Upload
minnie
View
45
Download
0
Embed Size (px)
DESCRIPTION
Clustered Repeats and Regulatory Sites. Abdulrahman Alazemi , Shahroze Abbas, Liam Lewis, Donald Ta, Ann Vo. Overview. Clustered repeats Wide variety of functions History largely unknown Regulatory Sites A segment capable of altering expression of specific genes - PowerPoint PPT Presentation
Citation preview
Clustered Repeats and Regulatory SitesAbdulrahman Alazemi, Shahroze Abbas, Liam Lewis, Donald Ta, Ann Vo
Overview• Clustered repeats
Wide variety of functions History largely unknown
• Regulatory Sites A segment capable of altering expression of
specific genes Various classifications of regulatory sequences
Found in non-coding regions Functions at the transcriptional level
Identification• Consensus sequences
Utilize PSSM How?
Determine consensus
Clustered repeats and potential regulatory sequencesAbdulrahman Alazemi
Background; Transcription factors?
Activators Vs Repressors.
Thoughts;- My questions;
Can I apply a known method/tool with a known results to other phage and get the same/similar
result?
The known case; Examine the proven
Repressor and Cro binding sites (operators) of Phage Lambda.
Bioinformatics method in the notes.
First “Name of Lambda in BioBike”.
Go to BioBike/Phantome.
The known case; Second; Motifs in for the upstream sequence of phage Lambda. Labeled, DNA, Multiple-Hits-ok.
The known case; Results of motifs in. More than one interesting
case. Motifs 1, 2 , 3.
The known case; BioBike function; Description-analysissubmenu, Genes-
proteins menu. Now, we have anidea about whereto look.
The known case; Used the function
sequence-of from Genome menu.
Go to the specific region in the genome
The known case; Finding the operators. Directly Vs inversion
of.
Phage Lambda map;
Thoughts;- My concern/focus;
Would I find some sort of generality between operators of different phages?
My experiment; Twenty one random phages of different phage families. Eight of them don't have repressors. (eliminated) Three of the 13 phages left didn't display a map because of linear
amplicon. Ten phages out of 21 went through all the steps of the
method/tool successfully and gave me back out come that I can work with.
Three out of 10 have similar results to phage Lambda.
Outcome analysis;- Similar to phage lambda:
-Bacillus-phage-1
Phage Bacillus-phage-1 map;
Outcome analysis;-Similar to phage Lambda:
-Listeria-phage-A006
Phage Listeria-phage-A006 map;
Outcome analysis;-Similar to phage lambda:
-Lactobacillus-johnsonii-prophage-Lj928
Phage Lactobacillus-johnsonii-prophage-Lj928 map;
First conclusion;- Out of 21 or 10 phages, only 3 phages are similar to phage
Lambda.- Less than 50%.- No Generality. - Appropriate conclusion;- Phage Lambda, Bacillus-phage-1, Listeria-phage-A006 , and Lactobacillus-johnsonii-prophage-Lj928 have a similarity/generality between their operators that the repressors bind to.
Inspiration; - Dead end.
- The articles !!!! - Extend my research.
- look for something interesting.
First interesting case;- In Burkholderia-phage-Bcep1.- Six similar sequence in one intergenic region- another 6 similar sequences in another intergenic region.- Palindromic sequences.- 6 or 3 sequences ?- Bacillus-phage-1 is similar to Burkholderia-phage-Bcep1 somehow.
First interesting case;
Phage Burkholderia-phage-Bcep1 map;
Second interesting case;• - In phage Clostridium-phage-39-O.• - Eight nucleotides sequence (TTACTACA) repeated 10 times in one
intergenic sequence.• - Again the same sequence repeated 8 times in another intergenic
sequence in another place on the phage.
Second interesting case;
Phage Clostridium-phage-39-O map;
Conclusion; - Goals;
- Pick one interesting case.
- Research it.
- Make sense of it.
A. Comparison of Pseudomonas putida and Azotobacter REP sequencesDonald Ta
REPs• Repetitive Extragenic Palindromic Sequences
Found mainly in abundance in Enterobacteriaecae
• Can be anywhere around 20 to 40 nt long
• Clustered into structures called BIMEs (bacterial interspersed mosaic element) as two inverted tandem repeats separated by a short linker of variable length
What do REPs do?• Regulate Gene Expression
• Structuring DNA
• Specific target sites for bacterial insertion sequences
• Possibly more that are undiscovered
Previous Study• I. Aranda-Olmedo 2002 used BLAST (Basic local
alignment search tool) to find regions of local similarity between sequences downloaded from the National Center for Biotechnology Information (NCBI)
• Used database with all contigs of Pseudomonas putida already available in The Institute for Genome Research
• Developed their own program to screen all of the strains against the 35 nt sequence 5’-CCGGCCTCTTCGCGGGTAAGCCCGCTCCTACAGGG-3’
Results of that Study
Implications from that study
They suggest that the 35 bp element they found is species specific in P. putida
First time that REP sequences have been described and characterized in a group of non-enterobacteriaceae
What am I doing?• Comparing REP sequence element of Pseudomonas
putida KT2440 with Azotobacter vanlandii Why? Order Pseudomonadales
• Used the REP element that is most common among Pseudomonas species “GCGGGnnnnCCCGC”
Methods• Used built-in functions of BioBike to scan a
sequence for possibly loose matches of a pattern
• “****GCGGG****CCCGC****” sequence iterated over the sequence of the organism of interest and then whenever there was a match it was displayed on the output
• “*” means an unspecified amino acid
Findings• 52 sequence hits in Azotobacter vanlandii that
appear to have the same conserved region found in Pseudomonas putida
• The species share similar REP elements with the same conserved central palindromic region
• “GCGGG****CCCGC”
Output
Significance• REP sequences mainly found abundantly in
Enterobacteriacaea
• Study by Bao Ton-Hoang 2012 suggested that transposases could’ve been responsible for the proliferation of REP sequences in the genomes of bacteria in Enterobacteriacaea
• Possibly suggest a similar origin of REP sequences/elements for Pseudomonas and Enterobacteriacaea?
Problems?• Found 2 hits in E. Coli K-12 that had the REP
element Maybe suggests similar origin?
• Could be just a fluke/just by chance that these two organisms share the same REP element in abundance Past Study found 804 REP sequences with that REP
element in Pseudomonas putida I found 52 in Azotobacter vanlandii
Possible plans of the future/near future?• Compare with other bacteria in the order of
Pseudomondas to see if I get similar results
• Possibly try to find a link to how REP sequences started proliferating in bacteria outside of Enterobacteriacae
Positional Preference of Rho-Independent Transcriptional Terminators in E. ColiAnn Vo
Transcriptional Terminators• Rho-independent• Specific activities poorly understood• Occurs in ssDNA and RNA• Unique characteristics:
T-Tract: 12-15 nt GC-rich stem: 4-18 nt
Transcriptional Terminators• Available algorithms:
RNAMotif TransTermHP ARNold
• About 317 natural terminators found in E. Coli• Lai et al. (2013) found a positional preference
between other regulatory sequences
Do transcriptional terminators have a positional preference relative to the end of the gene?
ARNold• Erpin
Scores input sequences Compares against 1,200 known terminators from
Bacillus subtilitis and Escherichia coli
• RNAMotif Used descriptors to find possible terminators Scores free energy of hairpin formation
Matching Sequences• BioBIKE/PhAnToMe
Extracted the 50 nucleotides following every gene
• Python Compared sequences to terminators Calculated distance to terminator
ARNold 3248 possible terminatorsBioBIKE 5341 downstream sequencesPython 126 terminators
CAGGACGGTTTACCGGGGAGCCATAAACGGCTCCCTTTTCATTGTTATCA ACGGTTTACCGGGGAGCCATAAACGGCTCCCTTTTCATTGTTA
downstream sequenceterminator
3 4 5 6 7 8 9 10 11 12 13 14 15 160
5
10
15
20
25
Count of Terminator Distance by Length
Terminators Distance (nt)
Num
ber o
f Ter
min
ator
s
3 4 5 6 7 8 9 10 11 12 13 14 15 160
5
10
15
20
25
Count of Terminator Distance by Length
Terminators Distance (nt)
Num
ber o
f Ter
min
ator
s
0 500000 1000000 1500000 2000000 2500000 3000000 3500000 4000000 45000000
2
4
6
8
10
12
14
16
18
20
Terminator Distance Relative to Genomic Position
Genome Length (nt)
Term
inat
or D
istan
ce (n
t)
Conclusion• Appear to exhibit some degree of positional
preference• Reasons remain unclear
• Further studies: Length of terminator Function of operons
References• Chen, Ying-Ja et al. “Characterization of 582 Natural and Synthetic Terminators and
Quantification of Their Design Constraints.” Nature methods 10.7 (2013): 659–64. Web. 20 Mar. 2014.
• Ermolaeva, M D et al. “Prediction of Transcription Terminators in Bacterial Genomes.” Journal of molecular biology 301.1 (2000): 27–33. Web. 4 Apr. 2014.
• Kingsford, Carleton L, Kunmi Ayanbule, and Steven L Salzberg. “Rapid, Accurate, Computational Discovery of Rho-Independent Transcription Terminators Illuminates Their Relationship to DNA Uptake.” Genome biology 8.2 (2007): R22. Web. 17 Apr. 2014.
• Lai, Fu-Jou et al. “Identifying Functional Transcription Factor Binding Sites in Yeast by Considering Their Positional Preference in the Promoters.” PloS one 8.12 (2013): e83791. Web. 10 Apr. 2014.
• Lau, Lester F et al. “A Potential Stem-Oop Structure and the Sequence CAAUCAA in the Transcript Are Insufficient to Signal Q-Dependent Transcription Termination at XtR1.” 12.2 (1984): 1287–1299. Print.
• Macke, T J et al. “RNAMotif, an RNA Secondary Structure Definition and Search Algorithm.” Nucleic Acids Research 29.22 (2001): 4724–35.
• Mooney, Rachel Anne, and Robert Landick. “Building a Better Stop Sign: Understanding the Signals That Terminate Transcription.” Nature Methods 10.7 (2013): 618–619. Web. 21 Mar. 2014.
• Naville, Magali et al. “ARNold: A Web Tool for the Prediction of Rho-Independent Transcription Terminators.” RNA Biology 8.1 (2011): 11–13. Web. 8 Apr. 2014.
Resemblances and differences between promoter sequences in E. coli and S. entericaLiam Lewis
Inspiration• Novel sequence-based method for identifying
transcription factor binding sites in prokaryotic genomes
• Results found promoters with high probability
Background of Promoter sequences• Regulatory Elements • -35 and -10 consensus sequence• Sigma factor + RNA Polymerase
Program used to identify promoters• PePPER• Uses PSSMs and Hidden markov Models• Algorithm is universal for prokaryotes
Biobike implementation• Biobike to compare both outputs from PePPER.
What’s next?• Comparison of results• Biobike algorithm to accurately predict promoters
Comparison of Repressor-Operator Sequences in Lambda and other Temperate PhagesShahroze Abbas
Repressor Sequences in Lambda• Two possible life cycles, dependent upon either
Lambda repressor or Cro repressor. • cI repressor maintains lysogenic state• Cro repressor initiates a switch to the lytic state• Significance of intergenic sequences and
neighboring genes to determine ‘hypothetical proteins’ in other organisms similar
Comparison of Repressor Sequence• Lambda repressor sequence tested for occurrence
in other phages• Enterobacteria phage Sfl• Enterobacteria phage HK244• Enterobacteria phage HK542• Enterobacteria phage HK544• Enterobacteria phage HK 106• Enterobacteria phage CL707
Still to come…• Analysis of operator sequences• Comparison of cro repressor in other phages• Trend or pattern to determine function of
neighboring proteins in other phages• Trend or pattern in sequences between phages