22
Cloning and Expression of Phytase (PhyA) Gene for supplementation of Poultry : By Dalia Abu Issa Supervisor : Dr.Fawzi Razem

Cloning and Expression of Phytase (PhyA) Gene for supplementation of Poultry :By Dalia Abu Issa Supervisor: Dr.Fawzi Razem

Embed Size (px)

Citation preview

Cloning and Expression of Phytase (PhyA) Gene for supplementation of

Poultry

:By Dalia Abu Issa

Supervisor:

Dr.Fawzi Razem

Outlines:

• Introduction• Statement of problem• Aim of study • Material and Methods• Results and Discussion• Conclusion• Future work

IntroductionPoultry

• Because poultry products are in demand around the world;

• and because chickens and other poultry can be reared in almost any part of the world,

• a renewed interest in poultry projects in all fields.

Poultry in Palestine

• There is a large commercial chicken industry in palestine

• We depend on chicken that provides us as a first supply with eggs and meat.

Poultry Food

• Feed for poultry mostly consists of grain.

• Which consist of P , Ca , zinc ,magnesium and iron ,

What is the problem?

Statement of problem

• plant especially bran and seeds store 80% of P as Phytic acid

• The problem is poultry have not the enzyme phytase that can librate P from its storage as phytic acid.

Statement of problem

• So farmers add inorganic P to the poultry feed in order to utilize it

• result in execration of all Inorganic P in their manure to cause environment P pollution especially in water resources at animal production areas

Aim of study

• to provide phytase gene (phyA) suitable for protein expression into phytase enzyme to

supplement poultry feed in Palestine

Materials and Methods

• Aspergillus niger strain 103 isolation• RNA Extraction from Aspergillus niger cell

Collection and • cDNA Synthesis from mRNA that Extracted

from Aspergillus niger

• Amplification and Visualization of a phytA Gene from Aspergillus niger cDNA

• To amplify the cDNA phytA gene, DNAMAN software was used to design primers based on the phytA sequence NCBI accession number AB022700 as follows:

• Phytase F 5`- ATGGGTGTCTCTGCCGTTCTAC -3` • phytase R 5`- CTAAGCGAAACACTCCCCCC -3`

• Cloning of phytA Gene in pGEM® -T Easy vector

• Transformation into DH5α• Screening and Verification of Positive Clones

• Sequencing of purified plasmid• Subsequent Cloning of phytA Gene into p

PROEXH-Tb Expression Vector

• Induction and Purification of phytase

Results and Discussion

• Aspergillus niger Growth and RNA Extraction

• Cloning of PhytA Gene Aspergillus niger

1500 bp

1000 bp900 bp

• Successful cloning of phytA gene in p GEM-T-Easy cloning vector ,

• Cloning was verified by PCR

1500 bp

• Sequence information and homologies of the cloned phytA gene

Conclusion

• We have now a clone of phyA gene which is 98% homology to aspergillus niger phytase

gene at NCBI

Future work

• We work now on the expression of phytase enzyme in order to supplement it to poultry