[CANCER RESEARCH55, 4717—4721,October 15, 19951

ABSTRACT

To search for genes related to hepatocarcinogenesis, the differentialdisplay technique for eukaryotic mRNA was conducted. We have cloneda gene that encodes the CD24 protein from the eDNA library of humanhepatocellular carcinoma (11CC). A single 2.1-kb mRNA was identified inHCC specimens and the HuH-7 HCC cell line but only rarely in smallamounts In nontumor livers. In 79 unicentric HCC, CD24 mRNA wasoverexpressed In 52 cases (66%), found in trace amounts in 11, and notdetectable in 16 (20%). In 12 cases ofmulticentric HCC, CD24 mRNA wasoverexpressed in 21 (68%) of 31 tumor nodules and was helpful for thedetermination of tumor clonal origin. There was an increased frequency ofCD24 mRNA overexpression In patients younger than 50 years with HCC(86%versus59%,P<0.025),inserumhepatitisBsurfaceantigen-positiveindividuals(74% versus48%, P < 0.023),in those with an elevatedseruma-fetoprotein level (82% versus 56%, P < 0.04), and in HCC with a-fetoprotein mRNA expression (82% versus 56%, P < 0.04). There was a strongcorrelation of CD24 mRNA overexpression with p53 gene mutation inHCC (91% versus46%, P < 0.0005) and poorly differentiated HCC (82%versus 53%, P < 0.008). Despite its correlation with p53 mutation and the

unfavorable outcome of HCC with p53 mutation, the CD24 mRNA expression did not correlate with tumor size, tumor invasiveness, or patient's prognosis. Thus, the CD24 gene expression appears to be a commonevent in HCC and may serve as an early but not prognostic biomarker formalignant transformation of hepatocytes.

INTRODUCTION

HCC3 is one of the most common cancers in Asia and Africa (1)and has been linked to chronic hepatitis B virus infection (2). Despiteenormous efforts, the mechanism of human hepatocarcinogenesisremains largely unknown. During the multistep carcinogenesis ofhuman cancers, multiple genetic abnormalities accumulate. Theseinclude activation of oncogenes and genes related to cell growth andinactivation of tumor suppressor genes (3, 4). These critical genes aredifferentially expressed in tumor and nontumor tissues and can bedetected by a variety of techniques. The differential display of eukaryotic mRNA technique first described by Liang and Pardee (5) hasbeen proved to be one of the most powerful methods (6). To betterunderstand the nature of human hepatocarcinogenesis, we used thissensitive technique to study the genes that were differentially expressed in human HCC. Among the first series of genes identified andcloned, we found that CD24 gene was often overexpressed in HCCcells.

The human CD24 antigen is a glycoprotein composed of a shortpeptide core of only 31 to 35 amino acids with a very high carbohydrate content (7). The antigen is present on the cell membrane ofimmature B cells (8, 9) and can modulate the cellular response to

Received 5/4/95; accepted 8/15/95.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18U.S.C.Section1734solelyto indicatethisfact.

I This work was supported in part by grants from the National Science Council of the

Republic of China (NSC83—0419-B-002—316).2 To whom requests for reprints should be addressed.

3 The abbreviations used are: HCC, hepatocellular carcinoma; GPI, glycosyl phos

phatidylinositol; HBsAg, hepatitis B surface antigen; AFP, a-fetoprotein.

signal activation (10, 11). The CD24 gene changes in expressionduring the maturation process of B cells and is not detected on plasmacells (1 1). The CD24 cDNA has been cloned on the basis of its geneticsimilarity to the murine heat-stable antigen (12), but the cDNAsequence is incomplete. The mature peptide backbone of CD24 is onlyabout 3 kDa (13) and is extensively N- and O-glycosylated. This leadsprotein to an apparent molecular mass of 35—70kDa on SDS-PAGE(7). The CD24 protein is anchored on the plasma membrane via a GPI

tail (7, 12, 14), which is added to the protein following cleavage ofsignal peptide and GPI-displaced tail (12, 15). GPI is complexed toprotein tyrosine kinases, and cross-linking of CD24 may lead totyrosine phosphorylation of several cellular proteins (16).

In addition to B cells, CD24 is also known to be a developmentallyregulatedantigenin kidney(17, 18), in developingbrain(13), andinhuman regenerating muscle (19) and may serve as a cell adhesionmolecule (20). Recently, CD24 has been shown to be constantlyexpressed in Wilms' tumor (17), small cell lung carcinomas (21), andin nasopharyngeal carcinoma cells (22), but little is known of itsbiological significance in human cancers. In this study, we firstreported the full-length CD24 cDNA sequence cloned from humanHCC. And CD24 mRNA overexpression was common in HCC cellsthat correlated p53 mutation and tumor differentiation.

MATERIALS AND METHODS

Subjects. From 1986 to 1992, 320 patients from National Taiwan University Hospital with resected, pathologically proved, primary HCC were enrolled

in the study. For differential display analysis, we selected 20 paired tumor andnontumor liver RNA samples in which the p.53 gene had been completelysequenced (23). To elucidate the biological significance of any gene cloned,we randomly selected 79 HCC patients (64 men and 15 women; from 14 to 80years) for further study based on the previously described follow-up criteria(23). HBsAg was detected in 54 patients (68.4%), and 4 were also positive foranti-HCV. In the other 25 HBsAg-seronegative cases, 13 were positive foranti-HCV, 3 were negative, and 9 were not examined. Tumor size was equal

or smaller than 5 cm (small HCC) in 42 patients and larger than 5 cm (large

HCC) in 37. Another 12 cases with multicentric HCC were also studied.Histological Study. The tumor differentiation was classified according to

Edmondson (24), with slight modification (25, 26), into two groups: welldifferentiated HCC (grades I and II); and poorly-differentiated HCC (grades IIIand IV). According to tumor invasiveness, HCC was divided into noninvasiveand invasive HCC (27, 28).

Differential Display. Total cellular RNA was extracted from 0.2—1g ofpaired tumor and nontumor livers as described previously (29). Modifieddifferential display was performed as described (5, 30). Briefly, 2 pg RNAwere reverse-transcribedwith 300 units of MMLV reverse transcriptase (BRL,Bethesda, MD) in the presence of 2.5 p.M of TI1CA (5'- lTl'l'iFl'lTi ICA

3') asanchoredprimer, 20 ,xMdeoxynucleotidetriphosphate,10 mM DTT, andreverse transcription buffer for 60 mm at 35°C. PCR was performed in solution

containing 0.1 volume of reverse transcription reaction mixture, 2.5 @MTi 1CA, 0.5 @.LMrandom primer (5'-CTACATGGGA-3'), 1X PCR buffer, 2@LMeach dGTP, dTFP, and dCTP, 10 @Ci [a-35S]dATP, and 1 unit DNA

polymerase. The PCR procedure was performed for 40 cycles at 94°C for 30

5, 37°C for 1 mm, 72°C for 30 s, and finally 5 mm for elongation at 72°C. After

adding loading buffer to the reaction, the PCR products were heated at 70°C

4717

Cloning and Expression of CD24 Gene in Human Hepatocellular Carcinoma:

A Potential Early Tumor Marker Gene Correlates with p53 Mutation and

Tumor Differentiation'

Lan-Ru Huang and Hey-Chi Hsu2

Department of Pathology, College of Medicine. National Taiwan University, Taipei 100, Taiwan

Research. on January 22, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

I

CD24 GENE EXPRESSION IN HCC

for 10 mm and then loaded on 6% polyacrylamide sequencing gels forelectrophoresis. The gels were exposed to Kodak XAR-5 film for 48 h.

Band Recovery, Amplification, Cloning, and Sequencing. Bandsshowing differential expression were cut out from the dried gel, and the cDNA was

eluted by boiling in 40 p1 H,O for 10 mm. The cDNA was recovered by

ethanol precipitation in the presence of 0.3 M NaOAC and 5 pA 10 mg/mIglycogen as carrier and redissolved in 10 pA of H2O. Four p.1of eluted cDNAwere reamplified in a reaction volume of 50 pJ for 40 cycles under the same

condition as described, but deoxynucleotide triphosphate concentration was 20

@LM,and no radioisotope was used. Reamplified PCR product was cloned into

pCR-Script SK(+) vector (Stratagene, La Jolla, CA). The insert was sequencedon both strands with T3 and T7 primers by using SequiTherm cycle sequencingkit (Epicentre Technologies, Madison, WI).

Northern Blot Analysis. Northern hybridization was carried out as de

scribed (31). The isolated clone from differential display was amplified by

PCR incorporatedwith [a-32P]dCFPin the presence of 2.5 p@MTi 1CA,0.5 p@M5'-CTACATGGGA-3', 1 X PCR buffer, i unit DNA polymerase, and 150 @M

dGTP, dATP, and dTTP. The PCR product was used as a probe for Northernblot analysis and cDNA screening. The intensity of the positive signal in

Northern blot analysis was graded as —, trace, and + 1 to +5.eDNA Construction and Screening. Poly(A)@mRNA was selected from

HCC by Oligotex-dT (Qiagen, Chatworth, Germany). Double-stranded cDNAwas synthesized and cloned into Uni-ZAP XR vector using ZAP-cDNAsynthesis kit (Stratagene). Approximately 2 X 106 phages were screened.

Phage DNA was blotted onto Hybond-N nylon membrane (Amersham, Buckinghamshire, England), hybridized, and washed under a standard stringent

condition. Positive plaques were selected for in vivo excision to generate the

pBluescript phagemid from Uni-ZAP vector following the manufacturer'srecommendation. Insert was sequenced with T3 and T7 primers.

Statistics. Statisticalanalysis was performedby Fisher's exact test. Theoverall survival among all patients was estimated with the method of Kaplanand Meier, and differences between the curves were tested using a statisticalpackage (BMDP Statistical Software, Inc., Los Angeles, CA). P < 0.05 was

considered significant.

RESULTS

Differential Display and Northern Blot Analysis. On the differential display of mRNA in paired tumor and nontumor livers, eachprimer set revealed 100—200bands on the polyacrylamide gel. Asshown in Fig. 1, three candidate bands, which were preferentiallyoverexpressed in HCC specimens, were eluted, amplified, and sequenced. Among them, clone 236, which had a sequence 80% identical to part of the mouse CD24 cDNA (Fig. 2) and could hybridize a2.1-kb mRNA in total cellular RNA from HCC, was selected forfurther analysis (Fig. 3).

10 20 30TCACATGGGAACAAACAGATCGAACAGTTTTGA

111111111 liii liii IIAGAGTCA@TCTCCATCT@AGAAACCTTCCTGGGAAGAAGGAGAGCTCACAGACCCGA

1530 1540 1550 1560 1570 1580

40 50 60 70 80 90AGCTACTGTGTGTGTGGGTG@CACTCT1@GCTTTAT1@CCAGAATGCTGTACATCTATIIIII@IIIIIIlIIIIIII I 11111111

AGCTAcGAATGAACACTCCCCTI'GCCTCACACCTGAATGC@TACATCTAT1590 1600 1610 1620 1630 1640

100 110 120 130 140T1WGGATTGTATATTGTGTITGTGTATTTACGCTTTG&T1@CATAGTAACTTC

II IIIIIIIIIIIIIIIIIIIIIIIIIIIJIIIIIIIIIIJIIIIIII IIIrr- -GATTGTAAATTGTGTTTGTGTATTTATGCTTTGATTCATAGTAACTTCTCATGTTA

1650 1660 1670 1680 1690

150 160 170 180 190 200TGGAAT@G AT1@GAACACAAACTGTAAATAAATCCTCTCTGCTGAAAAAAAAAAAI I I I I I I I@ I I I@@ I I I I I@ I@@ I I I I@ I@ ITGGAAT1'GATTTGCArrGAACACAA.ACTGTAAATAAAAGAAAGA.AATGGCGGAAAAA1700 1710 1720 1730 1740 1750

Fig. 2. Nucleotide sequence of the clone 236. Numbering indicates the sequence of theclone 236 (boldface) and murine CD24 cDNA. The sequence of the clone 236 is 79.9%identity in the 187-bp overlap with the eDNA sequence of murine CD24.

@:[@T Tt;T;T@:ThFig. 3. Northern blot analysis of CD24 mRNA in six representative HCC. The CD24

mRNA is overexpressed in HCC (H) with one exception (case 5) but is trace orundetectable in nontumor livers (L). The HuH7 HCC cell line also expresses CD24mRNA. The 285 ribosomal RNA is internal control for RNA loading.

1812 cccgaagtct tttgtttgta tggtcacaca ctgatgctta gatgttccag

1862 taatctaata tggccacagt agtcttgatg accaaagtcc tttttttcca

1912 tctttagaaa aCTACAT000 AACAAACAGA TCGAACAGTT TTGAAGCThC

1 962 TGTGTGTGTG AATGAACACT CTTGCTrTAT TCCAGAATGC TGTACATCTA

2 0 12 TITrGGATrG TATA@1'GTGG @TGTGTA@Tr ACGCTI'TGAT TCATAGTAAC

2 062 @CTTATGGAATI'GATTrGC ATI'GAACGAC AAACTGTAAA TAAAAAGAAA

2 112 CGGTGAAAAA AAAAA

Fig. 4. The additional 3-flanking sequence of CD24 cDNA cloned from the HCCcDNA library. Numbering indicates the 3' end of CD24 cDNA sequence from 1812 to2127 bp. The primers used in the differential display are underlined. Capital letters, thesequence of clone 236. Polyadenylation signal is indicated by boldface. The nucleotidesequence has been submitted to GenBank (accession no. L33930).

Sequence of Human CD24 cDNA from HCC. HCC cDNA library was screened with the clone 236 as a probe. A 2127-bp clonewas isolated and sequenced. The 181 1 bp in the 5' end had 100%identity with human CD24 cDNA. However, the new CD24 clone hadadditional 306 bp containing polyadenylation signal at the 3' regionwhere clone 236 located (Fig. 4). The nucleotide sequence of the 3'region has been submitted to GenBank (accession no. L33930).

Detection of CD24 mRNA in HCC, Normal Liver, and HCCCell Lines. A 2.1-kb mRNA band was detected by Northern hybridization in HCC specimens and the HuH7 HCC cell line but infrequently in the nontumor liver (Fig. 3). Among 79 unicentric HCC

case1 2 3 4 5 6

HuH7H I H I HL HI H I HI

18S-?@ • ..@ S

CASE A B C D E

F@ I—@ I1@1I

H1H2 LHLH1H2 LHLH1H2 L

Fig. 1. Differential display of total cellular RNA from five representative paired tumor(H) and nontumor livers (L). Arrowhead, three candidate cDNA tags that appear to bedifferentially expressed.

4718

@.

@i14mr

Research. on January 22, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

Table 1 Correlation of CD24RNA expression in 79 primaclinical featuresrv

unifocal HCCwithFeatures―CD24

mRNAoverexpression +(%)PAge

(yrs)@50 n=21

>50 n = 5818(86) 34(59)<0.025HBsAg

+ n=54

— n = 2540(74) 12(48)<0.023Serum

AFP level (ng/ml)320 n=39

<320 n = 4030(77) 22(55)<t).()4AFP

mRNA in HCC+ n=27

— n = 3422(82)19(56)<0.()4p53

mutation in HCC+ n=23

— n = 3721(91) 17(46)<0(1005Tumor

size@5cm n = 42

>5 cm n = 3726(62) 26 (70)NotsignificantTumor

gradeI—Il n=45IIl—IV n = 3424(53) 28 (82)<0(108

CD24 GENE EXPRESSION IN HCC

transcripts reported in small lung cell carcinomas (21), in bone marrow cells, and in a neuroblastoma cell line (12). In contrast, a weak4.8-kb band was detected in some of nontumor livers but not in HCC.This is likely because CD24 might be a multigene family (33). TheCD24 mRNA was overexpressed in 52 (66%) of 79 unicentric HCCand in 21 (68%) of 31 tumor nodules taken from 12 patients withmulticentric HCC. The mechanism for CD24 mRNA overexpressionis not clear, but it is not related to DNA amplification and demethylation (data not shown). Our findings suggest that CD24 mRNAoverexpression is a common event in human HCC and may play animportant role in hepatocarcinogenesis. Thus far, the expression ofCD24 on human HCC and HCC cell lines has not been reported in theliterature. The differential expression of CD24 mRNA among thetumors in multicentric HCC may help to determine the clonal originof the tumors.

The CD24 gene is expressed in a variety of developing or precursorcells in which a loss of CD24 expression precedes differentiation (1 1).These include lymphoid/myeloid cells (34, 35), brain (13, 18, 36, 37),kidney (38), and human regenerating muscle (19). The CD24 mRNAis overexpressed in human HCC, neuroblastomas (12), Wilms' tumors(17), small cell lung carcinomas (21), and nasopharyngeal carcinomas(22). This suggests that CD24 may serve as an oncodevelopmental

tumor biomarker in a wider variety of human cancers than perceivedpreviously and warrants more extensive study to clarify its role in thepathogenesis of human cancers. In this study, CD24 mRNA wasoverexpressed more often in poorly differentiated HCC (82% versus53%, P < 0.008), and there was a positive correlation of CD24 mRNAexpression with AFP mRNA (82% versus 56%, P < 0,04). Thesefindings confirm our observation that AFP mRNA expression in HCCis associated with poor tumor differentiation (31). The p53 mutationin HCC was strongly associated with CD24 mRNA overexpression(91% versus 46%, P < 0.0005), and invasive small HCC with p53mutation had a more unfavorable outcome (1-year survival; 50%versus 92%, P < 0.03). This confirms our observation that p53 genemutation is associated with tumor progression of HCC (23, 26). In

CASE1 2 3H L H L H L

specimens, 52 cases (66%) had increased CD24 mRNA, while 11cases had trace amount and 16 cases were negative. On prolongedexposure, a weak 4.8-kb band was detected in some of the nontumorlivers but not in HCC (Fig. 5).

Correlation of CD24 mRNA Expression with Clinical andHistopathological Features in Unicentric HCC. The overexpression of CD24 mRNA in HCC was more commonly encountered inpatients younger than 50 years (86% versus 59%, P < 0.025), inHBsAg-seropositive individuals (74% versus 48%, P < 0.023), and inthose with elevated serum AFP level above 320 ng/ml (77% versus55%, P < 0.04; Table 1).

The poorly differentiated HCC had a higher frequency of CD24mRNA overexpression than well-differentiated HCC (82% versus53%, P < 0.008; Table 1). The expression of CD24 mRNA did notcorrelate with tumor size and tumor invasiveness (Table 1).

Correlation of CD24 mRNA Expression with AFP Gene Expression and p53 Gene Mutation in HCC and Patient Outcome.HCC with p53 gene mutations was strongly associated with CD24overexpression (91% versus 46%, P < 0.0005; Table 1). HCC expressing AFP mRNA also had a higher frequency of CD24 mRNAoverexpression (82% versus 56%, P < 0.04).

Among invasive small HCC, the 1-year survival was lower in thosewith p53 gene mutation (50% or 4 of 8) than those without (92% or12 of 13), while the CD24 mRNA expression did not correlate withpatient prognosis.

Differential Expression of CD24 mRNA in Multicentric HCC.Among 12 cases of multicentric HCC (32), 31 tumor nodules wereexamined. A differential expression of CD24 mRNA was detectedamong the different tumor nodules of the same individuals in sevencases (Table 2). The CD24 mRNA expression did not correlate withsize of the tumor nodules.

DISCUSSION

Using differential display for eukaryotic mRNA by PCR (5), wehad successfully cloned a full-length cDNA encoding CD24 in humanHCC. The new CD24 clone was 306 bp longer than that reportedpreviously (12) and had the polyadenylation signal at the 3' region.The CD24 mRNA appeared as a single transcript of 2.1 kb in HCC

specimens and the HuH-7 HCC cell line. We did not detect small

28S-

Fig. 5. Expression of CD24 mRNA in three representative paired hepatocellularcarcinomas. The 2.1-kb CD24 mRNA (lower arrow) is overexpressed in tumor liver (H)compared with normal liver (L). A longer mRNA (upper arrow) is detected in normallivers. The amount of RNA loaded is equal.

Tumor invasion+ n=62 43(69)

_:_ n = 17@ Not significant

a@ positive;—,negative;n, numberof cases;gradesI—Il,well-differentiatedHCC;grades III—IV,poorly differentiated HCC.

4719

i@ = @. °l@

Research. on January 22, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

(V)-V (¡INI: tXPRESSION IN HCC

Table 2 CD24 mRNA expression in multicenlric HCC

Caseno.123456789III1112No.oftumors224232233323•n*+S-*+4&+2+

1*t"+4f-¿t*-d-CD24

mRNAT2_+2+3'+1+4**+2"*_+3'+2'-Ia+4expression"T3

T4+3

+3+2*+3"+4'+1+1Tl_NDND_+__+_NDAFP

mRNA'T2

T3T4_ND+

++ND+

ND_+-+

ND-ND

ND" Intensity of CD24 mRNA expression: -, negative; t, trace; +1 to +5, intensity of positive signal.'' Individual tumor nodule is indicated as Tl to T4.' AFP mRNA expression in HCC: +, positive; -, negative; ND, not examined.

p53 gene not mutated.' p53 gene mutated.

contrast, the CD24 mRNA expression did not correlate with tumorsize, tumor invasiveness, and patient outcome. CD24 gene overex-

pression may serve as a potential early tumor biomarker, while p53mutation is an unfavorable molecular prognostic marker for HCC. Themechanisms for the correlation of CD24 expression with p53 mutationare unknown. However, we found that p53 mutation in HCC wasassociated with aberrant mRNA expressions of several cellular genesin human HCC. These include mRNA overexpression of transcrip-tional factor E2F-1 and cyclins A and E4 and suppressed dehydroepi-androsterone sulfotransferase mRNA expression.5 We speculate that

the overexpression of CD24 may be part of this spectrum of dysfunction of cellular genes in relation to the deregulation of cell growthcontrol due to the loss of wild-type p53 function. Further studies will

be necessary to identify the promoter sequence and DNA bindingproteins for the CD24 gene to clarify its function. Studies are alsoneeded to delineate precisely the temporal expression of CD24 duringtumor growth and the potential for early detection of HCC. In thisstudy of 31 tumor nodules taken from 12 cases with multicentricHCC, we observed a differential expression of CD24 mRNA amongthe different tumor nodules of the same individual in seven cases(58%). These findings suggest that CD24 mRNA expression in combination with AFP mRNA expression, p53 gene mutation, and hepatitis B virus DNA integration pattern may be helpful for the determination of clonal origin in multicentric HCC (31, 32).

REFERENCES

1. Editorial. Hepatocellular cancer: Differences between high and low incidence regions[Review]. Lancet. 2: 1183-1184, 1987.

2. Beasley, R. P. Hepatitis B virus: the major etiology of hepatocellular carcinoma.Cancer (Phila.), 61: 1942-1956, 1988.

3. Sager, R. Tumor suppressor genes: the puzzle and the promise. Science (WashingtonDC), 246: 1406-1412, 1989.

4. Aaronson. S. A. Growth factors and cancer. Science (Washington DC), 254:1146-1153, 1991.

5. Liang, P., and Pardee, A. B. Differential display of eukaryotic mRNA by means of thepolymerase chain reaction. Science (Washington DC), 257: 967-971, 1992.

6. Nishio, Y.. Aiella, L. P., and King, G. L. Glucose induced genes in bovine aortic smoothmuscle cells identified by mRNA differential display. FASEB J., 8: 103-106, 1994.

7. Altcrman, L. A.. Crispe, I. N., and Kinnon, C. Characterization of the murineheat-stable antigen: an hematolymphoid differentiation antigen defined the by Jlld,Ml/69 and B2A2 antibodies. Eur. J. Immunol., 20: 1597-1602, 1990.

8. Mittler, R. S.. Talle, M. A., Carpenter, K., Rao, P. E., and Goldstein, G. Generationand characterization of monoclonal antibodies reactive with human B lymphocytes.J. Immunol., 131: 1754-1761, 1983.

9. Linton, P. J., Decker, D. J., and Klinman. N. R. Primary antibody-forming cells andsecondary B cells are generated from separate precursor cell subpopulations. Cell, 59:1049-1059, 1989.

4 S. Y. Peng and H. C. Hsu, unpublished observation.5 L. R. Huang, T. S. Lin, M. W. H. Coughtrie. and H. C. Hsu, unpublished data.

10.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

Fischer, G. F., Majdic, O., Gadd, S.. and Knapp, W. Signal transduction in lympho-cytic and myeloid cells via CD24, a new member of phosphoinositol-anchoredmembrane molecules. J. Immunol.. 144: 638-641. 1990.Yin, X-M-, Lee, W. T., and Vitella, E. S. Changes in expression of Jl Id on murineB cells during activation and generation of memory. Cell. Immunol., 137: 448-460,

1991.Kay, R., Rosten, P. M., and Humphries, R. K. CD24, a signal transducer modulatingB cell activation response, is a very short peptide with a glycosyl phosphatidylinositolmembrane anchor. J. Immunol., 147: 1412-1416, 1991.Hitsumoto, Y., Nakano, A., Ohnishi, H., Hamada, F., Saheki, S., and Takeuchi, N.Purification of the murine heat-stable antigen from erythrocytes. Biochem. Biophys.Res. Commun., 187: Ili-Ili, 1992.Nedelec, J., Pierres, M., Moreau, H., Barbet, J., Naquet, P., Faivrc-Sarrailh, F., andRougon, G. Isolation and characterization of a novel glycosyl-phosphatidylinositol-anchored glycoconjugate expressed by developing neurons. Eur. J. Biochem.. 203:433-442, 1992.

Pierres. M., Naquet, P.. Barbel. J.. Marchette, S., Maries, I., Devaux, C., Barad, M..Hyman, R.. and Rougon, G. Evidence that murine hematopoielic cell subset markerJl Id is attached to a glycosyl-phosphatidylinositol membrane anchor. Eur. J. Immunol.. 17: 1781-1785, 1987.Stefanova, I., Horejsi, V., Ansotegui, I. J., Knapp, W., and Stockinger. H. GPI-anchored cell-surface molecules complexed to protein tyrosine kinases. Science(Washington DC). 254: 1016-1019, 1991.Droz. D., Rousseau-Merck. M-F., Jaubert, F., Diebold, N.. Nezelof, C., Adafer, E.,and Mouly, H. Cell differentiation in Wilms'tumor (nephroblastoma): an immuno-

histochemical study. Hum. Pathol., 21: 536-544, 1990.

Shirasawa, T., Akashi, T., Sakamoto, K., Takahashi. H., Maruyama, N., andHirokawa, K. Gene expression of CD24 core peptide molecule in developing brainand developing non-neural tissues. Dev. Dyn., 198: 1-13, 1993.Figarella-Branger, H., Moreau, H., Peilissier. J. F., Bianco, N., and Rougon, G. CD24,a signal-transducing molecule expressed on human B lymphocytes, is a marker forhuman regenerating muscle. Acta. Ncuropathol., 86: 275-284. 1993.

Kadmon, G., Eckert, M., Sammar, M., Schachner, M., and Altevogt, P. Nectadrin.the heat stable antigen, is a cell adhesion molecule. J. Cell Biol.. /18: 1245-1258,1992.Jackson, D., Waibel, R., Weber. E.. Bell. J.. and Stahel. R. A. CD24. a signal-

transducing molecule expressed on human B cells, is a major surface antigen on smallcell lung carcinomas. Cancer Res.. 52: 5264-5270, 1992.

Karran, L., Jones, M., Morley, G., Noorden, S. V., Smith, P., Lampert, I., and Griffin,B. E. Expression of a B-cell marker, CD24, on nasopharyngeal carcinoma cells. Int.J. Cancer, 60: 562-566, 1995.

Hsu, H. C., Peng, S. Y., Lai, P. L., Chu, J. S., and Lee, P. H. Mutations of p53 genein hepatocellular carcinoma (HCC) correlate with tumor progression and patientprognosis: a study of 138 patients with unifocal HCC. Int. J. Oncol., 4: 1341-1347,

1994.Edmondson, H. A. Tumor of the liver and intrahepatic bile ducts, section VII, fascicle25. Washington, DC: Armed Forces Institute of Pathology, 1985.Hsu, H. C., Su. I. J., Lai, M. Y., Chen. D. S., Chang, M. H., Chuang, S. M.. and Sung,J. L. Biologic and prognostic significance of hepatocyte hepatitis B core antigenexpressions in the natural course of chronic hepatitis B virus infection. J. Hepatol.. 50:45-50, 1987.Hsu, H. C., Tseng, H. J., Lai, P. L., Lee, P. H., and Peng, S. Y. Expression ot>5.? genein 184 unifocal hepatocellular carcinomas: association with tumor growth and invasiveness. Cancer Res., 53: 4691-4694, 1993.

Hsu. H. C., Sheu, J. C., Lin, Y. H.. Chen, D. S., Lee, C. S., Hwang, L. Y., and Beasley,R. P. Prognostic histologie parameters in resected small hepatocellular carcinoma: acomparison with resected large hepatocellular carcinoma (HCC). Cancer (Phila.), 56:672-680. 1985.Hsu, H. C., Wu, T. T., Wu, M. Z., Sheu, J. C., Lee, C. S., and Chen, D. S. Tumorinvasiveness and prognosis in resected hepatocellular carcinoma: clinical and patho-genetic implications. Cancer (Phila.), 61: 2095-2(199, 1988.

4720

Research. on January 22, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

CD24 GENE EXPRESSION IN HCC

29. Chirgwin, J. M., Przybyla. A. E., MacDonald. R. J., and Rutter, W. J. Isolation of 34. Miller, B. A., Antognetti, G., and Springer, T. A. Identification of cell surfacebiologically active ribonucleic acid from sources enriched in rihonuclease. Biochem- antigens present on murine hematopoictic stem cells. J. Immunol., 134: 3286-3290,istry, 18: 5294-5299, 1979. 1985.

30. Liang, P., Averboukh, L., Keyomarsi, K., Sager, R., and Pardee, A. B. Differential 35. Wenger, R. H.. Ayane, M.. Böse,R.. Kohler. G., and Nielsen, P. J. The genes for adisplay and cloning of mRNA from human breast cancer versus mammary epithelial hematopoietic differentiation marker called the heat-stable antigen. Eur. J. Immunol..cells. Cancer Res., 52: 6966-6968. 1992. 21: 1039-1046, 1991.

31. Peng, S. Y., Lai, P. L., Chu, J. S., Lee, P. H., Tsung, P. T., Chen, D. S., and Hsu, H. C. 36. Ennas, M. G., Silvetti, C. E., Sogos, V., Riva, A., Torelli, S., and Grcmo, F.Expression and hypomethylation of a-fetoprotein gene in unicentric and multicentric Immunocompctent cell markers in human fetal astrocytes and neurons in culture. J.human hcpatocellular carcinoma. Hepatology, 17: 35-41, 1993. Neurosci. Res., ¡2:424-436, 1992.

32. Hsu. H. C.. Chiou, T. J.. Chen, Z. Y., Lee, C. S., Lee, P. H., and Peng. S. Y. Clonality 37. Rougon, G., Alterman. L. A., Dennis. K.. Guo. X. J., and Kinnon. C. The murineand clonal evolution of hepatocellular carcinoma with multiple nodules. Hepatology, heat-stable antigen: a differentiation antigen expressed in both the hematolymphoid13: 923-928. 1991. and neural cell lineages. Eur. J. Immunol., 21: 1397-1402, 1991.

33. Hough, M. R., Rosten, P. M., Sexton, T. L., Kay, R., and Humphries. R. K. Mapping 38. Droz. D.. Zachar, D., Charbit, L.. Gogusev. J., Chretien, Y.. and Iris, L. Expressionof CD24 and homologous sequences to multiple chromosomal loci. Genomics, 22: of the human nephron differentiation molecules in renal cell carcinomas. Am. J.154-161. 1994. Pathol.. 137: 895-904, 1990.

4721

Research. on January 22, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from

1995;55:4717-4721. Cancer Res   Lan-Ru Huang and Hey-Chi Hsu 

Mutation and Tumor Differentiationp53with Carcinoma: A Potential Early Tumor Marker Gene Correlates

Gene in Human HepatocellularCD24Cloning and Expression of

  Updated version

  http://cancerres.aacrjournals.org/content/55/20/4717

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/55/20/4717To request permission to re-use all or part of this article, use this link

Research. on January 22, 2020. © 1995 American Association for Cancercancerres.aacrjournals.org Downloaded from