42

Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Embed Size (px)

Citation preview

Page 1: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website
Page 2: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website
Page 3: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Chemical Detective websiteChemical Detective website

The Chemical Detective program is made up of:

*a forensic science website

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm* a CD ROM of forensic science teaching resourcesAim:Aim: to encourage the study of molecular and

physical science. It presents science in an enthusiastic and interesting format with

reference to the ‘real world’ so as to encourage Victorian students to continue their

science education into VCE and beyond.

Page 4: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

For more information contact the Programme Coordinator, Dr Simon Lewis at;

School of Biological & Chemical SciencesDeakin University, Geelong

VIC 3217, Australia +61 3 52271365       +61 3 52271040

  [email protected]

For more information contact the Programme Coordinator, Dr Simon Lewis at;

School of Biological & Chemical SciencesDeakin University, Geelong

VIC 3217, Australia +61 3 52271365       +61 3 52271040

  [email protected]

Chemical Detective Chemical Detective websitewebsite

Page 5: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Crime Solving Identification

Evidence Ballistics

Fingerprints Law

Chemical analysis Anatomy

Page 6: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

What activities are already being done in class that

can be related to forensic science?

Chromatography

Flame Test

Microscopy

DNA

Blood test

(theory)

Invisible Ink

Page 7: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Example of an aspect of forensic science: Example of an aspect of forensic science:

Blood StainsBlood StainsIs the sample blood?

What is the pattern of the blood stain?

Fe in haemoglobin catalyses Fe in haemoglobin catalyses reaction of luminol to produce reaction of luminol to produce blue light.blue light.

Other things can act as a catalyst Other things can act as a catalyst but blood gives a steady glow.but blood gives a steady glow.

Even after washing or with time, Even after washing or with time, blood still glows.blood still glows.

Hand out

Experiment

Safety!!!Safety!!!

Page 8: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Chemical NotesChemical Notes

• exothermic reactions

• reaction kinetics (changing conditions)

• effect of temperature

Luminol costs ~$15 per kit at toy shops.

Page 9: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

FingerprintingFingerprinting

Types of PrintsTypes of Prints

* Dusting

* Fuming - iodine crystals

Do experiment

SAFETY!What Science ??

Crystals subliming

Works best with greasy fingerprints: Child’s fingerprints have shorter fatty acid chains and evaporate quicker compared with adults (iodine attaches to fatty acids and stains it)

Genetics - different patterns of fingerprints

Page 10: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Fingerprinting…Fingerprinting…contdcontd

Compare with other methods of identification of fingerprints:

Luminescent fingerprints - use ninhydrin for staining amino acids (good for old documents but stains

very badly)

Superglue fuming - fluorescent dye (light source, developed at ANU)

Click here for Click here for

more infomore info

Page 11: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Relate to CSFRelate to CSF

Physical and Chemical Science Level 6

change of state

spectrum of light

atomic structure, exciting of electrons

chemiluminescence - light sticks

Biological Science

sweat glands, inheritance of fingerprints

DNA typing

Page 12: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

CareersCareers

Page 13: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website
Page 14: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

What is Forensic Science?

What is Forensic Science?

The application of scientific knowledge to solve legal problems Burglary Environmental protection International arms control

Examination and presentation of scientific evidence to solve crimes

Not a new way of science. Applied science.

The application of scientific knowledge to solve legal problems Burglary Environmental protection International arms control

Examination and presentation of scientific evidence to solve crimes

Not a new way of science. Applied science.

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 15: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

When is Forensic Science Needed?When is Forensic Science Needed?

Police officer arrives at a possible crime scene

Questions to be answered: Has a crime been committed? Who did it? If there is a suspect, can you prove

they did it?

Police officer arrives at a possible crime scene

Questions to be answered: Has a crime been committed? Who did it? If there is a suspect, can you prove

they did it?

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 16: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

The Forensic ScientistThe Forensic Scientist

The forensic scientist has a three  main duties; Examination of physical evidence Reporting on the results

of a forensic examination • investigation in tracing an offender• presentation of a case to a court

present verbal evidence in court (expert testimony)

The forensic scientist has a three  main duties; Examination of physical evidence Reporting on the results

of a forensic examination • investigation in tracing an offender• presentation of a case to a court

present verbal evidence in court (expert testimony)

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 17: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

The Crime SceneThe Crime Scene

A body has been found, a house has been burgled, a car has been broken into

Forensic science begins at the scene recognition of important physical evidence preservation of evidence

No amount of high tech instrumentation or expertise will recover a botched crime

scene investigation

A body has been found, a house has been burgled, a car has been broken into

Forensic science begins at the scene recognition of important physical evidence preservation of evidence

No amount of high tech instrumentation or expertise will recover a botched crime

scene investigation

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 18: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Physical EvidencePhysical Evidence

"any and all objects that can establish that a crime has been committed or can

provide a link between a crime and its victim or a crime and its perpetrator“

Saferstein, Criminalistics (6th Edition) Chain of custody or continuity of

evidence Crime scene to the laboratory to the lab

report to the courtroom. If the chain is broken, the forensic

investigation may be fatally compromised

"any and all objects that can establish that a crime has been committed or can

provide a link between a crime and its victim or a crime and its perpetrator“

Saferstein, Criminalistics (6th Edition) Chain of custody or continuity of

evidence Crime scene to the laboratory to the lab

report to the courtroom. If the chain is broken, the forensic

investigation may be fatally compromised

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 19: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Forensic DisciplinesForensic Disciplines

Forensic science today is increasingly multidisciplinary

pathologists, chemists, toxicologists, biologists, entomologists, anthropologists, dentists, document examiners, ballistics expert, engineers........

Forensic science today is increasingly multidisciplinary

pathologists, chemists, toxicologists, biologists, entomologists, anthropologists, dentists, document examiners, ballistics expert, engineers........

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 20: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website
Page 21: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

What is DNA?What is DNA?

Biopolymer responsible for; passing on genetic information Biochemistry of the body

It is made up of a sequence ofunits based on four chemicals; adenine (A), cytosine (C),

guanine (G) and thymine (T)

Biopolymer responsible for; passing on genetic information Biochemistry of the body

It is made up of a sequence ofunits based on four chemicals; adenine (A), cytosine (C),

guanine (G) and thymine (T)

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 22: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

DNA StructureDNA Structure

Double strandforms when unitsmatch up to formpairs; G with C

T with A

Double strandforms when unitsmatch up to formpairs; G with C

T with A

C

A

T

T

A

A

T

G

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 23: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

DNA and IndividualityDNA and Individuality

The DNA of a person is individual and can be shown to be theirs beyond reasonable doubt

How?

Because DNA has PATTERNS that can be identified using modern techniques

The DNA of a person is individual and can be shown to be theirs beyond reasonable doubt

How?

Because DNA has PATTERNS that can be identified using modern techniques

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 24: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Sir Alec JeffriesSir Alec Jeffries

The first application of DNA typing to forensic science Dr Alec Jeffries (Leicester University) Called in by police to apply his new

technique of "DNA fingerprinting" to help solve two murders in Leicestershire

Cleared an innocent man

The first application of DNA typing to forensic science Dr Alec Jeffries (Leicester University) Called in by police to apply his new

technique of "DNA fingerprinting" to help solve two murders in Leicestershire

Cleared an innocent man

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 25: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

RFLP DNA TypingRFLP DNA TypingExtractionExtraction of the DNA from the sample;blood, saliva, semen Production of Restriction FragmentsPurified DNA is then cut into fragmentsby RESTRICTION ENZYMES

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 26: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Patterns in DNAPatterns in DNA

Because there are only 4 nucleic acids, patterns occur in the DNA

Take the pattern GCGC Imagine it occurs more than once in the DNA Number of times it occurs is unique to the

individual

Using restriction enzymes we can chop the DNA into two at every place where the GCGC pattern occurs

Because there are only 4 nucleic acids, patterns occur in the DNA

Take the pattern GCGC Imagine it occurs more than once in the DNA Number of times it occurs is unique to the

individual

Using restriction enzymes we can chop the DNA into two at every place where the GCGC pattern occurs

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 27: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Patterns in DNAPatterns in DNA

Person 1; 5' GCGCATGTTGCGCAAGAGCGC 3'

Person 2; 5' GCGCATGAAGGCAATGAGCGC 3'

Person 1 - 2 large fragments; 5' G.....CGCATGTTG.....CGCAAGAG.....CGC 3'

Person 2 - 1 large fragment; 5' G.....CGCATGAAGGCAATGAG.....CGC 3'

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 28: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Gel ElectrophoresisGel Electrophoresis

22

11

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 29: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

VisualisationVisualisation

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 30: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

IdentificationIdentification

Parents and children Suspects at the scene of crime Populations of wildlife species for

conservation and environmental protection

Parents and children Suspects at the scene of crime Populations of wildlife species for

conservation and environmental protection

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 31: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

DNA Typing TodayDNA Typing Today

Modern forensic DNA typing based on polymerase chain reaction

DNA polymerases enzymes involved in the process of

DNA replication Analysis of minute traces of DNA

found at a crime scene

Modern forensic DNA typing based on polymerase chain reaction

DNA polymerases enzymes involved in the process of

DNA replication Analysis of minute traces of DNA

found at a crime scene

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 32: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website
Page 33: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

FingerprintsFingerprints

Main method of identifying criminals Sweat and oils secreted by glands in

the dermis of the skin Tiny ridges of skin on a finger make a

pattern Each fingerprint is unique Even identical twins do not

have the same fingerprints

Main method of identifying criminals Sweat and oils secreted by glands in

the dermis of the skin Tiny ridges of skin on a finger make a

pattern Each fingerprint is unique Even identical twins do not

have the same fingerprints

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 34: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

HistoryHistory Ancient History

ancient Chinese and Babylonian civilisations legal documents

Sir Francis Galton (1892) classification of fingerprints.

Sir Edward Henry (1897) modified classification system adopted by

Scotland Yard in 1901

FBI (1930) National fingerprint file set up in USA

Ancient History ancient Chinese and Babylonian civilisations legal documents

Sir Francis Galton (1892) classification of fingerprints.

Sir Edward Henry (1897) modified classification system adopted by

Scotland Yard in 1901

FBI (1930) National fingerprint file set up in USA

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 35: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Fingerprinting TodayFingerprinting Today

Dusting for prints fine powder that adheres to the traces of

oil and sweat.

Dusting is unsuitable for porous surfaces like paper or cloth another

Chemical treatments are used; iodine fuming ninhydrin superglue fuming

Dusting for prints fine powder that adheres to the traces of

oil and sweat.

Dusting is unsuitable for porous surfaces like paper or cloth another

Chemical treatments are used; iodine fuming ninhydrin superglue fuming

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 36: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

AFISAFIS

FBI, Metropolitan Police in London (UK)

vast collectionsof fingerprints

making a match Automated

fingerprint identification systems (AFIS)

FBI, Metropolitan Police in London (UK)

vast collectionsof fingerprints

making a match Automated

fingerprint identification systems (AFIS)

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 37: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Lasers and FingerprintsLasers and Fingerprints

sample

laser

fibre optic

observer

filter

sample

laser

fibre optic

observer

filter

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/index.htm

Page 39: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/Luminol_test.htm

Page 40: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

BloodstainsBloodstains Bloodstains at the scene of a crime;

occurrence of a blood stain in acertain place,

shape, position, size or intensityof a bloodstain

blood typing analysis

Important to be able to; identify a particular stain as

blood or not reveal "hidden" bloodstains

Bloodstains at the scene of a crime; occurrence of a blood stain in a

certain place, shape, position, size or intensity

of a bloodstain blood typing analysis

Important to be able to; identify a particular stain as

blood or not reveal "hidden" bloodstains

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/Luminol_test.htm

Page 41: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

The Luminol TestThe Luminol Test Haemoglobin

red pigment transports oxygen

around the body

Luminol Test

chemiluminescent reaction of the luminol reagent with the iron in the haemoglobin

Haemoglobin red pigment transports oxygen

around the body

Luminol Test

chemiluminescent reaction of the luminol reagent with the iron in the haemoglobin

http://bcs.deakin.edu.au/bcs_courses/forensic/Chemical%20Detective/Luminol_test.htm

Page 42: Chemical Detective website The Chemical Detective program is made up of: *a forensic science website

Career OpportunitiesCareer Opportunities

Forensic Industry Insurance claim investigation Risk assessment industry Government agencies Industry

chemical food pharmaceutical health

Forensic Industry Insurance claim investigation Risk assessment industry Government agencies Industry

chemical food pharmaceutical health