

insertion of the EwRIATG linker, and purified from an agarose gel.

33.2 Alkaline phosphatase treatment

When necessary, restriction digested DNA was treated with calf intestinal

alkaline phosphatase (CIAP) to prevent vector religation. The digestion mixture

containing 1-2 pg of cut DNA was dialyzed against d H P on a 0.025 prn pore

size filter (Millipore, Bedford, CA) for 10 minutes to remove excess salts. The

desalted DNA solution was recovered, ClAP buffer was added (for a I X

concentration) and ClAP was added at 'IUlpg DNA. This solution was incubated

30 minutes at 37OC and purified using the QlAquick PCR Purification Kit

(QIAGEN, Hilden, Germany).

3.2.3 DNA transfornation in P. aeruginosa

DNA was introduced into P. aenrginosa by chemical transformation according to

the method of lrani and Rowe (73). Electroporation was also used. The recipient

strain was grown overnight on LB agar. The bacterial lawn was collected and

resuspended in 1 ml of sterile 2% sucrose with 20 mM MgC12. The cells were

washed once in the same sucrose-MgC12 solution and resuspended in 400 pl of

sterile 2% sucrose. One hundred microiiters of cells were placed in a chilled

electroporation cuveffe, 50 ng of DNA was added and the mixture was pulsed.

The electroporation settings used were: 400 ohms resistance, 25 pFD

capacitance and 2.1 volts. The electroporated mixture was allowed to recover for

I hour in I ml LB broth at 37OC before plating on LB agar supplemented with the

appropriate antibiotic.

Mutations were introduced by a polymerase chain reaction (PCR)-based method

or using the QuikChangem Site-Directed ~ k e n e s i s Kit from Stratagene (La

Jolla, CA). The oligonucleotide primers and linkers used to introduce the

mufations are described in Table 1. The rationale for the construction of the

fusion plasmids is shown in Figure 8. Table 2 provides a summary of the pilS

mutants and other strains and plasmids used in this study.

3.3.1 PCR mufagenesis

Plasmid pJB315, which carries the pilS gene in a pBluescript vector, was used as

the DNA template for PCR mutagenesis. This method was used to introduce

BamHl restriction sites at five different locations within the pilS gene. PCR

amplification was performed using primer 27, which binds to the vector

backbone, and either one of the mutagenesis primers 3,4,9,10 or 14. The

following amplification conditions were used: 30 cycles of 1 minute denaturation

at 95*C, 1 minute annealing at 55OC and 1.5 minutes extension at 72OC in the

presence of pfu turbo DNA polymerase (Stratagene, La Jolla, Ca). Magnesium

(2 mM) was present in the reaction buffer provided with the enzyme.

The amplification product was purified from an agarose gel and digested wiih

EcoRl and BamHI. The digested piiS fragment, which represents a truncation of

the gene, was purified from an agarose gel and ligated into the cloning vector

pUCP22, thus generating plasmids pJE616, pJE619, pJE625, pJE630 and

pJE637. The KpnRBS linker was introduced at the EcoRl site of these five

constructs to generate plasmids pJE616K, pJE621, pJE625K, pJE630K and

pJE637K, respectively. The KpnRBS linker introduces a Kpnl restridion site

upstream of pjIS and cancels the EcoRI site in which it was inserted. The EcoRl

site was removed because it is also found in the iacZ and phoA genes of the

reporter vectors and could not be used for doning. This linker also introduced a

new ribosome-binding site (RBS) closer to the piiS initiation codon to improve

protein expression.

3.3.2 QuikChangen mutagenesis

The Kpnl-BamHI fragment carrying the complete pilS gene corresponding to

amino acids (a. a.) 1 to 529 from pJE621 was subcloned into pBluescript SKI[+ to

create plasmid pJE640, the template for the QuikChangeTM Site-Directed

Mutagenesis protocol. This technique was perfarmed as prescribed in the

instruction manual provided by the manufacturer. PCR amplification was

conducted at the following conditions: 30 seconds denaturation at 94OC. 1 minute

annealing at 55OC and 12 minutes extension at 68OC for 16 cycles.

Using the QuikChangem method and primers 15-18 and 20-23. Bglll restriction

sites were introduced at 4 other locations within pilS. Plasmids pJE641, pJE646,

pJE652 and pJE655 were thus produced. A Bglll restriction site was also

introduced at the iocation corresponding to a. a. 75 of PilS in pJE641 and a. a.

304 of PIIS in pJE659 with this method using primers 15-16 and 33-34, yielding

plasmids pJE644 and pJE810, respectively. - The EcoRIATG linker was

introduced into the Bglll teskicfrCon site of pJE641, pJE646 and pJE652 to

introduce a start codon at a. a. 123.75 and 49 of the native protein, respectively,

yielding plasmids pJE641E, pJE646E and pJE652E. The EcoRlATG linker

cancels #e Bglll site and introduces an EcoRl restridion site as well as an in-

50

fiame ATG start codon. The addition of these two features allows the creation of

three deletion constructs in which the N-terminaI helices are removed and TM2,

TM3 or TM5 now become the first helix of the mutant PilS proteins.

3-4 Construction of the pj/S internal deletions

34.1 Full-length deletions

The full-length deletions are constructs in which only one or more helices are

removed, while the linker and transmitter domains of PilS are maintained. The

first internal deletion produced was pJE645. It was created by removing the 144

bp Bglli-Bglll fragment corresponding to a. a. 76-123 of PiIS from pJE644.

Similarly, a 381 bp 8g111-Bg111 ftagment was removed from pJE810 to create

pJE811, which carries a deletion of 5 TM segments and the linker region of PIIS.

The 310 bp fragment corresponding to a. a. 1-99 was removed from pJE616K

with Kpnl and BarnHl and inserted into pJE641 and pJE655 to replace the

previous Kpnl-Bglll ftagment The two plasmids created, pJE649 and pJE664,

possess a deletion in the pilS gene corresponding to a. a. 100-123 and a. a. 100-

In, respectively. The other internal deletions were generated in a similar

manner. The 164 bp KpnCBglIl fragment was removed from pJE652 and

inserted at the same sites in pJE655, pJE646 and pJE6-I. Plasmids pJE659,

pJE662 and pJE663 were created; they contain a piiS gene deIeted for segments

51

corresponding to a. a. 50-177, a. a. 50-75 and a. a. 50-123 of the mature protein,

respectively. P lasmids pJ E660 and pJE66 2 were produced by rep lacing the

Kpnl-Bglll fragment from pJE655 with the 242 bp and 386 bp KpnCBglll

fragments from pJE646 and pJE641, resulting in deletions of a. a. 76-17? and

a. a. 124-177. respectively. A deletion of the segment that translates to TM6 (a.

a. 155-177) was created by replacing the Kpnl-Bglll fragment from pJE655 with

the 479 bp Kpnl-BamHI segment from pJE625K.

3.4.2 Truncated deletions

Truncated deletions consist of the fulklength deletions in which the TM6, linker

and transmitter domains (corresponding to a. a. 155-529) are removed. Using

the PCR-based mutagenesis method, a BamHl restriction site was introduced at

the location corresponding to a. a. 154 of the native protein in various mutants of

pilS. PCR amplification was performed using primers 27 and 9 and plasmids

pJE649, pJE645, pJE662, pJE663, pJE646E and pJE652E as DNA templates-

The PCR products obtained with the first four templates were digested with Kpnl

and BamHI, purified from agarose gels and ligated into pBluescript to create

pJE656, pJE667, pJE696 and pJE699, respectively. The PCR products obtained

wiVl the other brvo templates were digested with EcoRl and BarnHl and

introduced in pBluescript to produce pJE8Wand pJE807. The KpnRBS linker

was then introduced into the EcoRl site of these two plasmids to generate

pJE804K and pJE807K respectively.

3.5 Construction of the aene fusions

3.5.1 The reporter vectors

The reporter vectors pJE608, pJE609 and pJE670, shown in Figure 9, are

derivatives of the low copy-number broad host range vector pMMB67EH (56).

This vector contains lacp, the lac repressor, to allow transcriptional control from

its tac promoter. The three reporter vectors possess a unique in-frame BamHl

restriction site at the N-terminus of the reporter gene.

Plasmid pJE608 contains the promoterless lac2 gene missing its first eight amino

acids from pMC1871 (Pharmacia Biotech, Uppsala, Sweden). The gene was

removed from pMCi871 as a BamHl fragment and ligated into the BamHl and

Bglll restriction sites of pSL1180 (Pharmacia Biotech, Uppsala, Sweden). The

lac2 gene was then removed from this intermediate construct and ligated into

pMMB with BamHl and Xbal.

Plasmid pMS501 (137) was used as the source of phoA to create pJE609. First,

a 1.4 kb fragment was removed from pMS5Ol by digesting with BstEll and Nhel,

blunting both ends and religating. Then, the 1.7 kb ftagment containing the phoA

gene lacking a start codon and its export signal sequence was removed from this

construct and inserted into pMMB with BamHI and Hindlll. Similarly, the gene

53

coding for the green fluorescent protein (GFP) was removed from pJB713 and

inserted into pMMB with BamHl and Hindill to create pJE670.

3.5.2 Fusions of pilS to lac& phoA and gtjp

The pilS derivatives (described above and in Table 2) were fused to the reporters

using either Kpnl or EcoRl at the 5' end and BamHl or Bglll at the 3' end of the

pilS fragment. Three series of translational fusions were thus created, see

Figures 10, I1 and 12 for a diagram representation of the constructs created.

The same pilS fragments were also subcloned out of the pUCP22 or pBluescript

vectors where they were first cloned, and inserted into the pMMB vector (without

any reporter gene) using the same restriction enzymes. In this manner, a

complete panel of truncation and deletion mutants were created with fusions to

lacZ, phoA and gfp. All of the constructs are carried on the pMMB vector and

expressed from the iac promoter. The EcoRlATG linker was introduced into the

BamHl site of pJE608 to add a start codon to IacZ. The resulting plasmid.

pJE680, is used as a positive control for B-galactosidase activity.

3.6 Construction of the ~romoter fusion

In order to monitor pilin gene expression. a transcriptional fusion of the pilA

promoter to gfp was consfructed. Because of low levels of fluorescence obtained

from the pGG103A construct @iM promoter-gfp), a translational enhancer was

54

added upstream of the gfp gene to improve GFP translation efficiency. The

translation initiation region FIR) described by Miller and Lindow (99) and Cheng

and Patterson (23) carried on two complementary oligonucleotide linkers

(primers 24 and 25, Table 1) was cloned upstream of the gfp gene in pYG3. The

gfpTIR cassette was excised from pYG3-TlR and inserted into pDN19 to

generate pJE410. The only difference between pGG103 (gfp, no promoter) and

pJE410 is the presence of the TIR. The 400 bp BamHl fragment from pJB1O

carrying the pilA promoter was cloned into the BarnHl site upstream of gfpTlR in

pJE410 to create pJE4l I.

3.7 Hybrid protein analvsis

31.1 Western immunoblotting of the hybrid proteins

Bacterial cultures with the appropriate pfasmid were grown overnight in LB broth

without induction and then diluted 1:50 in fresh media containing lPTG (0.05 mM

for P. aeruginosa and 1 mM for E. col]]. The cultures were allowed to grow for 8

hours prior to harvesting. One milliliter of culture was pelleted, resuspended in

100 pL of W, reducing dye (3% sodium dodecyl sulfate [SDS], 20% glycerol, 5%

p-mercaptoethanol, 100 mM Tris-HCl [pH=hO], 0.01% bromophenol blue) and

boiled for 10 minutes. Three to ten microliters of the samples were loaded on

SDSpolyacrylamide gels (PAGE) for electrophoresis. Proteins were then

electroblotted onto a nitroceliulose membrane (Schleider and Schueil, Keene,

NH). The membrane was incubated overnight with the appropriate antibody.

After washing in Tris-buffered saline (TBS, 20 mM Tris-HCI, 500 mM NaCI,

pH=7.5), the membrane was incubated with the appropriate secondary antibody

(horseradish peroxidasecong ugated anti-mouse or anti-rab bit) for one hour and

washed in TBS prior to detection with the LumiGLOw Chemiluminescent

Substrate K i (Kirkegaard 8 Perry Laboratories. Gaithersburg, MD),

3.7.2 Alkaline phosphatase and pgalactosidase assays

Alkaline phosphatase and p-galactosidase enzymatic assays were performed

according to the methods of Manoil and Miller, respectively (91, 98). Bacterial

cells were grown overnight in LB broth with the appropriate antibiotic and without

IPTG. The next day, the cultures were diluted 1:50 in fresh media containing

IPTG (0.1 mM for P. aemginosa and I mM for E. col4 and allowed to grow until

the cultures reached a cell density (ODsw) of 0.4 to 0.6, approximately 3 hours.

The assay was then performed with 1 mf of these cultures.

3.7.3 Fluorescence assays

Bacteria were grown in LB broth supplemented with Tet and Carb. Two series of

cultures were grown, one without IPTG and one supplemented with 0.5 mM

IPTG. After an overnight incubation at 37OC, 1 ml of culture was hanrested and

washed in phosphate-buffered saline (PBS, 137 mM NaCI, 2.7 mM KCI, 4.3 mM

Na2HP04, 7.4 mM w O c pH=?.3) with 20 mM MgCh The absorbance

56

and fluorescence (excitation at 485 nm, emission at 535 nm) of 200 pl of

washed cells was measured with the ~a l l ac ~ 1 ~ ~ 0 ~ ~ ~ 1 4 2 0 multilabel counter

(PerkinElmer, WelIes ley, MA).

3-8 Cell fractionation

LB broth supplemented with Carb was inoculated 1:100 from an overnight

bacterial culure grown in LB Carb, no induction. After one hour of growth at

370Cr IPTG was added to 0.1 mM and incubation at 37OC was resumed and

allowed to proceed to overnight. The 200 ml overnight cultures were harvested

and the pellet was washed in 50 mM Tris-HCI (pH=8.0), 10 mM MgCh. The

washed cells were resuspended in 4 ml of the same buffer. DNasel and RNasel

were added to a final concentration of 50 pglml-each, lysozyme was also added

to 500 pgfml. Cells were sonicated at 30-50% intensity for 6 cycles of 15

seconds each and then incubated at room temperature for 30 minutes. A low

speed centrifugation (10 minutes, 10 000 x g) was done to remove unlysed cells

and cell debris. A 100 pl aliquot of the supernatant was removed and kept as a

whole-cell control (W fraction). The remaining supernatant was then centrifuged

at 100.000 x g for one hour. The supernatant (soluble fFactrCon) was transferred

to a clean tube and the pellet (membrane fraction) was resuspended in 4 rnl Tris-

HCI (pH=8.0), I 0 mM MgC12- Both fractions were centrifuged again at 100,000 x

g for one hour. The supernatant of the soluble ftactrCon was kept as the S fraction

57

and the pellet of the membrane fraa-on was resuspended in 4 rnl Tris-HCI

(pH=8.0), 10 mM MgCh and kept as the M fraction.

3.9 Microscopy

Bacteria were grown and prepared for microscopy as described previously (1 5)

with minor modifications. Briefly, 5 ml LB Carb with 0.1 mM lPTG cultures were

inoculated from an overnight culture in LB Carb and grown for 3 hours. These

cultures were then incubated ovemig ht at 4OC prior to mounting and imaging.

One milliliter of culture was washed in I ml PBS 20 mM MgCh, 35 pl of the

washed cells was applied to polylysine-coated cover slips for 5-10 minutes and

the excess rinsed off. The cover slips were then mounted on microscope slides

with Mowiol (Calbiochem, La Jolla, CA).

Slides were viewed at 100 X oil immersion, 1.4 NA, with a Leica DMRE

microscope using epifluorescence illumination and Chroma High Q filters.

Images were taken with a Princeton Instruments cooled (-40°C) CCD Digital

Camera (1 2 bit AD, 1 % linearity) and a Kodak KAF 1600 detector.

Chanter 4. TOPOLOGICAL MODEL OF PilS

4.1 Results

4.1 .f Topological predictions

A hydrophobicity profile of PilS was obtained using the program DNASIS@ (v2.0,

Hitachi Software Engineering Co. Ltd.) and the Kyte and Doolittle scale (83) at

the default settings (window of 7 amino acids) (Figure 13). Six peaks of

hydrophobicity greater than 2.00 were observed suggesting the presence of six

TM segments. A similar hydrophobicity analysis was performed using the

computer program TopPredll(25) and TMPred (69). Similar results were

obtained with both analyses. Both programs predicted a six helix model with a

cytoplasmic localization for both the N- and C-termini, as shown in Figure 2. The

only difference between the two models was the first andfor last amino acids of

the some helices. These variations were of only one to three amino acids per

helix (Figure 14).

4.1.2 Construction of the gene fusions

In order to confirm the presence and orientation (cytoplasm to periplasm or

periplasm to cytoplasm) ofthe six predicted helices, hnro series of translational

gene fusions were constructed (see Chapter 3 for experimental details), in the

first series schematized in Figure 10.1acZ and phoA were fused to eight different

59

locations within the pilS gene. These locations (a. a. 49,75,99, 123, 154, 177,

304 and 529) were chosen because they correspond to each of the predicted

connecting loops as well as the end of the linker region and the C-terminus of the

protein. The second series of fusions. shown in Figure 1 I, are to the C-terminus

of four full-length deletions and each of the truncated deletions. In the truncated

deletions, Lac2 and PhoA are fused to the site corresponding to a. a. 154 (after

TM5) of wildtype PIIS. The results obtained from the analysis of this series of

fusions should be compared to the results obtained for the C-term fusions

(pJE623 and pJE624) for the full-length deletions, and TM5 (pJE628 and

pJE629) for the truncated deletions.

4.1.3 Analysis of the PilS-La& and PilS-PhoA hybrid proteins

The hybrid proteins were expressed in the E. coli lacZphoA- strain CC118 as

well as in wildtype P. aeruginosa PAK and in the piiS deletion mutant PAK-AS2.

Western irnmunoblotting of whole cell lysates was performed to verify the stable

expression of the hybrid proteins. Figure 75 shows the results of these Western

blots for the strains PAK-AS2 (panels A and C) and CC1 I 8 (panels B and D);

band patterns and intensities seen for the strain PAK are comparable to those

observed for PAK-AS2. Although breakdown products are present, a major band

(top band in each lane) corresponding to the full size of the hybrid protein

(between 53 and 106 kDa for PilSPhoA and 116 and 175 kDa for PilS-LacZ)

was observed for each construct.

60

Bacteria expressing the hybrid proteins were all grown in the same media under

the same conditions, but variations in the level of protein expression can

nonetheless be observed (Figure 15). The most striking difference in protein

expression is seen between the P. aenrginosa strains and the E. coii strain, as

observed in Figure 15 and other Western blots where E. coli and P. aenrginosa

carrying the hybrid proteins were electrophoresed side by side on the same

polyacrylamide gel (not shown). This variation will be further emphasized by the

enzymatic assays carried out on the strains carrying the fusion plasmids since

these assays measure the activity of the enzyme present in the bacterial cell,

which is directly correlated to the levels of protein expression.

The PilS kinase activity can be measured by the ability of the protein to

complement the pilS deletion in PAK-AS2 and activate pilA transcription. and the

Pits phosphatase activity is determined by a reduction in pilin expression in PAK

when PilS is overexpressed compared to the wildtype strain canying the empty

vector pMMB. A qualitative pilin assay (Western irnrnunoblot probed with an anti-

PilA antibody) was perform to determine if the fusion of the reporter proteins to

full length PilS impaired its kinase and phosphatase functions. When uninduced,

pJE623 and pJE624 are able b fully complement the pilS deletion in PAK-AS2

and approximate wildtype levels of pilin were detected (Figure 16A, lanes 1 and

3), suggesting that the presence of €he repoiter enzyme does not affect PilS

kinase function.

61

Under inducing conditions (0.5 mM IPTG), piIA expression appears slightly

reduced presumably because of the phosphatase activity of PIIS. Figure 168

shows the results of the qualitative pilin assay for phosphatase activity. When

PilS is overexpressed, there is a slight reduction in pilin expression for the two

PilS-Lac2 (lane 2) and PilS-PhoA (lane 4) hybrids compared to PAK (pMMB)

(lane 6), however this inhibition is not as severe as is observed for PAK (pJB228)

(lane 8). This can be explained by smaller amounts of PilS in the cell for the two

hybrids compared to ppJB228, even when grown under the exact same

conditions. The amount of PilS in the cell was determined by visual examination

of the Western blot probed with an anti-PilS antibody (top panel of Figure 16B).

This suggests that the hybrids pJE623 and pJE624 retain fils p hosp hatase

activity as well as kinase activity.

4.1.4 Enzymatic activity of the hybrid proteins

Enzymatic assays were performed to determine the activity of the hybrid proteins

in the two P. aemghosa strains and in E. coli CC118. Strains producing more

than 10 units of either PhoA or Lac2 activity were considered to be positive for

enzymatic activity, while strains producing less than 10 units were considered

negative. Strains (PAK, PAK-AS2 or CCf 18) carrying the negative controls

yielded between 0 and 7 units of LacZ activity for pJE608, and I and 5 units of

PhoA activii for pJE609. High levels (>I0 Miller units) of LacZ activity suggest a

cytoplasmic fusion site, while high levels (>I0 units) of PhoA activity imply a

62

periplasmic fusion site since PhoA requires the oxidizing environment of the

periplasm to be active.

Over 16000 Miller units were obtained in PAK for the Lac2 positive control, this

result is not even comparable to the results obtained for the diverse Pits-Lac2

proteins. This should not come as a surprise considering the amount protein

detected by Western blotb'ng, as shown in Figure f5, lane 17. PilS protein

expression is variable and sometimes scanty, even in P. aemginosa, but the

positive control pJE680 does not contain any pilS sequences or the RBS

introduced by the KpnRBS linker. In addition, in pJE680 the lac2 gene

possesses an ATG start codon, while in the other constructs pits begins with a

GTG start codon. All of these features can explain the very large differences in

Lac2 expression and activity.

4.1.5 PilS possesses six TM segments

As expected, each pair of hybrid proteins shows contrasting patterns of activity

levels. Wlth the exception of the negative controls, pairs of fusions never exhibit

positive or negative enzyme actkity for both reporters. The same patterns of

enzymatic activities are observed in E.. coli and both strains of P. aemginosa

although the values are much lower in E. colithan in P. aeruginosa even when

induced with more IPTG. This difference in protein expression levels between

species is also observed on Western blots (Figure 15).

As shown in Figures 17 and 18 and Table 3, fusions of the reporter proteins to

sites in PilS located downstream of the predicted TM1 , TM3 and TM5 show a

PhoA+JLacZ- phenotype, suggesting a periplasmic localization of these particular

h ion sites. For PAK, the Lac2 activity values measured for these three

constructs are 2.8 k 2.3, ? -7 + 1 .I and 4.1 k 2.2, respectively, which is less then

the 4.1 t 1 -8 Miller units measured for the negative control pJE608. The P hoA

enzymatic activity values obtained for PAK for these same sites were 1 11 -4 &

34.0, 75.6 k 18.7 and 68.0 k 14.8, respectively, all notably elevated compared to

the negative control pJE609 which presented only 1 -3 & 0.4 units of PhoA activity

in PAK.

In contrast. a PhoA-/LacZ+ phenotype is observed for fusions of the reporters to

sites located downstream of the predicted TM2, TM4 and TM6. the linker domain

and at the Cterminus of full length PIS. This phenotype suggests cytoplasmic

fusion sites. The La& activity of these hybrid proteins assayed in PAK ranged

from 97.9 k 37.5 to 340.7 + 94.0 Miller units, while only 1.7 k 0.3 to 7.2 + 1.7

units of PhoA activity were measured for these fils-PhoA hybrids. Figure 19

summarizes these resufts in a schematic manner. These results are in

agreement with the topologicaI model obtained by computer programs.

4.1.6 Orientation of the TM segments

The orientation of the putative helices was confirmed by deleting some helices

and fusing the reporters after the transmitter region in one series of fusions and

at a site located downstream of TM5 in wildtype PilS in a second series of

deletion fusions. The hypothesis is that deletion of a pair of helices would not

reverse the orientation of the downstream helices or the C-terminus of the protein

or affect the topological model, while deletion of one or three helices would

reverse the orientation of the following TMs as well as the Cteminus.

4.1.6.1 Full-length deletion hybrid proteins

Four full-length deletion hybrids retaining the linker and transmitter domains were

constructed (Figure 11). The enzymatic phenotype of these deletion hybrid

proteins was compared to that of the fusions to the C-terminus (pJE623 and

pJE624). The phenotype was assessed by growing these strains on LB agar

supplemented with Xgal (for PilS-LacZ) or XP (for PilS-PhoA) and 0.j mM IPTG

and observing the color of the colonies. Fusions TMi C (deletion of TM2-TM6),

TM4C (deletion of TM5-TM6). ATM2-4C (deletion of TM2-TM4) and ATM4C

(deletion of TM4) a11 present a LacZ+/PhoA- phenotype, same as the Gtem

fusions. As summarized in Table 4, colonies of the four PilS-La& strains were

blue in W e presence of Xgal suggesting an active Lac2 moiety, while the colonies

of the PilSPhoA strains were white in the presence of XP suggesting an inactive

PhoA component. This LaS+PhoA- phenotype implies a cytoplasmic fusion site

for each of these bsions-

65

The phenotype observed for the TM4C fusions was expected if the hypothesis is

right and that deletion of a pair of helices does not affect the remaining helices

and the position of the C-terminus. However, the phenotype observed for the

other three pairs of fusions contradicts that hypothesis. Indeed. in these

constructs, removal of an uneven number of helices does not cause an inversion

in the topology of the protein and the C-terminus of the protein remains

cytoplasmic.

Further study of the amino acid sequence of PilS revealed the presence of a

strong hydrophilic segment between a. a. 175 and 206 just C-terminal of TM6

(Figure 14). Short hydrophilic segments are also present throughout the linker

and transmitter domains of PIS. To investigate the possible role of this segment

and the linker region as insertion inhibitors, a fusion was constructed in which the

entire linker region as well as the last 5 TMs have been removed. The

TMl Alinker fusions carry a deletion of a. a. 50 to 304 of PIIS.

Enzymatic activity of these fusions was measured in P. aeruginosa and

compared to the activities of the TMI and TMlC fusions (Figure 20). The

enzymatic levels obtained for these fusions are somewhat conflicting. Fusion

TMlC (pJE69O) shows high levels of Lac2 activity, 98.8 r 4.3 Miller units for PAK

and 79.6 k 4.2 Miller units for PAKdS2, while the other two PiIS-Lac2 hybrids

(pJE654 and pJE812) exhibit levels of Lac2 activity similar to the negative controI

66

pJE608, i. e. between approximately 1 and 6 Miller units. This would suggest

that when the linker region of PilS is absent, the Lac2 moiety of the hybrid protein

is translocated across the inner membrane. However, the difference in the PhoA

activity measured for the fusions pJE691 (TM1 C) and pJE813 (TMl Alinker) is not

as striking as it is for pJE690 and pJE812. The levels obtained, 12.6 + 0.8 for

PAK (pJE691) and 20.3 t 1.0 for PAK (pJE813), are approximately 10- and 15-

fold, respectively, higher than the negative control pJE609 and 1.5- to 3-fold

higher than the full length PilS-PhoA hybrid pJE623. Also, these values only

represent 10 to 20% of the activity measured for pJE653 (fusion to TMI). It is

therefore difficult to speculate on the cellular localization of the fusion sites.

P. aenrginosa PAK and PAK-AS2 carrying the hybrids were grown overnight with

induction (0.05 mM IPTG). Whole cell lysates of these strains were subjected to

SDS-PAGE and immunoblotted with an anti-PhoA antibody. As shown in Figure

218, more degradation products are detected for pJE6P1 and pJE813 (lanes 2

and 5; 3 and 6, respectively) in addition to the product corresponding to the full-

size hybrid compared to pJE653 (lanes 1 and 4) and the other hybrids (refer to

Figure 15), suggesting that pJE691 and pJE813 are unstable. In contrast, the

PilS-LacZ hybrids pJE690 and pJE8?2 show approximately the same amount of

break-down products as all the other Pits-LacZ hybrids (Figures 21A and 35). It

is therefore possible that the conflicting enzymatic assay results for pJE69T and

pJE813 are refiectke of the amount of degradation products present in the celI

67

and the instabifow of the proteins. Because of these wnfl icting results, 1 is hard

to speculate on the involvement of the hydrophilie segments of the linker and

transmitter regions on translocation, and as discussed in the Discussion section,

further testing should be done.

4.1.6.2 Truncated deletion hybrid proteins

Six truncated deletion hybrids were constructed (Figure 11). The removal of the

hydrophilic linker and transmitter regions (a. a. 155 to 529) negates the possible

insertion inhibitory effect of these domains. Enzymatic activity of the truncated

deletion hybrid proteins was compared to that of the fusions to TM5 (pJE628 and

pJE629).

Figures 22 and 23 and Table 5 show the results of the enzymatic activity assay

for the deletion hybrid proteins. Deletion of the pairs TM1-2 and TM3-4 did not

change the peripfasmic localkation of the reporters, compared to the TM5

fusions, as shown by strong levels of PhoA activity (for PAK, 49.9 t- 11 -7 for

pJE805,68.9 + 19.9 for pJE669, compared to 68.0 r 14.8 for pJE629). Elevated

levels of Lac2 activity were observed for the fusions A m 4 (pJE802) and ATM4

(pJE658) compared to pJE628, suggesting a cytoplasrnichsion site and an

inversion in the topology. Surprisingly, the independent deletions of TMI and

TM2 did not reverse the topology since these fusions showed high levels of PhoA

activity (for PAK, 56.7 + 13.3 and 79.0 & If -3, respectively) and low levels of

Lac2 activity (for PAK, T .1 + 0.5 and 3.6 k 1.4, respectively).

68

A topological prediction was done for the last two deletions using TopPredll. In

both case, the modeis proposed show a periplasmic localization for the fusion

site, as implied experimentally, indicating that these deletions cause an important

change in the topology. The ATMl model indicated a periplasmic N-terminus

and the AIM2 model proposed that the segment corresponding to TM3 in

wildtype PilS is fully translocated across the membrane, leaving only 3 TM

helices to anchor the protein (Figure 24).

4.1.7 Cellular localization of the PilS=LacZ hybrids

It was possible that the Lac2 hybrids were incompletely inserted into the

membrane and therefore cytoplasmic. Equally high activity levels would be

observed if the hybrid proteins were found in the cytoplasm in a soluble form,

giving a false interpretation of a cytoplasmic localization of the fusion site. In

order to confirm if this was the case, dl fractionation experiments were done on

the Lac- fusions showing strong activity levels.

Fve of the eight constructs tested (TM4, TM6, linker, Gterm and ATM4) were

found solely in the membranefiaction (M fraction) (Figure 25A). Fusions TM2

and ATM2-4 were predominantly found in the M fraction but a minor band was

detected in the soluble fraction (S €taction). This indicated that these two hybrid

proteins, which only possess two TM helices, did not insert into the inner

membrane with the same efficiency and stability as the other proteins. The

69

efficiency of separation of the M and S fractions was assessed by probing

identical Western blot membranes of each fraction with anti-Oprf (a membrane-

bound protein) and anti-plactamase (a soluble periplasmic protein) antibodies

(Figure 256). In all cases, segregation of these two proteins into the M or S

fractions appeared to be complete and there is no evidence of cross-

contamination between the two fractions, thus supporb'ng the enzymatic activity

data and the topology results obtained with the PilS-Lac2 hybrid proteins.

Interestingly, the positive Lac2 control was present in both fractions. Since this

protein is expressed to very high levels from the strong tac promoter, it is

possible that the excessive amount of Lac2 was not thoroughly separated even if

the controls OprF and plactamase were completely separated.

4.2 Discussion

The aim of the experiments described in this chapter was to prove or disprove

the topological model of PilS obtained through computer predictions. The

topological model of PilS suggested by the TopPredll(25) is shown in Figure 2.

This model predicts that the first in a. a of the protein form six TM segments

and that the remaining 353 a a. stay in the cytoplasm. This mode[ also complies

with the positive inside rule that states that the positively charged residues Arg

and Lys are more prevalent in cytoplasmic rather than periplasrnic segments

(153). Indeed, a total of 8 Arg and Lys are found in the cytoplasmic segments

(excluding the linker and transmitter regions), while only one Lys is present in the

three predicted periplasmic loops.

In order to confirm tfie predicted topology, two series of translational gene

fusions were engineered and analyzed. In the first series, the reporter genes,

IacZ and phoA, were fused to sites in pilS corresponding to each of the predicted

loops as well as the junction between the linker and transmitter domains and to

the last a. a. of the mature protein. The results of this series of fusions strongly

supports the presence of 6 TM segments. The second series of fusions was

constructed wlh the purpose of confirming the orientation of the helices and also

to determine the effects of helix deletions in the insertion of the protein into the

membrane. In these fusions, the reporters were fused to a piiS gene carrying

various deietions of segments corresponding to one or a combination of helices.

All of these gene fusions were analyzed in wildtype P. aenrginosa PAK and the

pilS deletion mutant PAK-ASZ, as well as in E. coli CC118 (iacZ- phoA-).

As shown in Tables 3 and 5, there is a noticeable fluctuation in the values of

enzymatic activity among the strains considered to be enzymatically active (> TO

units of enzymatic activity). For example, for the strain PAK, values of Lac2

activity measured in active strains vary from 97.8 + 37.5 Miller units for pJE634 to

340 J 2 94.0 Miller units for pJE624, while the PhoA a W i of positive strains

71

varies from 49.9 + I 1.7 for pJE805 to 17 1.4 f 34.1 units for pJE653. As shown

qualitatively by Western immunoblots in Figure 15, protein expression varies

from one construct to another and this variation in protein expression explains

the range of enzymatic values obtained for the various hybrid proteins. After all,

the Lac2 and PhoA activity quantitated by the enzymatic assays is representative

of the amount of protein being produced inside the bacterial cell.

Although a strain exhibiting positive activity in P. aeruginosa also shows positive

activity in E. coli, levels of enzymatic adivity differ substantially between the two

bacterial species. Previous PilS expression studies have reported a defect in

PifS expression in E. coii(l6, 17,66). These studies reported a 37 kDa PilS

product in coli instead of the 59 kDa product obtained in P. aemginosa. Point

mutations within potential start codons showed that this smaller product was due

to the recognition of an alternative start codon by the E. colitranslaional

machinery. This suggests that the correct GTG start codon of PilS is not favored

in E. coli. This could explain the considerable difference in hybrid protein

expression and enzymatic activity observed in E. coii and P. aemginosa.

Because most of the fusions created carry deletions of the portion of the protein

where the alternative start codon is located, smaller products resulting from

recognition of that initiation codon are not detected in E. coli. Despite low protein

expression levels, we are able to condude that the membrane topology of PilS in

E. coli is the same as it is in P. aemginosa.

72

Interestingly, La& enzymatic activity appears to be slightly greater in PAK-AS2

than in PAK, while PhoA activity seems to be elevated in PAK compared to PAK-

AS2 (Figures 17 and 22). Western immunoblots do not show variations in hybrid

protein expression between the two P. aemginosa strains or the two types of

hybrids, so protein levels are not the cause of this discrimination. Also, if the

presence of PilS expressed from the chromosome in PAK interferes with reporter

enzyme activity, why would it preferably negatively interfere with Lac2 activity

and heighten PhoA activity? A possible explanation is that PilS is somehow

involved in the secretion and membrane insertion system of P. aenrginosa. In a

strain where PiIS is absent, secretion may be deficient and the PhoA moiety of

the PilS-PhoA hybrids may not be as efficiently translocated into the penplasm as

it is in PAK where PilS is present and able to exert its effect on the secretion

system. This would explain the lower levels of PhoA activity in PAK-AS2

compared to PAK even though the same amount of protein is produced in both

strains. We have no direct evidence to support this, but it was recently proposed

that the PilA protein of N. gononhoeae, initially isolated as a pilin transcriptional

regulator. is an homologue of FstY, the E-coli SRP receptor (6).

The data obtained with the anaIysis of the fint series of fusions is summarked in

Figure 19. The fusions to sites immediately following the predicted TM7, TM3

and TM5 segments present a LacZ-!PhoA+ phenotype as judged by elevated

levels of PhoA activity and levels of La& activity similar b those measured for

73

the negative control. Such a phenotype impiies that the fusion sites were

periplasmic and that TMI is capable of acting as a signal peptide for PhoA

translocation into the periplasm. However, from these results alone it is not

possible to speculate on the function of TM3 and TM5 as signal peptides since it

is not possible to determine if all 3 (or 5) TM segments have inserted into the

membrane. As demonstrated by the fusion TMI , the insertion of only one TM is

sufficient to drive the translocation of PhoA across the membrane.

In contrast to the fusions to TMI, TM3 and TM5, fusions to TM2, TM4, TM6.

linker and C-terminus of PilS display a LacZ+IPhoA- phenotype, suggesting

cytoplasmic fusion sites. A similar LacZ+/PhoA- phenotype would be observed if

the hybrid protein was found in a soluble form in the cytoplasm. This could

happen if the removal of a number of N helices impaired the insertion process

or caused the protein to be inserted in an unstable way, in either case the

interpretation of the result could be inaccurate. Cell fractionation experiments

were performed on these 5 strains to verify that the hybrid proteins were stably

inserted in the membrane and that the conclusion of a cytoplasmic fusion site

was correct. The results of this experiment, displayed in Figure 25, show that the

PiIS-Lac2 proteins producing elevated levels of Lac2 activity are embedded

within the membrane, indicating that our inte-rpretation of the cytoplasmic fusion

sites was accurate. A very weak band is detected in the S ftaction for the TM2

fusion suggesting that although it is primarily membrane-bound, this protein may

74

not insert into the membrane with the same stability as the others. Nonetheless,

it is very unlikely that the presence of such a small amount of the soluble protein

in the cytoplasm could account for all of the 165.8 t 13.3 Miller units of Lac2

activity measured in PAK or the 11 14.1 !: 251.4 units measured in PAK-AS2.

The observation that TM1 serves as a signal peptide combined with the

cytoplasmic location of the the fusion site following TM2 means that TM2 can be

considered a stop-transfer sequence. As was the case for TM3 and TM5, the

function of TM4 and TM6 as topological determinants can not be ascertained

from the enzymatic phenotype of the TM4 and TM6 fusions alone. The same

LacZ+/PhoA- phenotype of these hsions would be obtained if only TM1 and TM2

were inserted into the membrane. But when the data obtained for all eight

fusions of this series is combined, the following conclusions may be drawn: 1)

TM1, TM3 and TM5 each act as signal peptides and cross the membrane with

their N-terminal end in the cytoplasm and their C-terminal end in the pen'plasm;

2) TM2, TM4 and TM6 serve as stoptransfer sequences that halt translocation of

the protein. These last TMs cross the membrane with their N-terminal end in the

periplasm and their C-terminal end in the cytoplasm. The fusions to the linker

and to the Gterminus of PilS remain cytoplasmic, suggesting that no other signal

peptide sequences are present aside from the three mentioned above.

75

Thus, the six hydrophobic segments of PilS detected by the Kyte and Doolittle

hydrophobicity profile (Figure 13) are capable of forming TM helices that anchor

the protein into the inner membrane with both the N- and C-termini of the protein

staying in the cytoplasm, as predicted by computer programs. Unfortunately, the

method used to investigate the topology of this protein does not allow us to

determine precisely which a. a. is the first or last a. a. of the TM helix. Only an

estimate on the a. a. composition of the TM segments and loops can be

proposed based on the computer models. The a. a. numbers indicated in Figure

2 as the first and last a. a. of the helix should therefore be looked at as possible

but not definite start and end of the TM segment.

The second series of fusions was created to study the effect of helix deletions on

the topology of Pits and to confirm the orientation of the TM helices. Our initial

hypothesis was that the removal of an even number of helices would not affect

the topology and the Gterrninus of the protein would remain cytoplasmic, and

that the deletion of an uneven number of TMs would cause an inversion in the

topology and that the Cterminus of Pits would become periplasmic. However,

the results obtained were not consistent with this hypothesis.

The fusions to the four fulClength deletions gave a LacZ+/PhoA- phenotype,

identical to the fusions at the Gterminus of full [ength PilS. This signifies that the

Gterminus of these mutant PiIS proteins remains in the cytoplasm, but the

76

precise membrane topology of the TM dom& of these mutants cannot be

determined. As noted elsewhere (9,22,43,58), the native topology of a protein

is fairly resistant to sequence modifications. The fact that the transmitter domain

of PilS stays in the cytoplasm regardless of the number of TM helices implies that

the protein adopts an alternative membrane topology in order to keep its

functional domain in the cytoplasm where it is free to bind ATP and interact with

PiIR. Alternative topologies of deletion mutants lacking, TMI or TM2 are shown

in Figure 24.

Two of our truncated deletion mutants cause an inversion in the orientation of

subsequent TMs. These two PilS variants contain a deletion of TM4 and TM2-

TM4. As shown by cell fractionation, despite the deletion, the PilS-Lac2 hybrid

proteins retain their ability to insert into the membrane (Figure 25A). It should be

noted however that small amounts of the ATM2-4 PilS-Lac2 protein are also

present in the solubIe fraction, suggesting that the impressive deletion of three

TMs somewhat impairs the insertion process. [t should be stressed that the

position and orientation of the TM segments in these mutants cannot be

determined and that only the location of the fusion site can be inferred from the

enzymatic profile of the fusions. Interestingly, the removal of TM4 in the

truncated deletion appears to cause an inversion in the orientation of TMS

(Figure 22), but the same helix deletion in the full-length deletion construct does

not appear to cause an inversion (Table 4). One possible explanation for this

77

observation is that the hydrophilic linker and transmitter domains, absent in the

truncated deletion, serve as strong translocation blockers. Lee et al(84) have

reported that multiple sequences in fhe Lac2 protein act together to block

translocation of the protein across the inner membrane. This would also explain

why all the fulClength deletions tested have their C-terminus in the cytoplasm

regardless of the number of TM helices.

A construct in which the last 5 TMs as well as the linker domain of PilS were

removed was created to determine if the hydrophilic segments found in the linker

had a translocation inhibition effect The enzymatic phenotype of this fusion was

compared to that of the fusion TMIC. The results obtained for the TMI C and

TMIAlinker PilS-La& hybrids suggest that the linker may play a role in the

keeping the Gterminal355 a. a. of PilS inside the cytoplasm. However, the

complementary TMlC and TMl Aiinker PilS-PhoA hybrids are highly unstable

and both exhibit some PhoA activity. Because of the instability of the protein, it is

not clear if the PhoA adivity measured is due to break down products or because

the PilS moiety of the hybrid is capable of driving PhoA into the periplasm. More

constructs in which a number of helices and the linker domain are removed

should be generated and analyzed before confidently assigning a role for the

linker in the insertion process. It would also be of interest to create PilS mutants

in which the fransmitter domain and a number of helices have been removed.

78

This would allow us to investigate the potential role of the hydrophilic transmitter

as a membrane insertion blocker*

Taken together, the data described in this chapter supports and proves the

topological model of PilS predicted by theoretical computer analysis. The

topology of PifS thus consists of a cytoplasmic N-terminus followed by six TM

helices joined by vely short connecting loops, and a large cytoplasmic domain

comprising the linker and transmitter domains.

Chanter 5. ROLE OF THE PilS TM SEGMENTS IN FUNCTION AND

CELLULAR LOCALIZATION

5-1 Results

5.1 .I Construction of the plasmids

Refer to Chapter 3 (materials and methods) for details on the construction of the

plasmids used in this portion of this study and Figure 12 for a diagram

representation of the constructs.

5.1.1.1 The internal helix deletions

A series of thirteen internal helix deletions were designed for this study (pJE680

series) in addition to the intemal deletions previously engineered (pJB200 series)

(Figure 12). These mutant piiS genes are carried on the pMMB vector and their

expression can be induced by addition of IPTG to the growth media. It should be

noted that very low levels of gene expression are observed from the fac promoter

of the pMMB vector even without induction.

5.1.1.2 The pilA promoter fusion

In order to quantitate the activity of the pilA promoter, a transcriptional fusion of

the gfp gene to the pilA promoter was constructed. This fusion is carried on the

pDNI9 vector. which has a very low copy-number. The vector pDNl9 is lncP

80

and encodes Tet resistance, it is therefore compatible with pMMB, which is lncQ

and resistant to Carb.

When expressed in wildtype PAK, the first piM-g@ fusion constructed, pGG103A,

produced insufficient amounts of GFP and fluorescence could not be adequately

measured. To remedy this problem, the translational enhancer TIR (23, 99) was

introduced upstream of the gfp translational start in pGG103A to create pJE4T 1

(Figure 26). The TIR contains a consensus ShinaDalgarno (SD) sequence with

a spacer region that minimizes RNA secondary structure as well as a

translational enhancer sequence from gene1 0 of phage T7. Introduction of the

TIR replaces the native SD sequence. Table 6 shows a comparison of the units

of fluorescence per cell measured with the Wallac VICTOR^" 1480 multilabel

counter. The ff uorescence and absorbance vaIues were normalized against a

growth media control. The presence of the TIR does not substantially affect gfp

expression and Ruorescence when the pilA promoter is absent (pJE47 0).

However, GFP fluorescence is increased by approximately 130% when gfp is

expressed from the pilA promoter with TIR in pJE411 compared to the pGGl03A

without the TlR.

5.11,'1.3 The PilS-GFP fusions

The thirteen mutant piiS genes carrying the various internal helix deletions

described above were fused to g@ to create the pJE670 series (Figure I2). The

87

gfp gene was also fused to the other deletions and to wildtype pilS to create the

pJB700 series (15) (Figure 12).

5.1.2 Cellular localization of the PIIS-GFP hybrid proteins

5.1.2.1 Epifluorescence microscopy of the PilSCFP hybrid proteins

The same piiS genes carrying the internal deletions used in the function study

were translaionally fused to gfp. These PilS-GFP hybrid proteins were

expressed in P. aemginosa and the cellular localization of the hybrids was

assessed by fluorescence microscopy. Controls for the validity of this system as

well as the pJB7OO series of PilS-GFP fusions were analyzed previously (15). To

briefly summarize, full length PilS is anchored to the inner membrane and

specifically localized to the poles of the P. aenrginosa cell (polar localization), but

not in E. coli where it is found on the entire inner membrane (lateral localization).

The negative control caving only GFP (pJB708) or mutant hybrids in which the

TM domain of PiIS has been deleted (pJB724, pJB733, pJB735 and pJB739) are

soluble and uniformly label ~e cell in both E. coli and P. aemginosa. The TM

domain is required for membrane anchoring, but the TM domain and complete

linker region are both necessary for poIar localization. The transmitter domain

does not appear to be involved in polar localization of PiIS.

The thirteen PIIS-GF P fbsions of the plE67Q series were visualized by

fluorescent microscopy. These PilS proteins carry deletions within the TM

82

domain only, their linker and transmitter regions are intact The amount of

protein expressed varied from one hybrid protein to another and consequently,

the fluorescence of the cell varied as well, No differences in cellular localization

ofthe protein or fluorescence intensity were observed between PAK and PAK-

AS2, therefore only microscopy images of the PiIS-GFP proteins expressed in

PAK are shown in Figure 27.

The polar localization of PilS was not affected by the removal of TM1 (pJE675).

TM1-2 (pJE673) or TM14 (pJE672), suggesting that the first helix is not required

for initiation of the insertion process or polar targeting. This observation also

suggests that the last two TMs of PilS are sufficient for anchoring the protein into

the membrane and polar targeting. Plasrnids pJE677, pJE674 and pJE6713

carry deletions ofTM3-4, TM4 and TM4i6, respectively, and these three PilS

deletion proteins also retain their polar localization.

Another mutant, pJE678 carrying a deletion of TM5-6, also shows polar

localization of the hybrid protein, but, as shown in Figure 27H, GFP also labels

the lateral edges of the cell. This suggests that the removal of the last two

helices of the TM domain does not prevent insertion of the protein into the

membrane, but keeps it from being efficiently targeted to the poles of the cell.

Lateral labeling with a polar concentration of fluorescence is also observed for

pJB742 (15). In this construct, the N-terminaI 177 a. a. of PilS have been

replaced by the Male protein; the linker and transmitter of PilS are attached to

the Cteninus of MalG (Figure 12). Male is an integral inner membrane protein

involved in maltose transport in E. colt the entire protein sequence fonns six TM

helices (31).

The cellular localization of the other mutant PilS-GFP fusions was not as easily

evaluated as that of the mutants described above. The six mutants (pJE676,

677,679,6710,671 1 and 6712) clearly lose their ability to drive PilS to the poles

of the bacterial cell, but their localization (soluble or lateral) cannot be clearly

assessed. These six proteins are not expressed as well and thus the cells are

not as fluorescent as the other strains, which rendered the fluorescent

microscopy examination and photography of the bacteria expressing these

proteins more strenuous.

5.1.2.2 Cell fractionation of the non-polar PilSCFP hybrid proteins

To determine the cellular localization of the six non-polar Pits derivatives, cell

fractionation experiments were performed. PAK expressing the six mutant PIIS-

GFP proteins was grown for 18 hours with induction (0.1 mM IPTG). The cells

were harvested, lyzeci by sonication and the-soluble and membrane fractions

were separated. Both fracfions were electrophoresed by SDS-PAGE and the

Western blot was probed with an anti-GFP antibody.

84

Figure 28A shows the results of this experiment Degradation products are

detected in the S fraction, but these bands are equally present for all fusions

tested including pJB7 12 (full length PIIS-GFP) and pJB708 (GFP alone). A band

corresponding to PIS-GFP is obsenred in the S fcaction of the six non-polar

constructs, suggesting that these constructs are found in a soluble form. A weak

but discemable band is also present in the M fraction of pJE676 (lane 3) and

pJE677 (lane 4), which means that the protein may be present in small amount in

the membrane. The other hybrid proteins were not detected in the M fraction,

supporting a soIuble localization of the proteins and the conclusion that removal

of TM2, TM2-4, TM4-6 and TM6 greatly affects the membrane insertion

processes of PiIS.

Only very weak bands are present for pJE6712 (lane 8), suggesting a

considerable defect in expression of this fusion protein. plac, used as a soluble

control for cell fractionation, is expressed from the pMMB vector. The plac band

in the solubk fraction of pJE6712 (Figure 288, bottom right panel, lane 8) is

detected with the same intensity as the fllac band of the constructs (lanes I to 7).

Expression from the vector is therefore equal in all strains and the deficient

expression of Me PPS-GFP of pJE6712 is particular to this strain.

The same OprF and plac contrors used for Pits-LacZ cell Fractionation

experiment were used here with the same results. partition into the M and S

fractions appears to be complete (Figure 28B), except for pJE6712. A band

corresponding to OprF (a membrane-bound protein) is visible in the S fractr*on of

pJE6712, but it is possible that this band may be the result of spill over from the

neighboring lane. No plac band is detected in the M fraction of pJE6712,

suggesting that the separation must have been complete.

It can therefore be concluded that these six deletion mutants, TMIC, TMZC,

TMJC, TMBC, ATM2C and ATM2-4Cr are unable to insert stably into the

membrane and are found primarily in a soluble cytoplasmic form inside the P.

aemginosa cell. Figure 29 shows a summary of the cellular localization data

accompanied by a diagramatic representation ofthe PiiS mutants.

5.1.3 PilS function assays

5.1.3.f Experimental considerations

The internal deletion constructs as well as the negative control pMMB and the

positive control pJB228 (wildtype pilS) were introduced into P. aenrginosa PAK

and PAK-ASZ already carrying pJE411, the pi& promoter@ transcriptional

fusion. The kinase and phosphatase activities reside in the transmitter domain

where the site of phosphorylation (His031 9) and nucleotide-binding motifs are

located. For this reason, mutants in which part or alI of this region have been

deleted were not analyzed for function. The focus was placed on mutants

86

carrying deletions within the TM domain or lacking the linker region to determine

the potential role of these domains in signaling and pilA transcription.

The values of pilA promoter activity are reported as the fluorescence emitted by

GFP per cell (Fluolcell). The GFP fluorescence measured in these strains

correlates to the activity of the pilA promoter in pJE4i 1 and activation from this

promoter is dependent on PilS, therefore fluorescence becomes a measurable

marker of PilS function. No effort has been made to control the levels of pilR

gene expression. Strain PAK-AS2 has an in-frame deletion of p i s so pilR

expression is unaffected by this deletion, PilR is therefore present in the both

strains in wildtype chromosomal amounts and is not a factor in these PilS

function assays.

One series of bacterial cultures of these strains was grown overnight in LB broth

with Carb and Tet and a second series of cultures of the same strains was grown

in media supplemented with 0.5 mM lPTG to induce averexpression of pilS.

Preliminary testing was done on cultures of PAK and PAK-AS2 with 5 different

plasmids (pMMB, pJ8224 p56228, pJB231 and pJB233) grown in the presence

of three different IPTG concentrations, 0.05 mMt 0.1 mM and 0.5 mM to

determine which lPTG concentration should be used in the PiIS function assays.

As shown in Figure 30, any amount of IPTG is enough to induce overexpression

of PilS and similar fluorescence (promoter aa0vity) results are obtained

87

regardless of the concentration of IPTG used. Therefore 0.5 rnM IPTG was

added to the growth media to ensure the excessive production of the PilS

mutants from the tac promoter for the following experiments.

5.1.3.2 Kinase and phosphatase function of mutant PilS

The phosphatase function of PilS is defined experimentally by a reduction in pilin

gene expression in wildtype PAK under induced conditions, i.e. when PilS

(wildtype or mutant) is overexpressed. in the reporter system designed for this

study, positive phosphatase activity is depicted by a reduction in fluorescence of

the PAK strain canying a PilS mutant compared to PAK carrying the pMMB

vector.

In PAK (pMMB), only chromosomal amounts of PilS are present and 7860 i 918

fluorescence units per cell (fluofcell) are measured when the bacteria are grown

with induckon (Figure 37 and Table 7). In the strain carrying wildtype PilS

(pJB228), 819 t 148 fluolcell are measured when PilS is overexpressed, which

represents a reduction of approximately 90% compared to pMMB. A reduction in

fluorescence of approximately 45% is observed for pJB228 even when the

bacteria are grown without induction. SmaB amounts of PilS are still produced

from the fec promoter even under uninduced conditions, indicating that the

phosphatase function of PilS is so strong that even slight overexpression ofthe

protein are sufficient to inhibit gene transcription.

88

Experimentally, the kinase function of PilS is defined as the ability of the protein

(wildtype or mutant) to complement the in-frame pilS deletion in PAK-AS2 leading

to transcription from the pilA promoter. It is measured under either induced or

uninduced conditions. Pilin promoter activity in the strains carrying the PilS

mutants was compared to pMMB (1 103 + 184 fluofcell) for basal promoter activity

levels and cell fluorescence. The value obtained for the strain carrying pJB228

(wildtype piis) (2917 +_ 445 fluofcell) grown under uninduced conditions was

considered as wildtype levels of PilS kinase activity (Figure 32 and Table 8).

Figure 29 summarizes the results obtained for the function assays. The first

striking observation is that only one PilS deletion mutant exhibits both wildtype

kinase (5382 k 787 fIuo/cell, uninduced) and phosphatase (822 t 241 fluofcell,

when overexpressed) activities. This mutant (pJB237) lacks the entire linker

region of PiJS but possesses the complete TM and transmitter domains, implying

that the linker region is not essential for signaling.

The next important observation is that all the other mutants lose one of the two

amities and are locked in one of two signaling states: U+P- or K-P+. Only

pJE686 (.lNllC) and TMSC (pJE6812) exhibit a K+IP- phenotype. However

unlike wildtype PIIS, the kinase fonction is only detectable when the mutant is

induced with a high concentration of IPTG. Plasmids pJE6712 and pJE6812

carry the same PilS mutant (TMSC) and the only difference between the two

89

constructs is the presence of GFP in pJE6712 and both of these construct are

very poorly expressed, as shown by immunoblots for pJE6712 (Figure 28) and by

the faint labeling of pJE6712 with GFP. As concluded from the GFP localization

experiments, both the pJE686 and pJE6812 mutants are found in a soluble form.

For pJE686. this result is not very surprising since the protein only contains one

TM. However for pJE6812 which possesses 5TMs, this observation is startling

considering that pJE688 (containing 4 TMs) is membrane-bound and even

capable of some polar targeting. This suggests that the deletion of TM6 in

pJE6812 generates severe expression. membrane insertion and conformational

defects, hence the unusual functional phenotype (K+/P-) observed cannot be

attributed to changes solely in the TM domain but are likely due to more severe

changes throughout the molecule.

Although protein expression does not appear to be altered in pJE686 (TMIC) as

it is in pJE6812 (TMSC), both proteins present the same functional phenotype

and soluble localization. Also, the pilA promoter activity is virtually the same for

both constructs in both PAK and PAK-AS2 strains (PAK-ASP: 10396 r 947

fluo/cell for pJE686 and 12525 & 1554 fluofcell for pJE6812; PAK: 10663 + 1501

fluotcelI for pJE686 and 1 1018 + 1972 Ruolcell for pJE6812). For these reasons.

it is probable that pJE686 suffers from conformational defects similar to those

hypothesized for pJE6812. it is therefore likely that the functionaI phenotype

90

observed for pJE686 is also the result of conformational defects in other parts of

the molecule and not to an attered TM structure.

The other 12 PilS mutants tested are locked in a K-/P+ signaling state, as judged

by baseline levels of fluolcell measured in PAK-AS2 and highly reduced levels of

fluo/cell in PAK (Figures 31 and 32. Tables 7 and 8). Indeed, for the kinase

function, between 446 + 40 and 1153 k 102 fluofcell are measured for the

mutants in PAK-AS2 when grown without induction compared to the baseline

fluo/cell of 693 c 58 measured for PAK-ASZ (pMMB). On the other hand, for the

phosphatase activity, between 71 1 + 86 and 3481 & 242 fluolcell are measured in

PAK when PilS derivatives are overexpressed, while 7860 k 91 8 fluolcell are

measured in PAK (pMMB) under the same growth conditions. The pilA promoter

activity of the mutant strains is reduced approximately 46% to 91 % compared to

the wiidtype pilA promoter activity in PAK (pMMB), this reduction in pilin gene

expression is also comparable to the 90% redudion observed for pJB228 when

full length PiIS is overexpressed. Although protein expression varies from one

construct to another, the K-/P+ mutants are well expressed and stable. Some of

these mutants are localized to the poles of the cell while some remain soluble.

The mutants carry deletions within the TM domain and one mutant

(~58233) is deleted for the entire TM domain, suggesting that the TM domain is

crucial for activation of the kinase function. The construct lacking the linker but

containing intact TM and transmitter domains (p JB237) retains wildtype kinase

function, supporting the importance of the TM domain in signaling. However, it

does not appear that one particular helix or a specific combination of helices is

required, but rather the whole TM domain is necessary for signaling.

5.2 Discussion

In this portion of the study, the implications of internal helix deletions on the

signaling functions of PilS, as well as the protein's ability to insert stably into the

membrane and to be targeted to the poles of the bacterial cell were investigated.

A series of helix deletions were thus created and the function of the mutant PilS

proteins was assessed by monitoring transcription from the piIA promoter. A piIA

promoter-gfp transcriptional fusion was used as a measurable marker of pilA

promoter activity. The cellular localization of the PilS variants was determined

using translational PIS-GFP and epifluorescence microscopy as well as cell

fractionation experiments.

S i PifS mutants (TMIC, TM2C, TMJC, TMSC, ATM2C and ATM24C) not onIy

lost their abitii to drive PilS to the poles. but were also unable to anchor the

protein into the membrane. These PilS-GFP proteins were also poorly

expressed and not as fluorescent as the membrane-bound PilS variants. It is

possible that the soluble proteins are more susceptibre to protein degradation

92

and proteolysis when away from the inner membrane, thus explaning the lower

levels of fluorescence.

Although six TM are preferred for-stable membrane insertion, the presence of

four TMs suffices to anchor PilS and target it to the poles. As discussed in the

previous chapter, the PilS-Lac2 fusion pJE654 (fusion to TM2) is mainly

membrane-bound, indicating that the first two helices are sufficient to anchor the

protein into the membrane in a relatively stable fashion. However, the presence

of the same two helices in pJE687 (TM1-2 with linker and transmitter) is not

sufficient for membrane protein insertion, possibly because the hydrophilic

domain present in pJE687 interferes with the insertion process. A similar C-

terminal domain interference situation is encountered for TM4 and TM4C. The

PiIS-Lac2 fusion pJE642 is clearly membrane-bound, but when the linker and

transmitter are maintained so that only TM5-6 are deleted, the PilS protein

inserts into the membrane but partly loses its ability to move to the poles.

The Pits variant containing only TM5-6 (plE682) also inserts stably into the

membrane and furthermore is targeted completely to the bacterial poles,

supporting the conclusion that two helices are sufficient for membrane anchoring.

Constructs pJE682 and pJE687 both contain only two helices as well as the

linker and transmitter of PilS and GFP; the only diflerence between the two

constructs being the individual helices (pJE682 has TMS-6, pJE687 has TMI-2).

As mentioned earlier, pJE687 cannot insert stably into the membrane, while

pJE682 inserts very well and is also targeted to the poles. According to €he

program TopPredll, the first TM1 is not as strong a topological determinant as

the other 5 TMs presumably because it contains an Arg residue within the TM

segment (22), while TM5 is ranked as the strongest candidate for membrane-

spanning segment Therefore, while all six TMs are required for kinase

activation, only two TMs (if they are the right two) are required for membrane

insertion and polar localization.

The fact that the removal of the first TM as well as the first two and first four TMs

does not affect membrane integration of the protein leads us to believe that PilS

insertion into the membrane is a non-sequential event and that each signal

peptide segment (?MI, TM3 or TM5) can independently initiate insertion (22.43).

Although experiments to determine the mode of insertion used by PilS have not

been done, we hypothesize that the insertion of PilS into the inner membrane

does not involve the Sec or SRP machinery, but rather is a spontaneous event

driven by the proton motive force. A more complex machinery may not be

needed since the periplasmic loops are so short and devoid of positive charges.

More specificaIIy, we speculate that PilS inserts into the membrane according to

the "helical hairpin" model (44,58). This model states that hydrophobic helices

pair up to form a helical hairpin structure that spontaneously partitions out of the

aqueous cytoplasm into the hydrophobic membrane (Figure 6). In this model,

TM1-2 would insert together, TM34 would form one pair and TM5-6 would form

the third helical hairpin. Because TMI is a weaker export signal than TM3 and

TM5, it is possible that the TM3-4 and TM5-6 pairs target the protein to the

membrane and insert first, the TMI-2 pair would then benefit from the close and

strong membrane association provided by the other twosomes and finally insert

into the membrane. This would explain why pJE682 (TM5-6) is stably inserted

into the membrane and pJE68f (TMI-2) remains soluble or very weakly

associated with the membrane.

The PilS function assays measure the modulating effects of the TMs and linker

on the transmitter. As shown on Figure 29, there is no correlation between the

cellular localization of the PilS mutants and their signaling state. The linker

domain was shown to be essential for polar localization (19, but as

demonstrated here, the linker is not necessary for signal transduction and

wildtype PilS function. The TM domain was also shown to be essential for

membrane anchoring (15), but as shown here, the complete TM domain is not

required for membrane insertion although the presence of the six helices is

optimum for stable polar localization. The kinase activity of the PilS mutants is

not asured by polar location as many polar constructs are K-. To complicate

matters, a fatetally localized mutant containing the intact TM domain (~56237)

exhibits both kinase and phosphatase activity.

The complete TM domain is however essential for wildtype PilS function and

signaling. As summarized in Figure 29, any alterations in the TM domain that do

not cause severe expression or structural defects lock the protein into a K-lP+

signaling state. As well replacing the PilS TM domain with the MalG protein,

which also forms six TM helices, results in a K-/P+ signaling state. This suggests

that the kinase activation signal is specific for PiIS and that MalG is unable to

transduce the signal to the transmitter domain and cause autophosphorylation of

PiIS. However MalG efficiently anchors the protein to the membrane and

furthermore the Male-PilS-GFP (pJB742) protein is partially targeted to the poles

of the cell, strengthening the conclusion that the linker is the principle

determinant of polar localization.

From the data obtained, it can also be concluded that the phosphatase function

of PilS is constitutive and does not depend on an intact TM domain or signaling

event to be induced. The K-/P+ state prevails in the absence of the activating

signal, but when the signal is perceived by the TM domain, a conformational

change occurs in the transmitter domain to activate PilS kinase function and pilA

transcription. This signaling system resembles the Envf-OmpR osmoregulation

system of E- coli (refer to section 2-32. I) in #at the transmitter domain is

present in one of two conformations. In the phosphatase-dominant state ATP is

not accessible to His-319, the phosphorylation site, while in the kinase-dominant

conformation, AT? becomes available and His-319 is phosphorytated.

96

The six TM helices are absolutely required for kinase signaling, which leads us to

believe that the three-dimensional structure formed by the entire TM domain is

necessary for signal perception and transduction to the kinase domain. In this

model, recognition of the signal induces a conformational change in the TM

domain that is transduced through the linker to the transmitter. Intramolecular

interactions (TM-TM, TM-linker, TM-transmitter) needed for signal transduction

from stimulus sensing to response could be impaired by missing helices or non-

inserted TM segments. Because the linker is not required for kinase function, it

excludes this region as the potential signal-sensing domain and rules out the

possibly of two activating signals. Rather, the role of the linker domain is to

promote polar localization of Pits and simply communicate the conformational

modification of the TM domain to the kinase domain. This, however, does not

exclude the possibility that the linker recognizes or interacts with a polar

component It does suggests however that the polar anchor recognized by the

linker is not the kinase activating signal recognized by the TM domain.

Dimerization is a common feature of membranebound sensor kinases and there

are no reasons to believe that PilS does not dimerize, but this phenomenon has

not been studied for PilS and the potential intermolecular interactions between

PilS monomers in an oligomer have not been investigated. It remains therefore a

possibility that the conforrnationaI change referred to above is intermolecuiar

rather than intramdecular, or that the combined TM domains of two PilS

97

monomers form a large 12-helix structure through which the signal is sensed.

Studies should be undertaken to determine if PilS dimerizes and to identify the

dimerization domain. If these studies reveal that PilS dimekes via the TM

domain or a portion of that region, it would indicate that dimerization is necessary

for kinase activity. Therefore missing helices or rnisinsertion of PilS could

interfere with dimer formation or intermolecular interactions.

Chanter 6. CONCLUSlONS AND FUTURE DIRECTIONS

The work presented here was undertaken with the aim of studying the structural

and functional properties of the hydrophobic domain of the P. aenrginosa pilin

gene transcriptional regulator PilS in order to better understand the signal

transduction events leading to activation of pilin gene transcription. Based on the

data shown in this thesis, the following conclusions may be formulated:

1) the N-terminal177 a. a. of PilS form six TM helices;

2) two TMs are sufficient for anchoring PilS into the inner membrane, although

four and six TMs are optimum for anchoring the protein stably into the

membrane;

3) internal helix deletions do not alter the cytoplasmic localization of the G

terminal end of the protein;

4) the six TMs are not necessary, but preferable, for polar localization of PiIS;

5) all six TMs are however absoluteIy required for PilS kinase function, but not

p hosphatase function;

6) polar localization does not guarantee normal kinase function, nor does it

appear to be rbquired for normal kinase function;

7) the polar anchor is not the kinase activation signal.

Other experiments could be done to expand and further support our wndusions

and hypotheses. M would be interesting to determine if PI'IS, or perhaps another

response regulator of PBS, is involved in the mechanisms of protein secretion

across and insertion into the inner membrane and how this new role would relate

to pilin expression and pili production. As well, determining the mode of PilS

insertion into the membrane (Sec-dependent, SRPdependent, helical hairpins)

would allow us to control the insertion mechanism and determine if full length

PilS is functional when entirely cytoplasmic. Also, experiments could be done to

demonstrate the potential role of the hydmphilic segments found in the linker and

transmitter regions as insertion blockers. These segments may work to prevent

translocation of the C-terminus of PilS in an attempt to keep the kinase domain in

the cytoplasm where it can interact with PiIR.

Chanter 7. TABLES AND FIGURES

Table 1. Oligonucleotides used in this study

GTTTCTGTCGGATCCTGGCGCCG

j CCAGCGGATCCTGCTGCGCCTGCTGG

Sequenceb Primer number

C 3

4

I a. a. 123 I CGGGCGCATAGATCTGGTCATCGC

Mutation sitea

I a. a. 123 I GCGATGACCAGATCTATGCGCCCG

a, a. 99

a. a. 529

1 21 I a. a. 49 I GACATGGAACAGATCT GGGTGGACG

GATGCCGCTGGGATCCCCGCCACCTG

GCGGCTTCCGTGGATCCAGmGCGC

I GACCGGCCAGCAGATCTTGCTGCGCCTGC

34 L

Primer number 13

a. a- 304

Primer name

EcoR IATG linker

I? prornotef

corresponding codon is underlined in the sequence column). a. a.: amino acid. The sequences read 5' to 3'. The sequence of the restriction site being

introduced in primers is shown in bold. This primer binds to a sequence of the T? promoter found in the vector. The underlined region in the next column is the enhancer sequence and the

sequence in bold is the Shine-Dalgarno sequence,

GCAGGCGCAGCAAGATCTGCTGGCCGGTC

Seq uenceD

Kpn RBS linker

GATCCATGAATTCATG

TAATACGACTCACTATAGGG

24

25

AATTGACCTCTGGTACCAGAGGTC

a Refers to the last amino acid of PilS before the new restriction site (the

TI orwar ward^

~ l ~ - ~ e v e n e ~

CTAGATGCATGATrAACmATAAGGAGGAA AAACA TATGTTmCCTCCmATAAAGmAATCATGC AT

Table2. Strains and plasmids used in this study

I Strain or p iasmid

P. aemgimsa

PAK

PAK AS2

p Bluescript I SKI!+

Wild type

In frame deletion of pilS, SP

Relevant traits a

~ r n p ~ . broad-host-range cloning vector, lncQ, lacP, ptac

Source or reference

I4mpR, phagemid cloning vector

/4mpR, ~ e n p , cloning vector

~ r n p ~ , superlinker phagemid

~et!, broad-host-range cloning vector, i ncP. plac

phoA lacking its export signal sequence

Promoterless lac2

pi19 promoter in pUCl8

piis with pfac in pMMB67EH

piiS and prlR in p6luescript SKI[+

mutant 2 in pCR2.1

gfp mutant 3 with plac in pUCP22

Stratagene

D. Bradley

(17)

Stratagene

H, Schweizer

P harmacia Biotech

D. Nunn

P harmacia Biotech

J. Boyd

(17) J. Boyd

J. Boyd

I mutant 3 with TIR, with plac in pUCP22

gfp mutant 3 in pDN19, no promoter

gfp from piIA promoter in pGGlO3

gfp mutant 3 with TIR in pDN19, no promoter

gfp with TlR and pilA promoter in pJE410

lacZ lacking its first 8 a. a. with ptac in pMMB67EH

phoA without its signal sequence with ptac in pMMB67EH

gfp mutant 2 with ptac in pMMB67EH

EcoRlATG linker inserted in pJE608

a. a. 1-99 of pilS in pUCP22, KpnRBS linker inserted in the EwRI site

a. a. 1-154 of pilS in pUCP22, KpnRBS linker inserted in the EcoRl site

a. a. 1-177 of pilS in pUCP22, KpnRBS linker inserted in the EcoRI site

a. a. 1304 of piiS in pUCP22, KpnRBS linker inserted in the EcoRl site

Full length piiS in pUCP22, KpnRBS linker inserted in the EcoRl site

same as pJE621 in pBluescript SKI[+

BgllI site at a. a. 123 of pilS in pJE640

EcoRlATG linker inserted in pJE641 in the BglIl site

Bglll site at a. a. 75 of pilS in pJE641

Bg Ill site at a. a. 75 of piiS in pJE640

EcoRlATG linker inserted in pJE646 in the Bglll site

BglII site at a. a 49 of pilS in pJE640

1 G. Gagnon

G. Gagnon

G. Gagnon

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

pJE655 I Bglll site at a. a. 177 of piiS in pJE640 I This study

pJE652E I EcoRlATG linker inserted in pJE652 in the Bglll site

This study

This study

pJE659

pJE660

a. a. 1-491177-529 of pi/S (ATM2-TMG), in p BluescriptSKI I+

pJE661

This study

a. a. 1-751177-529 of pi/S (ATM3-TMG), in pBluescriptSKII+

pJE663

This study

a. a. 1-1 231123-529 of pilS (A TM5-TM6), in pBluescriptSKII+

pJE664

This study

a. a. 1 4911 23-529 of pilS (ATM2-TM4), in pBluescriptSKII+

a. a. 1-99f477-529 of pi/S (ATM&TMG), in I This study pBluescn'ptSKlI+

pJE665

This study

This study

pJE666

pJE696 I a. a. i 49ff 5-1 54 of piis, in pBluescriptSKII+ I This study

a. a. 1 -1 5411 77-529 of pi/S (ATMG), in pBluescn'ptSKII+

This study

This study

a. a. 1-991123-I 541177-529 of pilS (4TM4 and TM6), in pBluescfiptSKII+

This study

pJE804K I a. a. 75-1 54 of piis, in pBluescriptSKII+, KpnRBS linker insetted in the EcoRl site

pJESi0 I Bglll rite at a. a. 305 ofpilS in pJE659 I This study

This study

pJE807K l a. a. 49-154 of pilS, in pBluescriptSKII+. KpnRBS linker inserted in the EcoRI site

This study

pJE811

AmpR, Gene S F , Tep: resistance to ampicillin, gentamicin, streptomycin and tetracycline, respectively. a. a.: amino acid.

a. a. 1-491305529 of prlS. in pBIuescriptSKll+

This study

Table 3. Enzymatic activitf of the PifS-&a& and PilS-PhoA hybrid proteins

I acid I I I fl-galactosidase activity (Miller units)

(-1 --- pJE608 2.0 k 0.2 4.1 + 1.8 6.2 + 1-5

TMI 49 pJE654 0.8 k 0-1 2.8 + 2.3 1.2 + 1.3

Fusion Last PilS Construct site

a The enzymatic activity values are the mean of at least 4 separate experiments c

' amino

TM5 154 pJE628 1.2 k 0.6 4.1 f 2.2 3-9 k 2-1

TM6 1 77 p JE634 43.3 k 4.2 97.9 + 37.5 277.1 + 105.3 linker 3 0 4 p JE638 44.1 + 5.0 323.6 & 72.8 466.5 & 163.0

G 5 29 p JE624 44.8 k 4.5 340.7 + 94.0 405.6 k 164.5 term (+I --* pJE680 8524.4k 16396.1 k 23889.8 &

201 5.1 2405.7 14600.4

standard deviation.

PAK-AS2 E. cdi CC1.10

PAK

Alkaline phosphatase activity (units)

pJE609

p JE653 p JE647 pJE635 pJE643

(-1 TMI TM2 TM3 TM4

--- 49

75 99

123

7.6 t 0-5

62.3 & 18.8

1.2 + 0-5

20.2 & 2.4

1.9 + 0-9

4-9 & 0.5

11-8 k0.9

4.3 & 0.4

10-3 k 0.7

5-0 ,t 0.6

TM5 TM6 linker G

term

1-3 k 0.4

j?1-4 & 34.1

1.7 k 0.3

75.6 k 18.7

2.8 4 0-9

154 177

3 04. 529

pJE629

pJE633 pJE639 pJE623

14.2+0-6

5.4 & 0-4

5.4 k 0.5

4.8 k 0.4

68.0&14-8

4.8 k 0-8

7.2 2 1 -7

7.2 k I -0

27.6 & 7-3

5.0 & 1-6

6-1 k1.2

4.3 +, 0.9

?06

Table 4. Colony phenotype of the fulklength deletion hybrid proteins

N. A. : not applicable

Deletion

(-) TMlC

TM4C

ATM2-4C

A m 4 C

C-term

(-1 TM1C

TM4C

ATM2-4C

ATM4C C-term

Color on Xgal

White

Blue

Blue

Blue

Blue

Blue

N. A.

N, A.

N. A

N, A

N. A.

N. A-

Construct

pJE608

pJE690

pJE692

pJE694

pJE650

pJE624

pJE609

pJE691

pJE693

pJE695

pJE651

pJE623

Color on XP

N. A.

N. A.

N. A.

N, A.

N. A,

N. A,

White

White

White

White

White

White

Table 5. Enzymatic activityl of the PilS-Lad and PiIS-PhoA deletion hybrid proteins

a The enzymatic activity values are the mean of at least 4 separate experiments k standard deviation.

Fusion name

E, coii CC118

Amino acids

removed

PAK Construct

(-1 ATMI

ATMI-2 ATM2

&TM2-4 ~TM304

A T M ~

TMS

(+I

hTM4

TM5

PAK- AS^

p-galactosidase activity (Miller units)

9.3 2 1.3

68.0k14.8

--- 1-49

1-75

50-75

50-154

100- 154 1 24- t 54 154- 529 --_

5.9 t 1.6

27.6 -c- 7.3 L

6.2 -c 1.5

3.1 k 1.5

2-7 ,+ 1-3

5.1 k 2.2

108.6k34.6

3.9 2 1.8

299.7 5 133.9

3.9 k 2.1

23889.8 & 14600-4

1 .O -+ 0.2

0.5 k 0.2

1.0 k 0.5

1.1 + 0.3

11.3t1.2

0.7 k 0.3

41 -2 k 6.6

1.2 k 0.6

8524.4 2 2075.1

pJE608 pJE808 pJE806 pJE698 pJE802 pJE668

p JE658

pJE628

p JE680

L

(-1 ATMI

ATMI -2 A T M ~

ATM2-4 A T M ~ - ~

5-7 -t- 0-7

14.2r0.6

154 124- 154 154

4.1 & 4.8

1 .I 5 0.5

2.5 ,+ 0.9

3.6 & 1.4

106.6215.8

1.2 c 0.1

280.0 + 71 .7

4.2 k 2.2

16396.1 k 2405.7

pJE657

pJE629

Alkaline p hosp hatase activity (units) -I)

1-49

1 -75 50 -75

50-154

4.9 k 0.5

8.8 + 0.7

11 -2 + 1.2

10.7 0.7

4.4 t, 0.5

1 1.4 & 1 .O

pJE609

pJE809 p JE805 p JE697

pJE803

1-3 + 0.4

56.7 +I 3.3

49.9 k 11 -7

79.0 k 17.3

2-8 2 0.7

1 0 0 -

1.6 k 0.5

33.7 k 14.0

15.3 3.5

21-1 a 6.3 1.2 k 1-1

p JE669 68.9 k 19.8 22.3 -t 3.2

Table 6. Effect of the presence of the translational initiation region FIR) on GFP ff uorescence .

Strain and Plasmid

PAK

pGGlO3

pJE410

pGG103A

pJE411

PAK-AS2

pGG103

pJE410

pGGlO3A

p J M ? 1

PromoterKIR

No I No

No / TIR

pilA I No

pilA / TlR

No / No

No / TIR

pilA I No

piIA / TIR

Fluorescence/ cell

m

200.0

252.6

2927.6

6762.6

322.3

248.7

198.2

455.7

109

Table 7. Phosphatase activity of the PilS mutants

a These values represent the activity of the GFP protein expressed from pJE411 and are the mean o f 4 separate experiments k standard deviation. This construct contains the entire linker and transmitter domains of PilS, but the TM domain of PilS has been reptaced by MalG (which comprises 6 TM helices).

A quantitative pilA promoter assay was not performed for this strain, the phosphatase activity was assessed qualiWively by western immunoblot with an anti-PilA antibody.

Construct

pJE681

pJE682

pJE683

plE684

pJE685

pJE686

Fluofcella no lPTG

7895 k 1063

4360 k 1 135

4646 k 1343

6857 k 806

3495 + 830

6978 & 1413

6084 k 941

3939 & 671

5098 a 530

6483 k 1228

7225 k 1036

7602 & 1835

4578 +, 806

2836 k 328

9007 k 806 C

4346 2 806

9065 k 286

Mutation

ATM3-4C

ATM14C

ATTMI-ZC

ATM4C

ATM?C

TMIC

Fluo/cef la 0.5 mM IPTG

1224 + 349

863 a 172

1092 k 102

946 a 160

1417 k254

1 0663 t 1500

888 _+ 66

711 1 8 6

1057 2 183

1069 k 242

3481 k 242

t f 018 k 1972

926 k 203

943 & 121

822 4: 241 C

819 r= 148

7860 kg18

pJE687

pJE688

pJE689

pJE68lO

pJE6811

pJE6812

p JE68 13

pJB233

pJB237

pJB742

pJB228

pMMB

TM2C

TM4C

ATM2C

A T M ~ ~ C

TM3C TMSC

ATM4/6

ATMI-GC

Alinker

MalG:PilS

none

no PilS

110

Table 8. Kinase activity of the PiIS mutants

a These values represent the activity of the GFP protein expressed from pJE411 and are the mean of 4 separate experiments f standard deviation. This construct contains the entire linker and transmitter domains of PiIS, but the

TM domain of PilS has been replaced by MaIG (which comprises 6 TM helices). A quantitative pilA promoter assay was not performed for this strain, €he kinase

activity was assessed qualitativeIy by western imrnunoblot with an anti-Pik anti body.

L

Construct

pJE681

pJE682

pJE683

pJE684

pJE685

p JE686

p JE687

pJE688

pJE689

pJE6810

pJE6811

pJE6812

pJE6813

pJB233

~56237

p56742

pJB228

pMMB

Fluofcella no IPTG

993 t 126

939 + 119 1072 k 81

881 & 70

1418 k471

1601 i 571

1069 +_ 146

819 k48

1012 k 108

973 ,t 60 984 & 102

948 k 203

1043f 224

646 & 71

5382 & 787 c

2917 & 445

1203 s 184

Mutation

ATM3-4C

ATM1-4C

ATMI-2C

ATM4C

ATM1C

TM1C

TM2C

TM4C ATM2C

ATM2-4C

TM3C

TMSC

ATM416

ATMI-GC

linker

MalG:PilS

none

no PiIS

Fluofcella 0.5 mM IPTG

586 k 74

496 k 45

558 k 70

545 + 86

823 + 97

Z 0396 + 947

686 k 256

446 k40

549 & t 95

494 kt 57

1153 + 102 12525k2554

643 t, 123

609 2 48

677 k 92 C

537 + 44

693 k 58

711

Figure 1. Schematic representation of the mechanism of pilA gene transcription

activation. See text for details.

113

Figure 2. Predicted topological model of PiIS. The boxes representing the six

TM segments are numbered 1 to 6. The first and last amino acids of each helix,

as predicted by TopPredIl, is also indicated in the TM boxes. The number above

or below the connecting loops refen to the number of Arg and Lys residues

found in that particular segment.

Periplasrn

n Cyt oplasrn

1?5

Figure 3. Classifcation of inner membrane proteins. The leader peptidase

cleavage site in class I proteins is indicated by the anow. SP: signal peptide; ST:

stop-transfer sequence; USP: uncleaved signai peptide; SST: start-stop-transfer

sequence. This figure was reproduced from (1 53).

w

cytoplasm w

SP&T USP SST Complex

117

Figure 4. Secdependent translocation and insertion mechanism (adapted from

(36)). Step I is the interaction of the nascent polypeptide chain and the

chaperone SecB in the cytoplasm. This complex then interacts with SecA (step

2). After SecB dissociates from the complex, SecA and the polypeptide chain

move to the SecYEG translocon (step 3). ATP binding to SecA and interaction

with SecY stimulates insertion of SecA and the precursor chain into the

membrane (step 4). ATP hydrolysis provides the energy necessary for release of

the preprotein into the translocation channel. Step 5A represents the

translocation of a periplasmic or extracellular protein. The arrow shows the

leader peptidase cleavage site. The proton motive force (Ap) drives the

translocation of the protein across the membrane. Alternatively in step 58, the

proton motive force drives translocation of the preprotein chain until a stop-

transfer sequence is encountered. Repeated cycles of SecA binding to

hydrophobic segments, ATP binding and hydrolysis and insertion and release will

lead to the insertion of the multiple TM segments of polytopic proteins in the

membrane.

Step 3

pedplasm

cytoplasm

119

Figure 5. The signal recognition particle (SRP) pathway. On the right side of the

diagram is the SecB pathway and the SRP pathway is shown on the left side of

the figure. The SRP, ribosome and nascent polypeptide chain complex binds to

its receptor FtsY in the cytoplasm. This complex then interacts with the

membrane, an event accompanied or preceded by GTP binding to SRP and

FtsY. At this stage, the polypeptide chain is able to interact with the SecYEG

translocon and be translocated or inserted into the membrane. Upon GTP

hydroiysis, SRP and F tsY dissociate from each other. This figure was

reproduced from (149).

GDP

121

Figure 6. Sec-independent insertion of the MI 3 prowat protein. Electrostatic

binding of the positive residues of M'I3 procoat brings the protein to the

membrane. The two hydrophobic segments of MI3 procoat then spontaneousIy

insert into the membrane with the help of the membrane electrochemical

potential. The insertion step is followed by cleavage ofthe signal peptide by the

leader peptidase. This figure was reproduced from (161).

123

Figure 7. Theoretical principle of the gene fusion approach to study topology.

The dotted ovals represent a reporter enzyme, either Lac2 or PhoA, fused to a

TM helix (black box). The phenotype expected for a cytoplasmic fusion site is

shown on the left and the phenotype expected for a periplasrnic fusion site is

shown on the right.

Lac2 -ve PhoA +ve

Figure 8. Rationale for €he construction of the fusion plasmids. BamHl

restriction sites are introduced within the piiS gene by PCR mutagenesis and

Bglll sites are introduced by Quikchange mutagenesis. The KpnRBS linker is

inserted in the EcoRl restriction site upstream of pilS, so the pilS fragment can be

cloned into the reporter vectors or on pMMB using Kpnl and BamHl or 89111. The

EcoRlATG linker was inserted into the newly engineered Bglll site of some

plasmids to replace the Bglll site by an EcoRl site and to introduce an ATG start

codon. Using EcoRl and BamHI, the pilS fragment was excised and cloned into

the reporter vectors and pMMB.

127

Figure 9. Diagram of the reporter vectors. The name and size of each plasmid

is indicated next to the circular diagrams. The restriction sites used for cloning

are shown in bold.

EeoRl Sstl Kmi Smal BamH1

pJE608 (1 'I 948 bp)

EcoRl Sstl Kpnl Smal BamHI

pJE609 (10460 bp)

Amp 1

pJE670 (9520 bp)

129

Figure 10. Schematic representation of the PilS-Lac2 and PilS-PhoA hybrid

proteins. Panel A shows a diagram of wildtype PilS with the six TM helices

numbered 1 to 6 and the position of the linker and transmitter regions is

indicated. The various PilS mutants are illustrated in panel B. The name of the

fusion is indicated in the leffmost column (fusion site) and the name of the

plasmid that carries the truncated piiS gene fused to lac2 is indicated in the

central column, while the name of the plasmid carrying the fusion to phoA is

mentioned in the rightmost column. The black circles represent the reporter

enzyme.

B Fusion site

linker pJE638

1 2 3 4 5 6 linker transmitter

131

Figure 'f1. Schematic representation of the PilS-Lac2 and PilS-PhoA deletion

hybrid proteins. Panel A shows a diagram of wildtype PilS with the six TM

helices numbered 1 to 6 and the position of the linker and transmitter regions is

indicated. The various PilS deletion mutants are illustrated in panel B. The

name of the deletion is indicated in the leftmost column and the name of the

plasmid that carries the mutant pilS gene fused to lac2 is indicated in the central

column, while the name of the plasmid carrying the fusion to phoA is mentioned

in the rightmost column. The black circles represent the reporter enzyme.

6

Deletion TM I C

TM 4C

ATM 24C

ATM 4C

ATM 1

ATM 3-2

ATM 2

ATM 2-4

ATM 3-4

ATM 4

TM 1 blinker

1 2 3 4 5 6 linker transmitter

133

Figure 12. Schematic representation of the full-length deletion of PIS and PilS

GFP hybrid proteins. Panel A shows a diagram of wildtype PilS with the six TM

helices numbered I to 6 and the position of the linker and transmitter regions is

indicated. The various Fils deletion mutants are illustrated in panel B. The

name of the deletion is indicated in the leftmost column (fusion site) and the

name of the plasmid that carries the truncated pilS gene fused to gfp is indicated

in the central column. The name of the plasmids in which the mutant piIS gene is

carried in pMMB without fusion to any reporter is indicated in the rig htmost

column. The biack circles represent GF P.

135

Figure 13. Hydrophobicity profile of PilS as determined by the Kyte and Doolittle

scale and a window of 7 amino acids. The six peaks of hydrophobicity are

numbered 1 to 6. The dashed line represents the threshold of hydrophobicity for

formation of a TM helix.

Amino acid position

137

Figure f4. Amino acid sequence of PilS. The underlined segments correspond

to the TM helices as predicted by TopPredll(25), while the sequences shown in

bold represent the TM helices as proposed by TMPred (69). The positively

charged residues Arg and Lys are outlined in blue, while the more moderately

hydrophilic residues Asp, Asn, Gln and Glu are colored in blue. The amino acids

found at the junction of the TM and linker domain (Arg-176) and the junction of

the linker and transmitter domains (Ser-296) are indicated. The site of

p hosphorylation (His-31 9) is also indicated. The fusion sites (Pro-49, Gln-75.

Gly-99, lle-123, Val-154, Gln-177, Gln-304 and Leu-529) are indicated in red.

Val Brg Ala Glu U g L e u U g Leu Ser Glu Glu Gln Gly G l n U g Ile Leu A q Leu T y r His L e u l&g~ Leu Zhr fle G l y L e u V a l Leu V a l Leu Leu IJe Set 88s GLu Leu Glu Asp Gln Val Leu Gym L e u V a l His pro4' G l u Leu Phe H i s V a l Qly Seg T w Cys Z y r Leu Val Phe Ile Leu Val bla Leu Phe L u Pro Pro Ser lLfB ~1x1'' L e u Leu P r o Ile Phe fie Leu Ala L e a 'Phr Asp Val Leu M e t Leu Cys Glp Lmz Phe Tlrr Ala G l y G l y 019' Val Pro S e t

Gly 118 059 S e t Leu Leu V a l Val Ala V a l Ala f le Ala Ada f le L e u Leu BtQ Gly &g 1leU3 OLp Leu V a l Ile Ala M a N a Ala ser Leu O l y Leu Leu P y r L e u T h r Phe Phe Leu Ser Leu Ser Ser Pro Asp A l a Thr Asn His Tyr ~a1"' O l n Ala G l y G l y L e u ( i ly

Zht Leu Cys Phe Ala Ala Ala Leu V a l Ile G l n Ala Leu Val U g ~ln''~ Glu G l n T h r Glu Thr Leu Ala Glu Glu Axg Ala Glu

Thr Val Ala Asn Leu Glu Glu Leu Asn Ala Leu Ile Leu Gln Arg Met Btg Thr Gly Ile Leu Val Val Asp Ser Azg G l n Ala Ile Leu Leu Ala Asn Gln kla kla Leu Gly Leu Leu Arg G l n Asp Asp Val G l n G l y Ala Ser Leu Gly lLIg H i s Ser Pro M e t Leu Met His Cys M e t Lys G l n Trp Axg Leu A8n Pro Ser Leu AEg P r o P r o Thr Leu Lys V a l Val P r o Asp Gly P r o Thr Val Gln Pro Ser Phe Ile Ser Leu Asn k g Glu Asp Asp Gln H i s V a l Leu Ile Phe Leu Glu Asp Ile ~ e r " ~ Gln Ile Ala Gln Gln Ala Gln ~ l n " ' Met S ~ I Leu Ala Gly Leu Gly J k g Leu T h r Ala G l y Ile Ala is"' G l u Ile Apg Asn Pro L e u Gly Ala Ile Ser H i s ALa ma G l n Leu Leu G l n Glu Ser Glu Glu Leu Asp Ala P r o Asp Arg lLPg Leu Thr Gln Ile Ile Gln Asp Gln Ser Lys llPg M e t Asn Leu Val Ile Glu Asn Val Leu Gln L e u Ser Jky Arg lLrg G l n Ala Glu Pro Gln G l n Leu Asp Leu Lya Glu Trp Leu G l n Aeg Phe V a l Asp G l u Tyr Pro Gly &g Leu U g Asn Bep Ser Glu Leu His Leu G l n L e u G l y Ala Gly Asp Ile G l n Thr lltg Met Asp Pro H i s G l n Leu Asn Gln Val Leu Ser Asn Leu Val Gln Asn Gly Leu lLtg Tyr Ser Ala Gln Ala H i s Gly &g Gly G l n V a l T r p Leu Ser Leu Ala Brg Asp Pro Glu Ser Asp Leu Pro V a l Leu Glu ile Ile Asp Asp Gly Pro Gly V a l P r o Ala Asp Lgs Leu Asn Asn Leu Phe G l u Pro Phe Phe Thr Thr G l u Ser &ys G l y T h r Gly Leu Gly Leu Leu Ser %pg Glu Leu Cys Glu Ser Asn G l n AZa Bng fle Asp Tyr lLEgl Asn lLrg Glu Glu G l y G l y Gly Cys Phe lLtg Ile Thr Phe AZa His Pro Arg Lym ~ e u ' ' ~ Ser

139

Figure IS. Western immunoblot of the PilS-Lac2 and PilS-PhoA hybrid proteins

from whole cell lysates of PAK-AS2 (panels A and C) and CC118 (panels B and

D) carrying the fusion plasmids. Panels A and B were probed with an anti-lac2

antibody and panels C and D were probed with an anti-PhoA antibody. Both

antibodies were purchased from 5 Primet3 Prime (Boulder, CO), diluted 1 :I000

and adorbed on acetone powder made €tom PAK-RA (pMMB) to reduce cross-

reactive binding. To better visualize the Lac2 band of the positive control (panels

A and 6, lane 17), half as much sample was loaded in this lane of the gel.

Molecular weight standards are shown on the left. The stars indicate the location

of the hybrid proteins or the expected position of the fusion protein (bands were

visible on other blots after overexposure to X-ray film).

Lane 1: pMMB Lane 2: (-) Lane 3: TMI

Lane4: TMZ Lane 5: TM3 Lane 6: TM4

Lane 7: TM5 Lane 8: TM6 Lane 9: linker

Lane 10: C-term Lane ?I : ATMI Lane 12: ATMI-2

Lane 13: ATM2 Lane 14: ATM24 Lane 15: ATM3-4

Lane 16: ATM4 Lane 17: (+)

141

Figure 16. Qualitative pilin assay in strains carrying the fusions to full length

PIS. PAK-AS2 (for the kinase assay) and PAK (for the phosphatase assay)

carrying the fusion plasmids and the negative (pMMB) and positive (pJB228)

controls were grown overnight in the presence or absence of IPTG. A: kinase

assay. B: phosphatase assay. The bands corresponding to PIS, PilS-Lad,

PilS-PhoA and PilA are indicated by arrows.

Lane I: pJE623, no IPTG Lane 2: pJE623.0.5 mM IPTG

Lane 3: pJE624, no lPTG Lane 4: pJE624. no IPTG

Lane 5: pMMB, no IPTG Lane 6: pMMB, 0.5 mM lPTG

Lane 7: pJB228, no lPTG Lane 8: pJB228, no IPTG

943

Figure I f . Enzymatic activity of the Pits-Lac2 and PiIS-PhoA hybrids in P.

aeruginosa. The assays were performed as described in Chapter 3 and the

values illustrated here and mentioned in Table 3 are the mean of at least 4

separate experiments f standard deviation. A: Bgalactosidase activity of the

PilS-Lac2 proteins. B: Alkaline phosphatase of the PilS-PhoA hybrids. The

black bars represent the activity measured in PAK, while the white ban show the

enzymatic activity measured in PAK-hS2.

1.0 (-1 TMI TM2 TM3 TM4 TM5 TM6 linker C (+)

term

0 -0 - fM1 TM2 TM3 TM4 TMS TM6 IinkerC-term

Fusion site

. . . , /. PAK U PAK-DS2 /

445

Figure 18. Enzymatic activity of the PilS-Lac2 and PilS-PhoA hybrids in E. coli

CCj 18. The assays were performed as deribed in Chapter 3 and the values

illustrated here and mentioned in Table 3 are the mean of at least 4 separate

experiments f standard deviation. A: 8-galactosidase activity ofthe Pits-Lac2

proteins. B: Alkaline phosphatase of the PilS-PhoA hybrids.

0.1 (-1 TMt TM2 TM3 TM4 TM5 TM6 linker C (+)

term

0 -0 (-1 TM1 TM2 TM3 fM4 TM5 TM6 linker C-term

Fusion site

147

Figure 19. Summary of the gene fusion results and topological model of PiIS.

Each fusion site is indicated along with its enzymatic phenotype. The shaded

ovals represent LaWPhoA- phenotypes, while the hatched rectangles

symbolize Lac-/PhoA+ phenotypes. Refer to Table 3 for the results of the

enzymatic assay.

a. a. 304

PhoA -

.- . . - - -. - -

transmitter

a- a- 529 I

PhoA -

149

Figure 20. Enzymatic activity of the fusions TM1, TMIC and TMlAlinker. The

assays were performed as described in Chapter 3 and the values illustrated here

are the mean of at least 4 separate experiments + standard deviation. A: &

galactosidase activity of the PilSLacZ proteins. B: Alkaline phosphatase activity

of the PilS-PhoA hybrids. The black bars represents the activity measured in

PAK, while the white ban show the enzymatic activity measured in PAK-AS2.

I

f

I. PAK U PAK-DS2 I

TMI TMIC

Fusion site / Deletion

151

Figure 21. Western immunoblot of the fusions TM1 (pJ E653/p JE654), TMl C

(pJE690fpJE691) and TMl Alinker (pJE812fpJE813) in PAK (lanes 13) and PAK-

A S 2 (lanes 4-6). Panel A was probed with an anti-Lac2 antibody and panel B

was probed with an anti-PhoA antibody. Molecular weight standards are shown

on the lefL The top band in each lane represents the fusion protein.

Lane 1 : PAK (TM1) Lane 2: PAK (TMI C)

Lane 3: PAK ml Alinker) Lane 4: PAK-AS2 (TM1)

Lane 5: PAK-AS2 (TM1 C) Lane 6: PAK-AS2 (TMl Alinker)

153

Figure 22. Enzymatic activity of the PilS-Lac2 and PilS-PhoA deletion hybrids in

P. aenrginosa. The assays were performed as described in Chapter 3 and the

values illustrated here and mentioned in Table 5 are the mean of at least 4

separate experiments f: standard deviation. A: p-galactosidase activity of the

PilS-Lac2 proteins. B: Alkaline phosphatase of the PilS-PhoA hybrids. The

black bars represents the activity measured in PAK, while the white bars show

the enzymatic activity measured in PAK-AS2.

j B PAK [I PAK-DS2

Deletion

4 55

Figure 23. Enzymatic activity of the PiISLacZ and PilS-PhoA deletion hybrids in

E. coli CC118. The assays were performed as described in Chapter 3 and the

values illustrated here and mentioned in Table 5 are the mean of at least 4

separate experiments + standard deviation. A: P-galactosidase activity of the

PilS-Lac2 proteins. 8: Alkaline phosphatase of the PilSPhoA hybrids.

157

Figure 24. Topological models of the ATM1 and ATM2 deletions as predicted

with TopPredll. The numbering of the TM helices (clear boxes) is the same as in

wildtype PilS. The arrows indicate the site of the fusion to lac2 or PhoA. A: the

N-terminus of the PilSATM1 protein is periplasmic and the topology of the

remaining portion of PilS is unchanged. B: The N-terminus of PilSATM2 remains

cytoplasmic and the segment corresponding to TM3 in wiidtype PilS is fully

translocated into the periplasm and the following TMs inserts into the membrane

in the same way as wildtype PilS.

J . b , I , Periplasi

1111 2

3 4 - 5 6

I.' I\ I Cytoplasm

Periplasm

Cytoplasm

159

Figure 25. Cell fractionation of the PilS-Lac2 hybrids showing positive activity.

The membrane and soluble fractions were separated as described in Chapter 3.

Western immunoblots of each fraction were done in triplicate and one set was

probed with an anti-Lac2 antibody (panel A), another with an anti-Oprf antibody

(panel B, top row) and the last one with an anti-plactamase (plac) antibody (panel

B, bottom row). The top panel in A and the right column in panel B are the M

fraction, while the bottom panel in A and the left column of panel B are the S

fraction. Molecu tar weight standards are shown on the left. The stars indicate

the location of the Pits-Lac2 hybrid proteins. The band corresponding to OprF

and plac in panel B are indicated by arrows.

Lane I : TM2 (pJE648) Lane 2: TM4 (pJE642) Lane 3: TM6 (pJE634)

Lane 4: linker (pJE638) Lane 5: Gterm (pJE624) Lane 6: A T M ~ - ~ (pJE802)

Lane 7: ATM4 (pJE658) Lane 8: (+) (pJE680)

21 5

M fraction

131

761

Figure 26. Sequence comparison of the junction of the pilA promoter and gfp

gene in pGGl03A (top) and pJE41 I (bottom). In both panels, the GFP start

codon is indicated with a blue arrow, the -24 and -12 sequences of the pilA

promoter are underlined, the PiiR binding sites (UAS) are shown in bold, and the

sequences underlined in red are the Shine-Dalgamo (SD) sequences. The

segment highlighted in green in the bottom panel is the translational enhancer

sequence. The sequence that differs between the two constructs is enclosed in

the rectangle.

AAGCTTTCCCTGTCCAGGCTGTTCAGGTCGCAATAGGCGATGCCGAA

TTCTGCACCAGGTGCGTCACCAGCGACAGCTTGTTGCGCTGCGCCTG

CGAGCTGTCGGGACAGACCGCTCAGITGGATGCTGTCGTTCATGGAG

GGGTCTGCCAAATCGGGGGAGTCCGGCTGTCAAAAAGTGTCACATC

-24 -1 2

TAGGCGTTAGGATCC

GFP start

CTGCTCGGCGGACAATTCGGCCAGGGCCAGGCCGCTTACCAGCTTG

TTCTGCACCAGGTGCGTCACCAGCGACAGCTTGTTGCGCTGCGCCTG

AAGGAAATCGCAGAGGGCTATTGAAGTGCCTTATAACGCAGATAACA

CATATGAGT 4 + Enhancer SD

GFP start

163

Figure 27. Epifluorescence microscopy images of the PIS-GFP fusion proteins.

Bacteria (PAK) were grown at 37OC for 2-3 hours in media supplemented with

0.1-0.5 mM IPTG. After an overnigth incubation at 4OC, cells were prepared for

microscopy as stated in Chapter 3. Images were processed and analyzed with

Adobe Photoshop using custom look-up tables.

A:pJE671(ATMWC) B:pJE672(AW?4C) C:pJE673(ATM1-2C)

0: pJE674 (ATM4C) E: pJE6713 (ATM416C) F: pJE676 (TM1 C)

G: pJE677 (TM2C) H: pJE678 (TM4C) I: p JE679 (ATMZC)

J:pJE6710(ATM2-4C) K:pJE6711(TMBC) L: pJE6712 (TMBC)

M: pJB772 (PIS) N: pJB731 (TM6) 0: pJB708 (GFP)

465

Figure 28. Gel[ fractionation of the non-polar PiIS-GFP hybrids. The membrane

and soluble fractions were separated as described in Chapter 3. Western

immunoblots of each fraction was done in triplicate and one set was probed with

an anti-GFP antibody (panel A), another with an anti-OprF antibody (panel B, top

row) and the last one with an anti-plactamase (plac) antibody (panel B, bottom

row). The top panel in A and the right column in panel B are the M fraction, while

the bottom panel in A and the left column of panel B are the S fraction.

Molecular weight standards are shown on the left. The stars indicate the location

of the PilS-GFP hybrid proteins. The band corresponding to OprF and plac in

pane( B are indicated by arrows.

Lane 1 : C-term (pJB712) Lane 2: Am (pJB733)

Lane 3: TM7C (pJE676) Lane 4: TM2C (pJE677)

Lane 5: ATM2C (pJE679) Lane 6: ATM2-4 (pJE67t 0)

Lane 7: TM3C (pJE6771) Lane 8: TMSC (pJE6712)

131 89

M fraction 45

32

431

89 S fraction

45

32

M fraction S ftacfron

Figure 29. Summary of the cellular localization, kinase and phosphatase assay

resuits of the PilS mutants. A schematic representation of wildtype PiIS is shown

in panel A. The name of the deletion as well as a diagram of the PilS mutant is

shown in panel B. The columns on the right side of the figure summarize the

results obtanied from the kinase and phosphatase assays as well as the cellular

location of the PiISGFP hybrids as evaluated by microscopic examination and

cell fractionation experiments. (+) : positive function assay; (-) : negative function

assay.

?69

Figure 30. Testing of the kinase and phosphatase functions of PilS mutants

under different induction conditions. Cells were grown overnight in the presence

of 0.0.0.05,O.l or 0.5 mM IPTG and washed in PBS 20 MgCl2. The absorbance

and fluorescence of an aliquot of washed cells was measured. The pilA

promoter activity is reported as ff uofceli. The vector pMMB is used as a negative

control for background cell fluorescence and pilA promoter activity. Each column

is labeled with the name of the construct as well as the concentration of IPTG

used in the growth media. The result of the phosphatase assay are shown in

panel A and the results of the kinase assay are shown in panel B.

Construct / lPTG concentration

171

Figure 31. Phosphatase assay of the PilS mutants. The piiA promoter activity is

reported as RuolcelI. The vector pMMB is used as a negative control for

background cell fluorescence and pilA promoter activity, pJB228 is used as a

control for wikltype PilS phosphatase function. The black bars indicate the

promoter activity in strain PAK under uninduced conditions; the white bars

represent the promoter activity grown under conditions in which the PilS mutant

tested was overexpressed. Results are the mean of four experrnients + standard

deviation.

173

Figure 32. Kinase assay of the PiIS mutants. The pilA promoter activity is

reported as fluofcell. The vector pMMB is used as a negative control for

background cell fluorescence, pJB228 is used as a control for wildtype PiIS

kinase function. The black bars indicate the promoter activity in strain PAK-AS2

under uninduced conditions; the white bars represent the promoter activity grown

under conditions in which the PilS mutant tested was overexpressed. Results

are the mean of four expennients t standard deviation.

C h a ~ b r 8. LITERATURE CITED

1. Alm, R. A*, and JB S. Mattick. 1997. Genes involved in the biogenesis and

function of t y p e 4 fimbriae in Pseudomonas aemginosa. Gene. 192:89-98.

2. Amsler, C. Dm, and P. Matsumura. 1995. Chemotadc signal transduction in

Escherichia coli and Salmonella typhimurium., p:89-103. in Two-component

signal transduction, J. A Hoch and T. J. Silhavy (ed.), ASM Press, Washington,

D.C.

3. Andenson, H., E. Bakker, and G. von Heijne. 1992. Different positively

charged amino acids have similar effects on the topology of a polytopic

transmembrane protein in Escherichia coli. J Biol Chem. 267:1491-1495.

4. Andersson, H., and G. von Heijne. 1994. Membrane protein topology:

effects of ApH+ on the translocation of charged residues explain the 'positive

inside' rule. EMBO J. 13:2267-2272.

5. Aron, S. K., Be W. Ritchings, E. C. Almin, S. Lory, and R. Ramphal.

1998. The Pseudomonas aemginosa flagellar cap protein. FIiD, is responsible for

mucin adhesion. Infect Immun. 669 000-1007.

6. Anridson, C. G., T. Powers, P. Walter, a d M. So. 1999. Neisseria

gononhoeae PilA is an FtsY homolog. J Bacterial. 181:731-9.

T. Austin, S., and R Dixon. 1992. The prokaryotic enhancer binding protein

NTRC has an ATPase activity which is phosphorylation and DNA dependent.

EMBO J. tf:22'€9-2228-

t 76

8. Ausubel, Fa, R. Brent, Rw Kingston, D. Moore, J. Seidman, and J. Smith.

1990. Current Protocols in Molecular Biology. John Wiley and Sons, New York,

9. Bibi, E., G. Verner, C.-Ye Chang, and H. R w Kaback. 1991. Organization and

stability of a polytopic membrane protein: Deletion analysis of the lactose

permease of Eschefichia coli. Proc. Nail. Acad. Sci. USA 88:7271-7275.

10. Bleves, S., A. Lazdunski, and A. Filloux. 1996. Membrane topology of

three Xcp proteins involved in exoprotein transport by Pseudomonas aemginosa.

J Bacterial. 178:4297-300.

11. Bounet, R B., J. F. Hess, K. A. Borkovich, A. Pakula, and M. I. Simon.

1989. Protein phosphorylation in chemotaxis and two-component regulatory

systems in bacteria. J Biol Chem. 264:7085-7088.

12. Boyd, D., C. Manoil, and J. B~chithw 1987. Determinants of membrane

protein topology. Proc. Natl. Acad. Sci. USA, 84:8525-8529.

f3. Boyd, D., B. Trader, and J. Becfittr. 1993. Analysis of the Topology of a

Membrane Protein by Using a Minimum of Alkaline Phosphatase Fusions. J.

Bacteriot. 175:553-556.

14. Boyd, D., B. frpxler, G. Jande, W. Print, and J. Beckwith. 1993. Gene

fusion approaches to membrane protein topology. Soc Gen PhysioI Ser. 48:23-

37.

15- Boyd, J. M. 2000. Localisation of the histidine kinase, PIS, to the poles of

Pseudomonas aemghosa and identification-of a localisation domain. Mol Micro

(accepted for pu blica80n).

177

16. Boyd, J. M., T. Koga, and S. Lory. 1994. Identification and characterization

of PIIS, an essential regulator of pilin expression in Pseudomonas aenrginosa.

Mol Gen Genet 243565-574.

17. Boyd, J. Ms, and S. Lory. 1996. Dual Functi-on of PilS During Transcriptional

Activation of the Pseudomonas aemginosa Pilin Subunit Gene. J. Bacterial.

178~831-839,

18. Bradley, D. E. 1980. A function of Pseudomonas aenrginosa PA0 polar pili:

twitching motility. Can. J. Microbial. 26:14&154.

19. Broorne-Smith, J w K., S. Gnaneshan, L. A. Hunt, F. Mehnein-Ghomi, 1.

Hashemudeh-Bonehi, M. fadayyon, and E. S. Hennessey. 1994. Cleavable

signal peptides are rarely found in bacterial cytoplasmic membrane proteins

(Review). Mol. Membr. Biol, l I :Me

20. Brunskill, E. W., and K. W. Bayles. 1996. Identification and molecular

characteriration of a putative regulatory locus that affects autolysis in

Staphyococcus aureus. J. Baderiol. 178:6 1 1-6 18.

21. Calamia, J., and C. Manoil. 1990. lac permease of Escherichia coik

topology and sequence elements promoting membrane insertion. Proc Natf Acad

Sci U S A- 87:493741.

22. Calamia, J., and C. Manoil. 1992. Membrane protein spanning segments as

export signals. J Mo( Biol. 22453943.

178

23. Cheng, X, and T. A. Patterson. 1992. Construction and use of lambda PL

promoter vectors for direct cloning and high level expression of PCR amplified

DNA coding sequences. Nucleic Acids Res. 20:4591-8.

24. Chi, E., T. Mehl, D. Nunn, and S. Lory. 1991. Interaction of Pseudomonas

ae~ginosa with A549 pneumocyte cells. Infect immun. 59:822-828.

25. CIaros, Me G., and G. von Heijne. 1994. TopPred 11: an improved software

for membrane protein structure predictions. Cornput. Appl. Biosci. 10:685-686.

26. Comolli, J. C., A. R. Hauser, L. Waite, C. 6. Whitchurch, J. S. Mattick,

and J. N. Engel. 1999. Pseudomonas aemginosa gene products PilT and PiIU

are required for cytotoxicity in vitro and virulence in a mouse model of acute

pneumonia. Infect lmmun. 67:3625-3630

27. Comolli, J. C., L. L Waite, K Em Mostov, and J. N. Engel, 1999. Pili

binding to asialo-GM1 on epithelial cells can mediate cytotoxicity or bacterial

internalization by Pseudomonas aemginosa. lnfect immun. 67:3207-3214.

28. Cometle, J. L., K. B. Cease, He Mrgalit, J. L. Spouge, J. A. Benofsky,

and C. DeLisi. 1 987. Hydrophobicity scales and computationaI techniques for

detecting amphipathic structures in proteins. J. Mol. Biol. 195:659-685.

29. Dalbey, R. E m 1990. Positively charged residues are important determinants

of membrane protein topology. Trends Biochem Sci. 15253-7.

30. Darzins, Am, a d M. A Ru~~ellm 1997. Molecular genetic analysis of type4

piIus biogenesis and Witching motility using Pseudomonas aemginosa as a

mode[ system- a review. Gene. 192: 1 09-1 1 5.

179

31. Dassa, E m , and So Muir. 1993. Membrane topology of MalG, an inner

membrane protein from the maltose transport system of Escherichia coli. Mot.

Microbiol. 7~29-38,

32. Davies, .Im, A. Dewar, A. Bush, T. Pitt, D. Gruenert, Dm M. Geddes, and Eo

W. F. W. Alton. 1999. Reduction in the adherence of Pseudomonas aemginosa

to native cystic fibrosis epithelium with anti-asialoGM1 antibody and

neuraminidase inhibition. Eur. Respir. J. 13:565-570.

33. De Gier, J.=W. L., P. A. Scotti, A. Saaf, Q. A. Valent, A. Kuhn, and J o

Luirink. 1998. Differential use of the signal recognition particle translocase

targeting pathway for inner membrane protein assembly in Escherichia coli. Proc.

Natl. Acad. Sci. USA, 95:14646-14651.

34. De Gier, J.-W. L., Q. A. Valent, 0. von Heijne, and J. Luin'nk. 1997. The

E. coli SRP: preferences of a targeting factor. FEBS Let 408:l-4.

35. Degli Esposti, M., M. Crimi, and G. Venturoli. 1990. A critical evaluation of

the hydropathy profile of membrane proteins. Eur. J. Biochem. 190:207-219.

36. den Bbauwen, f., and A. J. M. Driessen. 1996. Sec-dependent preprotein

translocation in bacteria. Arch. Microbiol. 165~1-8.

37. DiMango, Em, H. J. Zar, R. Bryan, and A. Prince. 1995. Diverse

Pseudomonas aenrginosa Gene Products Stimulate Respiratory Epithelia1 Cells

to Produce Interfeukin-8- 3. Clh- Invest 96:2204-2210-

180

38. Doig. P., T. Todd, P. A. Sastry, K. K. Lee, R. S. Hodges, We Paranchych,

and R T. Iwin. 1988. Role of pili in adhesion of Pseudomonas aeruginosa to

human respiratory epithelial cells. Infect Immun. 56: 1641 6.

39. Doring, G., M. Maier, E. Multer, Ze Bibi, B. Tummler, and A. Kharazmi.

1987. Virulence factors of Pseudomonas aeruginosa. Antibiot Chemother.

39:136-148.

40. Duong, F., and W. Wickner. 1998. Seutependent membrane protein

biogenesis: SecYEG, preprotein hydrophobicty and translocation kinetics control

the stop-transfer function. EMBO J. 17:696705.

41. Dziejman, M., and J. J. Mekalanos. 1995. Two-component signal

transdudon and its role in the expression of bacterial virulence facton., p:305-

317. in Two-component signal transduction, J. A. Hoch and T. J. Silhavy (ed.),

ASM Press, Washington, D.C.

42. Egger, L. A., H. Park, and M. Inouye. 1997. Signal transduction via the

histidylasparty1 phosphorelay. Genes Cells. 2: 2 67-1 84.

43. Ehnnann, Me, and J. Beckwith. 1991. Proper insertion of a complex

membrane protein in the absence of its amino-terminal export signal. J. Biol.

Chem. 266:16530-16533.

44. Engelman, 0. M., and T. A. Steitz. 1981. The spontaneous inserbion of

proteins into and across membranes: the helical hairpin hypothesis. Cell. 23:411-

422-

181

45. Engelman, D. M., Tm A. Steitz, and A. Goldman. 1986. ldentirying nonpolar

transbilayer helices in amino acid sequences of membrane proteins. Ann. Rev.

Biophys. Biophys. Chem. 15:321-353.

46. Fan'nha, I. A., B. D. Conway, L. M. G. Glasier, ND W. Ellert, R. T. Iwin, R.

Sherburne, and W. Panmchych. 1994. Alteration of the pilin adhesin of

Pseudomonas aemginosa PA0 resub in normal pilus biogenesis but a loss of

adherence to human pneumocyte cells and decreased virulence in mice. Infect.

tmrnun. 62:4118-4123.

47. Fasman, G. Dm, and W. A. Gilbert 1990. The prediction of transmembrane

protein sequences and their conformation: an evaluation. Trends Biochem. Sci.

t5:89-92.

48. Fekkes, P., and A. J. M. Driessen. 1999. Protein targeting to the bacterial

cytoplasmic membrane. Microbiol. Mol. Biol. Rev. 63:161-173.

49. Feldman, M., Re Bryan, S. Rajan, L. Scheffler, S. Bnmnert, H. Tang, and

A. Prince. 1998. Role of flagella in pathogenesis of Pseudomonas aemghosa

pulmonary infection. Infect lrnmun. 66:43-51.

50. Fick, R. B. (ed). 1993. Pseudomonas aemginosa the opportunist

pathogenesis and disease CRC Press, Boca Raton, Fla

St. Finck-Barbancon, V., J. Goranson, L.-Zhu, T. Sawa, J. P. Wiener-

Kronish, S. M. Fieiszig, C. Wu, L. Mende-Mueller, and D. W. Frank. 1997.

ExoU expression by Pseudbmonas aemginosa correlates with acute cytotoxicity

and epithelial injury. Mol. Microbiol. 25:547-57.

182

52. f leiszig, S. M., J. P. Wener-Kronish, H. Miyazaki, V. Vallas, K. E.

Mostov, D. Kanada, T. Sam, T. S. Yen, and D. W. Fnnk. 1997. Pseudomonas

aemginosa-mediated cytotoxicity and invasion correlate with distinct genotypes

at the loci encoding exoenzyme S. Infect. Immun. 65~579-586.

53. Fleiszig, S. M., T. S. Zaidi, E. L. Fletcher, M. J. Preston, and 0. B. Pier.

1994. Pseudomonas aenrginosa invades corneal epithelial cells during

experimental infection. Infect Immun. 62~3485-3493.

54. Forest, K. T., and J. A. Tainer. 1997. Type4 pilus-structure: outside to

inside and top to bottom- a minireview. Gene. 192~165-169.

55. Fnnk, D. W. 1997. The exoenzyme S regulon of Pseudomonas aemginosa.

Mol. Microbial. 26:62'l-629,

56. Filrste, J. P., W. Pansegrau, R. Fnnk, H. Bloecker, P. Scholz, M.

hgdasarian, and E. Lanka. 1986. Molecular cloning of the plasmid RP4

primase region in a multi-host-range tacP expression vector. Gene. &:I 19-131.

57. Fussenegger, M., To Rudel, R. Barlien, Ro Ryll, a d T. F. Meyer. 1997.

Transformation w m petence and t y p e 4 pilus biogenesis in Neisseria

gononftoeae - a review. Gene. f92: 125-1 34.

58. Gafvelin, G., and G. von Heijne. 1994. Topological ''frustration" in

multispanning E coli inner membrane proteins, Cell. 77:401412.

59. Gilligan, P. H- 1991. Microbiology of airway disease in patients with cystic

fibrosis- CIin- Microbioi. Rev. 435-51-

183

60. Govan, Jo R., and V. Deretic. 1996. Microbial pathogenesis in cystic

fibrosis: m ucoid Pseudomonas ae~ginosa and Burkholderia cepacia. Micro bio l

Rev. 60:539-574.

61. Grimwood, K 1992. The pathogenesis of Pseudomonas aemginosa lung

infections in cystic fibrosis. J. Paediatr. Child Health. 28:4-11.

62. Hauser, A. Rey and J. N. Engel. 1999. Pseudomonas aemginosa induces

Type-Ill-secretion-mediated apoptosis of macrophages and epithelial cells. Infect

Immun, 67:5530-5537.

63. Hauser, A. Re, S. Fleiszig, P. J. Kang, K Mostov, and J. N. Engel. 1998.

Defeds in type Ill secretion correlate with internalization of Pseudomonas

aemginosa by epithelial cells. Infect. Immun. 66:'I413-1420.

64. Heinrich, D. W., and A. C. Glasgow. 1997. Transcriptional regulation of

type 4 pilin genes and the site-specific recombinase gene, piv, in Moraxella

lacunata and Momella bovis. 3 Bacterial, 479:7298-7305.

65. Hidaka, Y., He Park, and M. Inouye. 1997. Demonstration of dimer

formation of the cytoplasmic domain of a transmembrane osmosensor protein,

EnvZ, of Escherichia coli using Ni-histidine tag affinity chromatography. FEBS

tetters. 400:238-242.

66. Hobbs, M., E. S. R Collie. P. D. Free, S. P. Livingston, and J. S. Mattick.

1993. Pits and PIIR, a No-wmponenttranscriptionaI regulatory system

controlling expression of type 4 firnbriae in Pseudomonas aemginosa. Moi.

Microbial, 7:669-682.

2 8 4

67. Hobbg, M., and J. S. Mattick. 1993. Common components in the assembly

of type 4 fimbriae, DNA transfer systems, filamentous phage and protein-

secretion apparatus: a general system for the formation of surface-associated

protein complexes. Mol. Microbial. 10:233-243.

68. Hoffman, C. S., and A. Wright 1985. Fusions of secreted proteins to

alkaline phosphatase: An approach for studying protein secretion. Proc. Natl.

Acad. Sci. USA. 8251 07-51 4 I,

69. Hofmann, K., and Wm Stoffel. 1993. TMBASE - A database of membrane

spanning protein segments. Biol. Chem. HoppeSeyler. 374:166

70. Hoiby, N., G. Doring, and P. 0. SchiotL 1987. Pathogenic mechanism of

chronic Pseudomonas aenrginosa infections in cystic fibrosis patients. Antibiot.

Chernother; 39:60-76.

71. Hsing, W., F. Dm RUSSO, K. K. Bemd, and T. J. Silhavy. 1998. Mutations

that alter the kinase and phosphatase activities of the twocomponent sensor

EnvZ. 3. Bacteriot. 180:4538-4546.

72. Hsing, W., and T. J. Silhavy. 1997. Fundion of conserved histidine-243 in

phosphatase activity of Envf, the sensor for porin osmoregulation in Eschenichia

CU\~ J, Bacterial, 179:3729-3735,

73. [rani, V. R., and J m J. Rowe. 1997. Enhancement of transformation in

Pseudomonas aefugiinosa PA01 by Mg2+ and heat Biotechniques. 22:54-56,

74. twin, R Y., P. Doig. K. K Lms P. A. Sastry, W. Paranchych, T. Todd, and

R S. Hodges. 1989. Characterization of the Pseudomonas ae~gimsa pilus

185

adhesin: confirmation that the pilln structural protein subunit contains a human

epithelial cell-binding domain. Infect lrnmun. 57:3720-3726.

75. lshimoto, K. S., and S. Lory. 1 989. Formation of pilin in Pseudomonas

aeruginosa requires the alternative sigma factor (RpoN) of RNA polymerase.

?roc Natl Acad Sci U S A, 86:1954-1957-

76. Ishimoto, K. S., and S. Lory. 1992. Identification of pilR which encodes a

transcriptional activator of the pilin gene in Pseudomonas aerughosa. J.

Bactenol, 174~35 14-3521.

77. Jahnig, F. 1990. Structure predictions of membrane proteins are not that

bad. Trends Biochern, Sci. 15:93-95.

78. Jennings, U L 1989. Topography of membrane proteins. Ann. Rev.

Biochern, 58~999-f 027.

79. Jin, S., K. S. Ishimoto, and S. Lory. 1994. PiIR, a transcriptional regulator

of p iliation in Pseudomonas aenrginosa, binds to a cis-acting sequence upstream

of the pilin gene promoter. Mol. Microbial. f4: 1 049-1 057.

80. Kallstrom, H., M. S. bhm, P.4. Berggren, and A.-B. Jonsson. 1998. Cell

signaling by the type N pili of pathogenic Neissena. J. Biol. Chem. 273:2177?-

21782.

8t. Kamberov, E. S., M. R. Atkinson, P. Chandnn, and A. J. Ninfr. 1994.

Effect of mutations in Eschen'chia coliglnL (nbg), encoding nitrogen regulator II

(NRII or NtrB), on the phosphatase activity involved in bacterial nitrogen

regulation. J. Biol. Chem. 269:28294-28299:

186

82. Kramer, G., and V. Weiss. 1999. Functional dissection of the transmitter

module of the histidine kinase NtrB in Eschenchia coli, Proc. Nail. Acad. Sci.

USA. 96:604-609.

83. Kyte, J., and R F* Dooliffle. 1982. A simple method for displaying the

hydropathic character of a protein. J Mol Biol. 1573 05-32.

84. Lee, C., P. Li, H, Inouye, E. R Brickman, and J. Beckwith. 1989. Genetic

studies on the inability of bgalactosidase to be translocated across the

Eschenchia coli cytoplasmic membrane. J. Bacterial. 171 ~4609-4616.

85. Lee, KO K, H. 8. Sheth, W. Ye Wong, R. Sherbume, W. Pannchych, R. S.

Hodges, C. A. Lingwood, H. Krivan, and R f. Irvin. W94. The binding of

Pseudomonas aeruginosa pili to glycosphingolipids is a tipassociated event

involving the GterminaI region of the structural pilin subunit Mol Microbiol.

11:705-713.

86. Linr, G., S. Jarraud, G. Ji, T. Greenland, A. Pednu, J. Etienne, R. P.

Novick, and f. Vandenesh. 1998. Transmembrane topology and histidine

protein kinase activity of AgrC, the agr signal receptor in Sfaphylococcus aureus.

Mol. Microbiol. 28:655-662,

87. Lory, S., and M. S, Strom. 1997. Structureknction relationship of type-l\l

prepilin peptidase of Pseudomonas aenrginosa- a review. Gene. 1929 1 7-121.

88. Lu, HA., S. T. Motley, and S. Lory. 1997. Interactions of the components

of the general secretion pathway: role of Pseudomonas ae~ginosa type 1V pilin

subunits in complex formation and extracellular protein secretion. Mol. Microbiol.

25:247-259.

89. Mahenthinlingam, Em, Ma Em Campbell, and D. P. Speeh 1994.

Nonmotility and phagocytic resistance of Pseudomonas aenrginosa isolates from

chronically colonized patients with cystic fibrosis. infect irnmun. 62596-605.

90. Maniatis, T., E. F. hitsch, and J. Sambrook. 1982. Molecular cloning: a

laboratory manual. cold'spring Harbor Laboratory, Cold Spring Harbor, NY.

91. Manoil, C. 1991. Analysis of Membrane Protein Topology Using Alkaline

Phosphatase and p-Galactasidase Gene Fusions. Methods Cell Biol. 3461-75.

92. Manoil, C., and J. Beckwith. 1986. A Genetic Approach to Analyzing

Membrane Protein Topology. Science. 233:1403-1408.

93. Manoil, C., D. Boyd, and J. Beckwith. 1988. Molecular genetic analysis of

membrane protein topology. Trends Genet 4223.226.

94. Manoil, C., and B. Traxler. 1995. Membrane protein assembly: genetic,

evolutionary and medical perspectives. Ann. Rev. Genet 299 31-1 50.

95. Marty, N., C. Pasquier, J.-L. Dournes, K. Chemin, F. Chavagnat, M.

Guinand, G. Chabanon, 6. Pipy, and H. Montrozier. 1998. Effects of

characterised Pseudomonas aenrgiiosa exopolysaccharides on adherence to

human tracheal cells- J. Med. Microbiol, 41:129-134.

96. Matsumoto, G., T. Yoshihisa, and K. lto. 1997. SecY and SecA interact to

allow SecA insertion and protein translocation across the Eschenchia coli plasma

membrane. EMBO J, 16:6384-6393,

188

97. Mattick, J. S., C. B. Whitchurch, and R A. Alm. 1996. The molecular

genetics of type-4 fimbriae in Pseudomonas aeruginosa - a review. Gene.

1?9:147-155.

98- Y iller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor

Laboratory, Cold Spring Harbor, NY.

99. Miller, W. G,, and S. E. Lindow. 1997. An improved GFP cloning cassette

designed for prokaryotic transcriptional fusions. Gene. 191:149-153.

100. Mizuno, T., and S. Mizushima. 1990. Signal transduction and gene

regulation through the phosphorylation of two regulatory components: the

molecular basis for the osmotic regulation of the porin genes. Mol. Microbial.

4:j 077-1 082,

101. Muhlebach, M. S., P. W. Stewart, M. W. Leigh, and T. L. Noah. 1999.

Quantificauon of inflammatory responses to bacteria in young cystic fibrosis and

control patients. Am. J. Respir. Clit. Care Med. t60:186-191.

102. Newitt, J. A., N. D. Ulbnndt, and H. D. Bemstein. 1999. The structure of

multiple polypeptide domains debmines the signal recognition particle targeting

requirements of Escheflchia coli inner membrane proteins. J. Bacterial.

181 ~4561-4567.

f03. Ninfa, E. G., Me R. Atklnson, E. S. Kamberov, and A. J. Ninfi. 1993.

Mechanism of autophosphorylation of EscheHchhia ccoli nitrogen regulator I1 (NRII

or NtrB): frans-phosphorylation between subunits. J. Bacteriol. 175:7024-7032.

189

104. Nunn, D. N., and S. Lory. 1991. Product of the Pseudomonas aemginosa

gene pilD is a prepilin leader peptidase. Proc. Natl. Acad. Sci. USA. 88:3281-

3285.

105. Ohta, N., f. Lane, E. G. Ninfa, J. M. Sommer, and A. Newton. 1992. A

histidine protein kinase homologue required for regulation of bacterial cell

division and differentiation, Proc. Natl. Acad. Sci- USA. 899 0297-1 0301.

106. Ouchane, S., and S. Kaplan. 1999. Topological analysis of the membrane-

localized redox-responsive sensor kinase PrrB from Rhodobacter spaeroides

2.4.1. J. bid. Chem. 274: 1 7920-1 7296.

107. Park, H., and M. Inouye. 1997. Mutational analysis of the linker region of

Envf, an osmosensor in Eschenchia COIL J Bacterial. 179:4382-4390.

108. Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in

bacterial signaling proteins. Annu. Rev. Genet 26:71-112.

109. Pasloske, B. L, D. S. Drummond, L. S. Frost, and W. Paranchych.

1989. The activity of the Pseudomonas aenrginosa pilin promoter is enhanced by

an upstream regulatory site. Gene. 81 :25-34.

1 Pier, G. B., M. Grout, T. S. Zaidi, and J. B. Goldberg. 1996. How mutant

CFTR may contribute to Pseudomonas aenrginosa infection in cystic fibrosis. Am

.J. Respir-Clit Care. Med. S175S182.

1tI. Plotkowski, M. C., A. M. Saliba, S. H. Pereira, M. P. Cewante, and L. 0.

Bajoiet 1994. Pseudomonas aenrginosa selective adherence to and entry into

human endothelial cells, Infectlmmun. 625456-5463.

1 90

2 . Ponnuswamy, P. K., and M. M. Gromiha. 1993. Prediction of

transmem b rane helices from hydrophobic characteristics of proteins. I nt J.

Peptide Protein Res. 42:326-341.

113. Porter, S. C., A K. North, A. 6. Wedel, and S. Kutsu. 1993.

Oligornerkation of NtrC at the ginA enhancer is required for transcriptional

activation, Genes Dev, 7:2258-2273.

114. Pratt, L. Am, and 1. J. Silhavy. 1995. Porin regulation of Escherfchia colf.,

p:105-127. in two-component signal transdudon, J. A. Hoch and T. J. Silhavy

(ed.), ASM Press. Washington, D. C.

115. Prinz, W. Am, D. H. Boyd, M. Ehnnann, and J. Beckwith. 1998. The

protein translocation apparatus contributes to determining the topology of an

integral membrane protein in Escherichia coli. J. Biol. Chem. 273:8419-8424.

1t6. Pugsley, A. P. 1993. The complete general secretory pathway in gram-

negative bacteria. Microbiol Rev. 57:50-108.

I ? Ramphal, R., 5. K Arora, and B. W. Ritchings. 1996. Recognition of

mucin by the adhesin-flagellar system of Pseudomonas aeruginosa. Am. J.

Respir. Crit Care Med. 154:S170S174.

11L Ramphal, Re, C. Guay, and 0. B. Pier. 1987. Pseudomonas aenrginosa

adhesins for tracheobronchia[ mucin. Infect Immun, 55:600-603.

119. Ramphal, R., L. Koq K. S. bhimoto, P. A. Totten, J. C. Lam, and S.

Lory. 1991. Adhesion of Pse~~domonas aemgimsa pilhdeficient mutants to

mucin. Infect Immun. 59:1307-'I 31 I,

191

120. Ramphai, R., J. C. Sadoff, M. Pyle, and J. D. Silipigni. 1984. Role of pili

in the adherence of Pseudomonas aemginosa to injured tracheal epithelium.

Infect. Immun, 44~38-40.

2 Reithmeier, R. A. 1995. Characterization and modeling of membrane

proteins using sequence analysis. Curr Opin Struct Biol. 549 1-500.

122. Roy, C. R, and R. R. Isberg. 1997. Topology of Legionella pneumophilia

DotA: an inner membrane protein required for replication in macrophages. Infect

lrnrnun. 65573-578.

123. Russel, M. 1998. Macromolecular assembly and secretion across the

bacterial cell envelope: Type II protein secretion systems. J. Mol. Biol. 279:485-

499.

124. Saier, M. J. 1994. Bacterial sensor kinasehesponse regulator systems: an

introduction. Res Microbiol. 145:349-355.

125. Saiman, L., and A. Prince. 1993. Pseudomonas aemginosa pili bind to

asialoGMl which is increased on the surface of cystic fibrosis epithelial cells. J.

Clin, invest, 92: 1875-1 880.

126. Salyets, A. A., and Dm D. Whitt. 1994. Pseudomonas aenrginosa., p:260-

270. in Bacterial pathogenesis: a molecular approach, A. A. Salyen and D. D.

Whitt (ed.), ASM Press, Washington, D.C.

127. SchaR P. J., and J. Beckwith. ? 990. Genetic analysis of protein export in

Escften'chia coli. Annu Rev Genet 24215-248.

192

128. Sheth, H. B., K. K. Lee, W. Y. Wong, G. Srivastava, 0. Hindsgaul, RD S.

Hodges, W. Pannchyth, and R f. Iwin. 1994. The pili of Pseudomonas

aenrginosa strains PAK and PA0 bind specifically to the carbohydrate sequence

beta GalNAc(l4)beta Gal found in glywsphingolipids asialo-GM1 and asialo-

GM2. Mol Microbiol. I I ~715-723.

129. Shiau, S.-P., P. Chen, and L. J. Reitzer. 1993. Effects of insertions and

deletions in glnG (ntrC) of Eschenchia coli on nitrogen regulator ldependent

DNA binding and transcriptional activation. J. Bacteriol. 1?5:190-199.

130. ShingIer, V. 1996. Signal sensing by m e p e n d e n t regulators:

derepression as a control mechanism. Mol. Microbiol. 19:409-416.

131. Simpson, D. A., R. Ramphal, and S. Lory. 1992. Genetic analysis of

Pseudomonas aeruginosa adherence: distinct genetic loci control attachment to

epithelial cells and mucins. Infect immun. 60:3771-3779.

132. Speert, D. P., B. A. &oh, D. A. Cabrol, and I. E. Safit. 1986. Nonopsonic

Phagocytosis of Nonmucoid Pseudomonas aenrginosa by Human Neutrophils

and Monocyte Derived Macrop hages Is Correlated with Bacterial Pitiation and

HydrophobicityD Infect immun. 53:207-212.

133. Spiess, M. 1995. Heads or tails-what determines the orientation of

proteins in the membrane. Febs Let 369:76-9.

I34. Stock, J. B.. A. J. NinfP, and A. M. Stock. 1989- Protein phosphorylation

and regulation of adaptive responses in bacteria. Microbiol Rev. 53:450-490.

193

135. Stock, J. B., M. G. Surette, M. Levit, and P. Park. 1995. Two-component

signal transduction systems: structu re-function relations hips and mechanisms of

catalysis., p:25-51. in Two-Component Signal Transduction, J. A. Hoch and T.

J. Silhavy (ed.), ASM Press, Washington, D.C.

136. Stone, B. J., and Y. Abu Kwaik. 1999. Natural competence for DNA

transformation by Legionella pneumophila and its association with expression of

type IV pili. J. Bacterial. t 81 :I 395-1400.

137. Strom, I. S. 1992. Analysis of determinants of pilus biogenesis in

Pseudomonas aeluginosa. Doctoral Thesis. University of Washington.

138. Strom, M. S., and S. Lory. 1993. Structure-function and biogenesis of the

type n/ pis. Annu. Rev. Microbiol. 47565-596.

139. Taha, M. Ks, B. Dupuy, W. Saun'n, M. So, and C. Marchal. 1991. Control

of pilus expression in Neisseria gonorrhoeae as an original system in the family

of t w ~ ~ ~ ~ m p o n e n t regulators. Mol Microbiol. 5:137-48.

140. Taha, M. K., Me So, He S. Seifert, E. Billyard, and C. MarchaI. 1988. Pilin

expression in Neisseria gononhoeae is under both positive and negative

transcriptional control. EMBO J. 7~4367-4378.

14f. Tang, HDr M. Kays, and A. Prince. 1995. Role of Pseudomonas

aemginosa pili in acute pulmonary infection: Infect lmmun. 63:1278-1285.

142. Taylor, 6. L., and I. B. Zhulin. f999. PAS domains: internal sensors of

oxygen. redox potential, and light Microbiol Mol Biol Rev. 63:479-506.

1 94

143. Tokishita, S., A. Kojlma, and f. Mizuno. 1992. Transmembrane signal

transduction and osmoregulation in Eschedchia coli: functional importance ofthe

transmembrane regions of the membrane-located protein kinase, EnvL J.

Biochem. 111:707-713.

244. Tokishita, S., and T. Mizuno. 1994. Transmembrane signal transduction

by the Escherichia coli osmotic sensor, EnvZ intermolecular complementation of

transmembrane signalling: Mol. Microbiol. 13:435-444.

145. Tokuda, H. 1994. Biochemical characterization of the presecretory protein

translocation machinery of Eschericha coif. FEBS Lett. 346:65-68.

146. Totten, P. Am, J. C. Lam, and S. Lory. 1 990. The rpoN gene product of

Pseudomonas aenrginosa is required for expression of diverse genes, including

the Ragellin gene. J. Bacterial. 172:389-396.

147. Traxier, B., D. Boyd, and 6. Beckwith. 2993. The Topological Analysis of

Integral Cytoplasmic Membrane Proteins. J. Membr. Biol. 132:l-11.

14%. Valent, Q A., J.-W. L. De gier, G. von Heijne, D. A. Kendall, C. M. ten

Hagen Jongman, B. Oudega, and J. Luirink. i997. Nascent membrane and

p resecretory proteins sy nthesked in Eschefichia coli associate with signal

recognition particle and trigger factor. Mol. Microbiol. 25:53-64.

149. Valent, Q. A., P. A. Scotti, S. High, JPW. L. de Gier, G. von Heijne, G.

Lentzen, W. Wintimneyer, B. Oudegr, and J. Luirink. 1998. The Escherichia

coliSRP and SecB targeting pathways converge at the translocon. EM60 J.

f E2504-2512,

150. Van Delden, C., and B. H. Iglewski. 1998. Cell-to-cell signaling and

Pseudomonas aeruginosa infections. Emerg Infect Dis- 4:552-560-

151. van der Wolk, J. P., J. G. de Wit, and A. J. Driessen. 1997. The catalytic

cycle of the Escherichia coii SecAATPase comprises Wo distinct preprotein

translocation events. EMBO 3. .16:7297-7304-

152. van Klompenburg, W., I. Nilsson, 0. von Heijne, and B. de Kruijff.

1997. Anionic phospholipids are determinants of membrane protein topology.

EM60 Jt t6~4261-4266.

153. von Heijne, 0.1986. The distribution of positively charged residues in

bacterial inner membrane proteins correlates with the trans-membrane topology.

EMBO J.5:3021-3027.

t54. von Heijne, 0.1992- Membrane Protein Structure Prediction

Hydrophobicity Analysis and the Positive-inside Rule. J. Mol. Biol. 225:487494.

155. von Heijne, 0.1994. Membrane proteins: from sequence to structure. Ann.

Rev. Biophys. Biomol. Struct 233 67-7 92,

156. von Heijne, G., and Y. Gavel. 1988. Topogenic signals in integral

membrane proteins. Eur J Biochem. 174:671-678.

157. Wall, D., and D. Kaiser. 1999. Type N pili and celi mobility. Mol. Microbial.

32~?-10.

158. Waukau, Jms and S. Forst 1999. Identification of a conserved N-terrninaI

sequence invoIved in transmembrane signal transduction in EnvZ J, BacterioI.

181 :5534-5538-

196

159. Weiss, Dm S., J. Batut. K. E m Klose, J. Keener, and S. Kustti. 1991. The

phosphocylated form of the enhancer-binding protein NTRC has an ATPase

activity that is essentiar for activation of transcription. Cell. 67: 1 55-67.

160. Weirs, V., F. Claverie-Martin, and B. Magasanik. 1992. Phosphorylation

of nitrogen regulator I of Escherichia coli induces strong cooperative binding to

DNA essential for activation of transcription. Proc Natl Acad Sci. 89:5088-5092.

161. Wickner, W., A. J. M. Driessen, and F.U. Had. 1991. The enzymology of

protein translocation across the Escherichia coli plasma membrane. Ann. Rev.

Biochem. 60:101-124-

162. Wolfe, P. B., M m Rice, and W. Wickner. 1985. EfFects of two sec genes on

protein assembly into the plasma membrane of Escherichia coli. J. Biol. Chem.

260~1836-1841.

163. Woods, D. 1987. Pathogenesis of acute and chronic Pseudomonas

aemginosa infections. Antibiot Chemother. 39: 160-1 71.

f64. Woods, D. E., O. C. Stnus, W. J. Johrnson, V. K. Berry, and J. A.

Bass. 1980. Role of pili in adherence of Pseudomonas aeruginosa to

mammalian buccal epithelial cells. Infect. Immun. 299 146-1 151.

165. Wu, S. S., and D. Kaiser. 1995. Genetic and functional evidence that Type

IV pili are required for social gliding motility in Myxococcus xanthus. Mol.

Microbio[, 18:54?-558.

t68. Wu, S. S., and 0. ffiiber. t 997. Regulation of expression of the piiA gene

in Myxococcus xanthus. J. Bacterial. f79:7748-7758.

197

167. Yaku, H., and T. Mizuno. 1997. The membrane-located osmosensory

kinase, EnvZ, that contains a leucine zipper-like motif functions as a dimer in

Escherichia coli. FEBS Let 41 7:409-42 3,

168. Yamaguchi, T., and H. Yamada. 1991. Role of mechanical injury on

airway surface in the pathogenesis of Pseudomonas aenrginosa. Am. Rev.

Respir. Dis. 144:114?-1152.

169. Yamane, Km, Y. Akiyama, K. lto, and S. Mizushima. 1990. A positiveIy

charged region is a determinant of the orientation of cytoplasmic membrane

proteins in Eschedchia coli. J. Biol. Chem. 265:21166-21171.

170. Yamane, K., and S. Mizushima. 1988. Introduction of basic amino acid

residues atter the signal peptide inhibits protein translocation across the

cytoplasmic membrane of Escherichia coli. Relation to the orientation of

membrane proteins. J Biol Chem. 263:19690-19696.

If I. Yang, Y., and Me Inouye. 1991. lntennolecular complementation between

Wo defective mutant signal-transducing receptors of Escherichia coii. Proc. Naff.

Acad. Sci. USA, 88:f i 057-1 1061.

172. Zimmann, P., W. Puppe, and K. Altendorf. 1995. Membrane topology

analysis of the sensor kinase KdpD of Esche~chia coli. J Biol Chem. 270:28282-

28288,