Embed Size (px)
Citation preview
The Use of 2-D PAGE to Detect Disulfide Bond
Containing Proteins in Pseudomonas aeruginosa
ELIZABETH JOY PRESCESKY
A thesis submitted to the Department of Microbiology and Immunology
In conformity with the requirements for
the degree of Masters of Science
Queen's University
Kingston, Ontario, Canada
August 2000
Copyright0 Elizabeth Joy Prescesky, 2000
National Library 1+1 of Canada Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographic Services services bibliographiques
395 Wellington Street 395, rue Wellington Ottawa ON K I A ON4 Ottawa ON K I A ON4 Canada Canada
Your file Vote reference
Our fiie Notre rdfdrence
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sel1 reproduire, prêter, distribuer ou copies of this thesis in rnicroform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de
reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts from it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
Abstract
The proper folding and stability of some proteins is dependent on the formation of
correct disulfide linkages. In Gram-negative bacteria, disulfide bond formation occurs in
the periplasm and is catalyzed by the disulfide oxidoreductase DsbA. The aims of this
project were to examine disulfide bond containing proteins in Pseudomonas aeruginosa
by using 2D PAGE and to detect proteins that are destined for the periplasm, the outer
membrane or the extracellular environment that rely on DsbA, both directly and
indirectly, to acquire their disulfide bonds. Periplasmic proteins were isolated fiom
osmotic shockate. Outer membrane proteins were prepared using a Triton X-100
enrichment procedure and secreted proteins were precipitated from the growth medium.
Initial trials using two dimensional polyacrylamide gel electrophoresis (2D PAGE)
established appropriate m i n g conditions for this analysis, then 2D PAGE was used to
detect disulfide bond containing proteins. An approximation of the nurnber of disulfide
bonded proteins was determined over a limited pI range for each of the protein
population: 7.5% for secreted proteins, 4.5% for outer membrane protein enrichments and
3.4% for the periplasmic proteins. Three of these proteins were found to be dependent on
the activity of DsbA to acquire their disulfide bonds. However, many of the proteins
analyzed did not seem to rely solely on DsbA to obtain their disulfide bonds. This could
be due to spontaneous oxidation, to a weaker oxidation system or to compensation of
disulfide bond formation by one of the components of the Dsb system in the absence of a
functional DsbA. In addition, a genomic library was created to serve as a source of clones
containing genes of proteins that have yet to be characterized.
Clearly, this work has shown that 2D PAGE is an extremely useful tool that can
be used to detect disulfide bonded proteins in P. aeruginosa.
Dedication
1 would like to dedicate this piece of work to my grandfather Earl Momson. It
was his inspiration and encouragement during my childhood that sparked and nourished
my interest in science.
Acknowiedgements
First of dl , 1 would like to thank my supervisor Dr. Nancy Martin. 1 really
appreciate al1 of your help, time, guidance and supervision while completing this project.
To my comrnittee members, Drs. K. Janell and K. Poole, thank you for your time,
support and helphl suggestions along my joumey to getting my masters.
A special thanks to Elizabeth Schumaker. You helped me through the rough
times, helped me to develop the tools necessary to succeed as a competent masters
student and encouraged me when 1 need it. Thank you so very much!
Now to d l my friends and fellow Grad students, you guys are great! You know
who you are! We suffered through stresshl times together and shared some great
moments together. 1 will cherish these mernories always!
To the Martin lab, both present and past, many, many thanks to al1 of you-
Prashanth, Catherine, Mark, Kathleen, Kristin, and Dhenuka. A special thanks to
Thilaka, Catrien and Michelle for helping me during the rough times, for al1 of the brain
storming and especially for your fnendship. 1 could not have done it without al1 of you
guys!
Finally, enormous thanks to my farnily for being there and supporting me.
Especially to Jay, thank you for your continued love, patience, support and
encouragement throughout my thesis. And finally, most importantly, 1 want to thank my
Lord Jesus Christ through which 1 can do al1 things!
Good luck to everyone in their future endeavors! ! ! ! !
Table of Contents
..................................................................................................... Abstract i
... Dedication ................................................................................................. iii
Acknowledgments .................................................................................... iv
...................................................................................... Table of Contents v
... List of tables .............................................................................................. viii
............................................................................................ List of figures ix
................................................................................. List of abbreviations xi
Introduction ......................................................................................................... 1
......................................................................... Pseudomonas aeruginosa 1
Two dimensional polyacrylamide gel electrophoresis (2D PAGE) ...................................................................... 1
........................................................................................ Protein secretion 7
Protein folding .......................................................................................... 11
.......................................................................... Disulfide bond formation 13
.......................................................... The Dsb system in Escherichia coli 14
. E coli DsbA ............................................................................................. 18
............................................. DsbA homologues in other microorganisms 20
Objectives ................................................................................................. 21
....................................................................................... Materials and Methods 23
.................................................................... 1 . Bacteriological techniques 23
1.1 Bacterial strains ....................................................................... 23
1.2 Media and Growth conditions .................................................
2 . Construction of genomic library .........................................................
2.1 DNA manipulations ................................................................
2.1.1 Quantitation of DNA ................................................
................................................................... 2.1.2 Enzymes
................................................ 2.1.3 DNA electrophoresis
2.2 Isolation of DNA .....................................................................
............................................................... 2.2.1 Insert DNA
............................................................. 2.2.2 Vector DNA
.................... 2.2.3 Ligation, packaging and amplification
. . . ............................................................ 2.3 Southem hybndization
............................................................ 2.3.1 DNA transfer
........................................... 2.3.2 Preparation of the probe
............................................. 2.3.3 Southern hybridization
2.3.4 Colony hybridization ...............................................
2.4 Isolation of cosmid clones ......................................................
3 . Protein isolation ....................................................................................
3.1 Isolation of secreted proteins ..................................................
.................. 3.2 Isolation of outer membrane protein enrichrnents
............................................. 3.3 Isolation of periplasmic proteins
3.3.1 Succinate dehydrogenase assay ...............................
.......................................................... 3.4 Quantitation of proteins
4 . Electrophoresis ......................................................................................
4.1 One dimensional polyacrylamide gel .................................................... electrophoresis (ID PAGE)
4.2 Two dimensional polyacrylarnide gel electrophoresis (2D PAGE) ....................................................
4.2.1 First dimension .........................................................
.................................................... 4.2.2 Second dimension
......................................................... 4.3 Visualization of proteins
........................................................ 4.4 Western imrnunoblotting
4.5 Determination of molecular weights and ................................... isoelectric points of unknown proteins
Results ..................................................................................................................
........................................................ . 1 Construction of a genomic library
2 . 2D PAGE ..............................................................................................
..................................... 2.1 Optimization of 2D PAGE technique
...................................................................... 2.2 Protein isolation
2.3 Analysis of disulfide bond containing ..................................................................... proteins using 2D PAGE
Discussion ............................................................................................................
References ............................................................................................................
Appendix ..............................................................................................................
Curriculum Vitae .................................................................................................
vii
List of Tables
Page
....................................... Table 1 . Bacterial and yeast strains used in this study 23
Table 2 . Specific activity after performing a succinate .......................................................... dehydrogenase assay 54
............................................................ Table 3 . Surnrnary of identified proteins 78
List of Figures
Page
Figure 1 . A mode1 for the Dsb system in E . coli ............................................... 15
Figure 2 . Southem blot for localization of dsbA gene ....................................... 45
.......................................................... Figure 3 . Comparison of 1 D and 2D gels 47
Figure 4 . 2D gels of secreted proteins displaying reproducibility of the 2D gel technique ..................................................................... 49
Figure 5 . 1 D gels of secreted proteins and outer membrane ................................. protein enrichments showing isolation protocol 52
...................................... . Figure 6 2D gels of three distinct protein populations 55
Figure 7 . 2D gels of entire secreted protein population ..................................... 58
Figure 8 . Sections of 12% 2D gels of secreted proteins (protein S 1 and S4) ............................................................................. 59
Figure 9 . 2D gels of entire outer membrane protein enrichrnents ..................... 61
Figure 10 . Sections of 8% 2D gels of outer membrane protein enrichments (protein 09) ................................................................... 62
Figure 11 . Sections of 13.5% 2D gels of outer membrane protein enrichments (protein 0 1 and 02) ...................................................... 63
Figure 12 . Sections of 12% 2D gels of outer membrane protein enrichments (protein 04A. 04B. 0 5 and 06) ................................... 64
Figure 13 . Western blot using 3 anti-oprF antibodies to detect OprF .................. 66
Figure 14 . 2D gels of entire periplasmic protein population ............................... 68
Figure 15 . Sections of 8% 2D gels of periplasmic proteins (protein P3) ........................................................................................ 69
Figure 16 . Sections of 13.5% 2D gels of periplasmic proteins (protein P2. P5 and P7) ...................................................................... 70
Figure 17 . Sections of 13.5% 2D gels of periplasmic proteins (protein Pl and P8) .......................................................................... 72
Figure 18 . Key proteins from outer membrane protein enrichments ........................................................................................ 100
.................................. Figure 19 . Key proteins from secreted protein population 101
............................ Figure 20 . Key proteins from periplasmic protein population 102
List of Abbreviations
AMS
ATP
bp
BCA
cm
CA
CF
CIP
CSPD
Cu
CYS
DCPIP
DNA
Dsb
DTT
dUTP
ER
EDTA
g
His
IPG
4-acetamido-4"-maleimidylstilbene-2'-disulfonate
adenosine 5"-triphosphate
base pair
bichinchoninic acid
centimetre
carrier ampholytes
cystic fibrosis
calf intestinal phosphatase
disodiurn 3-(4-methoxyspirol(1,2-dioxethane-3,2'-(5'chloro) tricyclo(3.3.1)decan)-4-y1)phenyl phosphate
copper
cysteine
dichlorophenolindophenol
deoxyribonucleic acid
disulfide bond fonning/formation
dithiothreitol
2'-deoxyuridine 5'-triphosphate
endoplasmic reticulum
ethylenediaminetetraacetic acid
gram
histidine
immobilized pH gradient
mins
M
MA
NEPHGE
nm
OD
ID PAGE
PBS
PD1
PI
Pro
p.s.i.
PVDF
rr'm
SDS
SSC
kilobase
kilodalton
lambda
litre
Luria-Bertani
micro
milli
minutes
molar
monoclonal antibody
non-equilibrium pH gradient electrophoresis
nanometre
optical density
one dimensional polyacrylamide gel electrophoresis
phosphate buffered saline
protein disulfide isomerase
isoelectric point
proline
pounds per square inch
polyvinylidene
revolutions per minute
sodium dodecyl sulfate
sodium chloride/sodium citrate
xii
STE
TAE
TB
TCA
TE
Thr
Tris
2D PAGE
v
vlv
wlv
YPD
sodium chloride/Tris-HCIEDTA
trislsodium acetateEDTA
temfic broth
trichloroacetic acid
trisEDTA
threonine
Tris(hydroxyrnethy1)aminomethane
two dimensional polyacrylarnide gel electrophoresis
volts
volume per volume
weight per volume
yeast/peptone/glucose media
Introduction
Pseudomonas aeruninosa
P. aeruginosa is a Gram-negative motile rod shaped bacterium that is a member
of the family Pseudomonadaceae. As a nutritionally adaptable organism, P. aeruginosa
can be found in water and soi1 in the environment, or colonizing moist places in hospitals
and homes such as, kitchen and bathroom drains, shower heads, tooth brushes,
vegetables, dehumidifiers and medical equipment (Villavicencio, 1998).
It is an organism that is not part of the normal human flora (Stanislavsky and
Lam, 1997) and has the ability to cause infection when presented with the right
environmental conditions. It is one of the most virulent opportunistic human pathogens
that gains access to the host by colonizing and injuring epithelial surfaces, resulting in
pneumonia, infections of the skin, the eye, sofi tissue and the urinary tract and also
bacteraemia (Salyers and Whitt, 1994). Treatment can be difficult because of P.
aeruginosa's intrinsic resistance to many antibiotics. Thus, it is necessary to study this
organism to better understand its mechanism of virulence with a goal to develop new
antibacterial methods of treatment.
Two dimensional Polvacrylarnide Gel Electro~horesis (2D PAGE)
Two dimensional polyacrylarnide gel electrophoresis (2D PAGE), first described
by O'Farrell and Klose in 1975 (O'Farrell, 1975; Klose, 1975), is a powerfùl technique
that is used to analyze complex protein mixtures. It combines two techniques, that of
isoelectric focusing and SDS-PAGE, to achieve better resolution than either technique
alone. Proteins are separated on the basis of charge or isoelectric point (PI) in the first
dimension and then are separated according to size or molecular weight in the second
dimension. In the end, a gel is produced that consists of many round or elliptical spots
representing well-separated proteins (Adams, 1992). Many proteins can be resolved on a
2D gel and certain information about a protein can be extracted from a 2D gel. For
example, apparent molecular weight, pI and the amount of each protein can be obtained.
The first dimension of 2D PAGE separates proteins according to their PI.
Proteins are composed of different combinations of amino acids. Some amino acids have
side groups that become positively or negatively charged or carry no charge at all,
depending on the pH of their surroundings. The net charge on a protein is the surn of al1
of its positive and negative charges on al1 of its amino acid residues. The point at which
the net charge on the protein is zero corresponds to a specific pH. This value is referred
to as the isoelectric point for that protein. At pH values below a protein's PI, the protein
becomes positively charged, whereas at pH values above a protein's pl, the protein
becomes negatively charged. For isoelectric focusing to work, a pH gradient must be
established in a medium that the proteins can migrate through until their net charge is
zero (Berkelman and Stenstedt, 1998; Dunbar, 1987). A pH gradient can be established
by either using carrier ampholytes or immobilized pH gradients.
O'Farrell (O'Farrell, 1975) and Klose (Klose, 1975) used carrier ampholytes (CA)
in the original 2D gel method to set up a pH gradient. CA are small synthetic charge
bearing isomers of aliphatic polyarninopolycarboxy1ic acids that have various amounts of
acidic and basic side changes. When a voltage is applied, CA with the lowest pI and
most negative charge migrate toward the anode and those with the highest pI and most
positive charge migrate toward the cathode. The rest of the CA align themselves
according to their respective pI in between the CA with the most lowest and highest pls
to generate a continuous pH gradient. Commercial CA have pIs that span a particular pH
range, such as pH 3-10 or pH 4-7 (Berkelman and Stenstedt, 1998; Dunbar, 1987). The
pH gradient can be adjusted by combining CA from one pH range with that of another. A
pH gradient can then be established for a particular protein population of interest.
CA have some limitations that have hindered their widespread use throughout the
world. First of all, CA are not well described and each arnpholyte mixture coming from
the manufacturer may not be identical. This can result in variability between 1
dimension runs. However, the run-to-run variability can be reduced if large batches of 1
dimension monomer solutions are prepared in large volumes and stored at -70°C.
Including either an interna1 or extemal charge standard with each 1'' dimension run can
aid in comparing pH gradients between différent 2D gel runs of the sarne protein
population.
Secondly, the CA pH gradient becomes unstable with prolonged focusing times
and tends to drift toward the cathode (cathodic or gradient drift) resulting in a loss of
resolution of basic proteins and a flattening of the pH gradient at each end. Basic
proteins can be focused using the non-equilibrium pH gradient electrophoresis
(NEPHGE) method (O'Farrell et al., 1977). With this method, the protein mixture is
loaded at the acidic end of the gel and focusing times are reduced, allowing the basic
proteins to remain in the gel. A 2D gel pattern is produced with distinct spots; however,
reproducibility is dependent on similar focusing times, gel lengths, and the composition
of the CA mixture and protein sample.
Thirdly, reproducible results are dependent on the ski11 of the person carrying out
the 2D gel experiments. The polyacrylamide tube gels are very flexible and break very
easily. Any stretching or breakage of the tube gels could cause a different protein profile
to appear. However, with proper training of the operator of the 2D gels, this low
mechanical stability of the tube gels can be overcome. With some of these limitations
hindering the widespread use of CA method, another technique to establish pH gradients
was developed.
Irnrnobilized pH gradients (IPG) were first introduced in 1982 (Bjellqvist et al.,
1982) to overcome some of the problems encountered with the CA method. IPGs are
generated by covalently anchoring a gradient of molecules, containing either a single
acidic or basic buffering group that is linked to an acrylarnide monomer, to a gel matrix
that is cast ont0 a plastic backing. Prior to ruming the lSt dimension, the gel matrix is
rehydrated in a solution containing the essential components for isoelectric focusing.
The 1'' dimension run is greatly improved using IPG because gradient drift is
eliminated due a pH gradient that is fixed to a gel rnatrix. The plastic backing allows for
easy handling of the gels and avoids stretching or breaking of the gels. A wider selection
of pH ranges allows the resolution of extreme acidic and basic proteins. IPG strips
permit higher protein loads compared to CA method (Bjellqvist, 1993) and proteins can
be introduced directly into the gels during rehydration (Sanchez et al., 1997; Rabilloud et
al., 1994). One disadvantage of the IPG technique is that the separation of membrane
proteins is not as good. Membrane proteins are amongst one of the most difficult to
solubilize during sample preparation and protein loss can occur due to protein absorption
to the IPG matrix at or close to the protein's pI and to precipitation because of their low
solubility (Molloy et al., 1998). However, recent improvements in this area such as the
extraction of proteins with lauroyl sarcosinate or the combining of various sample
treatments and different detergents to resolve soluble and hydrophobic proteins, have
aided with this problem (Herman et al., 2000; Santoni et al., 1999). This technique, while
extremely useful in the separation of proteins, has just recently become financially
available to smaller laboratories. Thus, for this study, the CA method was employed to
focus protein populations of interest.
After focusing in the 1'' dimension, the tube gels are removed from the tubes,
equilibrated in equilibration buffer and placed on a vertical SDS-polyacrylamide gel for
the 2nd dimension m. This separates proteins according to their respective molecular
weights due to the presence of sodium dodecyl sulphate (SDS). SDS is an anionic
detergent that is used to aid in denaturing proteins by binding to the polypeptide
backbone, forming anionic complexes with a relatively unifonn net negative charge per
unit mass. Approximately 1 molecule of SDS for every 2 amino acid residues or 1.4
grams SDS per gram of protein is required to give a protein an overall negative charge,
thereby hiding the intrinsic charge on the protein. This binding of SDS to the proteins
results in different protein-SDS complexes that have similar net negative charges along
the polypeptide backbone (Berkelman and Stenstedt, 1998; Creighton, 1997).
During electrophoresis, proteins will experience the same electric field strength
and will migrate at the same interna1 rate towards the anode. The combination of
properties, that of similar charge and conformation, allow SDS-protein complexes to
have different mobilities through a porous gel matrix during electrophoresis. Smaller
proteins will migrate faster and larger proteins will migrate more slowly. Consequently,
the mobility of a protein during electrophoresis is inversely proportional to its size.
(Berkelman and Stenstedt, 1998; Creighton, 1997).
2D PAGE is a powerful tool used in the separation of proteins and it provides
several advantages over the 1 D PAGE. In 1 D gels, proteins are separated out only
according to molecular weight. 2D gels separate proteins based on charge in the 1 ''
dimension and size in the 2nd dimension. Proteins with similar molecular weights can be
separated according to their respective PI. Likewise, proteins with similar pls can be
separated based on their respective molecular weights. Each band on a 1 D gel may
contain multiple proteins whereas each spot on a 2D gel will more than likely contain a
single protein. Because charge and molecular weight are monitored at the same time,
changes in a protein population between control and experimental samples can be
examined using 2D gels. 1D gels can also be used to observe general changes in a
protein population; however, it may be difficult to distinguish specifically which protein
within a single band is being affected. This superior resolving technique is useful as long
as reproducibility is achieved. Optimizing running conditions, sample preparation and
sample solubilization as well as using high quality reagents, can aid in obtaining
reproducible results. 2D gels provide a method for collecting small amounts of extremely
pure protein for identification using N-terminal sequencing or mass spectrometry
(Adams, 1992).
Prior to electrophoresis (either 1D or 2D PAGE), proteins are nonnally partially
unfolded using either SDS or urea. A reducing agent, such as dithiothreitol (DTT) is
added to help break any disulfide bonds and to help maintain the proteins in a reduced
state. When a reducing agent is not added, proteins containing disulfide bonds will have
a different mobility on a gel than if DTT were present and the molecular weight of a
particular protein could be misinterpreted (Creighton, 1997). However, these differences
can be used to study disulfide bond formation in proteins. Thus, 2D gels can be used to
study disulfide bonded proteins because any change in a protein potentially containing a
disulfide bond can be observed very easily on a 2D gel.
Protein Secretion
In Gram-negative bacteria, many proteins are destined to be secreted into the
extracellular environment, into the periplasm or be inserted into the outer membrane.
They begin their life by being synthesized in the cytoplasm, and then must somehow
cross the inner membrane (protein export) or both the inner and outer membrane (protein
secretion) to reach their final destiiiation (Danese and Silhavy, 1998). The mechanism
by which proteins reach their site of action will be discussed in the following section,
specifically outer membrane, periplasmic and secreted proteins.
Outer membrane, periplasmic proteins and secreted proteins using the Type II
(general) secretion apparatus are initially synthesized as precursors that contain a mainly
hydrophobic amino-terminal signal sequence (von Heijne, 1990) which directs them to a
group of proteins, known as the Sec proteins. These proteins actively participate in
protein translocation across the inner membrane. Different precursors can use different
factors for inner membrane targeting. Some polypeptides use the cytoplasmic chaperone
SecB in an ATP-independent manner to direct them to the inner membrane and to keep
them in an unfolded state (Danese and Silhavy, 1998). At the cytoplasmic side of the
imer membrane, a SecB-polypeptide complex interacts with SecA which is in contact
with the cytoplasmic face of three complexed inner membrane proteins, SecEGY.
ATP binding initiates a conformational change in SecA that allows it to insert into the
inner membrane, resulting in partial translocation of the bound precursor and cleavage of
the signal sequence by a signal peptidase. The membrane-bound SecA is stabilized by
the inner membrane proteins SecD, SecF and YajC. Repeated ATP binding and
hydrolysis ailows SecA to repeatedly insert and deinsert fiom the inner membrane,
facilitating further translocation of the polypeptide (Duong et al., 1997). Once
translocation has taken place, the mechanism by which proteins reach their final
destination depends upon where the final destination is, either to remain in the periplasm,
to be inserted into the outer membrane or to be secreted outside the bacterial cell.
How can the bacterial ceIl distinguish which proteins are destined for the
periplasm and which are to be inserted into the outer membrane? Adding a cleavable
signal sequence to a number of cytoplasmic proteins can cause them to be directed
toward the periplasm (Klose et al., 1988). Not al1 cytoplasmic proteins will be directed to
the periplasm with an added signal sequence (Surnmers and Knowles, 1989) because
sequences next to the added signal sequence may interfere with signal sequence function
(Rasmussen and Silhavy, 1987). In addition, deletions of mature parts of some outer
membrane proteins results in mislocalization to the periplasm (Bosch et al., 1986; Klose
et al., 1988). Thus, proteins that remain in the periplasm after cleavage of the signal
sequence do so as a result of a default process (Danese and Silhavy, 1998).
Two different modes of translocation of the outer membrane proteins to the outer
membrane have been proposed. The first model, known as the Bayer's Junction model,
suggests that outer membrane proteins are partially folded in the inner membrane and
translocate to the outer membrane via zones of adhesion between the inner and outer
membrane (Bayer, 1979). This model does not incorporate any penplasmic
intermediates. On the other hand, the Periplasmic Intermediate model proposes that outer
membranes proteins are translocated across the inner membrane, move through the
periplasm, and spontaneously insert into the outer membrane as a result of changes in the
3-D conformation of the protein and possible contact with other outer membrane
components (Nikaido, 1996).
Proteins destined for the extracellular environment can be secreted via a type 1, II,
III, or IV mechanisms. In P. aeruginosa, al1 four protein secretion mechanisms have
been identified (Filoux et al., 1990; Guzzo et al., 199 1; Yahr et al., 1996; Wilhelm et al.,
1999) although many P. aeruginosa exoproteins are secreted by type II secretion (also
known as the general secretory pathway). These proteins have a signal sequence which is
cleaved as the proteins are translocated across the inner membrane using the Sec proteins
(as described above). These proteins, after achieving a 3-D conformation, are transported
across the outer membrane to the extracellular environrnent using at least 12 xcp gene
products (XcpP-X and PilDKcpA). The role of these proteins in transport is not
completely understood; however some of them are homologous to proteins involved in
type IV pili biogenesis (Martinez et al., 1998).
In P. aeruginosa, three other secretory pathways exist in addition to the type II or
general secretory pathway. Type 1 secretion seems to bypass the penplasm, is sec-
independent and does not rely on N-terminal processing for translocation across the inner
membrane. Type 1 secretion requires three secretory proteins: an energy-providing inner
membrane transport ATPase (also known as ATP-binding cassette), a sec-dependent
secreted outer membrane protein and a membrane fusion protein that is anchored in the
inner membrane and extends into the periplasm. Proteins that are secreted using the type
1 secretion apparatus are not subject to proteolytic cleaving and their secretion signals are
located in the carboxy-terminus (Fath and Kolter, 1993; Wandersman, 1996; Carpenter et
al., 1993). Alkaline protease is one example of a protein using the Type 1 pathway and is
thought to be secreted via a one-step secretion mechanism because no accumulation of
exoproducts, of either wild type or mutant forms, were observed and alkaline protease
could be secreted in the absence of SecA (Tommassen et al., 1992).
The type III secretion pathway seems to be widely used by animal pathogens such
as Yersinia spp., Shigella flexneri, Salmonella ijphimurium, enteropathogenic E. coli, P.
aeruginosa and Chlamydia spp. as well as plant pathogens, including Envinia sp., P.
syringae, Xanfhomonas campestris, Ralstonia solanacearum and Rhizobium spp. (Hueck,
1998; Lee, 1997). Type III secretion allows gram-negative bacteria to secrete and inject
virulence factors into the cystol of eukaryotic host cells (Cornelis and Wolf-Watz, 1997).
Like type 1 secretion, it is sec-independent and is not subject to N-terminal signaling
during translocation across the inner membrane; however, it requires contact with its
target ce11 to secrete proteins directly into the cell's cytosol. The secretion apparatus
consists of approximately 20 proteins, most of which are found in the inner membrane
(Hueck, 1998). Proteins secreted via this pathway do not share any structural similarities
in the N-terminus that could act as a comrnon secretion signal (Sory et al., 1993, thus it
has recently been suggested that the secretion signal is located within the 5' region of the
mRNA encoding the secreted protein and not in the N-terminus (Anderson and
Schneewind, 1997). P. aeruginosa has several virulence factors that are secreted via a
type III system such as proteins with ADP-ribosyltransferase activity (Iglewski et al.,
1978), exoenzyme S or ExoS, and exoenzyrne T or ExoT (Cobm, 1992). Before any
proteins can be secreted via this pathway, they must be correctly folded into their final
conformation in order to function properly.
The type IV protein secretion pathway is sec-dependent and involves a group of
autotransporters. These proteins are thought to form a pore in the outer membrane
through which they pass and autoproteolytic cleavage releases the proteins into the
extracellular environment. The autotransporters include gonococcal immunoglobulin A
and other proteases, the vacuolating cytotoxin of Helicohacterpylori, a farnily of outer
membrane proteins in B. pertussis, the secreted protein SepA from S. flexneri, and the
secreted protein EspC from enteropathogenic E. coli (Finlay and Falkow, 1997).
Recently, a new esterase was identified and was localized to the outer membrane in P.
aeruginosa. This enzyme seems to be a member of a family of putative virulence factors,
which are self-secreted via a C-terminally located autotransporter domain. This is the
first example of a protein in P. aeruginosa that is secreted by this type of secretion
pathway (Wilhelm et al., 1999).
Protein folding
The area of protein folding has been investigated for many years. Anfinsen
demonstrated through in vitro experiments with ribonuclease refolding that there is
enough information in the primary amino acid sequence of a protein such that an
unfolded protein can fold into its native conformation without the help of other proteins
(Anfinsen et al., 1961; Anfinsen 1973). As well, under the right redox conditions,
disulfide bond formation occurs properly. In vitro folding is also slower than in vivo
folding, suggesting that the process of in vivo protein folding is assisted by other proteins
(Anfinsen et al., 196 1 ; Anfinsen 1973; Gething and Sambrook, 1992). Environmental
stressors, including heat, nutrient limitation, oxidative agents or changes in pH or osmotic
conditions can affect conformation and disulfide bond formation in proteins (Visick and
Clarke, 1995). Thus, there must be mechanisms in place to compensate for any defects in
protein folding that may mise due to these types of environmental conditions.
Two classes of proteins have been identified that assist in the protein folding
process. The first class of proteins are known as molecular chaperones. Molecular
chaperones, such as GroEL and DnaK, also called Hsp60 and Hsp70 respectively, are
suggested to interact noncovalently with substrates and prevent or reverse interactions
that can lead to improper folding and aggregation. This increases the chances that a
protein will be ultimately folded and function properly (Gething and Sarnbrook, 1992).
The protein folding process is complex and may require many steps. Some of
these steps may be rate-limiting. For example, proteins containing disulfide bonds are
often slow to fold in vitro because the oxidation and correct pairing of cysteine residues
is rate limiting (Creighton, 1984; Weissman and Kim, 1992). The second class of
accessory proteins speed up rate-limiting reactions, such as formation and interchange of
disulfide bonds and isomerization of peptidyl-prolyl bonds, by modifying the structure of
amino acids within the polypeptide chain. General examples of these type of enzymes
include protein disulfide isomerase and peptidylprolyl cis-tram isomerase (Gething and
Sambrook, 1992) and the proteins involved in disulfide bond formation, the Dsb proteins
(Bardwell and Beckwith, 1993).
Disulfide Bond Formation
Disulfide bonds are crucial to the folding and stability of many proteins
(Creighton, 1986). They are formed by the linkage of two cysteine residues in a
polypeptide chah. A disulfide bond is transferred from an externai donor, which in turn
becomes reduced. The effect of reducing a disulfide bond and breaking the covalent
linkage can cause unfolding of the protein. If pairing of incorrect cysteines occurs, this
pairing oflen leads to an unstable or inactive polypeptide because of an incorrect fold
(Missiakas and Raina, 1997).
The formation of stable disulfide bonds in proteins takes place in certain
compartments of the cell. In Gram-negative bacteria, this occurs in the periplasm; in
eukaryotes, disulfide bond formation occurs in the lumen of the endoplasmic reticulum
(ER) (Thorton, 198 1). In bacteria, the reducing environment of the cytoplasm prevents
disulfide bonds from forming and is maintained by molecules such as thioredoxin
reductase or reduced glutathione (Derman et al., 1993; Hwang et al., 1992); whereas the
ER and periplasm are a more oxidizing environment (Hwang et al., 1992). The formation
of disulfide bonds in proteins can occur spontaneously in vitro, albeit at a much slower
rate than that observed in vivo. It is now known that the process of disulfide bond
formation in Gram-negative bacteria and eukaryotes is a catalyzed process (Bardwell and
Beckwith 1993).
In eukaryotes, this catalyzed process is facilitated by an enzyme called protein
disulfide isomerase (PDI), a 55 kDa homodimer located in the lumen of the ER. PD1 was
originally defined by its ability to catalyze oxidative refolding of reduced, unfolded
proteins. It acts by catalyzing thiol-disulfide exchange reactions that can lead to the final
formation, reduction or isomerization of disulfide bonds (de Lorenzo et al., 1966). In
Gram-positive bacteria, very little is known about disulfide bond formation. Bolhuist et
al. (1999) have demonstrated that two proteins from Bacillus subtilis, BdbB and BdbC
(for Bacillus disulfide bond formation), play a general role in disulfide bond formation.
On the other hand, in Gram-negative bacteria, the process of disulfide bond formation
and isomerization is canied out by the disulfide bond forming (dsb) system (Bardwell et
al., 1991) in the periplasm of Gram-negative bacteria.
The Dsb System in Escherichia coli
Disulfide bond formation in the periplasm of E. coli has been studied extensively.
The dsb system is comprised of proteins that are located in the periplasm and the inner
membrane (Fig. 1). The main enzyme responsible for disulfide bond formation is a 21
kDa monomeric, soluble, periplasmic disulfide oxidoreductase known as DsbA that
contains a Cys-Xaa-Yaa-Cys motif characteristic of disulfide oxidoreductases (Bardwell
et al., 199 1 ; Kamitani et al., 1992). The DsbA active site cysteines form an extremely
oxidizing disulfide bond that reacts very quickly with free thiols, resulting in a rapid and
almost unidirectional transfer of a disulfide from DsbA to its substrate protein (Bardwell,
1994; Missiakas and Rainq 1997).
Figure 1. A mode1 of the dsb system in the periplasm of E. coli (Rietsch et al., 1996).
The key component, DsbA, is an oxidoreductase that catalyzes the oxidation of
sulfhydryl groups on cysteines. DsbA becomes reduced d e r donating its disulfide bond.
This is accomplished by the inner membrane protein DsbB. DsbC, a periplasmic
isomerase, shuffles incorrectly formed disulfide bonds, resulting in a stable protein. The
inner membrane protein DipZ (DsbD) maintains DsbC in it proper redox state (i.e.
reduced state). Like wise, the cytoplasmic protein thioredoxin maintains DipZ (DsbD) in
its active state (Le. reduced state).
The transfer of the disulfide bond from DsbA to a folding polypeptide is a two-
step process. First, the more N-terminal cysteine in oxidized DsbA forms a mixed
disulfide with a free thiol of the substrate protein. Secondly, another free thiol on the
protein attacks the mixed disulfide, resulting in transfer of the disulfide to the protein.
The extreme reactivity of the DsbA disulfide bond which reacts 1000-fold faster with free
thiols than normal protein disulfides (Zapun et al., 1993), coupled to the instability of the
mixed disulfide allows rapid transfer of the disuIfide from DsbA to the substrate protein
(Bardwell, 1994; Missiakas and Raina, 1997). This transfer of the DsbA disulfide bond
leaves DsbA in a reduced state. In order for DsbA to remain functionally active, it must
be reoxidized. This reoxidation is accomplished by DsbB (Fig. 1) (Bardwell et al., 1993;
Missiakas et al., 1993).
DsbB is an inner membrane protein with four membrane spanning segments and
two periplasmic domains. It contains two pairs of cysteines in the periplasmic domains
that are necessary for DsbB activity (Jander et al., 1994). The two cysteines, cys4' and
cys4', are located in the first periplasrnic domain and are arranged in a Cys-Xaa-Yaa-Cys
motif. It has been suggested that disulfide bonded cys'04 and ~ ~ s ' ~ ~ residues of DsbB,
located in the second periplasmic domain, are directly involved with the reoxidation of
DsbA. Likewise, the disulfide bond formed between ~ys" ' and cys4', which is located in
the first periplasmic domain is thought to be involved in the reoxidation of the disulfide
bond between cys'04 and ~ys" ' of DsbB (Guilhot et al., 1995; Kishigarni and Ito, 1996).
It is believed that the oxidation of DsbA by DsbB is oxygen-dependent and until
recently, there was some conflict in the literature about this point. Kobayashi et al.
(1 997) have previously s h o w that E. coli mutants defective in the respiratory chain
accurnulated a reduced form of DsbA when these cells were grown under protoheme- or
quinone-deprived conditions. These results suggested DsbB is kept oxidized and is
strongly oxidizing when DsbB is integrated into the inner membrane with a normal set of
respiratory components. Conversely, Bader et al. (1998) developed an assay that
demonstrated that membranes containing DsbB rapidly reoxidized DsbA to completion in
an oxygen-dependent manner. But they obtained mixed results when trying to
demonstrate a defect in disulfide bond formation in mutants lacking one or more
components of the respiratory chain. They maintain that DsbB transfers its electrons
directly to oxygen and may not need a fünctional electron transport chain in order to do
so. Bader and co-workers (1 999) have iiow s h o w that DsbB does use components of the
electron transport chain to facilitate its reoxidation. Under aerobic conditions, DsbB
donates its electrons to ubiquinone which then gives its electrons to cytochrome bd or bo
oxidases. These are in turn reoxidized by molecular oxygen, which serves as the final
electron acceptor. Under anaerobic conditions, menaquinone can be used as an
alternative electron acceptor. A bacterial ce11 c m therefore continue disulfide bond
formation under conditions of oxygen supply or deficit allowing disulfide bond formation
to proceed during environmental changes. It also emphasizes the importance of disulfide
bond formation in the protein folding pathway.
Other proteins that are involved in the dsb system include DsbC, DsbD, DsbE and
DsbG. DsbC is a dimeric, periplasmic thiol-disulfide isomerase that rearranges
incorrectly formed disulfide bonds (Fig. 1). To cany out this isomerization activity,
DsbC must be maintained in a reduced state. This is accomplished by DsbD (also known
as DipZ), an inner membrane thiol-disulfide reductase. Likewise, DsbD must be
maintained in a reduced state by the cytoplasmic protein, thioredoxin (Fig. 1) (Reitsch et
al., 1996, 1997; Missiakas and Raina, 1997). DsbE is a soluble periplasmic protein with
a Cys-Pro-Thr-Cys active site. It is proposed that the function of DsbE is similar to that
of DsbD, that is, the role of thiol-disulfide reductase (Missiakas and Raina, 1997).
Recently, another protein from the Dsb farnily has been identified, DsbG (Anderson et
al., 1997). DsbG appears to function p~ima~ily as an oxidant during protein disulfide
bond formation, but its substrate range may be narrower than the other periplasmic
oxidative enzymes DsbA and DsbC (van Straaten et al., 1998).
E. coli DsbA
DsbA is the key component of the dsb system in the periplasm of E. coli and is
the most well described of al1 of the Dsb proteins. Three-dimensional crystal structure of
oxidized DsbA, presented by Martin et al. (1993) and refined more recently by Guddat et
al. (1 997), depicted the thioredoxin fold, which is cornrnon to other members of disulfide
oxidoreductases, such as thioredoxin, PDI, and glutaredoxin. DsbA contains
characteristic surface features, such as a peptide groove, hydrophobic pocket and
hydrophobic patch, that seem to be conserved among the family of DsbA proteins. These
features form a distinctive uncharged surface around the active site and are thought to be
involved in substrate binding (Guddat et al., 1997).
DsbA contains an active site sequence of The presence
of the proline and histidine residues within the motif have been
s h o w to be essential in determining the oxidizing capacity of DsbA as mutations that
change these central residues decrease the oxidizing power of DsbA (Grauschopf et al.,
1995).
In addition to the role that DsbA plays in disulfide bond formation, it has been
suggested that DsbA may have some chaperone-like activity. The three dimensional
structure of DsbA revealing a hydrophobic surface close to its active site has been
suggested to bind to partially folded polypeptides in a chaperone-like fashion, prior to the
oxidation of cysteine residues (Martin et al., 1993). Frech et al. (1 996) provided evidence
that DsbA could interact by preferential non-covalent interactions with the unfolded
polypeptide RNase Tl. Zheng et al. (1997) demonstrated that when DsbA was mixed
with unfolded guanidine hydrochloride-denatured D-glyceraldehyde-3-phosphate
dehydrogenase or rhodanese, two enzymes lacking disulfide bonds, it increased the
reactivation and reduced aggregation during refolding. This provides evidence for
chaperone-like activity that is similar but weaker than that of PDI. PapD, a P pilus
chaperone of uropathogenic E. coli, contains a disulfide bond. Removal of this disulfide
bond did not prevent PapD from folding into its proper conformation or from forming a
complex with the pilus adhesin, suggesting that DsbA maintains newly synthesized PapD
in a folding-competent conformation before catalyzing disulfide bond formation. In this
way, DsbA acts as both an oxidant and as a chaperone-like protein (Jacob-Dubuisson et
al., 1994).
Although the dsbA gene is not essential for bacterial growth, mutants defective in
the dsbA gene show a significant and pleiotropic decrease in the rate of disulfide bond
formation in secreted proteins, such as OmpA and beta-lactamase proteins. Some
processes are severely affected, such as motility, assembly of pili, resistance to reducing
agents, alkaline phosphatase activity and sensitivity to certain drugs like benzylpenicillin
(Bardwell, 199 1 ; Missiakas et al., 1993). Even when dsbA is mutated, disulfide bond
formation is still detectable. Missiakas et al. (1 994) demonstrated that overexpression of
DsbC could partially replace the activity of DsbA. In addition, double mutations in DsbA
and DsbC were more severe with respect to disulfide bond formation than a single
mutation in either DsbA or DsbC.
DsbA has been implicated in pathogenicity, primarily through its involvement of
catalyzing disulfide bond formation in virulence factors. Enteropathogenic E. coli
(EPEC) causes severe diarrhea throughout the developing world. DsbA is responsible for
catalyzing the formation of a critical disulfide bond in bundlin, the major structural
subunit of a type IV fimbria called the bundle forming pilus that aids in adherence of
EPEC to host cells. In the absence of DsbA, bundlin is synthesized but is rapidly
degraded (Donnenberg et al., 1997). In uropathogenic E. coli, DsbA catalyzes disulfide
bond formation in PapD, a pilin-specific molecular chaperone. PapD is required for
proper assembly of P pili, which aid in adherence of the organism to its target surface. In
the absence of DsbA, adhesive P pili were not assembled (Jacob-Dubuisson et al., 1994).
DsbA homologues in other microoraanisms
DsbA has been well characterized in E. coli strains and the mode1 for disulfide
bond formation has been based on information gathered using E. coli. DsbA homologues
have been identified in other microorganisms including Vibrio cholerae (Yu et al., 1992),
Erwinia chrysanthemi (Schvchik et al., 1995), Shigellaflexneri (Watarai et al., 1993,
Pseudomonas aeruginosa (Leipelt et al., 1997), Pseudornonas syringae (Kloek and
Funkel, 1997), Legionella pneumophila (Sadoski and Shurnan, 1994), Klebsiella oxytoca
(Baek et al., 1996), Azotobacter vinelandii (Ng et al., 1997), Haemophilus infuenzae
(Tomb, 1 992), Salmonella typhi (Mendoza-del-Cueto and Rotger, 1 999), Salmonella
enteritidis (Mendoza-del-Cueto and Rotger-Anglada, 1998), Salmonella typhimurium
(Turcot and Martin, 1997), Burkholderia cepacia (Hayashi et al., 2000), Enterobacter
amnigenus (Kwon, 1999), Neisseria meningitidis (Klee et al., 2000) and Yersiniapestis
(Jackson and Plano, 1999). A dsbA homologue has also been described in Bacillus
brevis, a gram-positive bacterium (Ishihara et al., 1995).
Obiectives
The purpose of this investigation is to survey disulfide bond containing proteins in
Pseudomonas aeruginosa. It is hypothesized that by using the 2D PAGE technique, the
number of proteins that rely on DsbA to acquire their disulfide bonds, both directly and
indirectly, can be determined. Only proteins destined for the periplasm, the outer
membrane and the extracellular environment will be examined since disulfide bond
formation takes place in the periplasm of Gram-negative bacteria. Disulfide bond
containing proteins demonstrate an upward or downward mobility shifi in the presence of
a reducing agent, such as dithiothreitol (DTT), and this can be used to identify disulfides.
Proteins will be isolated fiom the outer membrane, the periplasm and the extracellular
environment of a wild-type and a dsbA nul1 strain of P. aeruginosa and separated using
2D gel analysis in the presence and absence of DTT. Comparative analysis of these gels
will provide an estimate of how many disulfide bonded proteins are present within these
protein populations. Also, specific proteins that demonstrate mobility shifis will be
examined to see if they are dependent on DsbA to acquire their disulfide bonds. From
this, an approximation of the nurnber of disulfide bonded proteins in P. aeruginosa can
be determined. In addition, a genomic cosmid P. aeruginosa library will be constructed
to serve as a source for clones containing genes of proteins that have not yet been
characterized.
Materials and Methods
1. Bacteriological Techniques
1.1 Bacterid Strains
Table 1 outlines the bacterial strains, the yeast strain and the cosmid that were
employed in this investigation.
Table 1. Bacterial and yeast strains as well as the cosmid used in this research. Genus
Pseudomonas
Pseudomonas aeruginosa
Pseudomonas aeruginosa
NLM 1008
E. coli
E. coli
1.2 Media and Growth Conditions
Strain Name NLM 1005
NLM 1009
Candida parapsilosis
Strains were grown in Luria Bertani (LB) broth (1% tryptone, 0.5 % NaCl and
Description PA01
Plasmid NIA
NIA
NLM 264 (DH5a)
S17-1
0.5% yeast extract) or terrific broth (TB) (1.2% bacto-tryptone, 2.4% bacto-yeast extract,
SourceIReference R. ~ancock '
NIA
' Dr. R. Hancock. Dept. Microbiology and Immiinology, University of British Columbia. Vancouver, BC Dr. N. Mariin, Dept. Microbiology and Immunology, Queen's University, Kingston. ON ' Dr. 1.. Tomalty. Kingston Public Health Lab. Kingston, ON
Yeast
0.4% glycerol and 100 ml of a solution of 0.17 M KH2P04 and 0.72 M K2HP04).
Spontaneous StrepR of NLM
1005
NIA
plafi-3
Cultures were aerated at 37OC using either a G10 gyrotory shaker (New Brunswick
N. arti in'
NLM 1008 with dsbA:Hg clone 1A
NIA
Scientific) set at approximately 180 rpm or a tube rotor (Glas-col) set at approximately 80
N. arti in'
supE44 AlacU 1 69 ($80 lacZ AM 1 5)
hsdR 1 7 recA 1 endA2 gyrA96 thi-
1 relAl Tetr
L. ~ o m a l t ~ ~ (Kingston Public
Health Lab)
Hanahan, 1983
Friedman et al., 1982
rpm. Solid media was prepared by supplementing LB broth or TB broth with 1.5 % (wlv)
agar. Bacteria on plates were incubated at 37°C and then stored at 4OC. The liquid TB
broth cultures were supplemented with 10 mM MgS04 and 0.2% (wlv) maltose.
Tetracycline was added to the media when it was required at a final concentration of 12.5
@ml (Sigma Chemicai Co.).
For secreted protein isolation, a 11500 dilution fiom a 5 ml ovemight culture was
made in 2 x 50 ml LB broth, grown up ovemight at 37OC with shaking. A 500 ml
ovemight culture in LB broth, isolated fiom a single colony, was used to isolate outer
membrane proteins. Inoculating 1 L of LB broth with 10 ml of a 50 ml ovemight culture
(11100 dilution) isolated periplasmic proteins. Yeast cells for the succinate
dehydrogenase assay were grown overnight in YPD media (1 % yeast extract, 2% bacto-
peptone and 2% glucose) at 25" with shaking at 400 rpm. Wild-type P. aeruginosa
whole cells for the succinate dehydrogenase assay were grown up ovemight at 37°C in
LB broth.
2. Construction of Genomic Library
2.1 DNA Manipulations
2.1.1 Quantitation of DNA
DNA was quantified using the Beckrnan DU-600 spectrophotometer. The
concentration of DNA in a sarnple was calculated at an OD of 260 nrn using the
following equation:
Concentration of DNA (uglml) = OD x 50 uglml x dilution factor
where 50 ug/ml= the concentration of double-stranded DNA at an 0D260 of 1.
The 0D2601280 ratio was used to assess the purity of the DNA. The OD26O reading was
only used to calculate the concentration of DNA in a sarnple if the 0D2601280 was between
1.8 and 2.0. If the 0D2601280 was above or below this range, the concentration of DNA
was estimated based on visualization on an agarose gel.
2.1.2 Enzymes
Restriction enzymes were purchased fiom New England Biolabs Inc. T4 DNA
ligase was purchased fiom Pharmacia Biotech and the calf intestinal phosphatase (CIP)
was purchased from Promega.
2.1.3 DNA Electrophoresis
Electrophoresis of high molecular weight DNA was performed on 0.5% (wlv)
agarose gels (FCM BioProducts) while al1 other DNA was run on 0.8% (wlv) agarose
gels (ICN). Ethidiurn bromide (1 pglml) was added to the agarose gel before it solidified
to visualize the DNA samples under ultra-violet light after electrophoresis. The size of
DNA was estimated by running either a hDNA high molecular weight marker
(GibcoBRL) or a hDNNEcoI301/Mlul ladder (MBI Fermentas). Prior to loading the
DNA sarnples ont0 the agarose gel, 1 x loading buffer [5% (vlv) glycerol, 0.04% (wlv)
xylene cyan01 FF and 0.04% (wlv) bromophenol blue] was added to each sarnple. The
agarose gel was submerged in 1 x TAE running buffer (40 mM Tris-acetate, 1 mM
EDTA pH 8.0). Electrophoresis was carried out at 10 volts for 17 hours (0.5% agarose
gels) to allow separation of the high molecular weight marker or at 75 volts for 1 hour
(0.8% agarose gels). After electrophoresis, a picture was taken of the gel using an
ultraviolet transilluminator (DiaMed Lab Supplies).
2.2 Isolation of DNA
2.2.1 Insert DNA
Wild-type Pseudomonas aeruginosa chromosomal DNA was isolated using a
PureGene DNA isolation kit and 215 pg of this was partially digested with 300 units of
HindIII for 30 minutes at 37OC to obtain 30 kb fragments. The partial digest was size
fractionated using spin columns and SephacrylB S-1000 (Pharmacia Biotech) to isolate
30 kb fragments. A spin colurnn was constmcted by taking a 1 ml syringe and placing a
0.5 cm thick layer of glass wool at the bottom of the syringe. Approximately 1 ml of
SephacrylB S-1000 was added to the syringe, put into a 15 ml falcon tube and
centrifuged at 200 x g for 2 minutes. More SephacrylB S-1000 was added to the syringe
to a final volume of 1 ml and centrifuged at 200 x g for 2 minutes. The colurnn was
washed 2 times with a total volume of 300 ul of 1 x STE [IM NaCl, 100 mM EDTA,
200mM Tris-HC1, pH 7.5 (from a 10X stock)] by centrifugation at 200 x g for 2 minutes.
A 1.5 ml microcentrifuge tube minus its lid was placed at the bottom of the falcon tube.
The partial digest was added to the top of the column, centrifuged at 200 x g for 2
minutes and the eluent was collected. Seven additional fractions were collected by
adding 60 ul of 1 x STE to the top of the spin colurnn, centrifuging at 200 x g for 2
minutes and keeping the eluent. To precipitate out the DNA from each fraction, 3
volumes of 100 % ethanol was added to each tube and the tubes were stored at -20°C for
a few hours or overnight. The tubes were centrifuged at 10 000 x g for 60 minutes at 4OC
and the pellets were washed in 500 pl of 70% ethanol. Each pellet was dried and
resuspended in 20 pl TE.
2.2.2 Vector DNA
pLAFR3, a 24.6 kb cosmid, was isolated following the QIAGEN very low-copy
cosmid purification protocol (QIAGEN Plasmid Purification Handbook). After complete
digestion with HindIII following the manufacturer instructions, the cosmid was
dephosphorylated following a standard protocol (Sambrook et al., 1989). Modifications
which were made include: no ethanol precipitation after complete digestion, 1 phenol and
1 chloroform extraction following CIP inactivation at 65OC for 1 hour (or 75OC for 10
minutes) in the presence of 5 mM EDTA and precipitating out the DNA with 100%
ethanol at -20°C for a few hours or ovemight. A test ligation was carried out to ensure
complete dephosphorylation of the cosmid.
2.2.3 Ligation, Packaging and Amplification
Ligations and amplification for the genomic library were performed according to
Sambrook et al. (1 989) while the packaging was done following the company's
instruction manual (Gigapack III Gold Packaging Extract, Stratagene). The 30 kb P.
aeruginosa chromosomal DNA fragments were ligated to dephosphorylated pLAFR3 in a
9: 1 molar ratio of vector to insert DNA. A final concentration of greater than 200 pglml
of DNA in the ligation reaction was needed in order to favor concatemeric DNA
formation. Three microlitres (- 1 pg DNA) of the ligation reaction was added to the
packaging extracts. The cosmid packaging reaction was titered using DH5a cells to
determine how many phages contained cosmid DNA as an indicator of the packaging
efficiency (expected titer: 5 x 104-5 x 105 colonies1 pg DNA packaged). The following
day, the library was amplified in liquid culture and plated out ont0 LB plates (14 cm)
containing 12.5pgl ml tetracycline by either plating the entire amplification reaction or by
plating enough of the amplification reaction to obtain approximately 1500 colonieslplate.
After incubation overnight at 37"C, colonies were scraped off the plates and the scraped
cell suspensions were aliquoted to contain about 1300 cosmid cloneslvial and stored at -
70°C.
2.3 Southern Hvbridization
The southern hybridization was carried out according to the GeniusTM
Nonradioactive Nucleic Acid Labeling and Detection System User's Guide (Boehringer
Mannheim). Deviations fiom the protocol are described in the following sections.
2.3.1 DNA Transfer
DNA was transferred to a nylon membrane (Amersham Inc.) using a vacuum
transfer system according to the manufacture's instructions (Tyler Research Instruments).
Depurination, denaturation and neutralizing solutions were added to center of the agarose
gel in sufficient amounts to just cover the surface of the gel and then completely removed
after the indicated times. After setting up the vacuum transfer apparatus, the DNA was
depurinated for 5 minutes using 250 mM HCl. Adding denaturation solution (1 -5 M
NaCl, 0.5 M NaOH) for 3 minutes followed by neutralization in neutralization solution
(0.5 M Tris-HC1, pH 7.5,3 M NaCl), then denatured the DNA. Vacuum transfer was
performed for 60 minutes with 20 X SSC (3 M NaCl, 0.3 M sodium citrate, pH 7.0). The
DNA was fixed to the damp nylon membrane by UV crosslinking using a GS Gene
LinkerTM UV Chamber according to the Quick Reference chart (Bio-Rad).
2.3.2 Preparation of the Probe
C. Bouwrnan prepared the DIG-labeled P. aeruginosa dsbA DNA probe used in
the Southern blot to detect dsbA. The 400 base pair probe was created by amplifying
wild-type P. aeruginosa (NLM 1005) using primers NM 42
(S'TGGAACTGTTCTGGTATGGCTG3') and NM 43
(S1GAAGCGATATTTGCCATTGACC3'). The probe was labeled with digoxigenin-
1 ldUTP using the random primed DNA labeling method outlined in the DIG guide and
diluted in standard buffer to a final concentration of 17 n g h l .
2.3.3 Southern Hybridization
After cross-linking the DNA to the nylon membrane, the membrane was
incubated at 70°C for 3 hours in a pre-hybridization solution of standard buffer (5 x SSC,
1 .O% (w/v) Blocking reagent (Boehringer Mannheim), 0.1 % (w/v) sarkosyl and 0.2%
(wlv) SDS). The hybridization solution, containing the DIG-labelled dsbA probe in
standard buffer diluted to 1 7 nglml, was boiled for 10 minutes at 100°C. The pre-
hybridization solution was discarded and the membranes were incubated with
hybridization solution overnight at 70°C.
After hybridization, the membrane was washed twice, 5 minutes per wash, in 2X
wash solution [2X SSC (from a 20X stock), 0.1% (wlv) SDS] at room temperature
followed by 2 washes, 15 minutes per wash, in 0.5X wash solution [OSX SSC (from a
20X stock), O. 1% (wlv) SDS] at 65°C.
The DIG labeled probe was visualized using the chemiluminescent detection
method according to the DIG guide. Before exposing to film, the membrane was
incubated in 111000 dilution of CSPD, the chemiluminescent substrate, in detection
buffer (100 mM NaCl, 100 mM Tris-HC1 pH 9.5) for 5 minutes. The membrane was
placed between two pieces of plastic wrap and incubated at 37°C for 15 minutes. The
chemiluminescent signal was detected by exposing the membrane to X-Omat film
(Kodak).
2.3.4. Colony hybridization
C. Bouwrnan performed the colony hybridization. A plate from the library
amplification process containing single colonies was chilled for 1 hour at 4°C. The
colonies were lifted off the plate by placing a circular piece of nylon membrane on the
chilled plate for 1 minute. The membrane was put colony side up on blotting paper that
had been saturated with denaturation solution [0.5 N NaOH, 1.5 M NaCl, 0.1% (wlv)
SDS]. Afier 15 minutes incubation, the membrane was place colony side up on blotting
paper that had been previously soaked in neutralization solution (1.5 M NaCl, 1 M Tris-
HCl pH 7.5). After an incubation of 5 minutes, the blotting paper was replaced with one
that had been soaked in 2X SSC. After 15 minutes incubation, the DNA was fixed to the
membrane by baking it a 120°C for 30 minutes. The pre-hybridization, hybridization,
washes and detection procedures were as described above.
2.4 Isolation of Cosmid Clones
Possible dsbA-containing clones, determined by colony hybridization (described
in the previous section), were isolated from DH5a cells using a modified version of the
QIAGEN very low-copy cosmid purification protocol. After the addition of P3 buffer,
the solution was chilled on ice for 30 minutes and the supernatant containing the cosmid
DNA was precipitated with room temperature isopropanol. The DNA was washed 2
times with room temperature 70% ethanol and allowed to air dry. The resulting DNA
pellets were resuspended in a suitable volume of TE. These clones were digested with
EcoRI and HindIII according to the manufacture's instructions to obtain a 4.7 kb DNA
fragment containing the dsbA gene. A southern hybridization was performed on these
clones using a 400 bp dsbA probe to confinn which clones contained the dsbA gene.
3. Protein Isolation
3.1 Isolation of Secreted Proteins
Secreted proteins from P. aeruginosa (wild-type and a dsbA nul1 mutant) were
isolated from culture supernatant according to the protocol described by Pegues et al.
(1 995) with modifications to scale-up the preparation. Two 50 ml ovemight cultures of
one strain were grown for 16 hours and were used to isolate secreted proteins from
culture supematant. Iodoacedamide was added to 80 mL of culture to a final
concentration of 100 mM. The mixture was shaken up and was placed on ice for 30
minutes to prevent spontaneous disulfide bond formation. Cells were spun down at 154
000 x g at 4°C for 90 minutes. The supernatant was subjected to a 10 % trichloracetic
acid (TCA) precipitation (prepared from a 20% TCA stock) by centrifugation at 39 000 x
g at 4OC for 2 hours. Proteins precipitated out and were washed twice with cold acetone
by centrifugation at 39 000 x g at 4OC for 1 hour. In between the two acetone washes,
some protein stuck to the side of the centrifuge tubes and had to be physically scraped off
the sides of the tube with a glass pasteur pipette. The protein pellets were dried over
night at 37OC and were resuspended in a final volume of 800- 1000 pl of sterile water.
After adjusting the pH to between 7.1-7.4 using 1 M NaOH, 1 M HCl and pH indicator
strips (pH 6.5-1 0.0), the protein concentration was determined using the Bradford protein
assay (average yield: 2-4pg/p1), the protein sample was aliquoted and stored at -70°C.
3.2 Isolation of Outer Membrane Protein Enrichrnents
Envelope proteins were isolated from a 500 ml overnight culture of one strain of
wild-type P. aeruginosa or a dsbA nul1 strain of P. aeruginosa (Martin, 1992). One
hundred mM iodoacedamide (final concentration) was added to the culture, was mixed
and was incubated on ice for 30 minutes. Cells were harvested by centrifugation at 5 000
x g for 5 minutes and resuspended in 2 ml of 50 mM Tris-HCl (pH 7.5). The cells were
lysed by passing them through the French Press (Arnerican Instrument Company) 2 or 3
times at 16,000 p.s.i. One hundred pg/ ml of DNase and RNase and 10 pg/ ml of MgCl*
was added to the lysed cells and allowed to sit on ice for 60 minutes. Any whole cells
still remaining in the sample were removed by low speed centrifugation at 400 x g for 5
minutes. The supernatant was transfened to a clean tube and the envelope proteins were
precipitated out by high speed centrifugation at 55 000 x g for 45 minutes. The resulting
pellets were resuspended in sterile water to a final volume of 1 mL.
Outer membrane proteins were isolated from the envelope preparations (Martin,
1992). 1 mL of envelope preparation was mixed with 9 mL 1 mM HEPES (pH 6.8), 1
mM MgCl2 and 2% (vlv) Triton X-100 by slow shaking at 30°C for 30 minutes or until
the proteins were in solution. The soluble inner membrane proteins were removed by
centrifugation at 28 000 x g at 4OC for 40 minutes and discarding the supernatant. The
pellet was resuspended in 6 mL of freshly prepared 10 mM HEPES (pH 6.8) containing
50 pgl ml of lysozyme by slow shaking at 4OC. Soluble peptidoglycan was removed by
centrifugation at 28 000 x g at 4OC for 60 minutes and discarding the supernatant. The
pellet was resuspended in sterile water to a final volume of 1 ml. The concentration of
the outer membrane protein enrichrnents was determined using the Bradford protein
assay (average yield: 7-Spglpl), the protein sample was aliquoted and stored at -70°C.
3.3 Isolation of Periplasmic Proteins
Periplasmic proteins were isolated using the protocol of Nossal and Heppel
(1966) which had been modified by Jensch and Fricke (1997). Cells were grown until the
middle of logarithrnic phase, were treated with 100 mM iodoacedarnide (final
concentration) and were placed on ice for 30 minutes. Cells were harvested via
centrifugation at 6,000 x g for 10 minutes at 4OC, washed twice with 100 ml of cold LB
and one gram of wet weight cells was resuspended in 40 ml of 0.033 M Tris-HC1 (pH
7.1). Forty ml of 40% (wlv) sucrose was added to the resuspended cells and mixed on a
rotary shaker for 30 minutes at 25OC. The mixture was centrifuged for 10 minutes at
6000 x g at 4°C and the supernatant was discarded. The cells were quickly suspended in
cold 0.5 mM MgC12, mixed in an ice bath on a rotary shaker for 10 minutes. centrifuged
at 6000 x g for 10 minutes to pellet the cells. The supernatant containing the released
periplasmic proteins was retained. Before concentrating the periplasmic proteins using
Centricon YM-3 tubes according to the manufacture's instructions, the initial protein
concentration of the supernatant was determined using the Bradford protein assay to
decide how much the periplasmic proteins needed to be concentrated. After periplasmic
concentration, the final protein concentration was determined (average yield: 2-4pg/p1).
The samples were aliquoted and stored at -70°C.
3.3.1 Succinate dehydrogenase assay
Periplasmic preparations were checked for contamination of i ~ e r membrane
proteins by performing a succinate dehydrogenase assay (Owen et al., 1982). Inner
mitochondrial membranes from yeast cells were used as a positive control. Sterile water
was used as a negative control and as a blank.
An overnight culture of yeast cells was hawested via centrifugation at 1200 x g
for 10 minutes. The resulting pellet was resuspended in 2 ml of 10 mM HEPES buffer
and kept on ice until it was ready to be used for the next step. The cells were lysed by
passing them 3 times through a French Press at 16 000 p.s.i. Any remaining intact cells
were removed by centrifugation at 400 x g for 10 minutes. The supernatant was
centrifuged for 15 minutes at 8000 x g to pellet the membrane fraction. This was
resuspended in a suitable volume of 100 mM Tris-HC1, pH7.5 and the protein
concentration in the sarnple was determined (average yield: 4.5pgIpl)
The succinate dehydrogenase assay was carried out by adding 0.9 ml of 100 mM
Tris-HCI, pH 7.5,50 pl of 2.5 mM dichlorophenolindophenol (DCIP) from a 5 mM
stock), 150 pl of 10 mM potassium cyanide, 75 pl of 3 mglm1 phenazine methosulphate
(kept frozen and in the dark), 0.3 ml of 20 mM sodium succinate (succinic acid, pH to 7.2
with 10 N NaOH) to a cuvette in the order stated with 50 pl of sample. The same amount
of protein was used for each sample. The absorbance of the 1.525 ml mixture was
measured continuously at 600 nrn for 6 minutes using the Beckrnan DU-600
spectrophotometer. The data was graphed using Microsoft Excel and the slopes of each
line were determined. Using this and the molar extinction coefficient for DCPIP
(16 rn~- 'cm-') , the specific activity of each sample was determined.
3.4 Quantitation of Proteins
Al1 protein sarnples were quantitated using the microtitre plate protocol from the
BCA Protein Assay Reagent Kit (Pierce). A standard curve was generated using known
concentration of BSA. Proteins within a sample reduce CU+^ to CU+' in an alkaline
environment known as the biuret reaction. A colored product is produced via the
chelation of 1 molecule of CU" to 2 molecules of bichinchoninic acid (BCA). The
absorbance of this purple-colored product was measured at 550 nrn using the Flow
TitertekB Multiskan PLUS plate reader (ICN). A standard curve was generated using
Microsoft Excel and the equation of the best fit line was determined. Using the slope
equation and the absorbances of the protein samples, the concentration of protein in the
sample could be estimated.
4. Electrophoresis
4.1 One dimensional Polyacrvlamide Gel Electrophoresis (1 D PAGE)
Protein samples were ofien visualized on 1 D PAGE gels prior to 2D PAGE
according to the Bio-Rad Mini-PROTEAN II Electrophoresis ce11 Instruction Manual.
Approximately 4-6 pl of 6X SDS sample buffer (130 mM Tris-HC1, pH 6.8,30% (wlv)
glycerol, 2% (wlv) SDS, 0.001 % (wlv) bromophenol blue) were added to each sample.
The samples were boiled for 10 minutes to aid in denaturing the proteins and then loaded
ont0 the gels. ID gels were composed of a 12% resolving gel consisting of 0.375 M Tris-
HCl pH 8.8 (from a 1.5 M stock), 0.4% (wlv) SDS (from a 10% stock) and 12%
acrylamidehis (from a 30% acrylamide/0.8% N,N'-methylenebisacrylamide stock). The
4% stacking gel was composed of 0.125 M Tris-HC1 pH 6.8 (from a 0.5 M stock), 0.4%
(w/v) SDS and 4% acrylamidelbis (from a 30% acrylamide/0.8% N,Nt-
methylenebisacrylamide stock). Electrophoresis using 1 x running buffer (from a 5X
stock) consisting of 1.5% (wlv) tris base, 7.2% (wlv) glycine and 0.5% (wlv) SDS was
carried out at 80 V through the stacking gel and 125 V through the resolving gel until the
dye front was at the very bottom of the gel. A liquid broad range protein marker (New
England BioLabs) was used as a molecular weight standard. Gels were either stained
with Coomassie Brilliant blue or silver stained (protocol outline below).
4.2 Two Dimensional Polyacrylamide Gel Electrophoresis (2D PAGE)
2D PAGE was perfonned according to the Bio-Rad Mini-Protean II Instruction
Manual. The basic protocol is outlined in the following subsections and any deviations
Som the protocol are noted.
4.2.1 First Dimension
Al1 instruments used to cast the first dimension (lS') gels were pre-warmed to
37°C and the tube gels were cast at 37OC to prevent urea crystallization. One end of the
casting tube was sealed with three layers of Parafilm and the appropriate nurnber of
capillary tubes was placed in the casting tube. The 1'' dimension monomer solution [9.2
M urea, 4% acrylamidelbis (from a 30% acrylamide/0.8% N,Nt-methylenebisacrylamide
stock), 20% Triton X-100 (from a 10% (wlv) stock)] was warmed to 37°C to aid in
dissolving the urea. Two point six ampholytes [2.08% Bio-Lyte 517 ampholyte, 0.52%
Bio-Lyte 3/10 ampholyte (Bio-Rad)] was added after complete urea solubilization and
the gels started to polymerize after addition of 0.01% ammonium persulfate (fiom a 10%
(w/v) stock) and O. 1 % (dv) TEMED. The monomer solution was taken up using a
needle and syringe. The needle was inserted into the casting tube and the monomer
solution was delivered so that the tube gels filled from the bottom. After al1 of the
monomer solution had been delivered, water was applied on top of the monomer solution
using the same needle and syringe in order to force the monomer solution up the tube gels
until they were 314 filled. The side of the casting tube was tapped to remove any trapped
air bubbles. The tube gels in the casting tube were left to polymerize at room temperature
for more than 30 minutes.
After complete polymerization, the parafilm was removed from the bottom of the
casting tube and the tube gels were carefully pushed out from the bottom of the casting
tube. The tube gels were either rinsed with distilled water or wiped with a Kim-wipe to
remove any excess acrylamide and the bottom of the tube gels (acidic end) were soaked
in lower chamber buffer (1 0 mM H3P04). Any tube gels with air bubbles or that failed to
polymerize were discarded. Each tube gel was attached to a sample reservoir via a
flexible tubing connector and inserted into a thinly vaseIine-coated hoIe in the tube ceII
module. The layer of vaseline was used to ensure that the upper charnber buffer did not
leak into the lower chamber buffer. Any holes that remained in the tube ce11 module
were plugged with stoppers.
Each tube gel was carefully filled with upper chamber buffer (100 mM NaOH)
using a needle and syringe, making sure not to introduce air bubble into the tube. First
dimension sample overlay buffer (9 M urea, 0.8% Bio-Lyte 517 ampholyte, 0.2% Bio-
Lyte 311 0 ampholyte and a few grains of bromophenol blue) was applied in enough
volume to fil1 the tube gels just below the flexible tubing connector.
Protein samples were mixed with an equal volume of 1" dimension sample buffer
[9.5 M urea, 2% Triton X-100 (from a 10% (wlv) stock), 1.6% Bio-Lyte 517 ampholyte,
0.4% Bio-Lyte 311 0,30% (vlv) glycerol] and allowed to solubilize at room temperature
for 60 minutes. The sample was loaded into each tube using a Hamilton syringe, taking
care not to introduce any air bubbles. The lower chamber was filled with lower chamber
buffer and the ceIl module was placed in the lower chamber. Air bubbles trapped at the
lower end of the tubes were removed using a needle and syringe. Upper chamber buffer
was placed in the upper chamber and each tube was checked for air bubbles at the basic
end. A magnetic stir bar was placed in the bottom of the lower chamber and allowed to
stir very slowly using a magnetic stirrer plate throughout the 1" dimension run. A 2D
SDS-PAGE pI marker (Bio-Rad) was included with each lS' dimension run as an extemal
indication of the pH gradient established in a particular run.
Each protein population was focused under previously determined running
conditions (voltage and volt hours). Volt hours (V-hrs) are defined as the product of the
voltage and the hours elapsed at that voltage. Secreted proteins were run at 200 V for 1 O
mins, 300 V for 15 mins, 400 V for 15 mins, 750 V for 9000 V-hrs and 1000 V for 300
V-hrs. Outer membrane protein enrichrnents were run for 100 V for 100 V-hrs, 200 V for
200 V-hrs, 400 V for 400 V-hrs and 600 V for 5720 V-hrs, 1000 V for 500 Vshrs.
Periplasmic proteins were run at 200 V for 10 mins, 300 V for 15 mins, 400 V for 15
mins, 750 V for 10,000 V-hrs and 1000 V for 500 V-hrs. The 2" dimension run was
normally run immediately following the 1'' dimension run. If the 2 " dimension was run
the following day, the tubes were wrapped in seran wrap and stored in the fridge over
night.
4.2.2 Second Dimension
Second dimension gels were prepared following the sarne procedure as described
in section 4.1 and were allowed to polymerize. Different percent gels, including either an
8%, 12%, 13.5% and 15% resolving gel with a 4% stacking gel, were cast depending on
the sample and the size of the proteins of interest. Meanwhile, the tube gels were
carefully extruded ont0 Parafilm laboratory film and allowed to equilibrate in SDS
sample equilibration buffer (with or without the addition of 10 mg/ ml DTT) for 15
minutes. The addition of DTT, a reducing agent that breaks disulfide bonds, prior to the
2nd dimension run was done to simplifj the task of locating shifting proteins. Proteins
would only demonstrate an upward or downward shift in mobility (change in molecular
weight) and not a side to side shift (change in PI). After removal of this solution using a
needle and syringe, the tube gels were soaked in SDS sarnple equilibration buffer with
iodoacedamide (25 mg/ ml) for 15 minutes. The iodoacedamide alkylates thiol groups on
proteins to prevent their reoxidation during reoxidation which can result in streaking and
other artifacts during electrophoresis in the 2nd dimension. It also alkylates residual DTT
that can cause point streaking and other silver staining artifacts (Berkelman and
Stenstedt, 1998). This solution was removed using a needle and syringe and each tube
gel was carefully straightened and positioned lengthwise against the slab gel with the aid
of a spatula. They were then slid between the glass plates ont0 the slab gel and overlaid
with more equilibration buffer. The electrode buffer reservoirs were filled with running
buffer and electrophoresed at 125 V for approximately 90 minutes. A broad range
protein marker (New England BioLabs) was used as a ladder in the second dimension.
4.3 Visualization of Proteins
1 D Gels were stained in Coomassie blue stain for approximately 2 hours (45%
(v/v) methanol, 10% (vlv) acetic acid, 0.25% (wlv) Coomassie blue R-250) and destained
either overnight in weak destain solution (5% (vlv) methanol, 7% (vlv) acetic acid) or for
a few hours in strong destain solution (30 % (vlv) methanol, 10% (vlv) acetic acid). Gels
were destained until bands were visible against a faint blue background.
Some 1 D gels and al1 2D gels were silver stained according to Blum et al. (1 987).
Al1 glassware was thoroughly cleaned first with a mild acetic acid solution and secondly
with ethanol prior to use. Gloves were used throughout the protocol when handling gels
and glassware. Gels were fixed in a solution of 50% (vlv) methanol, 12% (vlv) acetic
acid and 0.02% (vlv) formaldehyde (fiom a 37% solution in water) for at least an hour or
overnight with gentle shaking. The gels were washed 3 times in 50% (vlv) ethanol for 20
minutes per wash. Pretreatment with sodium thiosulfate pentahydrate (0.02% (wlv)
Na2S203-5H20) for 1 minute was followed by 3 x 20 second rinses with distilled water.
Gels were stained for 20 minutes [0.2% (wlv) AgN03, 0.03% (vlv) formaldehyde (fiom a
37% solution in water)] and rinsed 3 times for 20 seconds with distilled water. The
protein spots became visible after developing the gels in sodium carbonate in the
presence of formaldehyde [6% (wlv) Na2C03, 0.02% (viv) formaldehyde (fiom a 37%
solution in water), 2 ml of pretreatment solution per 100 ml (Na2S203-5H20)].
Immersing the gels in stop solution [50% (vlv) methanol, 12% (vlv) acetic acid] halted
the developing reaction. After stopping the silver stain reaction, gels were transferred
and put into distilled water before drying using a Bio-Rad GelAir Drying System
according to the manufacture instructions.
4.4 Western Immunoblotting
At times, 2D gels were transferred to a 0.2pm nitrocellulose membrane
(Schleicther and Schuell) after the 2" dimension run using the Western Blotting
equipment from Bio-Rad for 1 hour at 100 V in the presence of cold transfer buffer (27
mM Tris, 192 mM glycine and 20% (vlv) methanol).
Upon completion of the transfer, the blots were incubated for 20 minutes in a
blocking solution of 3% (wlv) BSA prepared with 1 x PBS (140 mM NaCI, 27 mM KC1,
43 mM Na2HP04). The blocking solution was removed and the blots were incubated in
primary antibody ovemight at room temperature. Three different monoclonal mouse
anti-P. aeruginosa OprF antisera diluted in lx PBS/l% (wlv) BSA that have been
previously described (Martin et al., 1993) were used in these experiments: MA 4-4,
MA7- 1, and MA7-3. The next day, the blots were rinsed briefl y with 1 x PBS and
incubated for 1 hour at room temperature with a 115000 dilution of secondary antibody,
peroxidase conjugated goat anti-mouse IgG (Kirkegarad and Perry Laboratories Inc.) in 1
x PBS/I% (wlv) BSA. The membranes received 3 x 5 minute washes in 1 x PBS.
Detection was performed using either the LumiGLO chemilurninescent detection kit on
film (Kodak) or TMB membrane peroxidase substrate system both from Kirkegaard and
Perry Laboratories Inc.
4.5 Determination of Molecular Wei~hts and Isoelectric Points of Unknown Proteins
A pI marker consisting of proteins with known molecular weights and known pIs
was used to establish the pH range of the gels (Appendix). The pI marker was included
with each 2D gel run for each protein population once a balance between focusing of
both the pI marker and the protein population had been determined. The pls of key
proteins that appeared on al1 of the gels from the same protein population were initially
approximated using the pI marker 2D gel. The molecular weights of the key proteins
were estimated using the molecular weight standards in the 2nd dimension. Thus, using
these key proteins, the pH gradient of subsequent gels could be standardized. Using the
established pH gradient and the molecular weight standards, the pI and molecular weights
of proteins of interest could be determined.
Results
1. Construction of a Genomic Library
A cosmid library was constructed using the vector pLAFR3 and wild-type P.
aeruginosa chromosomal DNA as the insert DNA. pLAFR3, a 24.6 kb cosmid, was
completely digested with HindIII was dephosphorylated and a test ligation was
performed to ensure that the cosmid was completely dephosphorylated. Chromosomal P.
aeruginosa DNA was partially digested with HindIII to generate 30 kb fragments via size
fractionation using spin columns. The eluent from several fractions was collected,
combined and the DNA was precipitated out. Dephosphorylated pLAFR3 was ligated to
the 30 kb inserts in a 9: 1 molar ratio of vector to insert DNA and a final concentration of
greater than 200 pglml of DNA in the ligation reaction was needed to favor concatemeric
DNA formation. The ligation reaction was packaged and titered; however, the titer was
lower than optimal (optimal: 5 x 1005 x 10' colonies/pg DNA packaged; actual: 6.5 x
10' colonieslpg DNA packaged), which will be taken into account for future library
screens.
Afier ampli@ing and storing the library at - 70°C, it was tested to see if a specific
gene could be cloned from the library. Previously the periplasmic oxidoreductase DsbA
has been successfully cloned from a wild-type P. aeruginosa lambda zap library by C.
Bouwman, using a 400 bp dsbA P. aeruginosa DNA probe. Thus, we tried to clone
DsbA from the cosmid library. A colony hybridization was performed on one of the
original amplification plates using this probe. Figure 2 represents double digests of wild-
type P. aeruginosa and six clones that were isolated and double digested with EcoRI and
HindIII to see if any contained a known insert size of 4.7 kb (Fig. 2B, lane 1-6). A
Figure 2. Agarose gels with HindIII and EcoRl double digests of wild-type P.
aeruginosa (Panel A; lane 1) and 6 possible dsbA-containing clones (Panel B; lane 1-6).
The DNA was transferred to a nylon membrane and probed with a 400 bp DIG-labeled P
aeruginosa dsbA probe. The corresponding Southern blot for wild-type P. aeruginosa is
illustrated in Panel A (lane2) and in panel B (lane 7-12) for the 6 possible dsbA-
containing clones. The arrow in both figures indicates the 4.7 kb fragments containing
dsbA.
southern hybridization was carried out on the six clones (Fig. 2B, lane 7-12) as well as
wild-type P. aeruginosa as the positive control (Fig. 2A, lane 2). It can be seen in Figure
1 A and 1 B that the probe reacted with a DNA fiagment of approximately 4.7 kb in the
positive control (Fig. 2A lane 2) as well as three of the six possible dsbA containing
clones (Fig. 2B lane 7,8 and 12), suggesting that these clones contain the dsbA gene.
2. 2D PAGE
2.1 O~timization of 2D PAGE Technique
Proteins can be studied in various ways, including using polyacrylamide gel
electrophoresis. 1 D gels are routinely used to analyze proteins; however, they only
separate proteins according to molecular weight. On the other hand, 2D gels separate
proteins on the basis of size and charge, resulting in a better separation of a protein
population. Figure 3 shows a 1 D gel and corresponding 2D gels of the protein profile of
an outer membrane protein enrichment from wild-type P. aeruginosa with and without
the addition of a reducing agent. A protein band on a 1 D gel may consist of more than
one protein whereas a protein spot on a 2D gel represents a single protein. For exarnple,
on a ID gel (Fig. 3A, lane l), a few bands are obsewed between 36.5 and 42.7 kDa.
However, each of those single bands on a 1 D gel consists of multiple proteins that are
similar in size but have differing pIs after separation using 2D PAGE (Fig. 3B).
Another advantage of 2D PAGE over 1 D PAGE is the ability to use 2D PAGE to
specifically detect proteins within a protein population that may be changing in response
to an external condition. On a 1 D gel, a prominent band at approximately 33 kDa shifts
up afier the addition of dithiothreitol (DTT), a chemical that breaks disulfide bonds (* in
Fig. 3A, lane 2). 2D PAGE analysis reveals that the single band on the ID gel has 2
Figure 3. Comparison of 1 D and 2D gels using outer membrane protein enrichrnents
from wild-type P. aeruginosa in the absence (-) and presence (+) of DTT. Panel A
illustrates the 12% Coomassie Blue stained 1 -D gel (lane 1 : -DTT; lane 2: +DTT), panel
B illustrates the corresponding 12% silverstained 2-D gel of panel A lane 1 (-DTT) and
panel C, the corresponding 12% silverstained 2-D gel of panel A lane 2 (+DTT). The
asterisk (*) indicates a prominent protein band that shifts up after the addition of DTT.
The arrow in panel B and C indicate that the prominent band contains 2 proteins that are
shifting up after the addition of DTT.
proteins that are demonstrating an upward shift in mobility after the addition of DTT
(arrow in Fig. 3B and C), suggesting that these proteins have a disulfide bond.
A concem that arises when using this technique is the question of reproducibility.
Electrophoresis conditions in the first dimension run were established for each protein
population and were maintained for subsequent runs. Making solutions up in batch
volumes, such as the 1 '' dimension acrylamidehis monomer solution and the 1 "
dimension solubilization buffer minimized variability between electrophoresis runs. In
the mini-gel system that was used, reproducibility and resolution were maximized by
achieving a balance between ampholyte concentration, maximum protein load, run time
and focusing of proteins and pI marker. Optimal conditions over a limited pI range (PI
4.5-5.6) have been established to resolve many proteins found within the periplasm, the
outer membrane and extemal environment.
Reproducibility was assessed visually by comparing gels of sequential protein
preparations over multiple 2D gel runs under previously established conditions. Figure 4
illustrates 2D gels of secreted proteins isolated from culture supernatant of a P.
aeruginosa dsbA nul1 mutant on two separate occasions. Secreted proteins were isolated
exactly the same way and approximately equal amounts of protein were loaded ont0 each
gel. The protein profiles are very similar suggesting that this technique is reproducible.
However, from time to time, the pH gradient may not be exactly similar between gels of
different 2D gel runs or gels of the sarne m. Anything that interferes with current flow
within the tube gel, such as air bubbles, dirt or dust, unpolymerized acrylamide or
insoluble protein, c m cause an extension in the pI range of the gel. An extemal marker
was included in most runs to monitor the stability and reproducibility of the pH gradient.
Figure 4. 12% silverstained 2D gels of secreted proteins isolated from a P. aeruginosa
dsbA nul1 mutant on two separate occasions. Secreted proteins were isolated in exactly
the same manner and approximately equal arnount of protein was loaded ont0 each gel.
To visualize proteins on the 2D gels, the gels had to be stained. Coomassie-Blue
staining was tried; however, it was not sensitive enough; thus, we turned to silver
staining. Various silver stain protocols were tested; but many of them resulted in much
background staining and the protein spots could not be seen. The silver stain of choice,
developed by Blum et al. (1 987), limits unspecific background staining and has proven to
be extremely sensitive in detecting trace amounts of protein on an almost clear
background.
2.2 Protein Isolation
The process of disulfide bond formation takes place in the periplasm of Gram-
negative bacteria. Proteins destined for the periplasm, the outer membrane or the
extemal environment will acquire their disulfide bonds as they pass through the
periplasm. Thus, periplasmic, outer membrane enrichment and secreted proteins from
wild-type and a dsbA nul1 mutant were investigated to determine which ones may contain
disulfide bonds. Iodoacedamide was added to the cultures (final concentration of 100
mM) prior to isolation of the proteins. Iodoacetarnide alkylates free cysteines and
irreversibly blocks disulfide bond formation so that spontaneous disulfides do not form
via air oxidation. However, iodoacedamide is inactive against disulfide bonds that have
been previously formed (Bardwell et al., 1991). Thus, in this way, a still photograph of
those proteins that have disulfide bonds could be taken.
In the mini-gel system used in this project, it would be too confusing to look for
disulfide bond-containing proteins in a complex population. Examining subfractions of a
more complex protein population simplifies this task. Thus, periplasmic proteins, outer
membrane protein enrichrnents and secreted proteins, three subfractions of the entire P.
aeruginosa protein population, were analyzed separately.
Secreted proteins were isolated from culture supernatant fiom an ovemight LB
culture via TCA precipitation followed by acetone extraction. Figure 5A represents a
1 D gel comparing the protein profiles of whole cells (lane 2) and proteins in culture
supernatant (lane 1) from wild-type P. aeruginosa. It can be clearly seen that the protein
profile of the secreted proteins isolated from culture supernatant is different and contains
fewer proteins compared to that of a whole ce11 lysate, suggesting that the isolation of
secreted proteins fiom culture supernatant was successful.
Outer membrane protein enrichrnents were prepared fiom an envelope
preparation (French pressed whole cells) using Triton X-100 solubilization and lysozyme
digestion. Figure 5B illustrates the protein profile at each step of the outer membrane
protein isolation procsdure of wild-type and a dsbA nul1 strain of P. aeruginosa. It is
evident that proteins are being removed at each step of the fiactionation procedure. The
final outer membrane protein enrichment profile is similar to that of the starting envelope
preparation; however, there are fewer proteins. This implies that the isolation procedure
enhanced for outer membrane proteins.
Periplasmic proteins were isolated fiom cells at mid-log phase of growth using a
method involving osmotic shock. The periplasmic proteins, released from the cells, were
concentrated using spin filters with a molecular weight cut off of 3 kDa. Periplasmic
preparations were checked for contamination with inner membrane proteins by
performing a succinate dehydrogenase assay. Succinate dehydrogenase is an inner
membrane protein that is involved in the transfer of reducing equivalents from succinate
Figure 5. Panel A: A 12% Coomassie blue stained 1 D gel of secreted proteins isolated
from culture supernatant from wild-type P. aeruginosa (lane 1) and whole ce11 lysate
from wild-type P.aeruginosa (lane 2). Panel B: A 12% Coomassie blue stained
1 D gel of the protein profile at each step of an outer membrane protein enrichment
procedure using wild-type and a dsbA nul1 strain of P. aeruginosa. Lane 1 : wild-type
envelope preparation, 2: dsbA nul1 mutant envelope preparation, 3: wild-type imer
membrane fraction, 4: dsbA null mutant inner membrane fraction, 5: wild-type
peptidoglycan fraction, 6: dsbA null mutant peptidoglycan fraction, 7: wild-type outer
membrane protein enrichment fraction, 8: dsbA null mutant outer membrane protein
enrichment fraction.
to the respiratory chain (Owen et al., 1982). The activity of the enzyme can be assayed if
the reaction is coupled to another reaction that can be easily monitored by a change in the
reactants or products. In the succinate dehydrogenase assay, an indicator called
dichlorophenolindophenol (DCPIP) is blue in the oxidized state but becomes colorless
when reduced. The color change can be quantified by monitoring the change in
absorbance with a spectrophotometer at a wavelength that is strongly absorbed by the
blue f o m (A=600 nm). Absorbance decreases as the DCPIP becomes reduced by the
electrons donated to it by reduced flavin adenine dinucleotide (FAD), a prosthetic group
that is covalently bound to succinate dehydrogenase (Owen et al., 1982).
In this experiment, inner mitochondrial membranes from yeast cells and whole
ceIl lysate were used as the positive controls. Sterile water was used as the negative
control and as the blank. The amount of reduction of DCPIP was quantitated
spectrophotometry and the nurnber of moles determined using its extinction coefficient.
Using the nurnber of moles produced divided by incubation time generated the reaction
velocity. Specific activity of the samples was determined by dividing the reaction
velocity by the amount of protein in each sample (Table 2). Specific activity refers to the
number of enzyme units per milligram of protein and is a measure of enzyme purity. One
unit of enzyme activity is defined as the amount of enzyme causing transformation of one
micromole of substrate per minute at 25°C.
Table 2. The specific activity calculated after performing a succinate dehydrogenase assay on sterile water, two positive controls (yeast cells and wild-type P. aeruginosa whole ce11 lysate) and on periplasmic protein extracts from wild-type and a dsbA null strain of P. aeruainosa..
1 Sample 1 Specific Activity 1 Sterile water Yeast cells
Whole ce11 lysate
The specific activity for both positive controls (yeast cells and whole ce11 lysate)
were similar. Likewise, both of the positive controls demonstrated higher enzymatic
activity than both of the periplasmic preparations. The results based on the succinate
dehydrogenase assay suggest that there is little contamination of the periplasmic protein
preparations with imer membrane proteins.
To m e r assess whether or not the protein populations of interest consisted
primarily of proteins fiom the respective compartments, proteins samples fiom wild-type
P. aeruginosa were analyzed using 2D PAGE (Fig. 6A-C). Comparing the protein
profiles of the protein preparations fiom the three populations reveals three distinct
patterns, involving the nurnber and size of proteins found within each population over a
narrow, but similar pI range. The pI range used in the mini gels (approximately 4.5 to
5.6) was focused in this range to serve as a starting point to locate disulfide bond
containing proteins. Based on these gels from Figure 6, it suggests that the isolation
techniques were successful at isolating particular protein populations from an entire
protein population.
(unitsl pg total protein) O
10.52 4.66
Wild-type periplasmic extract DsbA nul1 rieririlasmic extract
0.90 0.28
Figure 6. Silver stained 2D gels of secreted proteins (panel A, 12% gel), outer membrane
protein enrichments (panel B, 12% gel) and periplasmic proteins (panel C, 13.5% gel)
isolated fiom wild-type P. aeruginosa. The pI range of al1 three gels is approximately 4.5
to 5.6.
2.3 Analvsis of Disulfide Bond Containing Proteins using 2D PAGE
Once the technique of 2D PAGE had been perfected and the running conditions
for each protein population were established, it was possible to use 2D PAGE for an
application. Specifically, 2D PAGE was used to identi@ proteins in P. aeruginosa that
contain disulfide bonds in the pI range of 4.5 to 5.6 and, of these, determine which rely
on DsbA either directly or indirectly to acquire disulfides. To do this, proteins were
isolated fiom wild-type and a dsbA nuIl mutant and separated out using 2D PAGE in the
absence and presence of the reducing agent DTT.
When conducting 2D PAGE analysis of disulfide bonded proteins, several
scenarios are possible. In the absence of a disulfide bond, the mobility shifts of proteins
are not affected by a reducing agent; however, disulfide bond containing proteins will
demonstrate a mobility shift (upward or downward shift) in the presence of a reducing
agent, such as DTT (Scheele and Jacoby, 1982). Proteins from wild-type P. aeruginosa
that rely directly on DsbA to acquire their disulfide bonds would demonstrate mobility
shift after the addition of DTT. These proteins would also demonstrate a similar shift in a
dsbA nul1 strain whether DTT was present or not, assuming they have not been degraded.
Proteins that rely indirectly on the activity of DsbA for proper processing or require
interactions with DsbA to function properly would be present in wild-type and would not
change in mobility. with or with out DTT; however, these proteins would be absent in the
dsbA null mutant. Finally, proteins that are independeiit or not completely dependent
upon the activity of DsbA to acquire their disulfide bonds would demonstrate a simiiar
mobility shift in both wild-type and dsbA null mutant in the presence of DTT.
Each protein population was examined separately to simpli@ the task of
determining the number of disulfide bond-containing proteins in P. aeruginosa. Proteins
were isolated, solubilized and nin in the 1'' dimension. Prior to the 2" dimension run,
tube gels were extruded and allowed to equilibrate in equilibration buffer with or without
DTT. If DTT was added prior to the 1 '' dimension run, proteins could shift in both pI
(side to side) and molecular weight (up and down). The addition of DTT after the 1 '' dimension run simplifies the end analysis as only shifts in molecular weight (up and
down) would occur. This was followed by a soak in equilibration buffer with
iodoacedamide. Iodoacedamide not only prevents spontaneous disulfide bond formation
(Bardwell et al., 199 l), but it also alkylates any unreacted DTT to prevent point streaking
and other silver staining artifacts (Dunbar, 1987). The 2" dimension was then carried out
for each protein population, the subsequent gels were silver stained, dried and analyzed
for disulfide bond-containing proteins.
Under the established running conditions, 4 out of 53 (7.5%) of the total secreted
protein population of the wild type strain (Fig. 7) demonstrated a mobility shift,
suggesting that these proteins contain disulfide bonds. Specifically, two proteins in
particular were examined more closely and are illustrated in Figure 8. Protein S 1 has an
apparent molecular weight of 60 kDa and pI of 5.6. After the addition of DTT to wild-
type and dsbA null mutant, the S 1 protein shifts up. Likewise, protein S4, having an
apparent molecular weight of 40 kDa and pI of 5.3 also shifts up after the addition of
DTT to wild-type and dshA null mutant. These two proteins seem to contain a disulfide
bond because they demonstrate a mobility shift in the presence of DTT. However, a
Figure 7. 12% silver stained 2D gels of secreted proteins fiom wild-type and dsbA null
strain of P. ueruginosu in the presence (+) and absence (-) of DTT. Panel A: wild-type, -
DTT; B: wild-type, +DTT; C: dsbA null mutant, -DTT; D: dsbA null mutant, + DTT.
"- b
"!
II)
m mi
'9- V)
Figure 8. Sections of 12% silver stained 2D gels of secreted proteins isolated fiom
culture supernatant of wild-type and dsbA null strain of P. aeruginosa in the presence (+)
or absence (-) of DTT. Panel A: wild-type, -Dm; B: wild-type, +DTT; C: dsbA null
mutant, -DTT; D: dsbA null mutant, + DTT. Protein S 1 (MW 60 kDa, pl 5.6) and
protein S4 (MW 40 kDa, pI 5.3) shift up after the addition of DTT to wild-type and dsbA
nul1 mutant.
similar effect is seen in both wild-type and dsbA null mutant, suggesting that S 1 and S4
do not rely solely on DsbA to acquire their disulfide bonds.
Analysis of the outer membrane protein enrichrnents under fixed conditions
revealed that 10 of 2 19 (4.5%) of the total outer membrane protein population (Fig. 9)
contain disulfide bonds. A closer look at individual proteins within this population is
illustrated in Figures 10- 13.
Protein 09, depicted in Figure 10, has an apparent molecular weight of 60 kDa
and pI of 4.7. A portion of this protein shifts up in the presence of DTT in wild-type and
dsbA null mutant, independent of DTT, suggesting that this protein contains a disulfide
bond and must rely on DsbA to acquire its disulfide bond.
Figure 1 1 illustrates protein 0 1 that has an apparent molecular weight of 15 kDa
and pI of 4.8. This protein shifts up in wild-type after the addition of DTT and in the
dsbA null mutant. This protein must rely on DsbA to acquire its disulfide bond since the
mobility shift is independent of the presence of DTT in the null background. On the
other hand, protein 02, having an apparent molecular weight of 20 kDa and pI 4.6
appears after the addition of DTT to the wild-type and the dsbA null mutant. Since the
original position in the absence of DTT has not been located, the appearance of this
protein seems to suggest that it contains a disulfide bond, but does not rely on DsbA to
acquire it.
In Figure 12, protein 06, having an apparent molecular weight of 36 kDa and pI
of 4.8 demonstrates an upward shift in mobility in the presence of DTT in wild-type and
dsbA null mutant, implying that this protein does contain a disulfide bond, but does not
Figure 9. 12% silver stained 2D gels of outer membrane protein enrichrnents isolated
from wild-type and dsbA nul1 strain of P. aeruginosa in the presence (+) and absence (-)
of DTT. Panel A: wild-type, -DTT; B: wild-type, + D m ; C: dsbA nul1 mutant, -DTT; D:
dsbA nul1 mutant, + DTT.
Figure 10. Sections of 8% silver stained 2D gels of outer membrane protein enrichrnents
from wild-type and dsbA null strain of P. aeruginosa in the presence (+) or absence (-) of
DTT. Panel A: wild-type, -DTT; B: wild-type, +DTT; C: dsbA nul1 mutant, -DTT; D:
dsbA null mutant, + DTT. Protein 0 9 (MW 60 kDa, pI 4.7) shifts up in wild-type after
the addition of DTT and in the dsbA null mutant, independent of DTT.
Figure 11. Sections of 13.5% silver stained 2D gels of outer membrane protein
enrichments from wild-type and dsbA null strain of P. aeruginosa in the presence (+) or
absence (-) of DTT. Panel A: wild-type, -DTT; B: wild-type, +DTT; C: dsbA null
mutant, -Dm; D: dsbA null mutant, + DTT. Protein 0 1 (MW 15 kDa, pI 4.8) shifts up
in wild-type and dsbA null mutant after the addition of DTT. This shift is depicted by an
asterix (*) in panel B and D. Protein 0 2 (MW 20kDa, pI 4.6) appears after the addition
of DTT to wild-type and dsbA null mutant.
Figure 12. Sections of 12% silver stained 2D gels of outer membrane protein
enrichrnents from wild-type and dsbA null strain of P. aeruginosa in the presence (+) or
absence (-) of DTT. Panel A: wild-type, -DTT; B: wild-type, +DTT; C: dsbA null
mutant, -DTT; D: dsbA null mutant, + DTT. Protein 04A (MW 32kDa, pI 4.6), protein
04B (MW 32 kDa, pI 4.4) and protein 0 6 (MW 36 kDa, pI 4.8) shift up afier the
addition of DTT to wild-type and dsbA nul1 mutant. Protein 0 5 (MW 27 kDa, pI 4.9)
appears after the addition of DTT to wild-type and dsbA nul1 mutant.
rely on DsbA to acquire it. Protein 05, having an apparent molecular weight of 27 kDa
and pI of 4.9 appears after the addition of DTT to wild-type and dsbA null mutant
(Fig. 12). The original position in the absence of DTT has not been determined;
however, because it appears in wild-type and dsbA null mutant in the presence of DTT, it
can be inferred that this protein does contain a disulfide bond, but does not rely on the
activity of DsbA to obtain it. Protein 04A and 04B (Fig. 12) have an apparent
moIecu1ar weight of 32 kDa and pI of 4.6 and 4.4. Similar shifts up after the addition of
DTT to wild-type and dsbA null mutant are observed, suggesting that these proteins do
contain a disulfide bond and do not rely on DsbA to acquire it.
It was assurned that at least one of these two proteins was OprF because the
apparent molecular weight (32 kDa) was similar to the theoretical molecular weight (35
kDa), although not as much similarity was found between the apparent pI (4.4 or 4.6) and
calculated pI (4.86). Also, the fact that both proteins demonstrated mobility shifts after
the addition of DTT, suggested that they contained a disulfide bond. OprF is a major
outer membrane porin protein in P. aeruginosa and is known to contain two disulfide
bonds (Hancock and Carey, 1979).
Western blot analysis using three different monoclonal antibodies against OprF
that have previously been described (Martin et al., 1993) was performed on wild-type
(Fig. 13A) and oprF null mutant (Fig. 13E) outer membrane protein enrichments in the
presence of DTT to confirm that one of the two proteins was OprF. MA 4-4 recognizes
just the oxidized form of OprF. MA 7-1 and MA 7-3 recognize both oxidized and
reduced forms of OprF; however, the epitope of 7-3 incorporates four cysteine residues
whereas MA 7-1 does not. MA 4-4 reacted with several bands that could correspond to
Figure 13. Western blot analysis using three different anti-OprF antibodies performed on
wild-type (2D gel in panel A with corresponding western blots in panel B-D) and oprF
nul1 strain (2D gel in panel E with corresponding western blot in panel F) of
P. aeruginosa outer membrane protein enrichments in the presence of DTT. MA7-1 and
MA7-3 recognize oxidized and reduced forms of OprF; however, the epitope of MA 7-3
incorporates four cysteine residues whereas MA7-1 does not. MA 4-4 recognizes only
the oxidized form of OprF. Panel A: 12% silver stained 2-D gel of wild-type P.
aeruginosa; B: western blot probed with MA 4-4; C: western blot probed with MA 7-1;
D: western blot probed with MA 7-3; E: 12% silver stained 2-D gel of oprF nul1 strain of
P. aeruginosa; F: western blot probed with MA 7-3.
-reduced . oxidized -f- oxidized
B- . ,. ..*
reduced 32.5 - --- - a .A. -- , ==?"- f-oxidized 32.5 - . =
4- reduced 4- oxidized
oxidized and partially reduced forms of OprF (Fig. 13B). Western blots using MA 7-1
and 7-3 (Fig. 13C and D) reacted again with several bands that probably represent
oxidized, partially reduced and reduced forms of OprF. No forms of OprF were detected
in the oprF null mutant after probing with MA 7-3 (Fig. 13F). This data indicates that al1
of these protein spots are forms of the major P. aeruginosa porh protein OprF.
Analysis of the periplasmic proteins under established running conditions
revealed that 6 out of 175 proteins (3.4%) of the total periplasmic protein population (Fig.
14) demonstrate a mobility shift afier addition of DTT, suggesting that these proteins
contain disulfide bonds. Individual proteins within this population are illustrated in
greater depth in Figures 15- 17.
Protein P3, with an apparent molecular weight of 95 kDa and pI of 4.4 is
portrayed in Figure 15. This protein shifts slightly upward after the addition of DTT to
wild-type; however, is absent in a dsbA null mutant, regardless of the addition of DTT.
The implications are that protein P3 contains a disulfide bond and does rely on DsbA to
acquire it.
Figure 16 illustrates proteins P2, P5 and P7. Protein P2, having an apparent
molecular weight of about 15 kDa and pI of 5.3, is present in minute amounts in wild-
type with and with out the addition of DTT; while it is present in larger quantities in a
dsbA null mutant with and without the addition of DTT. This suggests that DsbA has
some type of impact on the quantity of synthesis of P2. Protein P5, having an apparent
molecular weight of 22 kDa and pi of 5.6, is in wild-type and absent in the dsbA null
mutant, independent of the presence of DTT. This implies that this protein does not itself
contain a disulfide bond, but may rely on another disulfide bond containing protein for
Figure 14. 13.5% silver stained 2D gels of periplasmic proteins fiom wild-type and dsbA
nul1 strain of P. aeruginosa in the presence (+) and absence (-) of DTT. Panel A: wild-
type, -Dm; B: wild-type, +Dm; C: dsbA nul1 mutant, -Dm; D: dsbA nul1 mutant, +
DTT.
Figure 15. Sections of 8% silver stained 2D gels of periplasmic proteins fiom wild-type
and dsbA null strain of P. aeruginosa in the presence (+) or absence (-) of DTT. Panel A:
wild-type, -Dm; B: wild-type, +Dm; C: dsbA nul1 mutant, -Dm; D: dsbA null mutant,
+ DTT. Protein P3 (MW 95kDa, pI 4.4) demonstrates a slight upward mobility shift after
the addition of DTT to wild-type but is absent in a dsbA null mutant, regardless of the
addition of DTT.
C 4.5 k û a I
Figure 16. Sections of 13.5% silver stained 2D gels of periplasmic proteins from wild-
type and dsbA null strain of P. aeruginosa in the presence (+) or absence (-) of DTT.
Panel A: wild-type, -DTT; B: wild-type, +DTT; C: dsbA null mutant, -DTT; D: dsbA
null mutant, + DTT. Protein P2 (MW 1 5kD4 pI 5.3) is present in minute arnounts in
wild-type with or without DTT and in larger quantities in the dsbA null mutant in the
presence or absence of DTT. Protein P5 (MW 22 kDa, pI 5.6) is present in wild-type and
absent in the dsbA nuIl mutant, regardless of the addition of DTT. Protein P7
(MW 25 kDa, pI >5.6) appears after the addition of DTT to wild-type and dsbA null
mutant.
proper processing. Protein P7, having an apparent molecular weight of 25 kDa and pI of
greater than 5.6, appears after the addition of DTT to wild-type and dsbA null mutant.
Since the original position in the absence of DTT has not been located, the appearance of
this protein seems to suggest that it contains a disulfide bond but does not rely on DsbA
to acquire it.
Proteins Pl and P8, illustrated in Figure 17, have an apparent molecular weight of
40 kDa and 42 kDa and pI of greater than 5.7 and approximately 5.7, respectively. They
both demonstrate some type of mobility shift after the addition of DTT to wild-type and
dsbA null mutant, implying that both proteins have a disulfide bond but do not rely on
the activity of DsbA to obtain it.
Figure 17. Sections of 13.5% silver stained 2D gels of periplasmic proteins from wild-
type and dsbA null strain of P. aeruginosa in the presence (+) or absence (-) of DTT.
Panel A: wild-type, -DTT; B: wild-type, +DTT; C: dsbA null mutant, -DTT; D: dsbA
null mutant, + DTT. Protein Pl (MW 40 kDa, pI >5.7) and protein P8 (MW 42 kDa, pI
5.7) demonstrate mobility shifts after the addition of DTT to wild-type and dsbA null
mutant.
Discussion
To begin this project, a cosmid library was created to serve as a source for clones
containing genes of proteins that have not yet been characterized. It was constructed
using the vector pLAFR3 and wild-type P. aeruginosa chromosomal DNA. The library
being constmcted used partially digested instead of completely digested chromosomal
DNA. If a complete digestion was used, the library would contain fragments that varied
in size because the distribution of restriction sites is random. AIso, the gene of interest
may contain one or several recognition sites for the restriction enzyme being used. The
gene would be split between different restriction fragments and none of the clones in the
library would contain the complete gene. To avoid these problems, a partial digest is
used. It allows only some, and not al1 of the restriction sequences in the DNA to be cut.
This is accomplished by keeping the concentration of the restriction enzyme low or
incubating the reaction for only a short penod of time until the desired insert size is
obtained (Synder and Champness, 1997).
Upon packaging and titering of the library, it was noted that the titer was lower
than optimal (optimal 5 x 104-5 x 105 colonies/pg DNA packaged; actual: 6.5 x 104
colonies/pg DNA packaged). This suggests that the library is under representative of the
entire genome as it is now and the chances of finding a specific gene of interest are
diminished. Thus, in future library screens, this under representation will have to be
taken into account by screening additional cosmid clones.
The library was tested to see if a specific gene could be cloned from the library.
DsbA, the periplasmic oxidoreductase, was previously cloned from a P. aeruginosa
lambda zap library constructed by C. Bouwman, using a 400 bp dsbA P. aeruginosa
DNA probe and was the gene of choice. Three of the six possible dsbA containing clones
found in an initial screen of the cosmid library were positive for dsbA (Fig. 2). Thus,
although this cosmid library may be under representative of the entire genome, it is still
possible to clone a gene from the cosmid clones and will serve as a gene pool of clones
containing proteins that have not yet been described.
In addition to the construction of the genomic library, the main goal of this
project was to become skiIled in the art of 2D PAGE and then to apply this technique to a
specific application. Disulfide bond containing proteins in three extracytoplasmic
compartments with pIs ranging from 4.5 to 5.6 were exarnined and the requirement for
DsbA for disulfide bond formation was determined for each disulfide bond containing
protein.
2D PAGE is much more useful than 1 D PAGE in locating specific proteins within
a protein population that change in response to an extemal condition. After addition of
DTT, a reducing agent that breaks disulfide bonds, to a protein population, 1 D gel
analysis reveals only a single band that demonstrates an upward shift in mobility (* in
Fig. 3A, lane 2). 2D gel analysis of the sarne protein population under the same reducing
environment shows that there are in fact two proteins that are shifting upwards, two
proteins with similar molecular weights but different pIs (arrow in Fig. 3B and C). This
suggest that the two proteins contain at least one disulfide bond. It also illustrates the
handiness of this technique for examining the effects of change in the extemal
environment on specific proteins within a protein population.
One of the draw backs of 2D PAGE using tube gels is obtaining reproducible
results from run to run. The run to run variability was minimized by making solutions up
in batch volumes and establishing the running conditions for each protein population.
Running conditions were determined by achieving a balance between ampholyte
concentration, maximum protein load, run time and focusing of proteins and pI marker.
Reproducibility was achieved in this project and was assessed visually by comparing gels
of sequential preparations over multiple 2D gel runs under previously established
conditions. The procedure for establishing reference protein spots to allow assessment of
reproducibility is outlined in the Appendix.
Proteins on the 2D gels were visualized via silver staining. Many silver stains
were tested; however, they were either not sensitive enough or had too high a background
staining. The protocol of choice, developed by Blum et al. (1 98î), proved to be very
good. After gels were fixed in a solution consisting of methanol and acetic acid and
formaldehyde, gels were pretreated with low amounts of thiosulfate. This helped
specifically in the reduction of silver ions that form and attach to the gel surface,
impairing contrast. Thiosulfate chemically dissolves silver salts by complexation and
also increases the sensitivity of silver staining. The end result is a sensitive and
reproducible staining protocol that is easy to use and allows the detection of nanogram
quantities of proteins on a clear, transparent background.
Since disulfide bond formation takes place in the periplasm of Gram-negative
bacteria, proteins destined for the extracellular environment, the outer membrane or the
periplasm will acquire any disulfide bonds via the periplasm en route to their final
destination. The capacity of the mini-gel system used in this study was not sufficient to
examine the entire P. aeruginosa protein population. Thus, three subfractions of the
entire protein population were looked at, that of outer membrane protein enrichments,
secreted proteins, and periplasmic proteins. Iodoacedamide was added to the cultures
prior to isolation of specific protein populations to prevent spontaneous disulfide bond
formation from occurring (Bardwell et al., 199 1). This approach was designed to gain
insight into the number of proteins that contain disulfide bonds in each protein
population.
The first protein population of interest was the secreted proteins. Visual
cornparison of the protein profile of whole ce11 lysates and secreted proteins isolated fiom
culture supernatant on a 1D gel clearly illustrates differences in the two profiles
(Fig. 5A). The secreted protein profile is distinct fiom that of the whole ce11 lysate and
contains fewer proteins, indicating that the isolation procedure was successful.
The second protein population to be examined was the outer membrane proteins.
1 D gel analysis of the protein profile at each step of the isolation protocol revealed not
only that proteins were being removed at each step, but the end protein profile contained
fewer proteins than that of the starting envelope preparation and was similar to the
starting prep (Fig. 5B). This implies that the protocol did enhance for outer membrane
proteins.
The 1s t protein population of interest was the periplasmic proteins. Periplasmic
preparations were checked for contamination with inner membrane proteins by using a
succinate dehydrogenase assay. According to the specific activity calculated for each
preparation, both of the periplasmic protein extracts of wild-type and the dsbA nul1
mutant displayed much lower enzymatic activity than that of the two positive controls
(yeast cells and whole ce11 lysate) (Table 2). Based on the succinate dehydrogenase assay
results, it was concluded that there was very little contamination of the periplasmic
proteins with inner membrane proteins.
To ascertain that the protein populations of interest consisted predominantly of
proteins from the respective protein populations, P. aeruginosa samples were analyzed
using 2D gels (Fig. 6). The protein profile of al1 three populations were different over a
similar but narrow pH range (approximately 4.5 to 5.6). For exarnple, there are more
proteins in the outer membrane protein enrichments and periplasmic protein profile than
the secreted protein profile. In general, there are differences in the number, the sizes and
the pIs of the proteins found within each of the three protein populations, implying that
these are indeed three distinct populations and that the isolation techniques for obtaining
these protein populations from an entire protein population were successful.
Upon optimization of the 2D gel technique and establishing the running
conditions for the secreted proteins, the outer membrane protein enrichrnents and the
periplasmic proteins, the 2D gels could be used for a specific task. 2D PAGE was used
to detect disulfide bonded containing proteins in P. aeruginosa that rely on DsbA to
acquire them either directly or indirectly. Proteins were isolated from wild-type and a
dsbA nul1 mutant and separated out using 2D PAGE with and without the addition of the
reducing agent DTT. The proteins analyzed are summarized in Table 3. Al1 of the
proteins discussed whose initial and final positions are known display an upward shifi in
mobility. The type of mobility shift (upward or downward) of those proteins whose
initial positions are not known but whose final positions are known cannot be determined.
Table 3. Summary of the disulfide bond-containing proteins from the extracellular environment, the periplasm and the outer membrane of P. aeruginosa that were identified after isolation of wild-type and dsbA nul1 strain in the presence and absence of DTT
During the analysis of the three protein populations, it was found that three
proteins displayed a mobility shifi in the dsbA null mutant, independent of DTT
(Table 3). These proteins included protein 0 9 (Fig. 10) and 0 1 (Fig. 1 1) from the outer
membrane protein enrichments and protein P3 fiom the periplasmic protein population
(Fig. 15). The results indicate that these proteins do indeed contain a disulfide bond and
rely on the catalytic activity of DsbA to obtain it.
Upon continuation of the 2D gel analysis, it was found that many proteins
displayed some type of a DTT-dependent mobility shifi in both the wild-type and the
dsbA null strain (Table 3). These proteins included protein S1 and S4 fiom the secreted
protein population (Fig. 8), protein 0 2 (Fig. 1 l), 05 ,06 ,04A and 04B (Fig. 12) fiom
the outer membrane protein enrichments and protein P7 (Fig. 16), Pl and P8 (Fig. 17).
This suggests that these proteins do indeed contain disulfide bonds; however, they do not
rely entirely on DsbA to acquire their disulfide bonds. If they don't rely on DsbA for the
oxidation of their cysteines to disulfide bridges, how are they obtaining them?
In dsbA null mutants, there is still some residual disulfide bond formation
observed. Without the Dsb system, disulfide bond formation is slower, about two orders
of magnitude than what is found in E. coli wild-type strains (Bardwell et al., 1991 ;
Bardwell et al., 1993; Kobayashi et al., 1997). The background oxidation observed may
be due to another weaker or secondary oxidizing system that may or may not take over
when components of the main pathway are absent or darnaged. But, it may also be due to
spontaneous oxidation (Rietsch and Beckwith, 1998). However, air oxidation using
molecular oxygen as a main source of oxidizing power is a slow, mechanistically
complex reaction (Rietsch and Beckwith, 1998) and the folding of a protein in this
environment c m take hours or even days (Bardwell, 1994).
The absence of a functional DsbA may cause other components of the Dsb system
to compensate for the disulfide bond formation. Thiol-disulfide oxidoreductases can be
forced to function as oxidants or as reductants by manipulating the redox environment in
vitro, regardless of their active site disulfide's redox potential or their physiological
tùnction. In addition, DsbC and thioredoxin 1 have been suggested to have an oxidizing
activity under appropriate conditions in vivo. Thioredoxin 1, a major thiol-disulfide
oxidoreductase in the cytoplasm of E. coli is kept in a reduced state by thioredoxin
reductase. In a thioredoxin null mutant, much of the thioredoxin 1 is in an oxidized form
which might promote disulfide bond formation in the cytoplasm in vivo (Stewart et al.,
1998). Exporting thioredoxin 1 to the periplasm of E. coli shows an oxidative function
that c m partially restore the formation of disulfide bonds in a dsbA null strain
(Debarbieux and Beckwith, 1998). DsbC, the bacterial protein disulfide isomerase, can
act as an oxidant in the periplasm of E. coli when the DsbD, the protein required for
DsbC reduction, is eliminated (Missiakas et al., 1995; Reitsch et al., 1996). Although
nothing like this has been described before in the literature, it is possible that in P.
aeruginosa disruption of the dsbA gene has some type of an effect on the Dsb forming
system, and that other proteins in the system, ones that have been previously described or
have yet to be discovered, partially compensate for the lack of a functional DsbA.
The other alternative is that the disulfide bonded proteins may not be dependent
on DsbA to acquire their disulfide bonds. The heat-stable enterotoxin Sta (also known as
STl), secreted by enterotoxigenic strains of E. coli, is responsible for intestinal secretion
and diarrhea (Beltry et al., 1986). It was previously shown that DsbA was involved in
forming the disulfide bond and in a dsbA mutant without these disulfide bonds, these
proteins are degraded during secretion (Okarnoto et al., 1995). More recently Batisson
and Der Vartanian (2000) provided evidence that this enterotoxin can be released from
the ce11 in an unfolded state before being completely disulfide bonded outside the cell,
independent of the dsbA background. Likewise, Pugsley (1 992) previously demonstrated
that pullulanase secretion in KlebsielZa oxyfoca occurred after the formation of at least
one intrarnolecular disulfide bond, that DsbA catalyzed the formation of this disulfide
bond, and that DsbA was required for secretion. Sauvonnet and Pugsley (1998) have
recently shown that the need for DsbA in pullulanase secretion is unrelated to its
capability to catalyze disulfide bond formation in the secreted protein. They have now
suggested that DsbA exhibits a chaperone-like effect that is essential for the proper
folding of this protein. Thus, some of the proteins described in this project (Table 3) may
contain disulfide bonds that have been obtained independent of DsbA.
Two proteins from the outer membrane protein enrichrnents that did not solely
rely on DsbA to acquire their disulfide bonds were investigated further. Protein 04A and
04B (Fig. 12) demonstrated similar mobility shifts after the addition of DTT to wild-type
and dsbA nul1 mutant, suggesting that they possess a disulfide bond. The apparent
molecular weight of both of these proteins (32 kDa) were similar to the theoretical
molecular weight of the major P. aeruginosa outer membrane porin protein OprF (35
kDa). However, the apparent pI of protein 04A and 04B differed from each other (4.4
or 4.6) and from the theoretical pI (4.86). OprF is known to contain two disulfide bonds
(Hancock and Carey. 1979) and based on the results obtained from the 2D gel analysis, it
was thought that at least one of these proteins was OprF. This was confirmed using
Western Blotting using several antibodies against OprF that recognize both oxidized and
reduced forms of the protein. Al1 three antibodies reacted with both 04A and 04B and
OprF was not detected in the oprF null mutant (Fig. 13). It was concluded that both of
these proteins were forms of the porin protein OprF. This is consistent with the fact that
proteins from a single gene product, especially outer membrane proteins, can produce a
nurnber of distinct polypeptide spots with different isoelectric points and apparent
molecular weights upon separation with 2D PAGE (Henning et al., 1978).
As well, protein S 1 from the secreted protein population contains an apparent
molecular weight and pI of 60 kDa and 5.6 (Fig 8). Exotoxin A, one of the most virulent
factors that P. aeruginosa synthesizes (Pollack, 1983), shuts down protein synthesis in
marnrnalian cells (Lory and Collier, 1980). It has a periplasmic intermediate (Lu et al.,
1993), has four essential disulfide bonds (Allured et al., 1986) and has a theoretical
molecular weight and pI of 66.8 kDa and 5.28. Although the pI of protein S1 is not
similar to the theoretical one, the apparent and theoretical molecular weights are similar.
In addition, exotoxin A contains disulfide bonds and protein S1 demonstrates a mobility
shift in the presence of DTT suggesting that it contains a disulfide bond. This implies
that the S 1 protein could be exotoxin A. However, this suggestion needs to be confirmed.
A single protein in the periplasm of P. aeruginosa was found to be dependent on
the activity of DsbA in an indirect manner. Protein P5 (Fig. 16) is present in the wild-
type and absent in the dsbA null strain, regardless of the addition of DTT (Table 3). This
protein does not contain a disulfide bond but relies on some other disulfide bond
containing protein for proper processing. PapD, a P pilus chaperone of uropathogenic E.
coli, contains a disulfide bond and is responsible for targeting of pilus subunits to the
outer membrane assembly site. In the absence of an interaction with PapD, the pilus
subunits aggregate nonproductively and are proteolytically degraded (Jacob-Dubuisson,
1994). This supports the fact that some proteins may rely on the indirect activity of
DsbA for proper processing or require interactions with DsbA to function properly.
One other possibility that was not initially considered to be a scenario using the
2D gel approach to localize disulfide bond containing proteins that rely on DsbA to
acquire their disulfide bonds were proteins that might be upregulated in the absence of a
fùnctional DsbA. Protein P2 (Fig. 16) was found to be up regulated in the dsbA nul1
mutant (Table 3). Jose et al. (1 996) demonstrated the requirement of an unfolded
conformation of the passenger domain of recombinant proteins when being translocated
across the outer membrane by the Neisseria gonorrhoeae IgAp autotransporter. When
disulfide bonds do form to stabilize the tertiary structure of the protein, it results in
blockage and degradation of the passenger protein in the periplasm. The proteins are
maintained in an unfolded state in the absence of DsbA. While protein synthesis is not
up regulated in this example, protein secretion is enhanced in the absence of DsbA. Thus
it provides some evidence that in the absence of a functional DsbA, some proteins may be
expressed or synthesized that would not normally be present in a wild-type background.
The question remains of whether al1 of the disulfide bonded proteins in P.
aeruginosa were identified using the 2D PAGE technique. The answer is simple: it is
impossible to identify al1 of the proteins containing disulfide bonds due to limitations
encountered during this project. These limitations include the limited pI range of 4.5 to
5.6, the expression of low abundance proteins that could not be detected with silver
staining, the fact that some disulfide bonded proteins may not have shifeed substantially
upon reduction and therefore these proteins would not be included, and the subjective
analysis of the operator of detecting changes in protein mobility between wild-type and
dsbA nul1 mutant in the presence and absence of DTT.
In the analysis of the different protein populations, it was found that 4 out of 53
proteins (7.5%) of the total secreted protein population (Fig. 7), 10 of 219 proteins (4.5%)
of the total outer membrane protein population (Fig. 9), and 6 out of 175 proteins (3.4%)
of the total periplasmic protein population (Fig. 14) demonstrated some type of mobility
shift, indicating that these proteins contain disulfide bonds. This gives a reasonable
estimate of the number of proteins in the populations that contain disulfide bonds.
However, to get a more accurate number, it would be necessary to expand the pH range
of the gels to include al1 proteins that may contain disulfide bonds.
If one considers a well-characterized proteome such as E. coli, the majority of the
proteins from the entire proteome tend to be in the pH range of approximately 5 to 8 upon
separation via 2D PAGE within a pH range of 4 to 10 and a molecular weight range of 1 O
to 80 kDa. There are some proteins on either side of this range; however, the bulk of the
E. coli proteins fa11 in this range (Tonella et al., 1998). Although these gels incorporate
the proteins from the total proteome and not sub protein populations, it provides an idea
of the pH range of the majority of proteins in E. coli (pH 5 to 8). It also reinforces the
fact that we need to expand the pH range of our 2D gels in order to incorporate al1 of the
proteins in P. aeruginosa, including those that may contain disulfide bonds.
The 2D PAGE technique may not be sensitive enough to detect al1 of the proteins
that are dependent on DsbA for disulfide bond formation. One recent development is
AMS trapping, which is the use of AMS (4-acetamido-4"-maleimidylstilbene-2'-
disulfonate) to alkylate sulfhydryl groups instead of iodoacedamide. Compounds such as
AMS tend to be more cysteine-specific and faster reacting with cysteines than
compounds such as iodoacedamide (Kriauciunas et al., 1991 ; Threvenin, 1989), although
microenvironrnental factors can have an impact on the reactivity and specificity of thiols
(Grauschopf et al., 1995). AMS reacts specifically and irreversibly with sulfhydryl
groups, conjugating a large 490-Dalton moiety to the free cysteines, thereby increasing
the molecular weight of proteins when their cysteines are reduced state (Joly and Swartz,
1997). For example, treatment of thioredoxin 1 with AMS allowed the distinction
between thioredoxin 1 with two reduced cysteines compared with thioredoxin 1 with its
cysteines in the form of a disulfide bond (Debarbieux and Beckwith, 1998).
To continue with this project, it would be beneficial to identifj those proteins that
have been shown to rely on the activity of DsbA to acquire their disulfide bonds.
However, due to the limitations of protein load with the CA system, it would be good to
switch to the imrnobilized pH gradient (IPG) system. This will allow more protein to be
loaded ont0 one gel. Once the running conditions have been established using the IPG
system for each protein population, the proteins of interest can be electrophoretically
transferred to a PVDF membrane, stained and cut out of the membrane. The proteins can
then be sent away for amino-terminal sequencing using Edman degradation reaction. The
N-terminal sequence can be used to search a protein database to locate proteins that have
been characterized (Lehninger et al., 1993).
Alternatively, proteins can be digested directly in the gel or on the PVDF
membrane with a protease. The resulting peptides are extracted from the gel or
membrane and are loaded into the mass spectrometer that generates the masses of the
peptides from the digestion. These generated peptide mass profiles are compared to
calculated masses of al1 possible enzymatic cleavage products of al1 proteins with known
sequences and the protein that gives the best agreement is selected. If the peptide mass
results are not clear, it is necessary to resort to other methods to complement the
generated peptide mass profile. This can include additional information from a second
proteolytic digestion and information about the intact protein (apparent mass and
apparent pI on a 2D gel, N-terminal sequence and amino acid composition). Peptide
fragments that were initially generated can be sequenced and this information c m be used
to search a protein database for proteins that have been characterized (Fenyo et al,, 1998).
The P. aeruginosa genome is completely sequenced which means that any protein can be
theoretically identified by comparing it to the entire protein complement of P.
aeruginosa. Thus, if peptide fragments do not match a described protein, the fragments
can be used to search the P. aeruginosa protein complement to locate an undescribed
protein. In addition, western immunoblots using antibodies for known proteins can be
used to identifi proteins.
In summary, proteins from three distinct populations were successfully isolated
from the total protein population. Ruming conditions were established for each protein
population and reproducible results were obtained using 2D PAGE. We were then able to
use the 2D PAGE technique to identiQ some disulfide bonded proteins that rely on the
activity of DsbA either directly or indirectly to acquire their disulfide bonds. Many
disulfide bonded proteins identified and discussed did not seem to rely solely on the
activity of DsbA to obtain their disulfide bonds. This could be due to spontaneous
oxidation, due to a weaker oxidation system or due to compensation of disulfide bond
formation by one of the components of the Dsb system in the absence of a functional
DsbA. As well, an estimate of the number of disulfide bonded proteins in each of the
protein populations was deterrnined over a limited pI range. In addition, a cosmid
genomic library was constructed to serve as a source of clones containing proteins that
have yet to be described. Our results support the use of 2D PAGE is a powerful method
to detect disulfide bond containing proteins in P. aeruginosa or in another bacteriurn.
References
Adams, L. D. 1992. Two-dimensional gel electorphoresis using the 07Farrell system. In Current Protocols in Molecular Biology. Upjohn Company, Kalamazoo, Michigan.
Allured, V. S., R. J. Collier, S. F. Carroll, and D. B. McKay. 1986. Structure of exotoxin A of Pseudomonas aeruginosa at 3.0-Angstrom resolution. Proc. Natl. Acad. Sci. USA 83: 1320-1 324.
Anderson, C. L., A. Matthey-Dupraz, D. Missiakas, and S. Raina. 1997. A new Escherichia coli gene, dsbG, encodes a periplasmic protein involved in disulphide bond formation, required for recycling DsbAIDsbB and DsbC redox proteins. Mol. Microbiol. 26: 12 1-1 32.
Anderson, D. M., and 0. Schneewind. 1997. A rnRNA signal for the type III secretion of Yop proteins by Yersinia enterocolitica. Science 278: 1 140- 1 143.
Anfinsen, C. B., E. Haber, M. Sela and F.H. White. 1961. The kinetics of formation of native ribonuclease during oxidation of the reduced polypeptide chain. Proc. Natl. Acad. Sci. USA 47: 1309-1 324.
Anfinsen, C. B. 1973. Principles that govern the folding of protein chains. Science (Washington, D.C.) 181:223-230.
Bader, M., W. Muse, T. Zander, and J. Bardwell. 1998. Reconstitution of a protein disulfide catalytic system. J. Biol. Chem. 273: 10302-1 0307.
Bader, M., W. Muse, D. P. Ballou, C. Gassner, and J. C. A. Bardwell. 1999. Oxidative protein folding is driven by the electron transport system. Ce11 98:2 17- 227.
Baek, M. C., S. K. Kim, D. H. Kim, B. K. Kim, and E. C. Choi. 1996. Cloning and sequencing of the Klebsiella K-36 astA gene, encoding an arylsulfate sulfotransferase. Microbiol. Immun. 4053 1-537.
Bardwell, J. C. A. 1994. Building bridges: disulfide bond formation in the cell. Mol. Microbiol. 14: 199-205.
Bardwell, J. C. A., and J. Beckwith. 1993. The bonds that tie: catalyzed disulfide bond formation. Ce11 74:769-77 1.
Bardwell, J. C. A., J. O. Lee, G. Jander, N. Martin, D. Berlin, and J. Beckwith. 1993. A pathway for disulfide bond formation in vivo. Proc. Natl. Acad. Sci. USA 90: 1038- 1042.
Bardwell, J. C. A., K. McGovern, and J. Beckwith. 1991. Identification of a protein required for disulfide bond formation in vivo. Ce11 67581-589.
Batisson, I., and M. Der Vartanian. 2000. Extracellular DsbA-insensitive folding of Escherichia coli heat-stable enterotoxin STa in vitro. J. Biol. Chem. 275(14): 10582- 10589.
Bayer, M. E. 1979. The fusion sites between outer membrane and cytoplasmic membrane of bacteria: their role in membrane assembly and virus infection. In Bacterial outer membranes, biosynthesis, assembly and function. Edited by M. Inouye. Wiley, New York, N. Y. pp. 167-202.
Berkelman, T. and T. Stenstedt. 1998. Two-dimensional electrophoresis using irnrnobilized pH gradients: principles and methods. Arnersham Pharmacia Biotech Inc., Piscataway, N.J.
Betlry, M. J., V. L. Miller, and J. J. Mekalanos. 1986. Genetics of bacterial enterotoxins. Annu. Rev. Microbiol. 40:577-605.
Bjellqvist, B., K. Ek, P. G. Righetti, E. Gianazza, A. Gorg, R Westerrneier, and W. Postel. 1982. Isoelectric focusing in immobilized pH gradients: principle, methodology and some applications. J. Biochem. Biophys. Methods 6:3 17-339.
Bjellqvist, B., J. C. Sanchez, C. Pasquali, F. Ravier, N. Paquet, S. Frutiger, G. J. Hughes, and D. Hochstrasser. 1993. Micropreparative two-dimensional electrophoresis allowing the separation of samples containing milligram arnounts of proteins. Electrophoresis 14: 1375-1 378.
Blum, H., H. Beier, and H. J. Gross. 1987. Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 8:93-99.
Bolhuis, A., G. Venema, W. J. Quax, S. Bron, and J. Maarten van Dijl. 1999. Functional analysis of paralogous thiol-disulfide oxidoreductases in Bacillus subtilis. J. Biol. Chem. 274:2453 1-34538.
Bosch, D., J. Leunissen, J. Verbakel, M. de Jong, H. van Erp, and J. Tommassen. 1986. Periplasmic accumulation of truncated forms of outer membrane protein PhoE of Escherichia coli K-12. J . Mol. Biol. 198:449-455.
Carpenter, P. B., A. R. Zuberi, and G. W. Ordal. 1993. Bacillus subtilis flagellar proteins FliP, FliQ, FliR and FlhB are related to Shigellaflexneri virulence factors. Gene 137:243-245.
Coburn, J. 1992. Pseudomonas aeruginosa exoenzyme S. Curr. Top. Microbiol. Irnmunol. 175133-143.
Cornelis, G. R., and H. Wolf-Watz. 1997. The Yersina Yop virulon, a bacterial system for subverting eukaryotic cells. Mol. Microbiol. 23:861-867.
Creighton, T.E. 1984. Disulfide bond formation in proteins. Methods Enzymol. 107:305-329.
Creighton, T.E. 1986. Detection of folding intermediates using urea-gradient electrophoresis. Methods Enzyrnol. 131: 156-1 72.
Creighton, T.E. 1997. Protein structure: a practical approach. s " ~ ed. IRL Press, New York, N. Y.
Danese, P. N., and T. J. Silhavy. 1998. Targeting and assembly of periplasmic and outer-membrane proteins in Escherichia coli. Annu. Rev. Genet. 3259-94.
Debarbieux L., and J. Beckwith. 1998. The reductive enzyme thioredoxin 1 acts as an oxidant when it is exported to the Escherichia coli periplasm. Proc. Natl. Acad. Sci. USA 95: 1075 1 - 10756.
De Lorenzo, F., R. F. Goldberger., E. Steers, D. Givol, and C. B. Anfinsen. 1966. Purification and properties of an enzyme from beef liver which catalyzes sulfhydryl- disulfide interchange in proteins. J. Biol. Chem. 241: 1562-1 567.
Derman, A. I., W. A. Prinz, D. Belin and J. Beckwith. 1993. Mutations that allow disulfide bond formation in the cytoplasm of Escherichia coli. Science 262: 1744- 1 747.
Donnenberg, M. S., H . 4 . Zhang, and K. D. Stone. 1997. Biogenesis of the bundle- forming pilus of enteropathogenic Escherichia coli: reconstitution of fimbriae in recombinant E. coli and role of DsbA in pilin stability-a review. Gene 192:33-38.
Dunbar, B. 1987. Two-dimensional electrophoresis and immunological techniques. Plenum press, New York, N. Y.
Duong, F., J. Eichler, A. Price, M. R. Leonard, and W. Wickner. 1997. The SecDFyajC domain of preprotein translocase controls preprotein movement by regulating SecA membrane cycling. EMBO J. l6:487 1-4879.
Fath, M. J., and R. Kolter. 1993. ABC transporters: bacterial exporters. Microbiol. Rev. 57:995-1 O1 7.
Fenyo, D., J. Qin, and B. T. Chait. 1998. Protein identification using mass spectrometric information. Electrophoresis 19:998-1005.
Filoux, A., M. Bally, G. Ball, M. Akrim, J. Tommassen, and A. Lazdunski. 1990. Protein secretion in Gram-negative bacteria: transport across the ouier membrane involves comrnon mechanisms in different bacteria. EMBO J. 9:4323-4329.
Finlay, B. B., and S. Flakow. 1997. Common themes in microbial pathogenicity revisited. Microbiol. Mol. Biol. Rev. 61:136-169.
Frech, C., M. Wunderlich, R Glockshuber, and F. X. Schmid. 1996. Preferential binding of an unfolded protein to DsbA. EMBO J. 15392-398.
Friedman, A. M., S. R. Long, S. E. Brown, and W. J. Buikema, and F. M. Ausubel. 1982. Construction of a broad host range cosmid cloning vector and its use in the genetic analysis of Rhizobium mutants. Gene 18:289-296.
Gething, M. J., and J. Sambrook. 1992. Protein folding in the cell. Nature 35533-45.
Grauschopf, U., J. R. Winther, P. Korber, T. Zander, P. Dallinger, and J. C. Bardwell. 1995. Why is DsbA such an oxidizing disulfide catalyst? Ce11 83:947- 955.
Guddat, L. W., J. C. A. Bardwell, T. Zander, and J. L. Martin. 1997. The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and implicated in peptide binding. Protein Science 6: 1 148-1 156.
Guilhot, C., G. Jander, N. L. Martin and J. Beckwith. 1995. Evidence that the pathway of disulfide bond formation in Escherichia coli involves interactions between the cysteines of DsbB and DsbA. Proc. Natl. Acad. Sci. USA. 92:9895- 9899.
Guzzo, J., F. Duong, C. Wandersman, M. Murgier, and A. Lazdunski. 1991. The secretion genes of Pseudomonas aeruginosa alkaline protease are functionally related to those of Erwinia chrysanthemi proteases and Escherichia coli alpha- haemolysin. Mol. Microbiol. 5447-453.
Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. Mol. Biol. 166557-580.
Hancock, R. E., and A. M. Carey. 1979. Outer membrane of Pseudomonas aeruginosa: heat-2-mercaptoethanol- modifiable proteins. J. Bacteriol. 140:902-9 10.
Hayashi, S., M. Abe, M. Kimoto, S. Furukawa, and T. Nakazawa. 2000. The DsbA- DsbB disulfide bond formation system of Burkholderia cepacia is involved in the production of protease and alkaline phosphatase, motility, metal resistance, and multi-drug resistance. Microbiol. Imrnunol. 44(1):4 1-50.
Henning, U., 1. Sonntag, and 1. Hindennach. 1978. Mutants (ompA) affecting a major outer membrane protein of Escherichia coli K-12. Eur. J . Biochem. 92:49 1-498.
Hermann, T., M. Finkemeier, W. Pfefferle, G. Wersch, R. Kramer, and A. Burkovski. 2000. Two-dimensional electrophoretic analysis of Corynebacterium glutamicum membrane fraction and surface proteins. Electrophoresis 21:654-659.
Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol. Mol. Biol. Rev. 62:379-433.
Hwang, C., A. J. Sinskey, and H. F. Lodish. 1992. Oxidized redox state of glutathione in the endoplasmic reticulum. Science 257: 1496- 1502.
Iglewski, B. H., J. Sadoff, M. J. Bjorn, and E. S. Maxwell. 1978. Pseudomonas aeruginosa exoenzyme S : an adenosine diphoc;:iale ribosyltransferase distinct for toxin A. Proc. Natl. Acad. Sci. USA 75:32 1 1-321 5.
Ishihara, T., H. Tomita, Y. Hasegawa, N. Tsukagoshi, H. Yamagata, and S. Udaka. 1995. Cloning and characterization of the gene for a protein thiol-disulfide oxidoreductase in Bacillus brevis. J. Bacteriol. 177:745-749.
Jacob-Dubuisson, F., J. Pinkner, Z. Xu, R Striker, A. Padmanhaban, and S. J. Hultgren. 1994. Pap D chaperone function in pilus biogenesis depends on oxidant and chaperone-like activities of DsbA. Proc. Natl. Acad. Sci. USA 91: 1 1552-1 1556.
Jackson, M. W., and G.V. Plano. 1999. DsbA is required for stable expression of outer membrane protein YscC and for efficient yop secretion in Yersiniapestis. J. Bacteriol. 181:5126-5130.
Jander, G., N. L. Martin, and J. Beckwith. 1994. Two cysteines in each periplasmic domain of the membrane protein DsbB are required for its function in protein disulfide bond formation. EMBO J. l3:5 12 1-5 127.
Jensch, T., and B. Fricke. 1997. Localization of alanyl aminopeptidase and leucyl arninopeptidase in cells of Pseudomonas aeruginosa by application of different methods for periplasm release. J. Basic Microbiol. 37: 1 15-1 28.
Joly, J.C., and J. R. Swartz. 1997. In vitro and in vivo redox States of the Escherichia Coli periplasmic oxidoreductases DsbA and DsbC. Biochemistry 36: 10067- 10072.
Jose, J., J. Kramer, T. Klauser, J. Pohlner, and T. F. Meyer. 1996. Absence of periplasmic DsbA oxidoreductase facilitates export of cysteine-containing passenger proteins to the Escherichia Coli ce11 surface via the Igaa autotransporter pathway. Gene 178: 107- 1 10.
Kamitani, S., Y. Akiyama and K. Ito. 1992. Identification and characterization of an Escherichia coli gene required for the formation of correctly folded alkaline phosphatase, a periplasmic enzyme. EMBO J. 1157-62.
Kishigami, S., and K. Ito. 1996. Roles of cysteine residues of DsbB in its activity to reoxidize DsbA, the protein disulfide bond catalyst of Escherichia coli. Genes Cells. 1:201-208.
Klee, S. R, X. Nassif, B. Kusecek, P. Merker, J. L. Beretti, M. Achtman, and C. R. Tinsley. 2000. Molecular and biological analysis of eight genetic islands that distinguish Neisseria meningitidis from the closely related pathogen Neisseria gonorrhoeae. Infect. Immun. 68(4):2082-2095.
Kloek, A. P., and B. N. Funkel. 1997. Genbank accession AF036929.
Klose, J. 1975. Protein mapping by combined isoelectric focusing and electrophoresis of mouse tissues. A novel approach to testing for induced point mutations in marnmals. Humangenetik. 26:23 1-243.
Klose, M., H. Schwarz, S. MacIntyre, R. Freudl, M.-L. Eschbach, and U. Henning. 1988. Interna1 deletions in the gene for an Escherichia coli outer membrane protein define an area possibly important for recognition of the outer membrane by this polypeptide. J. Biol. Chem. 263: 13291 -1 3296.
Kobayashi, T., S. Kishigami, M. Sone, H. Inokuchi, T. Mogi, and K. Ito. 1997. Respiratory chain is required to maintain oxidized States of the DsbA-DsbB disulfide bond formation system in aerobically growing Escherichia coli cells. Proc. Natl. Acad. Sci. USA 94: 1 1857-1 1862.
Kriauciunas, A., C. A. Frolik, T. C. Hassell, P. L. Skatrud, M.G. Johnson, N. L. Holbrook, and V. J. Chen. 1991. The functional role of cysteines in isopenicillin N synthase. Correlation of cysteine reactivities toward sulfhydryl reagents with kinetic properties of cysteine mutants. J. Biol. Chem. 266: 1 1779-1 1788.
Kwon, A. R. 1999. Genbank accession AF012826.
Lee, C. A. 1997. Type III secretion systems: machines to deliver bacterial proteins into eukaryotic cells? Trends Microbiol. 5: 148-1 56.
Lehninger, A. L., D. L. Nelson, and M. M. Cox. 1993. Principles of biochemistry. Worth Publishers, Inc. New York, N. Y.
Leipelt, M., B. Schneidinger, and K.-E. Jaeger. 1997. Genbank accession U84726.
Lory, S., and J. Collier. 1980. Expression of enzymatic activity by exotoxin A from Pseudomonas aeruginosa. Infect. Immun. 28:494-50 1.
Lu, H.-M., S. Mizushima, and S. Lory. 1993. A periplasmic intermediate in the extracellular secretion pathway of Pseudomonas aeruginosa exotoxin A. J . Bacteriol. 175:7463-7467.
Martin, N.L. 1992. Outer membrane proteins OprP and OprF from Pseudomonas aeruginosa: purification and analysis of secondary and tertiary structure. Ph.D. thesis. U.B.C.
Martin, N. L., E. G. Rawling, R. S. Wong, M. Rosok, and R. E. W. Hancock. 1993. Conservation of surface epitopes in P. aeruginosa outer membrane porin protein OprF. FEMS Microbiol. Lett. 1 13:261-266.
Martin, J. L., J. C. A. Bardwell, and J. Kuriyan. 1993. Crystal structure of the DsbA protein required for disulphide bond formation in vivo. Nature 365:464-468.
Martinez, A., P. Ostrovsky, and D. N. Nunn. 1998. Identification of an additional member of the secretin superfamily of proteins in Pseudomonas aeruginosa that is able to function in type II protein secretion. Mol. Microbiol. 28:1235-1246.
Mendoza-del-Cueto, M. T., and R. Rotger-Anglada. 1 W8. Genbank accession AF141380.
Mendoza-del-Cueto, M. T., and R Rotger. 1999. Genbank accession AF 14 1380.
Missiakas, D., C. Georgopoulos, and S. Raina. 1993. Identification and characterization of the Escherichia coli gene dsbB, whose product is involved in the formation of disulfide bonds in vivo. Proc. Natl. Acad. Sci. USA 90:7084-7088.
Missiakas, D., C. Georgopoulos, and S. Raina. 1994. The Escherichia coli dsbC (xprA) gene encodes a periplasmic protein involved in disulfide bond formation. EMBO J. l3:2O 13-2020.
Missiakas, D., and S. Raina. 1997. Protein folding in the bacterial periplasm. J. Bacteriol. 179:2465-2471.
Missiakas, D., F. Schwager, and S. Raina. 1995. Identification and characterization of a new disulfide isomerase-like protein (DsbD) in Escherichia coli. EMBO J . 14:3415- 3424.
Molloy, M. P., B. R. Herbert, B. J. Walsh, M. 1. Tyler, M. Traini, J.-C. Sanchez, D. F. Hochtrasser, K. L. Williams, and A. A. Gooley. 1998. Extraction of membrane proteins by differential solubilization for separation using two-dimensional gel electrophoresis. Electrophoresis 192337-844.
Ng, T L . , J. F. Kwik, and R. J. Maier. 1997. Cloning and expression of the gene for a protein disulfide oxidoreductase from Azotobacter vinelandii: complementation of an Escherichia coli dsbA mutant strain. Gene 188: 109-1 13.
Nikaido, H. 1996. Outer membrane. In Escherichia coli and Salmonella, cellular and molecular biology. 2nd ed. Edited by F.C. Neidhardt. ASM Press, Washington, D. C. pp. 29-47.
Nossal, N. G., and L. A. Heppel. 1966. The release of enzymes by osmotic shock from Escherichia coli in exponential phase. J. Biol. Chem. 241:3055-3062.
O'Farrell, P. H. 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250:4OO7-402 1.
O'Farrell, P. Z., H. M. Goodman, and P. H. 09Farrell. 1977. High-resolution two- dimensional electrophoresis of basic as well as acidic proteins. Ce11 12:1133-1142.
Okamoto, K., T. Baba, H. Yamanaka, N. Akashi, and Y. Fujii. 1995. Disulfide bond formation and secretion of Escherichia coli heat-stable enterotoxin I I . J. Bacteriol. 177:4579-45 86.
Owen, P., K. A. Graeme-Cook, B. A. Crowe, and C. Condon. 1982. Bacterial membranes: preparative techniques and criteria of puritfip. 1-69. In Techniques in lipid and membrane biochemistry-part 1. Edited by T.R. Hesketh, H.L. Kornberg, J.C. Metcalfe, D.H. Northcote, C.I. Pogson, and K.F. Tipton. Elsevier/North-Holland Inc., Ireland. pp. 1-69.
Pegues, D. A., M. J. Hantman, 1. Behlau, and S. 1. Miller. 1995. PhoPIPhoQ transcriptional repression of Salmonella iyphimurium invasion genes: evidence for a role in protein secretion. Mol. Microbiol. 17: 169-1 81.
Pollack, M. 1983. The role of exotoxin A in Pseudomonas disease and irnmunity. Rev. Infect. Dis. 5(Suppl.):S979-S984.
Pugsley, A. P. 1992. Translocation of a folded protein across the outer membrane via the general secretory pathway in Escherichia coli. Proc. Natl. Acad. Sci. USA 89: 12058- 12062.
Rabilloud, T., C. Valette, and J. J. Lawrence. 1994. Sample application by in-gel rehydration improves the resolution of two-dimensional electrophoresis with immobilized pH gradients in the first dimension. Electrophoresis 15: 1552-1 558.
Rasmussen, B. A., and T. J. Silhavy. 1987. The first 28 amino acids of mature LamB are required for rapid and efficient export from the cytoplasm. Genes Dev. 1: 185- 196.
Reitsch, A., and J. Beckwith. 1998. The genetics of disulfide bond metabolism. Annu. Rev. Genet. 32: 163-1 84.
Reitsch, A., D. Belin, N. Martin, and J. Beckwith. 1996. An in vivo pathway for disulfide bond isomerization in Escherichia coli. Proc. Natl. Acad. Sci. USA 93: 13048- 13053.
Reitsch, A., P. Bessette, G. Georgiou, and J. Beckwith. 1997. Reduction of the periplasmic disulfide bond isomerase, DsbC, occurs by passage of electrons fiom cytoplasmic thioredoxin. J. Bacteriol. 179:6602-6608.
Sadosky, A. B., and H. A. Shuman. 1994. Genbank accession U15278.
Salyers, A., and D. D. Whitt. 1994. Bacterial pathogenesis: a molecular approach. ASM Press, Washington, D.C., p. 260-268.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory maual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Sanchez, J. C., V. Rouge, M. Pisteur, F. Ravier, L. Tonella, M. Moosmayer, M. R. Wilkins, and D. F. Hochstrasser. 1997. Improved and simplified in-gel sarnple application using reswelling of dry imobilized pH gradients. Electrophoresis 18:324- 327.
Santoni, V., T. Rabilloud, P. Doumas, D. Rouquie, M. Manison, S. Kieffer, J. Garin, and M. Rossignol. 1999. Towards the recovery of hydrophobic proteins on two- dimensional electrophoresis gels. Electrophoresis 20:705-711.
Sauvonnet N., and A. P. Pugsley. 1998. The requirement for DsbA in pullulanase secretion is independent of disulfide bond formation in the enzyme. Mol. Microbiol. 27:66 1-667.
Scheele, G. and R. Jacoby. 1982. Conformational changes associated with proteolytic processing of presecretory proteins allowing glutathione-catalyzed formation of native disulfide bonds. J. Biol. Chem. 257: 12277-1 2282.
Sory, M. P., A. Boland, 1. Lambermont, and G. R. Cornelis. 1995. Identification of the YopE and YopH domains required for secretion and internalization into the cystol of macrophages using the cya gene fusion approach. Proc. Natl. Acad. Sci. USA 92: 1 1998-1 2002.
Shevchik, V. E., 1. Bortoli-German, J. Robert-Baaudouy, S. Robinet, F. Barras and G. Condemine. 1995. Differential effect of dsbA and dsbC mutations on extracellular enzyme secretion in Erwinia chrysanthemi. Mol. Microbiol. 16:745- 753.
Stanislavsky, E. S., and J. S. Lam. 1997. Pseudomonas aeruginosa antigens as potential vaccines. FEMS Microbiol. Rev. 21:243-277.
Stewart, E. J., F. Aslund, and J. Beckwith. 1998. Disulfide bond formation in the Escherichia coli cytoplasm: an in vivo role reversa1 for the thioredoxins. EMBO J. 17:5543-5550.
Summers, R. G., and J. R Knowles. 1989. Illicit secretion of a cytoplasmic protein into the periplasm of Escherichia coli requires a signal peptide plus a portion of the cognate secreted protein. Demarcation of the critical region of the mature protein. J. Biol. Chem. 264:20074-20081.
Synder, L. and W. Champness. 1997. Molecular genetics of bacteria. ASM Press, Washington, D.C. pp. 404.
Thorton, J. M. 198 1. Disulfide bridges in globular proteins. J. Mol. Biol. lSl:26 1-287.
Threvenin, B. J., B. M. Willardson, and P. S. Low. 1989. The redox state of cysteines 201 and 3 17 of the erythrocyte anion exchanger is critical for ankyrin binding. J. Biol. Chem. 264: 15886-1 5892.
Tomb, J.-F. 1992. A periplasmic protein disulfide oxidoreductase is required for transformation of Haemophilus influenzae Rd. Proc. Natl. Acad. Sci. USA 89: 10252-1 0256.
Tommassen J., A. Filloux, M. Bally, M. Murgier, and A. Lazdunski. 1992. Protein secretion in Pseudomonas aeruginosa. FEMS Microbiol. Rev. 103:73-90.
Tonella, L., B. J. Walsh, J.-C. Sanchez, K. Ou, M. R. Wilkins, M. Tyler, S. Frutiger, A. A. Gooley, 1. Pescaru, R D. Appel, J. X Yan, A. Bairoch, C. Hoogland, F. S. Morch, G. J. Hughes, K. L. Williams, and D. F. Hochstrasser. 1998. '98 Escherichia coli S WISS-2D PAGE database update. Electrophoresis 19: 1960-1 971.
Turcot, I., and N. L. Martin. 1997. Genbank accession AF0 19 1 10.
Van Straaten, M., D. Missiakas, S. Raina, and N. J. Darby. 1998. The functional properties of DsbG, a thiol-disulfide oxidoreductase from the periplasm of Escherichia d i . FEBS Letters. 428:255-258.
Villavicencio, R. T. 1998. The history of blue pus. J. Am. Coll. Surg. l87(2):2 12-2 16.
Visick, F. E., and S. Clarke. 1995. Repair, refold, recycle: how bacteria can deal with spontaneous and environmental damage to proteins. Mol. Microbiol. 16:835-845.
von Heijne,G. 1990. The signal peptide. J. Membr. Biol. 115: 195-201.
Wandersrnan, C. 1996. Secretion across the bacterial outer membrane. In Escherichia coli and Sulmonellu: cellular and molecular biology, 2nd ed. Edited by F.C. Neidhardt, R. Curtiss III, J.L. Ingraham, E.C.C. Lin, K.B. Low, B. Magasanik, M. Riley, W.S. Reznikoff, M. Schaechter, and H.E. Umbarger. ASM Press, Washington, D.C. pp. 955-966.
Watarai, M., T. Tobe, M. Yoshikawa, and C. Saskawa. 1995. Disulfide oxidoreductase activity of Shigellaflexneri is required for release of Ipa proteins and invasion of epithelial cells. Proc. Natl. Acad. Sci. USA 92:4927-493 1.
Weissman, J. S., and P. S. Kim. 1992. The pro region of BPTI facilitates folding. Cell 71:841-85 1.
Wilhelm, S., J. Tommassen, K.-E. Jaeger. 1999. A novel lipolytic enzyme located in the outer membrane of Pseudomonas aeruginosa. J. Bacteriol. 181:6977-6986.
Yahr., T. L., J. Goranson, and D. W. Frank. 1996. Exoenzyme S of Pseudomonas aeruginosa is secreted by a Type III pathway. Mol. Microbiol. 22:W 1-1 003.
Yu, J., H. Webb, and T. R. Hirst. 1992. A homologue of the Escherichia coli DsbA protein involved in disulfide bond formation is required for enterotoxin biogenesis in Vibrio cholerae. Mol. Microbiol. 6: 1949- 1958.
Zapun, A., J. C. A. Bardwell, and T. E. Creighton. 1993. The reactive and destabilizing disulfide bond of DsbA, a protein required for protein disulfide bond formation in vivo. Biochemistry 323083-5092.
Zheng, W.-D., H. Quan, J.-L. Song, S.-L. Yang, and C.-C. Wang. 1997. Does DsbA have chaperone-like activity? Arch. Biochem. Biophy. 337:326-33 1.
Appendix
Figure 18. 12% silver stained 2D gel of outer membrane proteins fiom wild-iype P.
aeruginosa demonstrating key proteins that were used to establish the pH gradient of the
secreted protein gels. A pI marker consisting of proteins with known molecular weights
and known pIs was used to establish the pH range of the gels. The pI marker was
included with each 2D gel run for each protein population once a balance between
focusing of both the pI marker and the protein population had been determined. The pIs
of key proteins that appeared on al1 of the gels fiom the sarne protein population were
initially approximated using the pI marker 2D gel. The molecular weights of the key
proteins were estimated using the molecular weight standards in the 2nd dimension. The
following table surnmarizes the 5 key proteins that were used to establish the pH
gradient:
Figure 19. 12% silver stained 2D gel of secreted proteins fi-om wild-type P. aeruginosa
demonstrating key proteins that were used to establish the pH gradient of the secreted
protein gels. The molecular weights and pIs of the key proteins were determined fiom
the pI marker 2D gel in the sarne manner as was explained for the outer membrane
protein enrichments in Figure 18. The following table surnmarizes the 4 key proteins that
were used to establish the pH gradient:
Protein
1 2 3 4
Apparent MW (kDa)
28 43 27 27
PI 5.6 5.3 5.1 4.5
Figure 20. 13.5% silver stained 2D gel of periplasmic proteins from wild-type P.
aeruginosa dernonstrating key proteins that were used to establish the pH gradient of the
secreted protein gels. The molecular weights and pIs of the key proteins were determined
ftom the pl marker 2D gel in the same manner as was explained for the outer membrane
protein enrichments in Figure 18. The following table surnmarizes the 4 key proteins that
were used to establish the pH gradient:
Protejn
1 2 3 4
Apparent MW ( D a )
67 60 16 45
PI 4.5 5.1 5.3 5.6
