DEVELOPEMNT OF A MULTIPLEX SEQUENCE …research-repository.uwa.edu.au/files/3248158/Hitchen...1 DEVELOPEMNT OF A MULTIPLEX SEQUENCE SPECIFIC PRIMER (SSP)-PCR SYSTEM TO IDENTIFY FORENSICALLY

1

DEVELOPEMNT OF A MULTIPLEX

SEQUENCE SPECIFIC PRIMER (SSP)-PCR

SYSTEM TO IDENTIFY FORENSICALLY

RELEVANT CALLIPHORIDAE

Yvette Hitchen (BSc, GDipForSci)

Centre for Forensic Science

University of Western Australia

This thesis is presented in partial fulfilment of the requirements for the

Master of Forensic Science

2

2008 I declare that the research presented in this 36 point thesis, as part of the 96 point Master

degree in Forensic Science, at the University of Western Australia, is my own work. The

results of the work have not been submitted for assessment, in full or part, within any

other tertiary institute, except where due acknowledgement has been made in the text.

…………………………………………………

Yvette Hitchen

3

Acknowledgments

I would like to thank my supervisors Dr Silvana Gaudieri and Associate Professor Ian

Dadour. Thank you Silvana for your expert knowledge, time and effort for the duration

of my thesis and especially these final weeks. Thank you Ian for providing the facilities,

funds and specimens in the completion of this thesis.

I would like to thank all the members of the laboratory who have provided both

friendship and support. Padillah Yahya, Ha Nguyen, Alison Pitt and Nik Elena Nik

Mohamed without you I would not have been able to face the lab everyday. Thank you

Catherine Rinaldi for being my sensei within the laboratory and providing endless

technical information, friendship and humour.

To Danielle Molan for keeping on top of the administration side of my thesis.

To Rhian Williams, Simone Claassen, Gemma Fitzpatrick and all my friends who

reminded me there was a life outside of the laboratory.

Finally to my family who have provided endless support and love throughout the entirety

of this thesis. Without you all I would not have made it to the end of this journey.

4

TABLE OF CONTENTS

ACKNOWLEDGEMENTS i

TABLE OF CONTENTS ii

GLOSSARY 1

LIST OF TABLES 5

LIST OF FIGURES 6

CHAPTER 1: ABSTRACT 7

CHAPTER 2: INTRODUCTION 10

2.1 Forensic Entomology – General Background 11

2.1.1 Urban Entomology 11

2.1.2 Stored Product Entomology 12

2.1.3 Medico-Criminal Entomology 12

2.2 Medico-Criminal entomology – Historical Background 13

2.3 The Diptera 15

2.4 The Calliphoridae 15

2.4.1 Calliphora dubia 17

2.4.2 Calliphora albifrontalis 17

2.4.3 Chrysomya rufifacies 18

2.4.4 Chrysomya megacephala 18

2.4.5 Lucilia sericata 19

2.5 Succession of Invertebrate Activity on the Corpse Environment 19

2.6 Post-Mortem Interval 23

2.7 Forensic Entomology – Morphological Identification 25

2.8 Alternative Approaches to Identification 26

2.8.1 Scanning Electron Microscopy (SEM) 26

2.8.2 Potassium Permanganate Staining Technique 27

2.9 Deoxyribonucleic Acid – General Background 27

2.10 DNA-Based Methods of Identification 28

5

2.10.1 Random Amplified Polymorphic DNA 28

2.10.2 PCR – Restricted Fragment Length Polymorphism 29

2.10.3 Ribosomal Genes 29

2.10.4 Cytochrome Oxidase Genes of the Mitochondrial DNA 30

2.10.5 Sequence Specific Primers (SSP) 32

2.11 Polymerase Chain Reaction (PCR) 34

2.11.1 PCR protocol 35

2.11.2 PCR Reaction Reagents and Their Optimisation 37

2.11.3 Specific PCR Primer Design 39

2.12 Multiplex PCR 41

2.12.1 Optimisation of Multiplex PCR 43

2.13 Aims of Thesis 45

CHAPTER 3: Design of a Sequence Specific Primer Set for the Identification of

Forensically Important Calliphoridae 47

3.1 Introduction 48

3.2 Methods 51

3.2.1 DNA Extraction 51

3.2.2 Primers 52

3.2.3 PCR 53

3.2.4 PCR optimisation 53

3.3 Results and Discussion 54

3.3.1 Re-Design of SSP Set 66

3.4 Conclusion 70

CHAPTER 4: Optimisation of a Modified Set of Sequence Specific Primers for

The Identification of Forensically Important Calliphoridae Species 71

4.1 Introduction 72

4.2 Methods 73


4.2.2 Primers 73

6

4.2.3 PCR 73

4.2.4 PCR Optimisation 74

4.2.5 PCR Clean-Up 74

4.2.6 Direct Sequencing 74


4.3.1 Verification of Quality of Extracted DNA Samples 75

4.3.2 Optimisation of SSP Pairs 76

4.3.3 Analysis of Sequenced SSP-PCR Products 89

4.4 Conclusion 98

CHAPTER 5: Development of Two Multiplex SSP-PCRs for the Identification of

Forensically Important Calliphoridae 100

5.1 Introduction 101

5.2 Methods 103


5.2.2 Primers 103

5.2.3 Multiplex PCR 103


5.4 Conclusions 111

CHAPTER 6: Discussion and Conclusions 112

CHAPTER 7: References 117

APPENDICIES 131

APPENDIX 1 132

APPENDIX 2 134

APPENDIX 3 135

APPENDIX 4 150

APPENDIX 5 152

7

GLOSSARY

A Adenine. Nucleotide base.

bp Base pairs. Make-up DNA sequence.

BSA Bovine Serum Albumin. Reduces the effect of

inhibitors within the PCR.

C Cytosine. Nucleotide base.

Calliphoridae Commonly known as blowflies and are amongst the

first species to locate and colonise a corpse.

Calliphora albifrontalis Western brown blowfly. Located throughout the

South-West of Australia and has a robust golden-

brown colouration.

Calliphora dubia Blue-bodied blowfly, located throughout the South-

West of Australia. Yellowish in colouration with a

purple stripe down abdomen

Chrysomya megacephala Oriental latrine fly, located throughout the whole of

Australia, Asia, South Africa and Afro-tropic Island

regions. Bright metallic green in colouration with

black margins on abdomen.

Chrysomya rufifacies Hairy maggot blowfly, it is located Australia-wide

and is metallic green in colouration with dark blue

margins on abdomen.

8

COI Cytochrome Oxidase I. A gene within the mtDNA

involved in the terminal catalyst for the respiratory

mitochondrial chain.

COII Cytochrome Oxidase II. A component of the

respiratory chain, located within the mitochondrial

inner membrane.

Cyt-b Cytochrome b. A component of the respiratory

chain, located in the mitochondria of the cell.

DNA Deoxyribonucleic Acid. Genetic material of all

living organisms found within the nucleus of cells.

DNA Sequencing Determination of nucleotide order of a selected

DNA molecule.

dNTPs Deoxynucleotide triphosphates. The four

nucleotides that make-up DNA. Involved in the

synthesis of complementary strands in PCR.

ddNTPs Dideoxynucelotide triphosphates. Chain

termination nucleotides involved in DNA

sequencing.

Forensic Entomology Scientific study of invertebrate succession upon a

corpse.

G Guanine. Nucleotide base.

Instar Development Instars are the stage of successive molts

experienced by the fly, which are split into 3

developmental stages, 1st, 2

nd and 3

rd.

9

IUPAC-IUB International Union of Pure and Applied Chemistry

– International Union of Biochemistry for mixtures.

Lucilia sericata Sheep blowfly, it is located throughout the whole of

Australia in urban and sub-urban environments. It

is metallic in colouration varying from blue-green

to green-bronze.

MtDNA Mitochondrial DNA. DNA genome located within

the mitochondria of the cell.

Multiplex PCR Variant of standard PCR that relies on multiple

primer sets.

Nucleotides The smallest unit of the DNA molecule, which are

Adenine (A), Thymine (T), Cytosine (C) and

Guanine (G).

PCR Polymerase Chain Reaction. Technique for the

exponential amplification of a selected region

within a DNA molecule.

PMI Post-mortem interval. Estimated time since death.

Primers Short oligo-nucleotide strands that anneal to the

DNA from which the polymerase enzyme can

extend in the PCR.

R =A+G mixtures in DNA sequence as per IUPAC-

IUB classification.

R2 Correlation coefficient reflects line of best fit in

standard curves. Value range from +1 to –1.

10

rDNA Ribosomal DNA. Sequences of encoding rRNA.

rRNA Ribosomal RNA. Central component of ribosomes,

involved in the manufacture of cell proteins.

SSP Sequence Specific Primers. Identify species based

on the presence of unique nucleotide(s) at the 3‟ end

of the primer sequence.

Succession Succession relies on predictable patterns of insect

colonisation upon a corpse based on the physical,

biological and chemical changes a body undergoes

during decomposition.

T Thymine. Nucleotide base.

Taq DNA Polymerase Enzyme from a thermophilic eubacterial micro-

organism involved in the extension of

complementary DNA strands in PCR.

W =A+T mixtures in DNA sequence as per IUPAC-

IUB classification.

Y =T+C mixtures in DNA sequence as per IUPAC-

IUB classification.

mm Millimetres.

µ Micro.

ºC Degrees Celsius.

11

LIST OF TABLES

Table 2.1 Decomposition stages and associating Calliphoridae

activity. 21

Table 3.1 Original SSP primer set designed for the identification of

forensically important Calliphoridae. 52

Table 3.2 Expected and observed amplicons of original SSP primer

set. 53

Table 3.3 Matrix of annealing temperatures tested in optimisation of

original SSP primer set. 56

Table 3.4 Matrix of MgCl2 concentrations tested in optimisation of


Table 3.5 Matrix of primer concentrations tested in optimisation of


Table 3.6 Non-concordance between expected and observed results

for original SSP primer set. 59

Table 3.7 Re-designed SSP primer pairs. 68

Table 4.1 Annealing temperature matrix for the optimisation of newly

designed SSP primer set. 78

Table 4.2 Optimised annealing temperatures for newly designed SSP

primer set. 90

Table 5.1 Multiplex PCR SSP pair grouping, expected amplified

species and amplicon lengths. 105

Table 8.1 Purity values of newly extracted DNA samples prior to

testing. 134

Table 8.2 List of sequences and region of origin utilised in

phylogenetic analysis. 150

12

LIST OF FIGURES

Figure 2.1 Image of C. dubia. 17

Figure 2.2 Image of C. albifrontalis. 17

Figure 2.3 Image of Ch. rufifacies. 18

Figure 2.4 Image of Ch. megacephala. 18

Figure 2.5 Image of L. sericata. 19

Figure 2.6 Diagrammatic representation of a typical Dipteran

lifecycle. 22

Figure 2.7 Schematic of a standard PCR. 37

Figure 2.8 Comparison of PCR and multiplex PCR. 42

Figure 3.1 Alignment of sequences for re-design of SSP set. 61

Figure 4.1 Electrophoresis gel image of COI amplification. 77

Figure 4.2 Electrophoresis gel image of SSP 1b at 48ºC. 80







Figure 4.9 Electrophoresis gel image of SSP 8 at 60ºC. 87



Figure 4.12 Alignment of sequenced data from SSP 2b, 4b, 5b, 7b and 8

against known sequenced information. 91

Figure 4.13 Neighbour-joining phylogenetic tree. 96

Figure 4.14 Alignment of sequenced data from SSP 1b and 9 against

known sequenced information. 97

Figure 5.1 Electrophoresis gel image of SSP 4b stock at 58ºC. 106

Figure 5.2 Electrophoresis gel image of Multiplex PCR 1 at 62ºC 107

Figure 5.3 Electrophoresis gel image of Multiplex PCR 2 at 50ºC 108

Figure 5.4 Electrophoresis gel image of SSP 2b stock at 50ºC. 110

13

Chapter 1

Abstract

14

From the entomological evidence occurring on and around a corpse it is possible to

determine an estimated post-mortem interval (PMI). The critical step in this examination

is the accurate identification of specimens collected ensuring the application of

appropriate species-specific developmental data. Current molecular techniques in the

identification of forensically important Calliphoridae species from the Australian region

have been explored and found to be a highly significant and valuable area of research.

The cytochrome oxidase genes in the mitochondrial genome have been shown to have

sufficient sequence diversity to distinguish forensically relevant Calliphoridae species.

In order to target the observed sequence diversity within relevant regions of the nuclear

or mitochondrial genomes, sequence specific primer (SSP) pairs are used to target

polymorphisms, resulting in the amplification of specific species. This technique has

proven to be both a rapid and successful identification tool in the analysis of insect taxa,

especially Culicidae. SSP typing is particularly useful, as it requires no subsequent

sequencing or restriction with enzymes, both of which require additional time and

reagents.

The aim of this research was to develop a multiplex SSP reaction for the identification of

forensically important Calliphoridae species. Seven SSP pairs preliminarily designed by

Harvey (2006) were utilised in the identification of Calliphora dubia, Calliphora

albifrontalis, Chrysomya rufifacies, Chrysomya megacephala and Lucilia sericata. Once

optimised the SSP pairs were developed into two multiplex PCR reactions. This thesis

presents the experiments performed, analysis conducted and results obtained through the

development of the multiplex SSP-PCR system.

Initial testing of the seven preliminarily designed SSP pairs conveyed non-concordance

between expected and observed results. Additional species were continually amplified,

even after extensive optimisation attempts, including alternations to annealing

temperature, MgCl2 and primer concentration. Of the 7 SSP pairs, 6 were re-designed to

improve specificity, whilst one was removed from further testing and replaced with 2

newly designed primer pairs.

15

Continual testing of 8 SSP pairs was conducted, but only 6 could be successfully

optimised. Optimisation was limited to alterations to annealing temperature, to allow for

potential multiplexing. To confirm the regions and species amplified, sequencing of the

PCR products was performed. Though only partial sequences were obtained for most

samples the alignment shows the expected region amplified with specific species

variations. Using the remaining 6 SSP pairs all species tested were identifiable, allowing

for multiplexing potential to be tested.

Multiplex PCR is a cost effective and efficient technique that is becoming increasing

popular within a wide range of scientific disciplines. To date there has been no recorded

use of this technique in relation to either forensic entomology or the analysis of

forensically important Calliphoridae species. The 6 SSP pairs were manipulated to

produce one successful multiplex PCR system using 3 SSP pairs to identify L. sericata,

Ch. rufifacies and Ch. megacephala, and one unsuccessful multiplex PCR that amplified

a single SSP pair for the identification of C. dubia and Ch. rufifacies. When both

reactions are utilised, it is possible to identify all 5 forensically important Calliphoridae

species tested.

16

Chapter 2

Introduction

17

2.1 Forensic Entomology - General Background

Forensic entomology is a field of science that interacts directly with the law, as a means

to reach conclusive results in litigations of both criminal and community-based cases

(Byrd and Castner, 2001). As a means to assist medico-legal investigations, research and

wildlife violations, the use of forensic entomology has in recent years become routine

(Benecke, 2001). Although in the majority of cases the focus relating to forensic

entomology is associated with crime scenes, there are three principle areas of

applications: urban entomology, stored products entomology and medico-criminal

(medico-legal) entomology (Byrd and Castner, 2001).

2.1.1 Urban Entomology

Urban entomology relates to situations in which insects have disrupted human

environments (Byrd and Castner, 2001). Such disruptions include the activities of

termites, cockroaches and evidence of an excess of insects as a result of livestock or

farms (Byrd and Castner, 2001). Cases involving the effect of termites usually relate to

the presence of infestations, costs of extermination and the damage caused by colonies

and the resulting cost and loss of property (Byrd and Castner, 2001). In many cases this

is the result of the lack of precautionary implementations to prevent infestations (Frankie

and Koehler, 1978).

Even on a small scale, flies cause a number of grievances within a person‟s environment.

Increase the number of flies and it follows that the annoyance they cause is exponentially

increased. Potential breeding and feeding grounds provided by large livestock holders,

including bovine and poultry, inevitably attract flies to the area (Byrd and Castner, 2001).

This increased number of flies can spread to surrounding areas, which can result in an

increasing number of lawsuits (Byrd and Castner, 2001).

Another serious example associated with urban entomology is evidence of neglect (Byrd

and Castner, 2001). The presence of arthropod activity upon a person‟s living body

indicates that there is a lack of hygienic conditions and that they have not been cared for

appropriately. Nursing homes and hospital patients have been known to suffer neglect

18

through myiasis (infestation) of flies, resulting in companies being taken to Court and

charged with neglect (Byrd and Castner, 2001).

2.1.2 Stored Product Entomology

Another application of forensic entomology is the presence and effect of arthropod

activity within stored products. Although extensive precautions are maintained to ensure

such infestations do not occur, maggots, caterpillars, insect debris within stored foods is a

common complaint (Byrd and Castner, 2001). The maintenance fees of upholding a pest-

free storage environment are very high, but pale in comparison to the potential costs of

insect infestations (Rees, 2004). Fines, detrimental publicity, loss of consumers trust and

potential legal actions are some of the possibilities associated with the presence of a

single insect or insect by product within consumables (Rees, 2004).

2.1.3 Medico-Criminal Entomology

Medico-criminal entomology is where arthropods are utilised to help solve crimes (Byrd

and Castner, 2001). The majority of crimes associated with medico-criminal entomology

involve violence (Hall, 2001) including murder, manslaughter and assault. These crimes

are not isolated to humans and forensic entomologists can be required to assist in

resolving questions associated with the death or mistreatment of livestock and

endangered animals (Byrd and Castner, 2001).

Entomological-based post mortem interval (PMI) can be one of the most important pieces

of information associated with a crime. Forensic pathologists utilise three natural

decomposition processes to determine an estimated PMI (Erzinclioglu, 2000). The

presence or absence of rigor mortis (stiffening of the body), time taken for a body to

reach a certain temperature, taking into consideration surrounding conditions, and the

order of organ decomposition (Erzinclioglu, 2000). These conditions can only be

manipulated to estimate PMI within two or three days since death. Beyond this interval

other methods must be used, the foremost of which is forensic entomology (Erzinclioglu,

2000).

19

With violent crimes that exhibit entomological evidence two main questions are central

for the forensic entomologist. Based on the entomological evidence what is the estimated

time since death (PMI)? And is there any possibility that the body has been moved from

a different location?

Medico-criminal entomology makes conclusions based on the examination and

identification of arthropods collected from both on and surrounding the corpse (Catts and

Haskell, 1997). By assessing the developmental stage of the species present and utilising

knowledge of successive colonisation; conclusions can be drawn (Catts and Haskell,

1997). For this information to be manipulated a forensic entomologist needs to have

extensive understanding and skill in sampling, identification, analysing and specific

species knowledge including geographical spread and biology (Catts and Haskell, 1997).

Using this knowledge a forensic entomologist is able to identify the specimens collected

from a corpse, determine the stage of development and, taking into consideration

surrounding environmental conditions, determine the time taken for the specimen to have

reached the stage of development based on the predictable succession of a corpse.

2.2 Medico-Criminal Entomology - Historical Background

Forensic entomology was first documented in the His Yüan Chi lu (“The washing away

of wrongs”) in 13th

century China (Benecke, 2001a). The recorded case involved a

stabbing at a farm (Benecke, 2001a). The investigator Sung Tźu utilised a flies ability to

detect blood to identify the murder weapon, which resulted in the owner confessing to his

crimes (Benecke, 2001a).

The observation of maggots feeding on corpses has been described through sculptures,

paintings and poems throughout the middle ages, reflecting the long history of forensic

entomology. In the 18th

and 19th

centuries, medico-legal doctors furthered the

understanding of the relationship that exists between decomposition and arthropod

activity. French medical doctor Orfila, observed the abundance of maggots, after

20

viewing a large number of exhumations, understanding that the maggots and other

arthropods played an important role in decomposition (Benecke, 2001a).

In 1855 after the observation of maggots on a corpse, French Doctor Bergeret explored

the idea of PMI determination from arthropod activity and development (Benecke,

2001a). PMI is the estimated time since death based on the stage of development of the

arthropods present at the scene (Benecke, 2001b). Bergeret used the idea of PMI to

determine the time interval between birth and death of a child found in a flat (Benecke,

2001b). Though Bergeret misunderstood the developmental rates of the insects and

produced a hugely inaccurate PMI, this is the first recorded case of modern forensic

entomology.

French medical doctor Jean Pierre Mégnin published in 1894 his most important work la

faune des cadavers based on 60 years of experience in the forensic utility of entomology

(Byrd and Castner, 2001). This book developed the theory of predictable waves of

arthropods upon a corpse, highlighting the eight stages of decomposition and the fauna

associated with them (Benecke, 2001). The book also dealt with the identity of larval and

adult forms of the different species present and 19 cases that had relied on forensic

entomology (Hall, 2001). Whilst popularising the subject, Mégnin‟s work also greatly

advanced the science of forensic entomology.

Through the 1900s, continued research revealed species lists of fauna associated with

corpses, circumstances of death affecting decomposition and the seasonality of species

present at decomposition (Benecke, 2001a). In the 1950s Hubert Caspers investigated a

case where a murdered woman was found in a water mill, naked except for a pair of red

socks and wrapped in a sack (Benecke, 2001a). Caspers use of entomological evidence

allowed him to identify the specimens collected from the corpse originated from a

different geographical region and as a results exhibited an alternative rate and time of

development (Benecke, 2001a). Subsequent to these advances in forensic entomology,

Leclecq (1969) and Nuorteva (1977) have maintained the movement of forensic

entomology into the future (Benecke, 2001a).

21

Though convincing the local authorities and other scientists of the benefits of forensic

entomology was initially difficult, the 150-year-old discipline has now become an

accepted practical method of investigation. Books by Byrd and Castner (2001), Goff

(2000) and Smith (1986) and continual research have cemented the use of forensic

entomology as a decisive tool in the search for conclusive legal evidence.

Of the arthropods that have the potential to be considered forensically important, it is the

Diptera and from this group, specifically the Calliphoridae that are by far the most

applicable and frequently researched. This is due to their direct involvement in forensic

entomological investigations including the determination of time since death, evidence of

neglect and the movement of corpses (Rees, 2004).

2.3 The Diptera

Insects are by far the most abundant animals on earth, found on every continent including

Antarctica; making up 85% of the worlds‟ known species (Erzinclioglu, 2000). This

equates to ~1,000,000 species worldwide, with more species being identified and

recorded daily (Erzinclioglu, 2000). Flies are one of the largest orders of insects and are

most forensically significant.

Flies are from the order Diptera and worldwide there are over 86,000 known recorded

species (Byrd and Castner, 2001). Within their respective environments flies are

considered scavengers, decomposers, active pollinators, parasites and predators (Byrd

and Castner, 2001). Of these the most forensically significant species are those

associated with scavenging and decomposition, generally from the family Calliphoridae.

2.4 The Calliphoridae

The family Calliphoridae, commonly called blowflies, comprise more than 1000 species

(Byrd and Castner, 2001), and contains Lucilia (Phaenicia) (green bottle flies),

Chrysomya, Calliphora (blue bottle flies) and Cochliomyia (screwworm flies) (Byrd and

Castner, 2001).

22

Adult Calliphoridae range in size between 6-14mm and have antennae with three

segments and a hair located on the final segment (Byrd and Castner, 2001). One of the

most characteristic traits of this species is a distinct metallic colouration that can range

from green, blue, bronze or black (Byrd and Castner, 2001). In the endemic

Calliphoridae species of Australia, the metallic colour is commonly dulled by a covering

of fine dust (Harvey, 2006).

The Calliphoridae species are amongst the first to locate a corpse and have been known

to appear within minutes of death (Byrd and Castner, 2001). Once located, the flies begin

oviposition, instigating the process of colonising the remains. The most frequently

sought sites on a corpse are the nose, mouth, eyes, ears, other exposed body orifices and

open wounds (Erzinclioglu, 2000). The flies target these areas due to the moist and

shaded conditions, which prevent the eggs from becoming dehydrated and desiccated

(Erzinclioglu, 2000).

Once the eggs have hatched, maggots develop, which range in length from 8 to 23mm

and are white or cream in colouration (Byrd and Castner, 2001). The larval body has a

terminal segment that includes the site of the spiracles and identifiable cone shaped

tubercles about its perimeter (Byrd and Castner, 2001). The spiracles are used to identify

the instar development stage (to be discussed in detail on page 22), for breathing, and as

an identification feature, as the slits within the spiracles slant towards the centre of the

larvae. In contrast, the spiracles of the Sarcophagidae maggots slat outwards or

downwards (Byrd and Castner, 2001). As the maggots are the most important specimens

for the determination of PMI these features can be of distinct importance in early

identification.

For a forensic entomologist the early appearance of the Calliphoridae species in the

decomposition of a body is forensically the most important evidence and essential for the

determination of PMI. For an accurate PMI to be determined species-specific

information is required. Below are the characteristics, common names and distribution

23

throughout Australia of the species, which were tested in this research. Permission for

use of pictures for figures was obtained from Associate Professor Ian Dadour (2008)

2.4.1 Calliphora dubia

Calliphora dubia (Macquart) commonly referred to as the blue-bodied blowfly is

distributed throughout the South-West of Australia (Dadour et al., 2001). The Western

Australian agriculture department describes the C. dubia as yellowish in colouration with

a purple stripe on its abdomen. Its size can vary from 5-10mm in length and is most

abundant during winter and spring.

Figure 2.1 Picture of C. dubia, commonly referred to as the blue-bodied blowfly.

2.4.2 Calliphora albifrontalis

Calliphora albifrontalis (Malloch) is commonly referred to as the Western Australian

brown blowfly. It is a robust golden-brown blowfly that can reach a length of 13mm.

Like C. dubia its distribution is through the South-West of Western Australia and it is

most predominant during winter and spring seasons (Smith, 1986).

Figure 2.2 Picture of C. albifrontalis commonly referred to as the Western Australian

brown blowfly.

24

2.4.3 Chrysomya rufifacies

Known as the hairy maggot blowfly, the Chrysomya rufifacies (Macquart) is a green

metallic blowfly, with dark blue margins on its abdomen. It can reach a length of 10mm,

and has a known Australia-wide distribution (Smith, 1986). Its activity is mainly

observed in the seasons of summer through to autumn.

Figure 2.3 Picture of Ch. rufifacies commonly referred to as the hairy maggot blowfly.

2.4.4 Chrysomya megacephala

Commonly known as the oriental latrine fly, Chrysomya megacephala (Fabricius) is

found throughout the whole of the Australia, Asia, South Africa and Afro tropic Islands

region (Smith, 1986). They are an urban species aggregating near human dwellings,

making them more likely to be encountered in forensic investigations (Smith, 1986). It

is bright metallic green in colouration with black margins on the 2nd

and 3rd

abdomen

(DuPonte et al., 2003). The most distinctive feature of this species is the presence of

large red eyes in the adult, see Figure 2.4 (DuPonte et al., 2003).

Figure 2.4 Picture of Ch. megacephala commonly referred to as the oriental latrine fly.

25

2.4.5 Lucilia sericata

Lucilia sericata (Meigen) is a widespread species within Australia and is commonly

found in urban or sub-urban districts (Smith, 1986). Its common name is the sheep

blowfly. It reaches a length between 6 to 9 mm and has a metallic blue-green, yellow-

green, green or green-bronze colouration (Byrd and Castner, 2001).

Figure 2.5 Picture of L. sericata commonly referred to as the sheep blowfly.

2.5 Succession of Invertebrate activity on the corpse environment

As mentioned forensic entomology involves the study of the successive colonisation of

invertebrate activity on and surrounding a corpse. When this information is coupled with

the species-specific environmentally based developmental information and the scientific

equation of accumulated degree-days (ADD calculation) an approximate PMI can be

determined.

Succession relies on predictable patterns of insect colonisation upon a corpse based on

the physical, biological and chemical changes a body undergoes during decomposition

(Byrd and Castner, 2001). Each stage of decomposition attracts a different group of

sarcosaprophagous arthropods. During early decomposition insects are attracted to the

abundant food source of the corpse and the suitable oviposition site it provides (Byrd and

Castner, 2001). Later species are attracted by the abundant quantity of other insect

activity, which also provides them with a food source (Byrd and Castner, 2001).

The predictability of succession is dependent on numerous factors that could potentially

affect the corpse. Factors such as environment (urban verses rural), season, rainfall, sun,

26

temperature, orientation of the body (hanging, burnt, buried or in an enclosed space) and

the geographic region in which the body is found are taken into account (where possible)

to ensure that accurate species development information is used (Byrd and Castner,

2001).

Examples of different urban versus rural environment effects have been observed by

Galloway (1989). After analysis of 189 cadavers found at different decomposition stages

within the Arizona desert, Galloway (1989) observed that onset of decomposition and

mummification occurred faster, than if within indoor conditions. Another example is the

effect of low temperatures on insect activity. Bass (1997) found that insect activity was

maintained between temperatures of 5ºC and 13ºC, but if the temperature dropped to 0ºC,

maggots were unable to survive, which would result in a longer decomposition period.

As mentioned Calliphoridae are amongst the first species to arrive at a corpse, with some

research suggesting they can arrive within minutes of death. The idea of succession is

dependant on the knowledge of the time of arrival of each species, and the temperature-

dependant time required to reach a developmental stage. Table 2.1 represents a broad

timeframe of the deposition of Calliphoridae (blowflies) upon a corpse. It is clear from

Table 2.1 that colonisation continues from the start of decomposition through to the later

stages of putrefaction. This colonisation length makes Calliphoridae one of the most

forensically important species to be collected from a corpse (Gunn, 2006).

27

Table 2.1: The decompositions stages that occur after death and the associated

Calliphoridae activity observed at each stage.

Stage of Decomposition

Calliphoridae (blowfly) Development Stage Observed

Fresh Blowfly eggs. 1st Instar Larvae.

Bloat Blowfly eggs. 1st, 2nd and 3rd Instar Larvae.

Putrefaction (Advanced Decay)

No eggs or 1st Instar Larvae. 2nd and 3rd Instar Larvae. Pupae in Surrounding environment.

Putrid Dry Remains

No Larvae Observed. Small number of pupae in surrounding environment.

An understanding of arthropod succession upon a corpse needs to be coupled with

detailed information of the life cycle of the species visiting the corpse. Figure 2.6 is a

diagrammatic representation of the life cycle of Calliphoridae including the specific

stages of larvae development (Goff, 2000). Each species follows a typical cycle, it is

only the specific time taken to arrive at a body and length of time spent at the body

reproducing and development of young that change between species (Campobasso et al.,

2001).

28

Figure 2.6: Typical life cycle of Diptera, including variations between larval

developmental stages (Goff, 2000, p52).

The first stage of the life cycle of flies is the eggs. Blowflies are typically diurnal, which

means they only deposit their eggs during the day, as their activity is inhibited at night

(Campobasso et al., 2001). The oviposition of Calliphoridae eggs occurs during the fresh

and bloat stages of decomposition, but ends by putrefaction due to the lack of a suitable

food source (Hall, 2001).

The next stage of development is the larvae, which is the immature stage of an insect and

is the most frequently observed stage of development associated with a corpse. The

larvae are split into three developmental stages; 1st, 2

nd and 3

rd instar. Instars are the

stage of successive molts experienced by the fly (Byrd and Castner, 2001). Age of larvae

can be determined by the molt stage of the larvae, which is identified by the number of

spiracles present on the posterior of the larvae (Figure 2.6). First instar larvae have a

29

single slit in the posterior spiracle, whereas the 2nd

instar larvae have two slits on the

posterior spiracle. The larvae of successive species will be present on the corpse from the

fresh stage of decomposition to the putrefaction stage. The extensive duration of larvae

upon a corpse is due to the food source available for the larval species to consume.

Once the larvae are mature they will migrate from the body to shed their skin to form a

pupa. The unusual aspect of this process is that the shedding is done from inside the old

skin, which will shrink and harden to form a protective outer skin called a puparium

(Byrd and Castner, 2001). The morphological features of the larvae are retained on the

puparium and can be used as a means of identification (Byrd and Castner, 2001). Once

the pupae have completed metamorphosis the adult fly will emerge, beginning the cycle

anew.

Succession relies on a predictable sequence of species arrival upon a corpse and has long

been considered an accurate method of PMI. It must be understood though that each

region will have different species, which can arrive in different orders or be present upon

the corpse for variable times. Goff (2000) recorded within the Hawaiian region that the

first species to colonise a corpse was Chrysomya rufifacies, yet within Western Australia

Dadour (2001) found Calliphora dubia to be the primary blowfly collected. The

predicability of succession is limited to detailed species information for a specific

geographical region.

2.6 Post-Mortem Interval

PMI is the determination of the estimated time of death or the time elapse between death

and locating the body (Dix et al, 2001). PMI can be applied to numerous areas of

forensic work but investigation of homicide is of critical importance. Elimination of

suspects or the connection of victims to a missing person‟s records can be determined via

the information provided through PMI (Byrd et al, 2001). Unfortunately unless death is

witnessed the exact PMI cannot be determined, but there can be sufficient forensic

entomological evidence for an estimation to be made (Dix et al, 2001).

30

In the determination of PMI specific steps must be followed.

1. Collect specimens from on and around corpse, collecting eggs, larvae, pupae and

adult flies if present.

2. Record temperature of scene and maggot masses, location of body (inside or

outside), surrounding environment (urban or rural) and any information that may

be relevant during analysis (presence of animals, disturbance of site or partial or

full burial).

3. Identification of specimens collected.

4. Obtain climatic data for approximately a month prior to discovery of corpse and

several days after. The mean temperature must be determined, making a note of

excessive rainfall or extreme low temperatures.

5. Analysis of larvae, including length and instar stage. This recorded information

should then be compared to databases for the relevant species, with reference to

relevant mean temperature determined previously. This will allow for the age of

the specimens to be determined.

6. Using the mean temperature determined previous and specific-species information

accumulate degree days (ADD) can be determined. ADD is simply the

calculation of multiplying the hours taken for a species to reach a developmental

stage by the mean temperature (Amendt et al., 2007). The resulting number is

then divided by 24 to reach the estimated number of days between death and

location of the body. It must be noted that succession patterns will have to be

considered within the final analysis.

Cases that have utilised the above methodology include neglect of elderly people in the

form of misconduct by carers (Benecke et al., 2004), neglect of children (Benecke et al.,

2001b), suicides (Arnaldos et al., 2005) and homicides (Catts et al., 1990, Arnaldos et al.,

2005, Goff, 2001 and Erzinclioglu, 2000).

By far the most important aspect prior to the determination of PMI in all forensic

entomology cases is the accurate identification of the specimens collected from the

corpse. False identification would lead to the application of incorrect developmental data

31

and succession information resulting in an inaccurate PMI. Below is the traditional

method of species identification, followed by the variety of modern techniques available

as an alternative means of identification.

2.7 Forensic Entomology - Morphological Identification

Traditionally the identity of a specimen was determined using morphology.

Morphological techniques rely on taxonomic keys and illustrations coupled with an

extensive knowledge of entomology (Smith, 1986). Identification can be complicated by

many underlying problems, including quality of samples, lack of identification key for

immature specimens, loss of diagnostic features (during extraction), subtle differences

between species and foreign species.

The quality of a specimen collected can vary greatly, from whole larvae, to only a

fragment of a single fly wing (Ames et al., 2006), affecting the ability of the taxonomist

to morphologically identify the species. If the specimen is poorly preserved or damaged,

the diagnostic features can be lost, thus making an accurate identification impossible

(Harvey et al, 2003). Subtle differences between species are common, which can result

in the false identification through lack of knowledge or mis-judgment of a feature.

Furthermore, if the feature exhibiting the only difference between species is lost or

damaged, identification and therefore PMI cannot be determined. Wallman (2001) has

suggested that the third instar of some species is unable to be separated diagnostically,

thereby making them impossible to identify without the rearing of larvae to adults.

Rearing is a time consuming process, which is dependent on larvae not having been

preserved, and thus killed, prior to identification attempts (Stevens et al., 2001).

Though there is an extensive collection worldwide of taxonomic literature (Smith, 1986),

this does not extend into immature stages of development, such as eggs and larvae. In

relation to Australian species this is particularly evident (Harvey et al, 2003). The

majority of specimens collected from on or around a corpse are larvae (maggots) making

this lack of diagnostic information of great significance, as PMI initially relies solely on

this information (Wallman et al, 2001).

32

For the diagnostic keys available, the complex wording of morphological features

requires an extensive knowledge of insect morphology and numerous years of experience

for a positive identification to be possible. The closer the diagnostic keys are to

identifying a species, the more complicated and subtle the descriptions become. Below is

an example of the detailed entomological language utilised. The description is used in

the identification of L. sericata from L. cuprina (Smith, 1986).

Upper margin of anal segment in end view with the inner tubercule (i) separated

from each other by a distance approximately equal to the distance between the

inner (i) and median (m) tubercules. Lucilia sericata

Another problem that is becoming more frequent is the presence of foreign carrion

breeding blowflies (Wallman et al, 2001).

Due to these problems, an alterative method of identification is imperative for

entomological evidence to be used as a frequent and acceptable tool in criminal cases.

The new diagnostic identification technique must fulfil certain criteria to be accepted

over tradition methods.

Identification from any stage of development.

No reliance on a single feature that can be easily damaged.

Distinction between local and exotic species.

Reproducibility of tests.

Relatively easy to perform.

Taking into consideration all these factors alternative techniques have been tested to

deem the most appropriate replacement for morphological identification of forensically

important arthropods.

2.8 Alternative Approaches to Identification

2.8.1 Scanning Electron Microscopy (SEM)

The idea of morphological identification, though highly problematic, still has merit to

warrant continual research with advanced techniques. SEM allows for the visualisation

33

of an abundance of features previously not considered (Sukontason et al., 2004a).

Sukontason (2006) used SEM to morphologically differentiate Chrysomya rufifacies and

Chrysomya villeneuvi via elaborate tubercles and the number of globules at the dorsal-

lateral membrane border. Sukontason (2004a) furthered the application of SEM to more

species by observing morphological differences between antennal sensilla (sensory

organs). Sukontason (2007) also targeted the identification of forensically important eggs

via the use of SEM, and found the split of the plastron differed between Lucilia cuprina

and Lucilia ibis and could be used for identification.

2.8.2 Potassium Permanganate staining technique

Potassium permanganate staining has been utilised by Sukontason (2004b) as an

alternative method of identification for the sometimes problematic but forensically

important eggs. The staining enhances features so that they can be observed under light

microscopes. Sukontason (2004b) found that the eggs from the Calliphoridae species

Chrysomya nigripes, Chrysomya pacifica, Aldrichina grahami, Lucilia cuprina, Musca

domestica and Megaseli. Scalaris could be distinguished subsequent to staining. This

distinction was not reflected by Chrysomya rufifacies or Chrysomya megacephala.

Though the technique shows potential as a simple and relatively inexpensive method of

morphological identification, the lack of universal distinction between species is a key

limitation.

2.9 Deoxyribonucleic acid (DNA) - General Background

DNA is the genetic material of living things, located within every cell of the body (Glick

et al., 2003). Friedreich Miescher, a Swiss Biochemist, made the discovery of DNA in

1869, which was obtained from pus stained bandages and fish sperm (Tobin, et al.,

1997). In 1944, Oswald Avery, determined that DNA was the genetic material, which

had been encoded with information for the establishment and maintaining of cellular and

biochemical functions within organisms (Glick et al., 2003).

In the 1920s biochemist P.A. Levene found that no matter the source of DNA the

chemical structure was the same (Tobin et al., 1997). The chemical structure of DNA

34

consists of four nucleotide bases, which are Adenine (A) and Guanine (G) (purines), and

Thymine (T) and Cytosine (C) (pyrimidines). The nucleotides are complementary such

that adenine binds to thymine with a double hydrogen bond, whilst guanine binds to

cytosine with a triple hydrogen bond (Griffith et al., 2005). The backbone to which the

nucleotides attach is a phospho-sugar component arranged in a double helix structure,

which was discovered in 1953 by James Watson and Francis Crick (Rudin et al., 2002).

DNA is the vehicle by which traits are transferred through each generation and is now

referred to as the „blue-print of life‟ (Rudin et al., 2002). The specific arrangement of

nucleotide bases is what provides distinction between species (Griffith et al., 2002). The

challenge has been the identification of species based on the variation between species.

Below are examples of the uses of DNA for the identification of forensically important

Calliphoridae.

2.10 DNA Based Methods of Identification

2.10.1 Random Amplified Polymorphic (RAPD) DNA

RAPD requires limited knowledge of the DNA sequence of an organism/species and

instead relies on the use of several arbitrary short oligonucleotide primers, 8-12 base in

length (Otranto et al., 2002). The arbitrary primers randomly amplify segments of DNA

producing a pattern (fingerprints) that can be used as a means of identification (Benecke,

1998). The discriminating power and efficiency of RAPD‟s has been utilised in

commercial breeding, research of endangered species, bacteria, plants and several insects

and inbreeding in wildlife (Benecke, 1998). Benecke (1998) has shown the potential of

the technique in the identification of forensically related arthropod species and found that

distinct profiles could be developed. The main limitations associated with the technique

were the variation in both the height and width of peaks within the fingerprint under

different parameters. These parameters include the brand of PCR thermocycler, the DNA

concentration and the specific primers utilised (Benecke, 1998). Due to these limitations,

the technique was utilised as a species-identification test for urgent cases, where further

testing was to be conducted.

35

2.10.2 PCR-Restricted Fragment Length Polymorphism (PCR-RFLP)

PCR-RFLP is another method for species identification. PCR-RFLP involves the

amplification of specific regions of DNA using target primers (Schroeder et al., 2003).

The resulting product is then further digested with restriction enzymes and then the

resulting bands are viewed using gel electrophoresis (Noel et al, 2004 and Schroeder et

al., 2003). Restriction enzymes cut at specific nucleotide combinations within the

genome. These cutting sites (usually 4-6 nucleotides in length) cover variations in the

region that distinguish species (Schroeder et al., 2003). The technique is both rapid and

accurate and has been used to distinguish species from U.S, Canada and Germany (Noel

et al, 2004 and Schroeder et al., 2003). Noel (2004) used the technique to confirm the

identification of museum specimens and found that molecular testing conveyed mistaken

morphological identity of more than one specimen. Schroeder (2003) researched the use

of PCR-RFLP in the differentiation of Calliphoridae and found a degree of distinction but

also similarity between species. The regions targeted using this technique include the

cytochrome oxidase I (COI) and cytochrome oxidase II (COII) genes in the mitochondrial

DNA (mtDNA) and the tRNA leucine gene (Schroeder et al., 2003). Though a

potentially viable technique, the additional step of identifying restriction enzymes sites

for the production of unique PCR-RFLP patterns (Ratcliffe et al., 2003); which is both

time and resource consuming has resulted in its reduced application within the field of

forensic entomology in favour of more advanced techniques.

2.10.3 Ribosomal Genes

Nuclear ribosomal DNA (rDNA) is considered a useful target for the identification of

species as it contains an array of tandemly repeated units (Otranto et al., 2002). Within

the repeat units, internal transcribed spacers (ITS-1 and ITS-2) and associated ribosomal

RNA (rRNA) genes (12S, 18S and 28S) are present (Otranto et al., 2002).

ITS sequences are found within the non-coding regions of the DNA, and exhibit high

substitution rates lending themselves to phylogenetic studies of populations (Otranto et

al., 2002). ITS-1 and ITS-2 typing have also proven useful methods of identification of

arthropods as they have a high degree of interspecific sequence variation coupled with

36

low levels of intraspecific sequence variation (Otranto et al., 2002). Phuc (2003)

determined the ITS-2 sequences to be suitable in the identification of 2 sibling species

and 4 related species of Anopheles.

The rRNA genes have an intrinsically varied degree of genetic evolution, which lends

itself to phylogenetic studies especially in the distinction between older evolutionary

relationships (Stevens et al., 2002 and Stevens, 2003). Within the rRNA there are highly

informative regions that represent potential sites for the development of molecular

markers for the identification of forensically important Calliphoridae (Steven and Wall,

2001). The advantages of rRNA include the high volume of information on the gene

family and the large amount of highly conserved sequence (Kumar et al., 1999).

The 16S and 12S rRNA have been used by Kambhampati and Smith (1995) in the

development of universal primers in the identification of 10 insect taxa due to the high

amount of conserved regions. Stevens and Wall (2001) found the 28S rRNA gene to be

an appropriate region for the development of species-specific molecular markers for the

identification of 9 forensically important species from Britain and Europe. One problem

encountered was the identification of 2 Lucilia species, which required further DNA

sequencing of the 28S rRNA region to establish definitive separation. Though an ideal

method of inter-species identification, intra-specific identification has proven difficult. In

testing of Lucilia cuprina, intra-specific separation was not possible using the 28S rRNA

gene (Stevens et al., 2002). Also tested in that study was the 2.3kb of the COI and COII

region, which instead conveyed a wide variation of differences across all specimens

making separation of the L. sericata and L. cuprina a possibility (Stevens et al., 2002).

2.10.4 Cytochrome Oxidase Genes of the Mitochondrial DNA

Mitochondrial DNA (mtDNA) is the genome located within the mitochondrion. Utilising

a separate set of enzymes to nuclear DNA, the mitochondria is able to code for a number

of functions, including self-replication and genome transcription (Hale et al., 1995). The

mitochondria are considered the site of energy production within a cell and have such

been named the „powerhouses‟ (Hale et al., 1995). The mtDNA is composed of 2 rRNA

37

genes, 13 protein-coding genes and 22 transfer RNA (tRNA) genes (Otranto et al., 2002).

Structurally the mtDNA is a circular, double-stranded molecule generally between 15 to

20kb (Junqueira et al., 2004). Recently, mtDNA has become a common tool of

taxonomy, population analysis and evolutionary investigations because of its high copy

number and high mutation rate, which has led to rapid sequence differences between sub-

species within only a few generations (Malgorn et al., 1999). Another important

characteristic of mtDNA is the large amount of highly conserved sequences, which

allows for the development of universal primers (Otranto et al., 2002).

Genes within the mtDNA are able to accumulate mutations over time, making it a

common target region in the use of phylogenetic studies including the grouping of

blowflies of forensic importance (Wells and Sperling, 2001). Recently the focus of

mtDNA has been the development of molecular markers for the identification of

arthropod species (Noel et al., 2004 and Phuc et al., 2003 and Stewart et al., 2003).

Within the mtDNA the majority of published material focuses on the cytochrome oxidase

genes one and two (COI and COII) and the Cytochrome b gene (Cyt-b). The COI and

COII regions have been extensively studied for their use in the identification of

forensically important species across the world (Ames et al., 2006, Malgorn and Coquoz,

1999, Harvey et al., 2003, Wallman and Donnellan, 2001, Wells and Sperling, 2001,

Zehner et al., 2004, and Saigusa et al., 2005). Areas that have been studied include

Western Australia, South Australia, South Africa, USA, Canada and Europe (Wallman et

al, 2001, Harvey et al., 2003, Wells et al., 2001).

COI is the terminal catalyst in the respiratory mitochondrial chain and has proven to be

one of the most suitable areas for the development of species identifiable markers

(Otranto et al., 2002). The COI is large in size and contains both highly conserved and

variable regions (Otranto et al., 2002). Harvey et al., (2003) utilised a 278bp region of

the COI region in the identification of 5 forensically important species from the Western

Australian region. A problem encountered by Harvey et al., (2003) was the difficulty in

distinguishing between some species, which could only be alleviated through the

sequencing of a larger region of the COI gene. Saigusa et al (2005) extended the region

38

of COI analysed to 304bp and found that 8 forensically important species from Japan

could be successfully identified.

Analysis of the COII gene by Wallman and Donnellan (2001) found the gene to be a

potential developmental site for the identification of forensically important Calliphoridae

species. The majority of research for the identification of Calliphoridae species using the

COII gene has been performed in conjunction with the COI gene (Stevens, 2003, and

Stevens and Wall, 2001). Within other insecta species the use of the COII gene has been

more prominent (Ma et al, 2006 and Goswami et al., 2005).

The use of the Cyt-b gene as a means of species identification is relatively rare due to a

lack of sequences for the region. Ramos de Pablo (2006) has found through preliminary

testing that the Cyt-b gene can differentiate between insect orders and has the potential

for species identification.

The extensive research into the COI gene has made it a useful site for the development of

new primers in an attempt to design an efficient and reliable means of identification.

2.10.5 Sequence Specific Primers

Sequence specific primers (SSP) are designed to identify at least one species based on the

presence of a unique segment of nucleotides within the sequence. Overall the greatest

application of SSP has been in relation to humans (Gonzalez et al., 2003, Clague et al.,

2003, Grahn et al., 2001 and Pantelidis et al., 2003). SSP applications are varied and

when coupled with PCR are considered a rapid and accurate technique.

In the realm of insects the most frequent application of SSPs is in relation to the genus

Anopheles, commonly referred to as the Mosquito (Manonmani et al., 2001, Fettene et

al., 2002, Kampen et al., 2003 and Phuc et al., 2003). The distinct focus associated with

the Anopheles is their interaction with humans and the relating medical implications.

SSPs have been used to identify malaria vectors from non-malaria vectors assisting in

locating only the populations with medical consequences to humans (Phuc et al., 2003).

39

Noel (2004) compared SSP with PCR-RFLP and found identification using both possible,

but SSP had a much higher success rate than PCR-RFLP.

The human forensic application of SSP has been shown in the analysis of bloodstains

upon cloth (Ota et al, 2006). Ota (2006) describes how SSP can be used to type the

highly polymorphic human leukocyte antigen gene(s) from both fresh samples and dried

samples upon cloth ranging from a single day to 3 months. Ota (2006) found the

technique to be highly sensitive and did not require the isolation of DNA prior to

analysis, making it a very useful forensic tool.

Marshall (2007) describes the use of SSP for the forensic discrimination of two species of

scallops, Placopecten magellanicus and Chlamys islandica. The mis-identification of

seafood has many forensic implications including the breach of fishing regulations,

pressure on endangered species and fraud of commercial products (Marshall et al., 2007).

Marshall (2007) describes the difficulties associated with visual identification of species

due to loss of identifiable features and how the use of SSP is both rapid and relatively

inexpensive.

SSPs have been used both forensically and non-forensically, on both insects and humans

on the basis that identification using morphological methods is unreliable and not ideally

suited for forensic situations. Though the use of SSP in relation to Calliphoridae has not

been applied, the results obtained in research on other insects demonstrate its potential as

an identification tool of forensically important Calliphoridae.

The use of SSPs relies on the concept that where there is a difference between species in

a particular segment of the sequence, it can be used to identify species based on the

presence or absence of amplification. This method depends on careful and accurate

design of the SSP for it to be an effective identification tool. The tools utilised in the

amplification of the SSP pairs from the study are polymerase chain reaction (PCR) and

multiplex PCR.

40

These techniques presented are a selection of the increasing application of DNA based

approaches to the area of forensic and specifically forensic entomology. Additional

techniques to these mentioned above include sequencing, which is applied to multiple

DNA techniques and allows for whole sequences to be viewed, analysed and manipulated

for identification (Malgorn et al., 1999), development of molecular phylogenies (Nei,

1996) and population structuring (Lessinger et al., 2000). Other techniques also include

inter simple sequence repeats (ISSR) (He et al., 2007) and sequence-characterised

amplified regions (SCAR‟s) in the development of universal markers for identification

(He et al., 2007 and Vidal et al., 2000). DNA based area of research are continually

developing and advancing towards greater efficiency and specificity and subsequently

improving and increasing the application of forensics within the society. A common

methodology occurring between the majorities of the DNA techniques mentioned above

is the polymerase chain reaction.

2.11 Polymerase Chain Reaction (PCR)

DNA within a cell is naturally copied prior to the division of the cell. The laboratory

replication of this method is the process called the polymerase chain reaction (PCR).

PCR is an in-vitro reproduction technique of specific DNA sequences in analysable

amounts (Hoy, 1994) and following its introduction, PCR has become one of the most

significant techniques in biology. PCR is an enzymatic process that facilitates a specific

segment of the DNA molecule to be isolated and amplified (Gunn, 2006). Since its

introduction, PCR has been applied to a large range of scientific disciplines and has since

become a widespread research technique. The amplification of low copy numbers of

DNA, isolation of DNA fragments, cloning DNA and genomic DNA, sequencing of

DNA and the mutagenesis of specific DNA sequences are examples of some of the

applications of the PCR reaction (Hoy, 1994). Predominantly the samples commonly

encountered in the forensic application of PCR include saliva residues on envelopes…

(Withrow et al., 2003), blood (Pizzamiglio et al., 2004) and fingerprints (Balogh et al.,

2003); allowing for DNA profiling to be conducted as a means of exclusion or conviction

of suspects.

41

2.11.1 PCR Protocol

Three main steps are involved in the PCR process allowing the amplification of a specific

target DNA sequence. These are denaturation, annealing and synthesis, which are cycled

to allow for an exponential increase in the DNA template quantity. After a certain

number of cycles the PCR will no longer exponentially accumulate amplification

fragments and will enter a linear stage (Saiki, 1989). The greater the concentration of

DNA the fewer cycles required in reaching an amplification plateau (Hoy, 1994). A

standard PCR will have approximately 30-35 cycles, but if the DNA concentration is

extremely low 40-45 cycles may be required (Hoy, 1994). Below is a detailed

description and diagrammatic representation (Figure 2.7) of each step involved in the

PCR.

Prior to PCR cycling, the initial step is the thermal denaturation of the double-stranded

DNA into single-stranded DNA at an optimal temperature of 94-95ºC (Glick et al.,

2003). This step is maintained for approximately 1 to 3 minutes and ensures that the

entire DNA template within the reaction is separated into single strands (Hoy, 1994). If

complete initial denaturation is not obtained, it will result in the inefficient utilisation of

the template, causing overall final yield of PCR products to be poor (Hoy, 1994). After

the completion of the initial denaturation step, the temperature will be maintained and the

first denaturation of the PCR cycles will begin. This initial doubling of denaturation only

occurs once within a reaction and further ensures complete template separation. During

cycling the denaturation step is reduced to 30 seconds, and separates the newly

synthesised double-stranded DNA sequences and activates the Taq polymerase (Erlich,

1993).

The second step of the cycle is primer annealing or attachment to the complementary

single-stranded DNA sequence. For this step the temperature of the reaction is slowly

cooled to the optimal annealing temperature, which is determined using the base

composition of the primer (Glick et al., 2003). In a standard PCR this step occurs for

approximately 20 to 30 seconds (Hoy, 1994). During the first cycles, the primer will scan

the template to locate the correct target sequence for amplification (Hoy, 1994). Once the

42

newly synthesised product is selected it will become the preferred template for primer

attachment (Hoy, 1994).

The third step is the synthesis of the complementary DNA using the 3‟ end of the

previously attached primer as a marker for extension (Glick et al, 2003). This is

accomplished using Taq DNA polymerase and free nucleotides present within the

reaction (Hoy, 1994). The synthesis of the new template strand occurs in a 5‟ to 3‟

direction (Hoy, 1994), under the standard conditions of 72ºC for 30 seconds (Erlich,

1993). It is during this step that complementary double-stranded DNA is produced ready

for the cycling process of PCR to recommence.

After the cycling of the above three steps has ended there is a final extension period. The

final extension ensures that all the protruding ends of the newly synthesised PCR

products are filled in, resulting in the presence of double-stranded DNA sequence of the

accurate length determined by the primers (Glick et al., 2003). Within a standard

reaction the final extension occurs at 72ºC for 5 minutes (Hoy, 1994).

43

Figure 2.7: Schematic representations of a standard PCR in the amplification of target

DNA using specific primers. Included are the reagents involved, the three PCR steps and

the exponential increase of DNA following each cycle (from Hoy, 1994, p206)

2.11.2 PCR Reagents and Optimisation

PCR requires specific reagents to be combined in exact amounts to ensure accurate and

efficient amplification of a specified segment of the DNA sequence. The standard

reagents included within a PCR are a DNA sample or template, deoxynucleotide

triphosphates (dNTPs), Taq DNA polymerase, DNA polymerase buffer, MgCl2, and

specific primers (Saiki, 1993). Each reagent has a specific role to play within the PCR

and its concentration within the final volume should be optimised.

DNA can be obtained from various sources, but the samples must have a sufficient

amount of intact DNA for the PCR to amplify the specific DNA sequence (Ridgwell,

44

2004). A standard PCR ideally requires 105 to 10

6 target molecules for primer-template

binding (Hoy, 1994). If the template concentration is too low there is limited target

regions for primer-binding, results in limited or inhibited amplification in the PCR.

Alternatively if the template concentration within the reaction is too high it can promote

the production of non-specific bands or inhibit the reaction entirely.

The dNTPs are the four nucleotides that make up DNA (dATP, dTTP, dCTP, dGTP).

Free dNTPs are required in the synthesis of a complementary sequence of the template

DNA (Ridgwell, 2004). It is important that all dNTPs are present in equal amounts

within the reaction for efficient precursors during synthesis (Saiki, 1993). The amount of

dNTPs within the reaction should be between 50 to 200µm as they directly reflect the

amount of free Mg2+

(Saiki, 1993).

Taq DNA polymerase is involved in the extension of the complementary DNA replicated

within the PCR (Hoy, 1994). Originally in 1985 an Escherichia coli DNA polymerase I

was utilised, which synthesised DNA at 37ºC, resulting in the addition of new DNA

polymerase every cycle (Hoy, 1994). This was not an efficient process and an alternative

DNA polymerase was sought. Taq DNA polymerase is from a thermophilic eubacterial

microorganism Thermus aquaticus (T. aquaticus) isolated from a hot spring in

Yellowstone National Park (Gelfand, 1989). The distinct advantage of Taq was its

thermostable abilities to withstand repeated exposure to temperatures up to 94-95ºC

required in the denaturation of double-stranded DNA (Hoy, 1994). This feature allowed

for a single application of Taq DNA polymerase within a PCR, greatly improving the

efficiency, specificity and yield of the reaction.

MgCl2 concentration affects the ability of the primer to anneal to the specific site of the

template DNA sample and hence can affect both specificity and yield of the PCR (Saiki,

1989). Raising the MgCl2 concentration lowers specificity, which is roughly comparable

to the lowering of the annealing temperature (Hoy, 1994). If there is an excess

concentration of Mg2+

it will result in an accumulation of non-selected product,

alternatively if the concentration is too low, the overall yield of the reaction will be

45

reduced (Hoy, 1994). The MgCl2 concentration affects both the Taq DNA polymerase

and dNTP amounts within the PCR, the recommended standard concentration within a

reaction are 1.5mM of MgCl2 with 200µM of each dNTP, which provides sufficient free

Mg2+

for primer-binding without inhibiting the Taq DNA polymerase activity (Saiki,

1989).

Primers determine the length, specificity and nature of the amplified DNA (Hoy, 1994).

Within a standard reaction, there is both a forward and reverse primer, which flank the

segment of DNA to be amplified (Hoy, 1994). As visible in Figure 2.7 the primer

anneals to the single-stranded DNA and provides the starting point for the extension of

the complementary sequence identified for replication (Hoy, 1994). If primer

concentration is in excess within the reaction, non-selected products will be amplified

(Gunson et al., 2003). Alternatively if the primer concentration is low, the overall yield

of the reaction will be reduced (Gunson et al., 2003).

2.11.3 Specific PCR Primer Design

Primer design provides the distinct specificity required to amplify only the segment of

DNA required for the analysis. In the design of a stable, specific primer the following

guidelines must be taken into consideration (Hoy, 1994):

1. A unique primer sequence

2. GC content between 45-55%

3. Primer length between 18-25 oligonucleotides

4. No self-complementarity

5. No antisense complementarity

The initial guideline in primer design is that the primers are composed of a unique set of

nucleotides (Sharrocks, 1994). The most important region requiring unique nucleotides

is the 3‟ end, as this is where synthesis begins (Sharrocks, 1994). A method for

increasing the specificity of the 3‟ end of the primer is the addition of a mismatch base,

which is located at the second nucleotide position from the 3‟ end of the primer and does

46

not exhibit complementarity with the template sequence. This lack of complementarity

ensures to a degree that only the specified segment of the template can bind with the

primer.

The distribution of unique nucleotides within the primer sequence includes an optimal

GC content of 45-55% and an avoidance of purine and pyrimidine stretches (Saiki, 1989).

By utilising the individual base composition within the primer sequence it is possible for

an approximate annealing temperature (Tm) to be determined via the equation: Tm =

2AT + 4GC (Suggs et al., 1981). Calliphoridae DNA has proven to be difficult in the

development of specific primers, due to an average GC-content of only 30% (Junqueira et

al., 2004). Even with this limitation, successful primers have been designed and proven

both efficient and stable for specific amplification (Ames et al., 2006, Malgorn and

Coquoz, 1999, Harvey et al., 2003, Wallman and Donnellan, 2001, Wells and Sperling,

2001, Zehner et al., 2004, and Saigusa et al., 2005).

The average recommended length of a primer is 18-25 nucleotides, but this can vary

depending on the specific region to be amplified from the template DNA sequence (Hoy,

1994). The length of the primer is dependant on the amount of specificity required by the

primer in the amplification reaction (Hurley et al., 1993). Primers 18-25 nucleotides in

length are generally recommended, as it provides both primer stability and specificity

(Sharrocks, 1994). In the use of multiple primers, it is recommended that all primer be of

the same or similar length (Hurley et al 1993).

Secondary products are unexpected amplification artefacts caused by the mis-annealing

of the primer, either via self-complementarity or antisense complementarity (Saiki,

1989). Self-complementarity is where the primer hybridises to itself instead of the

template (Hurley et al., 1993). This occurs when the 3‟ end of the primer anneals to its

own 5‟ end resulting in the folding of the primer into a hairpin structure to be formed

(Hurley et al., 1993). These secondary product hairpins will be the favoured product in

the PCR, overwhelming the reaction and masking the desired primer amplification

47

(Hurley et al., 1993). Ensuring long stretches of a single base within the primer sequence

are avoided can prevent self-complementarity (Sharrocks, 1994).

Antisense complementarity is where the primer exhibits homology with the antisense

primer within the reaction (Sharrocks, 1994). The secondary product resulting from this

is the formation of primer-dimers (Sharrocks, 1994). Primer-dimers are the partial

hybridisation between primer pairs resulting in the formation of a double-stranded

fragment with a length close to the sum of the two primers involved (Saiki, 1989). As

with the hairpin structures, primer-dimers can overwhelm a reaction becoming the

predominant product, masking the expected amplified amplicon (Saiki, 1989).

The above recommendations and guidelines usually result in the design of primers with a

relatively high degree of success due to the removal or prevention of potential

problematic features. These guidelines are not foolproof and it is possible for potential

primers that are designed accurately and carefully to still result in failed amplification.

For all primer-design conducted within this study, these guidelines and recommendations

were applied to ensure high-quality primer design for subsequent testing.

2.12 Multiplex PCR

Multiplex PCR is a variant of the standard PCR in which two or more DNA targets are

simultaneously amplified within a single reaction (Henegariu et al, 1997). Figure 2. 8

shows the difference between a standard PCR, which utilises a single primer pair, and the

multiplex PCR, which uses numerous primer pairs each with a specific region to amplify.

The obvious advantage of this technique is the considerable time, effort and resources

that can be saved and is consequently becoming a popular technique within the realm of

forensic science.

48

Figure 2.8: Diagrammatic representation of the difference between standard PCR primer

binding (a) and multiplex primer binding (b). The standard PCR involves a single

forward and reverse primer. Multiplex PCR can be composed of multiple reverse primer

pairs and a single forward primer, where only the expected primer will bind to its selected

species.

Multiplex PCR was first described by Chamberlain in 1988 and has since been adapted to

varied areas of DNA analysis (Markoulatos et al, 2002). These areas include gene

deletion analysis (Cagliani et al., 2004), mutation and polymorphism analysis (Barker,

2000), quantitative analysis (Bombieri et al., 2005) and reverse transcription PCR (Morin

et al, 2004). Multiplex PCR has also become a tool in the identification of viruses

(Heredia et al., 1996), bacteria (Malkawi et al., 2003 and Kawaguchi et al., 2005),

parasites (Orlandi et al., 2003), insects (Pavan et al., 2007 and Dang et al., 2005) and

medically important insecta (Phuc et al., 2003, Kengne et al., 2001 and Noel et al.,

2004).

Pavan (2007) utilised the multiplex PCR technique for the diagnostic identification of the

cryptic species complex of Rhodnius prolixus and Rhodnius robustus (Hemiptera).

Pavan (2007) found the multiplex PCR component to be simple, objective and cost-

efficient. Dang (2005) has also utilised multiplex PCR as a rapid and powerful method in

the identification of Trichogramma wasps. Dang (2005) found multiplex PCR to be fast

and required low quantities of DNA. Dang (2005) also found it was possible to design a

multiplex PCR that avoided false negative results via the presence of at least one band for

every species.

49

Though the above examples represent the application of multiplex PCR to insects, the

species they utilised are not pertinent to this study. Noel (2004) has explored the

application of the technique in relation to Calliphoridae in the identification of two

species of Cuterebra, which are known to cause myiasis. Noel (2004) found the

technique to be efficient and to have a high identification success rate, when compared to

alternative methods.

The common forensic application of multiplex PCR is in relation to wildlife forensics.

McInnes (2005) developed two multiplex PCRs for the identification of the Australian

black cockatoo, which are under-threat from poachers and exotic pet traders. Frasier

(2006) has explored the application of multiplex PCR as a means of identifying North-

Atlantic Right whales. Frasier (2006) was able to develop a rapid, reliable and cost-

effective multiplex PCR that has the potential as a forensic identification marker in illegal

trading of whale meat. Another example is the development of a multiplex PCR for

forensic discrimination of two species of scallops (Marshall et al., 2006). The objective

of multiplex PCR is to eliminate the necessity of secondary testing including DNA

sequencing, RFLP mapping and fingerprinting, all of which are time-consuming and

expensive (Marshall et al., 2006). Marshall (2006) found the multiplex PCR technique

provided a direct means of identification and has the potential to be adapted to other

DNA regions and species.

The extensive advantages of this technique are hindered by a single limitation, which is

the optimisation of all reagents, temperatures and specific primers used to amplify target

regions.

2.12.1 Optimisation of Multiplex PCR

Though the same reagents are used within a multiplex PCR as within a standard PCR, the

effect of altering the primer and Mg+2

concentration, or the annealing temperature, can be

dramatically different. As the purpose of each reagent has previously been described,

this section will focus on their individual effect upon a multiplex PCR.

50

The optimisation stage of the multiplex PCR is one of the most difficult areas of

development due to several associated problems including poor sensitivity and

specificity, preferential amplification of one target over another and the amplification of

secondary products such as primer-dimers (Markoulatos et al., 2002). Primer-template

ratio is very important in preventing the problems mentioned above. If the primer-

template ratio is too high, primer-dimer will form, which is caused by the primers binding

together due to low template concentration (Markoulatos et al., 2002). Alternatively if

the primer to template ratio is too low the template will re-anneal after denaturation due

to lack of primer concentration within the reaction.

As there are numerous primer sequences within the multiplex PCR, optimisation of

individual primer concentrations is required. Initial testing should utilise equimolar

primer amounts with a concentration range of 0.2µM to 0.4µM to determine the degree of

uneven amplification between primer pairs (Henegariu et al., 1997). After reviewing

amplification, changes to the proportions of various primers within the reaction can be

made by increasing the concentration of weaker primers, whilst decreasing the

concentration of the stronger primers (Henegariu et al., 1997).

The amounts of dNTP and MgCl2 concentration have significant effects upon the

multiplex PCR optimisation. The dNTP concentration should be increased to an amount

between 200 and 400 µM of each primer until an optimum concentration is reached

(Markoulatos et al., 2002). If the concentration of dNTP is below 100µM the amplified

product yield can be low, whereas if the dNTP concentration is above 500µM the

reaction may be inhibited (Henegariu et al., 1997). Markoulatos (2002) recommends that

the dNTP not be thawed and frozen more than 3 to 4 times as the dNTPs are sensitive and

will lose their stability resulting in a less efficient multiplex PCR. To prevent this dNTPs

should be made into small aliquots that are frozen at -20ºC.

The MgCl2, as in the standard reaction, is very important and should be carefully

optimised, as it is the co-factor for Taq DNA polymerase enzyme activity (Lawyer et al.,

1993), whilst also affecting the dNTPs, the template and the primers efficiency within the

51

reaction (Markoulatos et al., 2002). If the concentration is too high the double-stranded

DNA will become stabilised and will not separate during the denaturation step, resulting

in reduced overall yield (Markoulatos et al., 2002). Excessive MgCl2 can also affect the

stabilisation of annealing primers to incorrect sites within the sequence, causing non-

selected amplicons to be amplified. If the MgCl2 concentration is too low the overall

amount of amplified product is reduced (Markoulatos et al., 2002).

The limited supply of reagents within a reaction containing numerous competing primers

makes the optimisation of the annealing temperature essential for a balance to exist

between all primer pairs. Henegariu (1997) found that the optimal annealing temperature

required by a single primer pair, needed to be reduced by 4ºC to 6ºC for it to be

successfully amplified. This reduction to the annealing temperature balances the

difference between the more efficient and less efficient primer pairs.

Ultimately multiplex PCR is an efficient testing technique that reduces the expenditure of

both time and funds within the laboratory. Though optimisation can be problematic and

time-consuming, the eventual reaction provides both specificity and efficiency within a

single reaction. Multiplex PCR to date had not been utilised as a means of identifying

forensically important Calliphoridae species and is therefore applicable to this research.

2.13 Aims of Thesis

The ultimate objective of this project was the development of a multiplex PCR-SSP

reaction that can be utilised in the identification of 5 forensically important Calliphoridae.

In an attempt to obtain this outcome specific aims were identified and have been

separated into the successive chapters (3-5). The original aims of this project are as

follows.

1. Optimising and re-design of the original SSP set obtained from a preliminary

project conducted by Harvey (2006) (Chapter 3). Included in this chapter are the

original optimisation results, observed non-concordance of expected results,

52

alignment of species sequences tested and the initial and re-designed primer

sequences positions.

2. Individual optimisation of newly designed primers, altering only the annealing

temperature to allow for potential multiplexing (Chapter 4). Alignment of

expected amplified regions for each species has been confirmed via the inclusion

of PCR product sequence analysis.

3. Development of a multiplex PCR reaction for the identification of the five

forensically important Calliphoridae species selected for testing (Chapter 5).

Utilising the optimised SSP pairs two multiplex PCRs were developed, one fully

optimal, whilst the other only partially.

All laboratory work performed in the completion of this thesis was conducted by me,

including the extraction of all samples, except where specifically mentioned, all PCRs,

multiplex PCRs and electrophoresis analysis within this thesis.

53

Chapter 3

Design Of A Sequence

Specific Primer Set For The Identification Of Forensically

Important Calliphoridae

54

3.1 Introduction

Forensic entomology is the study of arthropod activity on a corpse and surrounding crime

scene. The main focus of forensic entomology is to determine the approximate time

since death using species-specific information including the rate of development and

environmental conditions (Benecke, 2001). After specimens have been collected from on

and around a corpse the primary information that needs to be obtained is the identity of

these specimens (Benecke, 2001). Once the species have been identified the necessary

developmental information can be applied to determine post-mortem interval (PMI). Due

to numerous problems associated with the use of morphology in the identification of flies,

molecular techniques have been developed (Wallman et al., 2001, Harvey et al., 2003a,

Harvey, 2003b). Molecular techniques based on the extraction of DNA provide an

accurate and rapid test to assist in the area of forensic identification of entomological

activity present on and around a corpse (Wallman et al., 2001).

Calliphoridae are generally the first insects to arrive and colonise a corpse, making them

one of the most useful specimens in the determination of PMI (Harvey, 2006). By far the

most common molecular techniques target the mitochondrial DNA (mtDNA), specifically

the cytochrome oxidase I (COI) and, to a lesser extent, the cytochrome oxidase II (COII)

genes. MtDNA is present in an abundance of copies within every cell, making it easy to

extract (Malgorn et al., 1999). It also has a high mutation rate within certain regions such

as the COI and Cytochrome b genes, which provides the necessary sequence distinction

in only a few generations (Malgorn et al., 1999). Accordingly, it is possible via

amplification and sequencing to analyse nucleotide changes in these regions that

distinguish between sub-species. Though a high mutation rate over only a few

generations would seem disadvantageous to sequences based taxonomic identification,

mtDNA also maintains highly conserved regions such as the control or D-loop gene,

which exhibits a low number of variations and is suitable for the development of

universal primers across species (Otranto et al., 2002).

The COI region has been extensively studied and found to posses areas that can

distinguish between species at the DNA level (Wallman et al, 2001, Harvey et al., 2003,

55

Wells et al., 2001, Malgorn et al., 1999). This makes it suitable for the development of

sequence specific primers (SSPs)(Otranto et al., 2002).

SSPs target sequence difference(s) between species within a certain region. SSPs are

designed directly from the sequence and usually rely on single nucleotide substitutions,

located at the 3‟ end of the priming site such that extension from a primer in the PCR is

limited to selected species that match the primer, particularly at the critical 3‟ end. Using

a single forward primer C1-J-1718 (Simon et al, 1990), which binds to all Calliphoridae

species, and by varying the position of the reverse primer to a site containing nucleotide

changes specific to a species (or set of species) it is possible to design primer pairs that

identify species based on the presence or absence of a PCR amplicon. To date the

application of SSPs has been relatively limited to Culicide (mosquitoes) due to their

medical applications (Manonmani et al., 2001, Fettene et al., 2002, Kampen et al., 2003

and Phuc et al., 2003), yet they have also been applied in the identification of forensically

significant Cuterebra, which are parasitic and forensically important flies presenting the

usefulness of the SSP technique (Noel et al., 2004).

The initial set of SSP pairs to be tested in this study, were developed for the COI region

based on previous research and extensive information gathered for sequence-based

identification of the Calliphoridae (Wallman et al, 2001, Harvey et al., 2003, Wells et al.,

2001). Previous techniques have relied on sequencing to identify unknown species by

direct comparison with sequence databases of known species. The advantage of a PCR-

based assay for distinction based on the presence or absence of an expected PCR

amplicon is that it is both rapid and relatively inexpensive when compared to direct DNA

sequencing techniques.

In designing SSP pairs, general guidelines are recommended to enhance primer stability

and specificity to particular sequence(s): i) for stable attachment a primer length of 18-25

oligonucleotides is optimal (Sharrocks, 1994) and ii) GC-content between 45-55%

stabilises primer attachment and reflects a primer‟s estimated annealing temperature

(Sharrocks, 1994) (refer to Chapter 2 for details). This can prove difficult in relation to

56

fly DNA as it contains a high A-T content, making it problematic when trying to locate

multiple sites of a high G-C content (Harvey, 2006). This is important for potential

multiplex optimisation, as similar annealing temperatures between SSP pairs is required

(Hurley et al., 1993). To further ensure specificity it is essential that a match occur at the

3‟ end, which increases specific primer binding (Marshall et al., 2006). Specificity can

be further increased through the addition of a mismatch oligonucleotide at the second

position from the 3‟ end (Marshall et al., 2006).

There are several known primer design obstacles that need to be addressed in SSP design,

including self-complementarity, which can be prevented by avoiding long runs of a single

base, antisense complementarity, which results in the formation of primer-dimers that

become the predominant product during amplification (Sharrocks, 1994), and a suitable

annealing temperature, formulated using Tm = 2AT + 4GC (Suggs et al., 1981).

Optimisation is the process of variable testing of PCR reagents to selected species and

fragment sizes are amplified efficiently and specifically (Erlich, H., 1993). The

conditions that are optimised include annealing temperature, primer concentration, MgCl2

concentration and the amount of template DNA. The effect of these conditions on the

amplification of specific products has been previously discussed in Chapter 2.

Additional to the optimisation of the above parameters, general guidelines in the care of

reagents should be followed. Included is the use of dNTP aliquots to prevent degradation

through repeated thawing. The DNA buffer, MgCl2 and primers should be mixed prior to

addition to the master-mix to ensure total dispersion of chemicals, and DNA should be

maintained short-term at 4ºC and long-term at -20ºC to prevent degradation.

The initial aim of this research was to test each of the original SSP pairs designed by

Harvey (2006) to ensure that they produce the expected results and to optimise the

primers to their most appropriate annealing temperature and reagent conditions.

Although it was known that the design of these primers was not optimal, the 7 SSP pairs

to be tested had previously shown promising results in the separation of species and

57

amplification of expected fragment sizes during initial testing by Harvey (2006). This

chapter will describe the method used to optimise these original primers, results

produced, a sequence analysis of the SSP primers to determine why they did not work as

expected and their re-design.

3.2 Methods

3.2.1 DNA Extraction

DNA was extracted from C. dubia (Macquart), Ch. rufifacies (Macquart), C. albifrontalis

(Malloch), Ch. megacephala (Fabricius) and L. sericata (Meigen) using the Qiagen

DNeasy Tissue Kit as described by Harvey (2006) with some modifications. The

extraction technique used by Harvey (2006) included a minimum 3-hour incubation

period, which related to the purification of total DNA from animal tissue protocol in this

kit. Due to the low DNA yields obtained, the protocol was modified according to the

manufacturer‟s instructions with specific reference to the purification of genomic DNA

from insects.

For DNA extraction from blowflies, the flight muscle was removed and placed in a 1.5ml

microcentrifuge tube with Phosphate Buffered Saline (PBS) and homogenised using a

microtube pestle. During the course of study the amount of Proteinase K added was

increased from 20µl (12mAU) to 30µl (18mAU) to improve overall yield. Following the

addition of buffer ATL, the sample was vortexed and incubated at 56ºC for 10 minutes.

After removal from a water bath, 96-100% ethanol was added and then the sample was

vortexed and transferred into a spin column. The solution was centrifuged and the flow-

through discarded. The elution and storage buffer AE was added and the sample

incubated at room temperature and then centrifuged to elute extracted DNA, which was

stored at -20ºC. All other reagent amounts and steps were followed as per

manufacturer‟s instructions with the exception of the use of 100µl of buffer AE instead of

200µl, to increase final DNA concentration.

58

Quantitation of extracted DNA was performed using the NanoDrop ND-1000

spectrophotometer and purity determined using the 260/280nm ratio. The 260/280-ratio

for pure DNA is approximately 1.8. This value is based on the equal distribution of each

base within the sequence. Due to the high concentration of A and T within fly DNA the

ratio was expected to be higher at approximately 2.1 to 2.4. Results from 260/280 ratio

analysis are provided in the Appendix 2 (Table 8.1). The quality of the DNA sample was

determined by UV transillumination following ethidium bromide staining.

3.2.2 Primers

All originally designed SSPs are shown in Table 3.1. The generic forward primer C1-J-

1718 (Simon et al., 1990) was paired with all reverse SSPs. The reverse primers were

taken from Harvey (2006), which presented an alternative method for rapid identification

of forensically important Calliphoridae species. The expected amplicon size, the

calculated annealing temperatures (Tm) and selected and observed species (Harvey,

2006) for each SSP are shown in Table 3.2.

Table 3.1: Original set of SSPs designed by M. Harvey (2006).

Primer Name Sequence (5'→3') ^

SSP 1 GGTATTCGGTCAAAAGTTACA

SSP 2 ATTCTTGRCTAATAATATGTG

SSP 3 CAATWGAAATWGAAATTACG

SSP 4 CTAAACTTTCTCAAAYAATAC

SSP 5 GCAGTAATAACTACAGATCAT

SSP 6 CCTAAAGCTCATAAAGTAGCA

SSP 7 GCTCGAGTATCTACATCTATA

C1-J-1718 * GGAGGATTTGGAAATTGATTAGTTCC

* Forward primer used for all PCR. ^ Use of International Union of Pure and Applied Chemistry

– International Union of Biochemistry (IUPAC-IUB) for mixtures where R=A+G; W=A+T;

Y=T+C.

59

Table 3.2: Expected and observed amplicons for original SSP pairs designed and tested

by M. Harvey (2006).

Primer Name SSP 1 SSP 2 SSP 3 SSP 4 SSP 5 SSP 6 SSP 7

Optimised Annealing Temperature (Tm) (ºC) 52 54 58 54 58 58 58

Product Size (bp) 320 557 1130 1203 350 803 683

Species

C. albifrontalis X X X X

C. dubia √ √ X X √

Ch. megacephala X (X) √ X X

Ch. rufifacies X √ X X

L. sericata X (X) X √

X denotes the species that were amplified during testing by M. Harvey (2006). A √ denotes the

expected amplification results of the selected species, which had been determined via primer

design and sequence alignment. (X) is a selected species that did not amplify during testing.

3.2.3 PCR

PCR master-mix conditions were followed from the initial works of Harvey (2006) and

the final PCR reaction mix consisted of: 1x PCR buffer (Fisher Biotec), 200µM of dNTP

mix (Fisher Biotec), 25pM each primer, 1 unit of Taq polymerase (Fisher Biotec), 5µl of

5% BSA, 1.5mM MgCl2, 10-150ng of template DNA and water added to a total volume

of 50µl.

3.2.4 PCR Optimisation

During testing, modifications to the concentration of MgCl2 and primer, and annealing

temperatures were made as indicated in Table 3.3, Table 3.4 and Table 3.5. The range of

MgCl2 concentration tested was between 1.5mM and 5mM. Primer concentration varied

from 25pmol to 50pmol at 5pmol increments. The annealing temperature range tested

was from 50ºC to 58ºC with 2ºC increments.

All PCR were performed using a BioRad iCycler or GeneAmp PCR system 2700

(Applied Biosystems). Cycling conditions were 90 seconds at 94ºC initial denaturation,

followed by 36 cycles of 94ºC for 22 seconds denaturation, annealing temperature (refer

60

to Table 3.2) for 30 seconds and extension at 72ºC for 1 minute 20 seconds. A final

extension period of 72ºC for 1 minute was used followed by holding at 4ºC. Products

were visualised on a 2% agarose gel with ethidium bromide staining and UV

transillumination. Length of fragment was visually measured from gel image.

The DNA samples utilised as positive controls within the optimisation testing of SSP

pairs were previously extracted DNA samples that had been tested by Harvey (Pers.

Comm.). Besides confirmation of DNA quality and quantity using the

spectrophotometer, no alternative confirmational testing was performed on the newly

extracted DNA.

3.3 Results and Discussion

The original primers by Harvey (2006) (Table 3.1) were known to be sub-optimal but

initial testing had produced a degree of concordance with expected results. Table 3.2

shows the species tested, the specific species the primers were designed to amplify and

the species observed during initial testing. The discrepancies in specific species

amplification were reproduced during the initial testing phase. Though deviation of

expected species amplified occurred, the amplicons produced were of an expected

fragment size, confirming the potential of the primer pairs. These initial results

warranted further optimisation of the SSP pairs. Table 3.2 also shows the expected

amplicon length for each SSP pair and the annealing temperature used during initial

testing by Harvey (2006).

The original primers were tested over a range of conditions using a matrix set-up. The

conditions included annealing temperature, MgCl2 and primer concentration. Table 3.3,

Table 3.4 and Table 3.5 represents the testing matrixes for the conditions annealing

temperature, MgCl2 gradient and primer concentration respectively. Each table shows

the attempted optimisations of the SSP pairs and the results from each reaction.

61

Table 3.3: Matrix of annealing temperature optimisation of original SSP set. A 0 denotes

where the conditions tested showed no results. 1 to 4 represents the intensity of bands

produced. 1 denotes band is possibly present; 2 a band of low intensity; 3 a band of

medium intensity and 4 a band of high intensity. A blank box signifies that testing did

not occur using this condition. All band lengths indicated were determined via visual

analysis using a 100bp DNA ladder marker.

Annealing Temperature (Tm) (ºC)

50 52 54 56 58

Primer Name Species

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

SSP 1

C. dubia 0 0 3 300-350

C. albifrontalis 0 0 3 300-350

Ch. megacephala 0 0 3 300-350

L. sericata 2 300-350 3 300-350

Ch. rufifacies 0 0 3 300-350

SSP 2

C. dubia 3 550-600 4 550-600

C. albifrontalis 3 550-600 2 550-600

Ch. megacephala 3 550-600 4 550-600

L. sericata 3 550-600 4 550-600

Ch. rufifacies 3 550-600 4 550-600

SSP 3

C. dubia 0 0 0 0

C. albifrontalis 0 0 0 0

Ch. megacephala 0 0 0 0

L. sericata 0 0 0 0

Ch. rufifacies 0 0 0 0

SSP4

C. dubia 0 0 3 1100-1200

C. albifrontalis 2 1100-1200 3 1100-1200


L. sericata 0 0 3 1100-1200


SSP5

C. dubia 2 300-350

C. albifrontalis 4 300-350

Ch. megacephala 4 300-350

L. sericata 3 300-350

Ch. rufifacies 2 300-350

SSP 6

C. dubia 2 800-850

C. albifrontalis 0 0

Ch. megacephala 0 0



SSP 7

C. dubia 3 650-700


Ch. megacephala 0 0

L. sericata 0 0


62

Table 3.4 Matrix of MgCl2 concentration optimisation of original SSP set. A 0 denotes






MgCl2 Gradient (mM)

1. 5 1.75 2.25 3.75 4.25

Primer Name Species

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

SSP 1

C. dubia 3 300-350





SSP 2

C. dubia 4 550-600 3 550-600

C. albifrontalis 2 550-600 3 550-600

Ch. megacephala 4 550-600 0 0 3 550-600 0 0 0 0

L. sericata 4 550-600 3 550-600

Ch. rufifacies 4 550-600 3 550-600

SSP 3

C. dubia 0 0 0 0



L. sericata 0 0 0 0 0 0 0 0 0 0


SSP4

C. dubia 3 1100-1200 3 1100-1200 3 1100-1200 3 1100-1200 3 1100-1200

C. albifrontalis 0 0 3 1100-1200 3 1100-1200 3 1100-1200 3 1100-1200


L. sericata 0 0 3 1100-1200


SSP5

C. dubia 2 300-350 3 300-350

C. albifrontalis 4 300-350 3 300-350

Ch. megacephala 4 300-350 3 300-350

L. sericata 3 300-350 3 300-350

Ch. rufifacies 2 300-350 3 300-350

SSP 6

C. dubia 2 800-850


Ch. megacephala 0 0



SSP 7

C. dubia 0 0 0 0 0 0 1 650-700 3 650-700

C. albifrontalis 0 0 1 650-700 2 650-700 2 650-700 2 650-700

Ch. megacephala 0 0 0 0 0 0 0 0 0 0

L. sericata 0 0 0 0 0 0 0 0 0 0

Ch. rufifacies 2 650-700 2 650-700 3 650-700 3 650-700 3 650-700

63

Table 3.5 Matrix of primer concentration optimisation of original SSP set. A 0 denotes






Primer Concentration (pmol)

25 30 35 40 45 50

Primer Name Species

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

Band Intensity

Band Size (bp)

SSP 1

C. dubia 3 300-350





SSP 2

C. dubia 4 550-600 4 550-600 4 550-600 3 550-600

C. albifrontalis 2 550-600 3 550-600

Ch. megacephala 4 550-600 3 550-600

L. sericata 4 550-600 3 550-600

Ch. rufifacies 4 550-600 3 550-600

SSP 3

C. dubia 0 0 0 0



L. sericata 0 0 0 0


SSP4

C. dubia 0 0 0 0 3 1100-1200

C. albifrontalis 0 0 0 0 0 0 0 0 0 0 3 1100-1200


L. sericata 0 0 3 1100-1200


SSP5

C. dubia 0 0 2 300-350

C. albifrontalis 0 0 4 300-350

Ch. megacephala 4 300-350 4 300-350 4 300-350 3 300-350 4 300-350 4 300-350

L. sericata 1 300-350 3 300-350

Ch. rufifacies 2 300-350 4 300-350

SSP 6

C. dubia 0 0 2 800-850 0 0

C. albifrontalis 0 0 0 0 0 0

Ch. megacephala 0 0 0 0 0 0

L. sericata 0 0 4 800-850 0 0

Ch. rufifacies 0 0 2 800-850 0 0

SSP 7

C. dubia 0 0 0 3 650-700

C. albifrontalis 0 0 0 2 650-700

Ch. megacephala 0 0 0 0 0

L. sericata 0 0 0 0 0

Ch. rufifacies 0 0 3 650-700 1 650-700

64

The non-concordance recorded between the selected species and the observed results for

each SSP pair after optimisation is shown in Table 3.6. The band fragments observed

were measured by visual comparison between the DNA ladder marker and the resulting

amplicon band. An amplicon size range has been provided to compensate for the low

resolution of the gel electrophoresis technique used in the experiment.

Table 3.6: Non-concordance between expected and observed results. Expected selected

species and fragment length are based on M. Harvey‟s (2006) initial analysis of primer

alignment of original SSP pairs. Observed amplified species were recorded following

optimisation testing. Amplicon length was determined from visual analysis of

electrophoresis gels.

Primer Name

Annealing Temperature

(ºC)

Expected Fragment

Length (bp)

Observed Fragment

Length (bp)

Expected Selected Species

Observed Amplified Species

SSP 1 52 320 340 C. dubia

C. dubia, C. albifrontalis, Ch. megacephala L. sericata, Ch. rufifacies

SSP 2 54 557 580 C. dubia


SSP 3 58 1130 No Product Ch. megacephala Not Applicable

SSP 4 54 1203 1150 L. sericata C. dubia, C. albifrontalis,

SSP 5 58 350 330 Ch. megacephala Ch. rufifacies


SSP 6 58 803 830 L. sericata

C. dubia L. sericata Ch. rufifacies

SSP 7 58 683 660 C. dubia

C. dubia C. albifrontalis Ch. rufifacies

65

From the results, it is clear that the primers were not working as expected (Table 3.6) due

to the non-concordance between expected and observed results. The amplicons produced

were of an expected size for each SSP pair, but the species amplified varied from what

was predicted. This result continued subsequent to extensive optimisation attempts.

Possible reasons for the lack of concordance between the expected and observed

outcomes were limited to technique within the laboratory or the design of the primers.

Due to the availability of COI sequence information relating to the species, the design of

the primers was reviewed and re-evaluated.

Figure 3.1 represents the positions of the original 7 SSP pairs tested. The sequence

information used was obtained from Genbank via the National Centre for Biotechnology

Information (NCBI) (http://www.ncbi.nlm.nih.gov). Accession numbers utilised were

EU418556 (C. dubia), EU418566 (C. albifrontalis), AB112833 (L. sericata), AB112845

(Ch. rufifacies) and AB112847 (Ch. megacephala). The C. augur sequence (DQ345074)

is added to show the position of the forward primer CI-J-1718 (Simon et al., 1990) for the

determination of the expected fragment lengths.

http://www.ncbi.nlm.nih.gov/

66

C1-J-1718

GGAGGATTTGGAAATTGATTAGTTCC

C_Augur_DQ345074 GGAGGATTTGGAAATTGATTAGTTCCTTTAATGCTAGGAGCTCCAGATAT 50

L_sericata_AB112833 --------------------------------------------------

Ch_rufifacies_AB112845 --------------------------------------------------

C_megacephala_AB112847 --------------------------------------------------

C_albifrontalis_EU418566 --------------------------------------------------

C_dubia_EU418556 --------------------------------------------------

**************************************************

C_Augur_DQ345074 AGCATCCCCTCGATTAAATAATATAAGTTTCTGACTTTTACCTCCTGCAT 100

L_sericata_AB112833 ---------------------------------ACTTTTACCTCCTGCAT

Ch_rufifacies_AB112845 ---------------------------------ACTTTTACCCCCTGCAT

C_megacephala_AB112847 ---------------------------------ACTTTTACCTCCTGCAT

C_albifrontalis_EU418566 ---------------------------------ATTACTACCTCCCGCAT

C_dubia_EU418556 ---------------------------------ACTTTTACCTCCTGCAT

********************************** * **** ** ****

C_Augur_DQ345074 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA 150

L_sericata_AB112833 TAACTTTATTATTAGTTAGTAGTATAGTAGAAAACGGAGCTGGAACAGGA

Ch_rufifacies_AB112845 TAACTTTACTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA

C_megacephala_AB112847 TAACTTTATTATTAGTAAGTAGTATAGTAGAAAATGGGGCTGGAACAGGA

C_albifrontalis_EU418566 TAACTTTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGGACAGGA

C_dubia_EU418556 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA

**** ** ******* ***************** ** ***** ******

C_Augur_DQ345074 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC 200

L_sericata_AB112833 TGAACAGTTTACCCTCCTCTATCTTCTAATATTGCTCATGGAGGAGCTTC

Ch_rufifacies_AB112845 TGAACTGTTTATCCACCTTTATCATCTAATATTGCACATGGTGGAGCATC

C_megacephala_AB112847 TGAACTGTTTACCCACCTTTATCTTCTAATATTGCTCATGGAGGAGCATC

C_albifrontalis_EU418566 TGAACTGTTTACCCTCCTTTATCTTCTAATATTGCTCATGGAGGAGCTTC

C_dubia_EU418556 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC

***** ***** ** *** **** ******** ** ***** ***** **

C_Augur_DQ345074 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT 250

L_sericata_AB112833 TGTTGATTTAGCTATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTT

Ch_rufifacies_AB112845 AGTTGATTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTT

C_megacephala_AB112847 AGTTGATTTAGCTATTTTCTCTTTACACTTAGCAGGAATTTCTTCAATTT

C_albifrontalis_EU418566 TGTTGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATTTCTTCAATTT

C_dubia_EU418556 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT

***************** ** * ** ***** ******** *******

New SSP 9 ATCTGTAATTAATATACGATC T

T

C_Augur_DQ345074 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT 300

L_sericata_AB112833 TAGGAGCTGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGA

Ch_rufifacies_AB112845 TAGGGGCCGTAAATTTTATTACAACTGTTATTAATATACGATCTACAGGA

C_megacephala_AB112847 TAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCTACAGGA

C_albifrontalis_EU418566 TAGGAGCAGTAAATTTTATTACTACCGTAATTAATATGCGATCAACAGGG

C_dubia_EU418556 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT

**** ** ************** ** ** ******** ***** *****

Modified SSP 1b GTAACTTTTGACCGAATACC AAGATCTGTAGTTATTACTGC Modified SSP 5b

SSP 1 GTAACTTTTGAC GAATACC ATGATCTGTAGTTATTACTGC SSP 5

C_Augur_DQ345074 GTAACTTTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC 350

L_sericata_AB112833 ATTACTTTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC

Ch_rufifacies_AB112845 ATTACATTTGATCGAATACCTTTATTTGTATGATCTGTAGTTATTACTGC

C_megacephala_AB112847 ATTACATTTGATCGAATACCTTTATTTGTATGATCTGTAGTTATTACTGC

C_albifrontalis_EU418566 ATTACCTTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC

C_dubia_EU418556 GTAACTTTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC

* ** ***** ***************** ***** ***** ***** **

67

C_Augur_DQ345074 TTTATTACTTTTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATAT 400

L_sericata_AB112833 TTTATTACTTTTATTATCATTACCAGTATTAGCAGGAGCTATTACAATAC

Ch_rufifacies_AB112845 TCTTCTTTTATTATTATCATTACCAGTATTAGCAGGTGCAATTACTATAT

C_megacephala_AB112847 TCTATTATTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATAT

C_albifrontalis_EU418566 TCTATTACTTCTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATAT

C_dubia_EU418556 TTTATTACTTTTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATAT

* * * * ******* ************** ** ** ***** ***

C_Augur_DQ345074 TATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAGCAGGAGGA 450

L_sericata_AB112833 TTTTAACAGACCGAAATCTTAATACATCATTCTTTGACCCTGCAGGAGGA

Ch_rufifacies_AB112845 TATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCAGCAGGAGGG

C_megacephala_AB112847 TATTAACTGACCGAAATCTAAATACTTCATTCTTTGATCCAGCAGGAGGA

C_albifrontalis_EU418566 TATTAACAGATCGAAACCTTAATACTTCATTTTTTGACCCTGCTGGAGGA

C_dubia_EU418556 TATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAGCAGGAGGA

* ***** ** ***** * ***** ***** ***** ** ** *****

C_Augur_DQ345074 GGAGATCCTATTTTATATCAACACTTATTTTGATTTTTTGGTCACCCTGA 500

L_sericata_AB112833 GGAGATCCAATTTTATACCAACATTTATTTTGATTCTTTGGACACCCTGA

Ch_rufifacies_AB112845 GGAGACCCTATTTTATATCAACACTTATTTTGATTCTTTGGTCATCCAGA

C_megacephala_AB112847 GGAGATCCTATTTTATATCAACATTTATTTTGATTCTTTGGACATCCTGA

C_albifrontalis_EU418566 GGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCAGA

C_dubia_EU418556 GGAGATCCTATTTTATATCAACACTTATTTTGATTTTTTGGTCACCCTGA

***** ** ******** ***** *********** ***** ** ** **

Modified SSP 2b AGATATTATTA

SSP 2 CACATATTATTA

C_Augur_DQ345074 AGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCACATATTATTA 550

L_sericata_AB112833 AGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTA

Ch_rufifacies_AB112845 AGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATCATTA

C_megacephala_AB112847 AGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTATTA

C_albifrontalis_EU418566 AGTATATATTTTAATTTTACCAGGATTTGGAATAATTTCTCACATTATTA

C_dubia_EU418556 AGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCACATATTATTA

*** ***************** ***** *********** ** ** ****

GTCAAGAAT

GRCAAGAAT

C_Augur_DQ345074 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGGTCATTAGGAATAATTTAT 600

L_sericata_AB112833 GTCAAGAATCAGGTAAAAAGGAAACATTCGGTTCATTAGGGATGATTTAT

Ch_rufifacies_AB112845 GTCAAGAATCAGGAAAAAAGGAAACCTTTGGATCTTTAGGAATAATTTAT

C_megacephala_AB112847 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGATCTTTAGGAATGATTTAT

C_albifrontalis_EU418566 GTCAAGAATCAGGTAAAAAGGAAACTTTCGGGTCACTAGGAATAATTTAT

C_dubia_EU418556 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGGTCATTAGGAATAATTTAT

************* *********** ** ** ** **** ** ******

C_Augur_DQ345074 GCCATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCCCACCATAT 650

L_sericata_AB112833 GCCATATTAGCTATTGGATTATTAGGATTTATTGTTTGAGCTCATCATAT

Ch_rufifacies_AB112845 GCAATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATAT

C_megacephala_AB112847 GCTATACTAGCTATTGGTCTATTAGGATTTATTGTATGAGCTCACCACAT

C_albifrontalis_EU418566 GCTATACTAGCTATTGGTTTATTAGGATTCATTGTATGAGCTCATCATAT

C_dubia_EU418556 GCCATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCCCACCATAT

** *** ********** ********** ***** ***** ** ** **

68

Modified SSP 7b TCTAGATACCCGAGCTTA

SSP 7 TATAGATGTAGATACTCGAGC

C_Augur_DQ345074 ATCTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACCTCAGCTA 700

L_sericata_AB112833 ATTTACAGTAGGAATAGACGTTGATACACGAGCTTACTTTACTTCAGCTA

Ch_rufifacies_AB112845 ATTCACTGTAGGAATGGATGTAGATACTCGAGCATATTTCACTTCAGCTA

C_megacephala_AB112847 GTTTACTGTTGGAATAGACGTAGACACACGAGCTTATTTCACTTCAGCTA

C_albifrontalis_EU418566 ATTTACAGTAGGAATAGACGTAGATACTCGAGCTTATTTTACATCAGCAA

C_dubia_EU418556 ATTTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACCTCAGCTA

* ** ** ***** ** ** ** ** ***** ** ** ** ***** *

C_Augur_DQ345074 CTATAATTATTGCGGTACCAACTGGAATTAAAATTTTCAGTTGATTAGCA 750

L_sericata_AB112833 CTATAATTATTGCTGTACCAACTGGAATTAAGATTTTTAGTTGATTAGCA

Ch_rufifacies_AB112845 CAATAATTATTGCTGTACCAACTGGAATTAAAATTTTTAGTTGATTAGCA

C_megacephala_AB112847 CAATAATTATTGCTGTACCAACTGGAATTAAGATTTTCAGTTGATTAGCA

C_albifrontalis_EU418566 CTATAATTATTGCTGTTCCAACTGGAATTAAAATTTTCAGTTGATTAGCC

C_dubia_EU418556 CTATAATTATTGCGGTACCAACTGGAATTAAAATTTTCAGTTGATTAGCA

* *********** ** ************** ***** ***********

Modified SSP 6b TCCTACTTTATGAGCTTT

SSP 6 TGCTACTTTATGAGCTTT

C_Augur_DQ345074 ACTCTTTATGGAACTCAATTAAACTATTCACCAGCTACTTTATGAGCTTT 800

L_sericata_AB112833 ACTCTTTATGGAACTCAATTAAACTATTCCCCTGCTACTTTATGAGCTTT

Ch_rufifacies_AB112845 ACTCTTTATGGAACTCAATTAAATTATTCTCCAGCTACTTTATGAGCCTT

C_megacephala_AB112847 ACTCTTTACGGAACACAATTAAATTATTCTCCAGCTACTTTATGAGCTTT

C_albifrontalis_EU418566 ACTCTTTATGGAACTCAATTAAATTATTCCCCAGCTACTTTATGAGCATT

C_dubia_EU418556 ACTCTTTATGGAACTCAATTAAACTATTCACCAGCTACTTTATGAGCTTT

******** ***** ******** ***** ** ************** **

AGG CTTTTCACAGTAGGAGGATTAA New SSP 8

AGG

C_Augur_DQ345074 AGGATTTGTATTTTTATTTACAGTAGGAGGATTAACTGGAGTTGTTTTAG 850

L_sericata_AB112833 AGGATTTGTATTTTTATTCACTGTAGGAGGTTTAACTGGAGTTGTTTTAG

Ch_rufifacies_AB112845 AGGGTTTGTATTTTTATTTACTGTAGGAGGATTAACTGGAGTAGTTTTAG

C_megacephala_AB112847 AGGATTTGTATTTTTATTTACTGTAGGAGGATTAACTGGAGTTGTTTTAG

C_albifrontalis_EU418566 AGGGTTTGTATTCCTTTTCACAGTAGGAGGATTAACTGGAGTTGTTTTAG

C_dubia_EU418556 AGGATTTGTATTTTTATTTACAGTAGGAGGATTAACTGGAGTTGTTTTAG

*** ******** * ** ** ******** *********** *******

C_Augur_DQ345074 CTAACTCATCTGTAGATATTATCCTTCATGATACTTATTATGTAGTTGCT 900

L_sericata_AB112833 CTAACTCTTCAGTTGATATTATTTTACATGATACATACTATGTAGTAGCT

Ch_rufifacies_AB112845 CTAATTCATCTATTGATATTATTTTACATGACACATACTATGTAGTAGCT

C_megacephala_AB112847 CTAATTCATCAATTGACATTATTTTACATGATACATATTATGTAGTAGCT

C_albifrontalis_EU418566 CTAATTCTTCTGTTGATATTATCCTTCATGATACATACTATGTAGTTGCT

C_dubia_EU418556 CTAACTCTTCTGTAGATATTATCCTTCATGATACTTATTATGTAGTTGCT

**** ** ** * ** ***** * ***** ** ** ******** ***

C_Augur_DQ345074 CATTTCCATTATGTTTTATCAATAGGAGCTGTATTTGCCATTATAGCAGG 950

L_sericata_AB112833 CACTTCCATTATGTTTTATCAATGGGAGCTGTATTTGCTATTATAGCAGG

Ch_rufifacies_AB112845 CACTTCCATTATGTTCTTTCAATAGGAGCTGTATTTGCTATTATAGCAGG

C_megacephala_AB112847 CACTTCCATTATGTTCTATCAATGGGAGCTGTATTTGCTATTATAGCAGG

C_albifrontalis_EU418566 CATTTCCATTATGTTCTATCTATAGGAGCTGTATTTGCTATTATAGCCGG

C_dubia_EU418556 CATTTCCATTATGTTTTATCAATAGGAGCTGTATTTGCCATTATAGCAGG

** ************ * ** ** ************** ******** **

C_Augur_DQ345074 ATTTGTTCATTGATACCCTCTATTTACAGGTTTAACTTTAAATGGAAAAA 1000

L_sericata_AB112833 ATTTGTTCACTGATATCCTTTATTTACAGGATTAACTTTAAATACTAAGA

Ch_rufifacies_AB112845 ATTTGTACATTGATTCCCATTATTTACTGGATTAACCTTAAATAATAAAA

C_megacephala_AB112847 ATTTGTTCATTGATTCCCTCTATTTACTGGATTAACTTTAAATAGCAAGT

C_albifrontalis_EU418566 ATTTGTACACTGATACCCTCTATTTACAGGATTAACTTTAAATGGAAAAA

69

C_dubia_EU418556 ATTTGTTCATTGATACCCTCTATTTACAGGTTTAACTTTAAATGGAAAAA

****** ** **** ** ******* ** ***** ****** **

C_Augur_DQ345074 TACTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAGTATTACATTT 1050

L_sericata_AB112833 TATTAAAAAGTCAATTTGCTATTATATTTATTGGGGTAAATTTAACATTC

Ch_rufifacies_AB112845 TACTAAAAAGTCAATTTGCTATTATATTTATTGGAGTAAATTTAACATTC

C_megacephala_AB112847 TATTAAAGAGTCAATTTGCTATTATATTTATCGGAGTAAATTTAACATTC

C_albifrontalis_EU418566 TGTTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAATATTACTTTC

C_dubia_EU418556 TACTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAATATTACATTT

* **** ********* ************* ** **** * * ** **

C_Augur_DQ345074 TTCCCTCAACACTTTTTAGGATTAGCAGGAATACCTCGACGATATTCAGA 1100

L_sericata_AB112833 TTCCCTCAACATTTCTTAGGATTAGCAGGAATACCACGACGATATTCAGA

Ch_rufifacies_AB112845 TTCCCTCAACATTTTTTAGGACTAGCTGGTATACCTCGACGATACTCAGA

C_megacephala_AB112847 TTCCCTCAACATTTCTTAGGATTAGCAGGTATACCTCGACGATACTCAGA

C_albifrontalis_EU418566 TTCCCTCAACACTTTTTAGGATTAGCAGGAATACCTCGACGATATTCAGA

C_dubia_EU418556 TTCCCTCAACACTTTTTAGGATTAGCAGGAATACCTCGACGATATTCAGA

*********** ** ****** **** ** ***** ******** *****

SSP 3 CGTAATTTCWATTTCWATTG

C_Augur_DQ345074 TTATCCAGATGCATACACAACTTGAAATGTAATTTCTACTATTGGATCAA 1150

L_sericata_AB112833 CTACCCAGATGCTTACACAACTTGAAATGTAATTTCTACAATTGGGTCAA

Ch_rufifacies_AB112845 CTATCCAGATGCTTACACAACATGAAATGTTATTTCAACAATTGGATCAA

C_megacephala_AB112847 CTATCCAGACGCTTACACAGCTTGAAATGTAATTTCTACAATTGGTTCAA

C_albifrontalis_EU418566 CTACCCAGATGCTTATACAACTTGAAACGTAATTTCTACTATTGGGTCAA

C_dubia_EU418556 TTATCCAGATGCATACACAACTTGAAATGTAATTTCTACTATTGGATCAA

** ***** ** ** *** * ***** ** ***** ** ***** ****

Modified SSP 4b TGTTYTTTGAGAAAGT

SSP 4 GTATTYTTTGAGAAAGT

C_Augur_DQ345074 CAATTTCATTACTAGGAATTTTATTTTTCTTTTTCATTGTTTGAGAAAGT 1200

L_sericata_AB112833 CAATTTCTTTATTAGGAATTTTATTCTTCTTCTTTATTATTTGAGAAAGT

Ch_rufifacies_AB112845 CAATTTCATTATTAGGAATTTTATTTTTCTTTTTCATTATTTGAGAAAGT

C_megacephala_AB112847 CAATTTCATTATTAGGAATTTTATTCTTCTTTTTCATTATTTGAGAAAGT

C_albifrontalis_EU418566 CAATCTCATTACTAGGAATTTTATTTTTCTTTTTCATTGTTTGAGAAAGT

C_dubia_EU418556 CAATTTCATTACTAGGAATTTTATTTTTCTTTTTCATTGTTTGAGAAAGT

**** ** *** ************* ***** ** *** ***********

CTTG

TTAG

C_Augur_DQ345074 TTAG

L_sericata_AB112833 CTTG

Ch_rufifacies_AB112845 TTAG

C_megacephala_AB112847 TTAG

C_albifrontalis_EU418566 TTAG

C_dubia_EU418556 TTAG

* *

Figure 3.1. Alignment of all species tested in the development of SSP pairs

for the amplification of forensically important Calliphoridae. All sequences

were obtained at Genbank http://www.ncbi.nlm.nih.gov. Included are the original

primer sites, modified primer sequences and newly designed SSP pairs. C. augur

is added to represent the position of the forward primer (C1-J-1718), not as a

species tested. * denotes conserved sites. A blank signifies a variable site.

– denotes missing sequence information for a species.


70

SSP 1 was designed to specifically amplify C. dubia and initial testing by Harvey (2006)

confirmed this result. However, subsequent testing using the recommended conditions

by Harvey (2006), resulted in the amplification of all species tested, including C. dubia.

After reviewing the position of the primer it is clear that it was designed with base

distinction at the 3‟ end to select for C. dubia and a mismatch base in the second position

at the 3‟ end to increase specificity. The primer is also a suitable length with 20 bases

and has a GC-content of 38%. However, there is a deletion at position 13 from the 3‟ end

of the primer. This deletion is unlikely to be the cause for the amplification of the non-

selected species tested and it is unclear why this primer is unable to specifically amplify

C. dubia. A possible solution could be an increase of the annealing temperature, which

may have alleviated the amplification of the non-specific species. Though alternative

annealing temperatures were tested, they were perhaps not high enough to prevent the

amplification of the non-specific products.

SSP 2 was again designed to select for only C. dubia, and during initial testing by Harvey

(2006) Ch. megacephala was consistently amplified in addition to C. dubia. The initial

PCR conditions utilised by Harvey were replicated and resulted in the amplification of all

species tested. During subsequent optimisation attempts, the annealing temperature

(52ºC to 54ºC), primer concentration (25pmol to 50pmol) and MgCl2 concentration

(1.5mM to 2.5mM) were all increased to prevent the amplification of non-selected

species. These condition variations resulted in the continual amplification of all species.

Possible explanation for the continual amplification of species tested was a potential

specificity problem in the primer design. After sequence analysis, SSP 2 showed no

distinctive base at the critical 3‟ end of the primer. The specificity of this primer was

designed at the second base from the 3‟ end, which was designed to amplify the selected

species C. dubia. It is likely that the lack of a distinguishing base at the most 3‟ end of

the primer would account for the amplification of all species tested.

Testing of SSP 3 produced no results. This result further persisted after alterations to

conditions including increased MgCl2 concentration from 1.5mM to 2.5mM, annealing

temperature from 56ºC to 58ºC and primer concentration from 25pmol to 50pmol. SSP 3

71

was difficult to align to the expected position in the sequence alignment (Figure 3.1).

There are at least 11 sites of difference between the primer and the sequences for the

expected species to be amplified; reflecting the lack of concordance obtained from the

initial optimisation tests. Hence, SSP 3 was not examined further.

SSP 4 was originally designed to amplify L. sericata, but initial testing by Harvey (2006)

amplified C. albifrontalis. The initial conditions tested by Harvey were replicated, and in

an attempt to amplify only the selected species the annealing temperature, primer

concentration and MgCl2 concentrations were all increased. At 54ºC, with a primer

concentration of 50pmol, and an MgCl2 of 2.25mM the selected species L. sericata was

amplified, in addition to the species C. dubia and C. albifrontalis. SSP 4 had no

distinctive base at the critical 3‟ end of the primer sequence. One mismatch was located

at the second base from the 3‟ end, which was specific for L. sericata instead of the

amplified species C. albifrontalis and C. dubia. This result suggests the primer requires

an additional single base adjustment for specific species identification.

SSP 5 was designed to amplify both Ch. megacephala and Ch. rufifacies. Initial testing

by Harvey (2006) resulted in slightly different results, with the additional amplification

of C. dubia and L. sericata. Optimisation experiments attempted to alleviate this by

increasing the MgCl2 concentration (from 1.5mM to 2.25mM) and primer concentrations

(from 25pmol to 50pmol), yet these extra species were continually amplified, with the

addition of C. albifrontalis. When the primer is aligned with the species‟ sequences, it is

clear that the primer is well designed with only Ch. rufifacies and Ch. megacephala

selected for amplification (Figure 3.1). With the addition of a mismatch base at the

second base from the 3‟ end, the primer has the potential to be distinctive for these

species.

SSP 6 was designed to amplify L. sericata and during initial testing by Harvey (2006) all

species tested amplified. Optimisation testing removed the amplification of both C.

albifrontalis and Ch. megacephala, but the non-selected species Ch. rufifacies and C.

dubia continued to produce an amplicon. A review of the primer sequence conveyed that

72

SSP 6 was specifically designed to amplify L. sericata. The additional amplified species

may be a result of the absence of a mismatch base pair at the second nucleotide from the

3‟ end, which would have increased the specific binding of the primer.

It was expected that SSP 7 would amplify only C. dubia. Original testing by Harvey

(2006) amplified all species except L. sericata. Optimisation included an increase of

MgCl2 concentration from 1.5mM to 4.25mM in an attempt to amplify the selected

species. C. dubia was only observed at the MgCl2 concentration of 4.25mM, which in

addition amplified C. albifrontalis and Ch. rufifacies. The only species to be inhibited

from amplification were Ch. megacephala and L. sericata. Review of the primer position

in the sequence alignment showed that SSP 7 is located in a site of variability between

species but lacked a distinctive base at the critical 3‟ end of the primer (Figure 3.1),

resulting in the amplification of non-selected species.

3.3.1 Re-Design of SSP Set

Following the identification of areas within the original primer sequences that required

modification, alterations to the existing SSP set were made. Additional to the specificity

modifications, mismatch base pairs were added to all SSPs at the second nucleotide from

the 3‟ end to increase specificity. Figure 3.1 represents the original and re-designed

sequences for the 6 retained SSPs and 2 additional SSPs (SSP 8 and SSP 9) that were

designed to replace SSP 3, which was removed from further testing as previously

described.

Table 3.7 shows the new primer sequences, estimated annealing temperatures, expected

amplicon lengths and selected species. Care was taken to ensure that all species were

identified by at least one primer and where possible multiple primers. Multiple species

amplification provides a confirmation of species identification. C. albifrontalis was the

only species to be amplified by a single SSP.

73

Table 3.7: New SSP set following re-design.

Primer Name Sequence (5' - 3')^

Fragment Length (bp)

Estimated Tm (ºC)* Selected Species

SSP 1b GGTATTCGGTCAAAAGTTACA 320 58 C. dubia

SSP 2b ATTCTTGACTAATAATATCT 559 48 C. dubia

SSP 4b CAAGACTTTCTCAAARAACA 1204 54 L. sericata

SSP 5b GCAGTAATAACTACAGATCTT 350 56

Ch. megacephala,

Ch. rufifacies

SSP 6b CCTAAAGCTCATAAAGTAGGA 803 58 L. sericata

SSP 7b TAAGCTCGGGTATCTAGA 686 52

C. dubia,

Ch. rufifacies

SSP 8 TTAATCCTCCTACTGTGAAAAG 835 60 C. albifrontalis

SSP 9 GATCGTATATTAATTACAGAT 293 52

Ch. megacephala,

Ch. rufifacies

^ Use of International Union of Pure and Applied Chemistry – International Union of

Biochemistry (IUPAC-IUB) for mixtures where R=A+G. *Estimated annealing

temperature calculated using Tm=2AT+4GC.

SSP 1 required a single modification of the addition of the 13th

base that had previously

been excluded. The length of the primer was increased to 21 base pairs to account for

this addition, but the GC-content remained at 38%, both of which follow the

recommended guidelines of primer design. Though there is a string of 4 T bases that

could result in self-complementarity, due to initial results the sequence position was

maintained. SSP 1 is now expected to amplify only C. dubia at an estimated annealing

temperature of 58ºC, producing an expected amplicon size of 320bp.

SSP 2 lacked a diagnostic base at the 3‟ end, which resulted in a lack of specificity to a

single species. In the re-design of SSP 2, the non-distinctive base at the 3‟ end was

removed. The newly designated first nucleotide at the 3‟ end provided unique base

specificity to C. dubia. The primer length was reduced to 20bp, which is still suitable for

specific attachment. The GC-content is relatively low at 20%, but as mentioned it is

difficult to locate regions of high GC-content in fly DNA. A mismatch base pair was

added to the second position from the 3‟ end to further increase specificity. At position

13 the base was changed from an R=(A+G) to a T: based on Figure 3.1 all species tested

exhibit a T at this position resulting in additional primer specificity. After modifications

74

it was expected that C. dubia would be the only species amplified, with an amplicon

length of 559bp and an estimated annealing temperature of 48ºC.

SSP 4, like SSP 2, lacked a diagnostic base at the 3‟ end. To correct for this the most 3‟

base was removed and specificity was provided by the second base at the 3‟ end.

Additional to this a mismatch base was added to the 2nd

last position of the primer to

increase specific primer-binding. The new primer length was reduced to 20bp, yet the

GC-content was increased from 23% to 30%, which will assist with specificity of

attachment. L. sericata is the only species expected to amplify, with a band of 1204bp at

an estimated annealing temperature of 54ºC.

SSP 5 required a single modification, which was the addition of a mismatch base pair to

increase specific binding to C. dubia and L. sericata. The length and GC-content

remained the same and both are within the range recommended by design guidelines. C.

dubia and L. sericata are expected to produce an amplicon of 350bp at an estimated

annealing temperature of 56ºC

SSP 6, like SSP 5, required a single modification in the addition of a mismatch base to

increase specificity towards the amplification of L. sericata. A mismatch base pair was

added to the second base from the 3‟ end, to further increase specific binding and prevent

amplification of non-specific products. No other modifications to length or GC-content

were made. The expected fragment length is 803bp at an annealing temperature of 58ºC.

The initial positioning of SSP 7 lacked the specificity required for sequence specific

identification. Re-designing of SSP 7 required the primer to be moved 6 base pairs

upstream in the sequence, to a position that provides specificity to both Ch. rufifacies and

C. dubia. Complementing the unique first base at the 3‟ end, the second base from the 3‟

end was altered to be a mismatch base for all species, increasing both specificity and

stability of the primer. The new primer length is 18bp, with a GC-content of 44%. The

expected fragment length is 686bp at an estimated annealing temperature of 52ºC.

75

SSP 8 and SSP 9 were newly designed primers to replace the removal of SSP 3. In

designing SSP 8 the aim was to find a region unique for the identification of C.

albifrontalis, as the previous primers were not specific for this species. The region

chosen is located at position 835bp, where C. albifrontalis has a unique base substitution

relative to the other known species (Figure 3.1). A mismatch is also located at the third

base from the 3‟ end, increasing the specificity of the primer. With a GC-content of 36%

and a primer length of 22bp, the primer design guidelines were followed where possible.

The expected fragment length of the PCR is 835bp using an annealing temperature of

60ºC.

SSP 9 was designed to give secondary amplifications for both Ch. megacephala and Ch.

rufifacies. Located within the 5‟ end of the COI sequence, the primer targets a unique

base for the identification of Ch. megacephala and Ch. rufifacies. This unique diagnostic

base is enhanced via the addition of a mismatch base at the second base from the 3‟ end.

The expected length of the amplified product is 293bp and the annealing temperature for

optimisation testing is 52ºC.

If the estimated annealing temperatures are accurate, the development of a single

multiplex PCR utilising all SSP pairs is unlikely due to the annealing temperatures

ranging from 48ºC to 60ºC. Alternatively two multiplex PCRs may need to be

developed. The first multiplex PCR will utilise the SSP pairs 1b, 5b, 6b and 8, which

have an annealing temperature range from 56ºC to 60ºC. This multiplex PCR would

allow for all tested species to be identified. A potential problem is the amplicon sizes for

SSP 1b and 5b, which are 320bp and 350bp respectively, which could make positive

identification difficult. This is also observed with SSP 6b and 8, which are expected to

produce amplicons of 803bp and 835bp respectively. A possible solution to this problem

is the separate amplification of all species except C. albifrontalis with the second

multiplex PCR. Alternatively 3% agarose electrophoresis gel or poly acrylamide gel

electrophoresis could be utilised for clearer distinction between similarly sized products.

Utilising SSP pairs 2b, 4b, 7b and 9 with an annealing temperature range from 48ºC to

54ºC the identification of unknown species can be confirmed. The fragment lengths

76

expected within this multiplex PCR are varied and identification would be relatively easy

as both an initial and confirmation test.

Alternatively, if the two multiplex PCR were unable to be optimised by varying the

annealing temperature alone, extending the primer length would be a potential solution,

as it would increase the Tm of the primer. This would limit the effects of the annealing

temperature, therefore allowing for optimisation to be focussed on other parameters such

as MgCl2, DNA and primer concentration.

3.4 Conclusion

The preliminary SSP pairs designed for a multiplex assay conveyed non-concordance

between the observed and expected results. After a comparison between primer

positioning and available sequence information from relevant species, it was clear SSP 1,

2, 4, 5, 6 and 7 required only minor adjustments to increase specificity and stability. SSP

3 was removed from further testing. In the re-design of the original SSP pairs, the aim

was to ensure the presence of a unique diagnostic feature at the 3‟ end of the primer and

the addition of a mismatch base at the second base from the 3‟ end. During the re-design,

SSP 8 and SSP 9 were added as replacements for SSP 3. Care was taken to amplify all

species tested with at least one primer pair and where possible multiple primer pairs.

Though a preliminary study, the potential of the SSP pairs as a means of identifying the

forensically important Calliphoridae species tested is evident. This is further observed in

the possibility of grouping primers based on their annealing temperature, which would

allow for the development of a multiplex PCR.

77

Chapter 4

Optimisation Of A Modified Set Of Sequence Specific Primers For

The Identification Of Forensically Important Calliphoridae Species

78

4.1 Introduction

Sequence Specific Primers (SSPs) rely on the concept of distinction based on nucleotide

differences between species in a particular segment of DNA. This technique can be used

in the identification of species based on the presence or absence of an amplicon using

PCR. SSP analysis has been applied in the identification of mosquitos because of their

human interaction and medical implications (Manonmani et al., 2001, Fettene et al.,

2002, Kampen et al., 2003 and Phuc et al., 2003). The successful applicability of SSPs in

other families of insects, indicates that the technique is valid for the identification of

Calliphoridae.

Optimisation is the testing of all reagents at variable amounts until a specific, efficient

and reproducible PCR is obtained (Erlich, 1993). The conditions that are commonly

optimised are annealing temperature, primer concentration, MgCl2 concentration and the

amount of template DNA. For this study the only condition altered was the annealing

temperature. The annealing temperature (Tm) is the temperature at which the primer

binds to the template and is a critical condition varied during optimisation. The

annealing temperature can be estimated from the number of G+C and A+T nucleotides

within the primer sequence (Hoy, 1994). The simple calculation used is Tm = 2AT +

4GC, which shows the greater the GC-content, the higher the annealing temperature. If

the annealing temperature of the PCR is too low the resulting amplification will likely

contain non-specific DNA fragments (Rychlik et al., 1990). Alternatively if the

temperature is too high the primer is unable to bind efficiently to the template, which

results in reduced yield and purity of the product (Rychlik et al., 1990).

In the development of a multiplex PCR, similarity between annealing temperatures of

individual primers is essential to ensure potential efficiency of each primer. Additionally,

the other reagents within the reaction should exhibit similarities to make multiplexing

possible. Due to this the initial condition altered was the annealing temperature, whilst

keeping all other conditions and reagents the same.

79

4.2 Methods




DNeasy Tissue Kit as described by Harvey (2006) with some modifications as specified

in Chapter 3.

The DNA extraction method and quantitation of resultant DNA samples were performed

as described in Chapter 3 and the Appendix 1. Results of quantitation of DNA purity are

presented in Appendix 2.

4.2.2 Primers

Several species were identified based on the presence or absence of an amplified band

using the single forward primer C1-J-1718 (Simon et al., 1990) and 8 new reverse

primers were designed from within the COI region. The forward primer C1-J-1718 was

paired with all reverse SSPs.

Extracted DNA quality was confirmed through the amplification of a 1270bp fragment of

the COI gene using the forward primer C1-J-1718

(5‟GGAGGATTTGGAAATTGATTAGTTCC 3‟) (Simon et al., 1990) and the reverse

primer TL2-N-3014 (5‟TCCAATGCACTAATCTGCCATATTA 3‟) (Simon et al.,

1994).

4.2.3 PCR

PCR master-mix conditions were followed from Harvey (2006). Final PCR reaction mix

consisted of: 1x PCR buffer (Fisher Biotec), 200µM of dNTP mix (Fisher Biotec), 25pM

each primer, 1 unit of Taq polymerase (Fisher Biotec), 5µl of 25mg/ml BSA, 3mM of

MgCl2, 10-150ng of template DNA and water added to a total volume of 50µl. All

reagent amounts were followed as prescribed, except BSA was modified from 5µl of 5%

BSA, to 5µl of 25mg/ml BSA, as it was readily available, and MgCl2 concentration was

80

increased from 1.5mM to 3mM to increase the primer specificity towards the target DNA

sequence.

4.2.4 PCR Optimisation

To allow for later development of a multiplex PCR, during optimisation the reagent

concentrations were kept the same unless changes to the annealing temperature proved

ineffective in optimisation of PCRs. During testing, modifications to the annealing

temperatures were made as indicated in Table 4.1. The annealing temperatures tested

ranged from 48ºC to 62ºC with 2ºC increments.

All PCRs were performed using a BioRad iCycler or GeneAmp PCR system 2700

(Applied Biosystems). Cycling conditions were 90 seconds at 94ºC initial denaturation,

followed by 36 cycles of 94ºC for 22 seconds denaturation, annealing temperature (refer

to Table 3.7) for 30 seconds and extension at 72ºC for 1 minute 20 seconds. A final

extension period of 72ºC for 1 minute was used followed by holding at 4ºC. Products

were visualised on a 2% agarose gel with ethidium bromide staining and UV

transillumination. Due to the difficulties in obtaining an exact fragment band length from

visual analysis alone, an expected range has been given. Standard curves for all SSP tests

were produced (see Appendix 3) to confirm the amplicon fell within the visually

expected size range.

4.2.5 PCR Clean-Up

The PCR products are purified to remove excess nucleotides and primer. The resulting

PCR product were utilised in direct sequencing. The Wizard SV Gel and PCR Clean-Up

System (Promega) kit was used in the purification of PCR products. Detailed instructions

for the clean-up kit are described in the Appendix 1.

4.2.6 Direct Sequencing

The ABI PRISM® Big Dye

® Terminator v 3.1 Cycle Sequencing Kit was utilised

according to manufactures‟ instructions. Samples were sequenced on an ABI 3730XL

81

sequencer at the Centre for Clinical Immunology and Biomedical Statistics, at Royal

Perth Hospital.

Each sequencing reaction contains 8µL of the BigDye terminator ready reaction mix,

3.2pmol of the primer (forward and reverse primers were used), template (amount

dependant on the expected amplicon size) and de-ionized water to make the reaction mix

up to 20µl.

All sequencing reactions were performed using the BioRad iCycler. Cycling conditions

were 96ºC for 1 minute initial pre-heat, followed by 25 cycles of 96ºC for 15 seconds

denaturation, annealing temperature (refer to Table 4.2) for 15 seconds and extension at

60ºC for 4 minutes followed by holding at 4ºC.


4.3.1 Verification of Quality of Extracted DNA Samples

Prior to the testing of the new SSP pairs, extracted DNA was tested using an established

PCR method that utilises the COI primer pairs C1-J-1718 and TL2-N-3014. This primer

pair amplifies a 1270bp region of the COI gene and was used to confirm that the

extracted Calliphoridae DNA was not degraded, does not contain excessive amounts of

inhibitors and is insect DNA. Figure 4.1 shows the COI amplification of C. dubia, Ch.

megacephala, Ch. rufifacies and L. sericata. All bands have the expected fragment

length within the range of 1100bp to 1300bp (fragment length position within range was

confirmed using a standard curve, see Appendix 3) and were of high intensity, reflecting

that a large quantity of high quality DNA was present. These results confirm that the

DNA extracted was of good quality and suitable for use in testing the newly designed

SSP pairs.

82

1 2 3 4 5 6

1400bp

1000bp

100bp

Figure 4.1: Electrophoresis gel image of COI amplification. Lane 1 is DNA ladder.

Lane 2 is C. dubia. Lane 3 is Ch. megacephala. Lane 4 is Ch. rufifacies. Lane 5 is L.

sericata and Lane 6 is the negative control. The expected fragment size is 1270bp in

length. Arrows indicate the 100bp, 1000bp and 1400bp fragments.

4.3.2 Optimisation of SSP Pairs

Table 4.1 represents the matrix of annealing temperatures utilised in the optimisation

steps of the newly designed SSP pairs. Two independent readers scored the intensity and

size of the resultant amplicons. For all electrophoresis gels displayed in this thesis a

standard curve was developed to obtain an accurate measurement of the selected

amplicons. This information is provided in Appendix 3.

83

Table 4. 1: Annealing temperature matrix for the testing of newly designed SSP pairs. 0 denotes where condition

was tested but no result was observed. 1 to 4 represents the intensity of bands produced. 1 denotes band possibly present;

2 a band of low intensity; 3 a band of medium intensity and 4 a band of high intensity. The sizes of the bands were

determined using a marker and a standard curve (Appendix 3). An expected ± 50bp variation is between expected and

observed band length due to the low resolution of electrophoresis technique gel. Optimum results are highlighted in red.

A blank box signifies that testing did not occur using this condition. (*) denotes expected species to be amplified.

Primer Name and

Expected Length Species Tested

Annealing Temperature (ºC) (Tm)

48 50 52 54 56

Band

Intensity Band Size

(bp) Band

Intensity Band Size

(bp) Band

Intensity Band Size

(bp) Band

Intensity Band Size

(bp) Band

Intensity Band Size

(bp)

SSP 1 (320bp)

C. dubia (*) 4 300-350 4 300-350

C. albifrontalis 2 300-350 2 300-350

Ch.megacephala

1 1 2 1 1 1 1

100 150-200 250-300 300-350 450-500 600-650 700-750

1 1

300-350 100

L. sericata 1 300-350 0 0

Ch. rufifacies 1 1

300-350 100

1 1

300-350 100

SSP 2 (559bp)

C. dubia (*) 3 550-600 3 550-600



L. sericata 3 550-600 0 0


SSP4 (1204bp)

C. dubia 1 1100-1400 0 0 0 0

C. albifrontalis 4 1100-1400 2 1100-1400 3 1100-1400

Ch. megacephala 1 1100-1400 0 0 0 0

L. sericata (*) 4 1100-1400 3 1100-1400 3 1100-1400

Ch. rufifacies 2 1100-1400 3 1100-1400

SSP5 (350bp)

C. dubia 0 0


Ch.megacephala(*) 4 300-370


Ch. rufifacies (*) 4 300-370

SSP 6 (803bp)

C. dubia

C. albifrontalis

Ch. megacephala

L. sericata (*)

Ch. rufifacies

SSP 7 (686bp)

C. dubia (*) 4 650-700 4 650-700



L. sericata 1 650-700 0 0

Ch. rufifacies (*) 2 650-700 4 650-700

SSP 8 (835bp)

C. dubia

C. albifrontalis (*)

Ch. megacephala

L. sericata

Ch. rufifacies

SSP 9 (293bp)

C. dubia 2 290-320 0 0 1 290-320 1 290-320

C. albifrontalis 0 0 0 0 0 0 0 0

Ch. megacephala(*) 4 290-320 4 290-320 4 290-320 4 290-320

L. sericata 4 290-320 4 290-320 4 290-320 4 290-320

Ch. rufifacies (*) 4 290-320 4 290-320 4 290-320 3 290-320

84

Annealing Temperature (ºC) (Tm)

Primer Name and Expected

Length Species 57 58 60 62

Band

Intensity Band Size

(bp) Band

Intensity Band Size

(bp) Band

Intensity Band Size

(bp) Band

Intensity Band Size

(bp)

SSP 1 (320bp)

C. dubia (*) 4 300-350 4 300-350 4 300-350

C. albifrontalis 2 300-350 2 300-350 1 1

300-350 100

Ch. megacephala 2 250-300 2 300-350 2 100-150

L. sericata 2 300-350 4 1

300-350 100 2 100-150

Ch. rufifacies 2 300-350 2 1

300-350 100

3 2

300-350 100-150

SSP 2 (559bp)

C. dubia (*)

C. albifrontalis

Ch. megacephala

L. sericata

Ch. rufifacies

SSP4 (1204bp)

C. dubia 0 0 0 0 0 0

C. albifrontalis 2 1100-1400 0 0 0 0

Ch. megacephala 0 0 0 0 0 0

L. sericata (*) 3 1100-1400 2 1100-1400 0 0

Ch. rufifacies 0 0 0 0 0 0

SSP5 (350bp)

C. dubia 0 0 0 0 0 0

C. albifrontalis 0 0 0 0 0 0

Ch. megacephala (*) 4 300-370 3 300-370 2 300-370

L. sericata 3 300-370 0 0 0 0

Ch. rufifacies (*) 4 300-370 3 300-370 2 300-370

SSP 6 (803bp)

C. dubia 1 700-750 0 800-850 0 0

C. albifrontalis 1 700-750 4 800-850 0 0

Ch. megacephala 0 700-750 1 800-850 0 0

L. sericata (*) 3 700-750 3 800-850 2 770-820

Ch. rufifacies 0 0

SSP 7 (686bp)

C. dubia (*)

C. albifrontalis

Ch. megacephala

L. sericata

Ch. rufifacies (*)

SSP 8 (835bp)

C. dubia 0 0 0 0 0 0

C. albifrontalis (*) 4 850-900 4 770-850 2 800-850


L. sericata 0 0 0 0


SSP 9 (293bp)

C. dubia 0 0 0 0


Ch. megacephala (*) 3 290-320 0 0

L. sericata 2 290-320 0 0

Ch. rufifacies (*) 3 290-320 0 0

85

Based on primer design and sequence information SSP 1b was expected to produce an

amplicon of 320bp in length for only C. dubia, yet consistently during testing other species

were amplified. SSP 1b was tested at a range of annealing temperatures including 48ºC,

52ºC, 58ºC, 60ºC and 62ºC. Figure 4.2 represents the non-concordance obtained for SSP

1b at 48ºC. All species tested produced a PCR amplicon of the expected amplicon size of

approximately 300 to 350bp (Appendix 3). Additionally, Ch. megacephala and Ch.

rufifacies produced extra fragments varying in length between 80bp and 730bp (Appendix

3).

1 2 3 4 5 6 7

1000bp

500bp

100bp

Figure 4.2: Electrophoresis gel image of SSP 1b amplification at 48ºC. Lane 1 is a 100bp

DNA ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala.

Lane 5 is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. Fragment

of 320bp in length was expected for only Lane 2 C. dubia. All additional bands are non-

targeted products. Arrows indicate the 100bp, 500bp and 1000bp fragments.

86

A possible explanation for the amplification of non-specific bands is the annealing

temperatures of 48ºC and 52ºC are too low. In an attempt to alleviate the amplification of

additional bands the temperature was increased to 58ºC, 60ºC, and 62ºC. At the higher

temperatures all species continued to be amplified. Figure 4.3 represents the

electrophoresis gel produced at 62ºC. If the temperature had been too high for primer

binding the resulting outcome would have been reduced yield and limited amplification,

which did not occur.

1 2 3 4 5 6 7

1000bp

300bp

100bp

Figure 4.3: Electrophoresis gel image of SSP 1b amplification at 62ºC. Lane 1 is the DNA

ladder. Lane 2 is C. dubia. Lane 3 is C. albifrontalis. Lane 4 is Ch. megacephala. Lane 5

is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. Fragment of

320bp in length was expected for only Lane 2 C. dubia. All additional bands are non-

targeted products. Arrows indicate the 100bp, 300bp and 1000bp fragments.

The continual amplification of all species over a 14ºC temperature range suggests an error

within the primer design or that the MgCl2 concentration was too high, as excess Mg++ can

result in the amplification of non-specific amplicons. As the primer had recently been

redesigned, MgCl2 concentration was lowered to 1.5mM, which resulted in no bands for a

87

single species tested. This lack of amplification at a reduced MgCl2 concentration, and the

results from altering the annealing temperatures (discussed above), resulted in SSP 1b

being removed from further testing. This result was not unexpected, as the original primer

design was determined to require a single modification in the addition of a base at the 13th

position from the 3‟ end. This additional base is unlikely to have affected primer

specificity over a wide temperature range. SSP 1b should be redesigned to amplify an

alternative region of the COI gene.

SSP 2b is expected to amplify only C. dubia with a fragment size of 559bp in length. The

initial temperature tested was 48ºC. The result from this reaction was the amplification of

both C. dubia and L. sericata. The temperature was increased to 50ºC to prevent the

amplification of L. sericata. Figure 4.4 shows a clear single medium intensity band for C.

dubia at approximately 550bp to 600bp in length.

1 2 3 4 5 6 7

1000bp

500bp

100bp

Figure 4.4: The electrophoresis gel image of SSP 2b amplification at 50ºC. Lane 1 is the

DNA ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala.

Lane 5 is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. The

selected species was C. dubia with an expected fragment of 559bp. Arrows indicate the

100bp, 500bp and 1000bp fragments.

88

SSP 4b is expected to amplify L. sericata, producing a fragment size of 1204bp in length.

SSP 4b was tested at 52ºC, 54ºC, 56ºC, 57ºC, 58ºC and 60ºC. At 52ºC, 54ºC and 57ºC

non-selected species were amplified. In an attempt to remove non-selected species, the

temperature was increased to 58ºC, which resulted in the amplification of only L. sericata

with an amplicon size of approximately 1100bp to 1400bp (Figure 4.5). The annealing

temperature was raised to 60ºC, but no fragments were produced suggesting that the 60ºC

was too high for the primer to bind and therefore 58ºC was concluded to be the optimal

annealing temperature for SSP 4b.

1 2 3 4 5 6 7

1000bp

500bp

100bp


ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5

is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. The expected

fragment length is 1204bp (approximately 1200bp) and should only be amplified by L.

sericata as shown in the gel. Arrows indicate the 100bp, 500bp, 1000bp and L. sericata

fragments.

89

SSP 5b is expected to produce a fragment of 350bp in length for both Ch. megacephala and

Ch. rufifacies. Initial temperatures tested were 56ºC and 58ºC, which amplified Ch.

megacephala, Ch. rufifacies and L. sericata. To optimise the reaction and prevent the

amplification of L. sericata, the annealing temperature was increased to 60ºC. Figure 4.6

shows the results obtained at 60ºC where it is clearly observed that a medium intensity

band of approximately 300bp to 370bp is present for both Ch. rufifacies and Ch.

megacephala. All other species showed no amplified products as expected, and thus 60ºC

was concluded to be the optimal annealing temperature.

1 2 3 4 5 6 7

1000bp

400bp

100bp




amplified fragment is 350bp for both Ch. megacephala and Ch. rufifacies, which is visible

from the gel. Arrows indicate the 100bp, 500bp and 1000bp fragments.

90

SSP 6b is expected to produce an 803bp fragment for the species L. sericata. The initial

estimated annealing temperature tested for SSP 6b was 58ºC, which amplified all species

tested. To prevent the amplification of the non-selected species the temperature was

increased to 60ºC, which produced the same results. The temperature was further increased

to 62ºC, which was the optimal temperature for specific amplification of a low intensity

band fragment at approximately 770bp to 820bp using SSP 6b (Figure 4.7).

1 2 3 4 5 6 7

1100bp

500bp

100bp



is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. L. sericata is the

only species expected to amplify, producing an amplicon of 803bp in length. Arrows

indicate the 100bp, 500bp, 1100bp and L. sericata fragments.

91

SSP 7b is expected to produce a fragment of 686bp in length for C. dubia and Ch.

rufifacies. The estimated annealing temperature for SSP 7b was determined to be 52ºC,

which when tested produced a high intensity band of approximately 650bp to 700bp for C.

dubia and Ch. rufifacies (Figure 4.8). Though this produced good results extra conditions

were tested to determine if 52ºCwas optimum for this SSP pair. Decreasing the

temperature to 48ºC produced non-specific products, which confirmed the optimal

annealing temperature as 52ºC.

1 2 3 4 5 6 7

1100bp

600bp

100bp



is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. C. dubia and Ch.

rufifacies are the only species expected to amplify a 686bp fragment. Arrows indicate the

100bp, 500bp and 1100bp fragments.

92

SSP 8 is expected to produce an 835bp fragment for C. albifrontalis. The estimated

annealing temperature was 60ºC. Testing at this temperature produced a single high

intensity band for only C. albifrontalis, measured at approximately 770bp to 850bp in

length (Figure 4.9). The temperatures of 62ºC and 58ºC were tested and produced the

expected results; the only difference was the intensity of the bands. As the highest

intensity band was obtained at 60ºC, this was determined to be the optimal annealing

temperature for SSP 8.

1 2 3 4 5 6 7

1000bp

500bp

100bp

Figure 4.9: Electrophoresis gel image of SSP 8 amplification at 60ºC. Lane 1 is the DNA


is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. Only C.

albifrontalis is expected to produce a band fragment of 835bp in length. Arrows indicate

the 100bp, 500bp and 1000bp fragments.

93

Similar results were obtained for SSP 9 as SSP 1b. Specifically SSP 9 produced non-

concordance between expected and observed results over a temperature range of 12ºC.

Based on sequence information and primer design SSP 9 was expected to produce a 293bp

fragment for Ch. rufifacies and Ch. megacephala. Consistently during testing non-selected

species amplified an amplicon of approximately 290bp to 320bp in length. Figure 4.10

shows the species amplified at 48ºC, which can be viewed in comparison with Figure 4.11,

where the annealing temperature was 58ºC. These figures convey the observed continual

amplification of non-expected species. The temperature was further increased to 60ºC,

which resulted in no amplified products, suggesting the temperature was too high.

1 2 3 4 5 6 7

500bp

100bp

Figure 4.10: Electrophoresis gel image of SSP 9 amplification at 48ºC. Lane 1 is the DNA



species to be amplified were Ch. megacephala and Ch. rufifacies with a band fragment of

293bp in length. Arrows indicate the 100bp and 500bp fragments.

94

1 2 3 4 5 6 7

500bp

100bp

Figure 4.11: Electrophoresis gel image for SSP 9 amplification at 58ºC. Lane 1 is the

negative control. Lane 2 is L. sericata. Lane 3 is Ch. rufifacies. Lane 4 is Ch.

megacephala. Lane 5 is C. dubia. Lane 6 is C. albifrontalis and Lane 7 is the DNA ladder.

Arrows indicate the 100bp and 500bp fragments.

As excess Mg++

can result in the amplification of non-selected products, the MgCl2

concentration was reduced to 1.5mM as was done with SSP 1b. This resulted in no

amplified fragments, which suggests 1.5mM of Mg++

was insufficient to support the

binding of SSP 9. Due to the lack of optimisation, SSP 9 was removed from further

testing.

In summary, of the results obtained from optimisation of annealing temperatures, 6 of the 8

SSP pairs required the alteration of annealing temperature for adequate optimisation. Table

4.2 shows the optimised annealing temperatures of each SSP pair. SSP 1b and SSP 9 were

unable to be optimised by varying the annealing temperature and were removed from the

primer set. Three of the five Calliphoridae species tested were amplified by more than one

SSP pair, enabling a secondary confirmation test for identification.

95

Table 4.2: Optimised annealing temperatures and selected species amplification for newly

designed SSP pairs.

Primer Name SSP 2b SSP 4b SSP 5b SSP 6b SSP 7b SSP 8

Optimal Annealing Temperature (ºC) 50 58 60 62 52 60

Fragment Size (bp) 550-600 1100-1400 300-370 770-820 650-700 770-850

Species Tested

C. albifrontalis X

C. dubia X X

Ch. megacephala X

Ch. rufifacies X X

L. sericata X X

4.3.3 Analysis of sequenced SSP-PCR products

Using the sequence results obtained from the PCR amplicon products for SSP pairs 2b, 4b,

5b, 7b and 8 a sequence alignment was performed to confirm the expected regions were

amplified. Sequence information from tested samples and known published sequences

(Genbank database accessible from the National Centre for Biotechnology Information

(NCBI) website at http://www.ncbi.nlm.nih.gov) were utilised in the comparison.

Accession numbers utilised in the alignment were EU418556 (C. dubia), EU418566 (C.

albifrontalis), AB112833.1 (L. sericata), AB112845.1 (Ch. rufifacies), AB112847.14 (Ch.

megacephala) (Figure 4.12). DQ345074 (C. augur) is added not as a species tested, but to

indicate the position of the forward primer.

The purpose of the alignment was to confirm the primer sequence, species and regions

amplified. Due to the lack of sequence at some of the 5‟ and 3‟ end of the products, only

confirmation of the species and the region was possible. Figure 4.12 highlights the variable

nucleotides between the species and confirms the presence of distinctive nucleotides in the

amplified regions. The sequenced data for SSP 2b, 5b, 7b and 8 aligned accurately for all

species sequenced, confirming the correct species and regions expected were amplified.

SSP 6b failed to produce a resulting sequence and was therefore not aligned. L. sericata


96

portrayed some variation between the published species sequence and the sequenced data.

These points have been highlighted in Figure 4.12, where there are 20 differences between

the species sequence and the SSP sequenced data. These variations are observed between

450bp to 1050bp

C1-J-1718


Seq SSP 8 C. albifrontalis --------------TTGATTAGTTCC-T----GT-------T--------

Seq SSP 7b C. dubia ----------GAAATTGATTAGTTCC-T----GC-------T--------

Seq SSP 7b Ch. rufifacies --------------TTGATTAGTTCC-T----AC-------C--------

Seq SSP 5b Ch. megacephala -------TTGGAAATTGATTAGTTCC-T----GT-------T--------

Seq SSP 5b Ch. rufifacies -------TTGGAAATTGATTAGTTCC-C----AC-------C--------

Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº

Seq SSP 2b C. dubia -GAGGATTTGGAAATTGATTAGTTCC-T----GC-------T--------

C_Augur_DQ345074 GGAGGATTTGGAAATTGATTAGTTCCTTTAATGCTAGGAGCTCCAGATAT 50

L_sericata_AB112833 --------------------------------------------------

Ch_rufifacies_AB112845 --------------------------------------------------

Ch_megacephala_AB112847 --------------------------------------------------


C_dubia_EU418556 --------------------------------------------------

Seq SSP 8 C. albifrontalis G--A-T---T---T----------------T---T-AC----T--C---T

Seq SSP 7b C. dubia A--A-T---T---T----------------C---C-TT----T--T---T

Seq SSP 7b Ch. rufifacies G--T-T---A---A----------------T---C-TT----C--T---C

Seq SSP 5b Ch. megacephala A--T-T---A---A----------------C---C-TT----T--T---T

Seq SSP 5b Ch. rufifacies G--T-T---A---A----------------T---C-TT----C--T---T

Seq SSP 4 L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº

Seq SSP 2 C. dubia A--A-T---T---T----------------C---C-TT----T--T---T

C_Augur_DQ345074 AGCATCCCCTCGATTAAATAATATAAGTTTCTGACTTTTACCTCCTGCAT 100

L_sericata_AB112833 ----------------------------------C-TT----T--T----

Ch_rufifacies_AB112845 ----------------------------------C-TT----C--T----

Ch_megacephala_AB112847 ----------------------------------C-TT----T--T----

C_albifrontalis_EU418566 ----------------------------------T-AC----T--C----

C_dubia_EU418556 ----------------------------------C-TT----T--T----

* * **** ** ****

Seq SSP 8 C. albifrontalis ----TT--T-------A-----------------T--A------------

Seq SSP 7b C. dubia ----AC--T-------A-----------------T--A------------

Seq SSP 7b Ch. rufifacies ----TT--C-------A-----------------T--A------------

Seq SSP 5b Ch. megacephala ----TT--T-------A-----------------T--G------------

Seq SSP 5b Ch. rufifacies ----TT--C-------A-----------------T--A--//


Seq SSP 2b C. dubia ----AC--T-------A-----------------T--A------------

C_Augur_DQ345074 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA 150

L_sericata_AB112833 ----TT--T-------T-----------------C--A------------

Ch_rufifacies_AB112845 ----TT--C-------A-----------------T--A------------

Ch_megacephala_AB112847 ----TT--T-------A-----------------T--G------------

C_albifrontalis_EU418566 ----TT--T-------A-----------------T--A------------

C_dubia_EU418556 ----AC--T-------A-----------------T--A------------

**** ** ******* ***************** ** ***** ******

Seq SSP 8 C. albifrontalis -----T-----C--T---T----T--------T--T-----A-----T--

Seq SSP 7b C. dubia -----T-----C--C---T----T--------C--T-----A-----T--

Seq SSP 7b Ch. rufifacies -----T-----T--A---T----A--------T--A-----T-----A--

Seq SSP 5b Ch. megacephala -----T-----C--A---T----T--------T--T-----A-----A--



C_Augur_DQ345074 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC 200

L_sericata_AB112833 -----A-----C--T---C----T--------T--T-----A-----T--

97

Ch_rufifacies_AB112845 -----T-----T--A---T----A--------T--A-----T-----A--

Ch_megacephala_AB112847 -----T-----C--A---T----T--------T--T-----A-----A--

C_albifrontalis_EU418566 -----T-----C--T---T----T--------T--T-----A-----T--

C_dubia_EU418556 -----T-----C--C---T----T--------C--T-----A-----T--

***** ***** ** *** **** ******** ** ***** ***** **

Seq SSP 8 C. albifrontalis T-----------------T--AC-T--T-----T--------T-------

Seq SSP 7b C. dubia T-----------------T--TT-A--T-----A--------C-------

Seq SSP 7b Ch. rufifacies A-----------------T--TT-A--C-----T--------A-------

Seq SSP 5b Ch. megacephala A-----------------C--TT-A--C-----A--------T-------



C_Augur_DQ345074 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT 250

L_sericata_AB112833 T-----------------C--TC-T--T-----A--------T-------

Ch_rufifacies_AB112845 A-----------------T--TT-A--C-----T--------A-------

Ch_megacephala_AB112847 A-----------------C--TT-A--C-----A--------T-------

C_albifrontalis_EU418566 T-----------------T--AC-T--T-----T--------T-------

C_dubia_EU418556 T-----------------T--TT-A--T-----A--------C-------

***************** ** * ** ***** ******** *******

Seq SSP 8 C. albifrontalis ----A--A--------------T--C--A--------G-----A-----G

Seq SSP 7b C. dubia ----A--T--------------T--T--A--------A-----A-----T

Seq SSP 7b Ch. rufifacies ----G--C--------------A--T--T--------A-----T-----A

Seq SSP 5b Ch. megacephala ----A--T--------------A--T--A--------A-----T-----A


Seq SSP 2b C. dubia ----A--T--------------T--T--A--------A-----A-----T

C_Augur_DQ345074 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT 300

L_sericata_AB112833 ----A--T--------------T--A--T--------A-----A-----A

Ch_rufifacies_AB112845 ----G--C--------------A--T--T--------A-----T-----A

Ch_megacephala_AB112847 ----A--T--------------A--T--A--------A-----T-----A

C_albifrontalis_EU418566 ----A--A--------------T--C--A--------G-----A-----G

C_dubia_EU418556 ----A--T--------------T--T--A--------A-----A-----T

**** ** ************** ** ** ******** ***** *****

Seq SSP 8 C. albifrontalis A-T--C-----T-----------------T-----A-----A-----A--

Seq SSP 7b C. dubia G-A--T-----C-----------------T-----A-----A-----A--

Seq SSP 7b Ch. rufifacies A-T--A-----T-----------------A-----T-----T-----T--

Seq SSP 5b Ch. megacephala A-T--A-----T--------//

Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººA-----A-----A--

Seq SSP 2b C. dubia G-A--T-----C-----------------T-----A-----A-----A--

C_Augur_DQ345074 GTAACTTTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC 350

L_sericata_AB112833 A-T--T-----T-----------------T-----A-----A-----A--

Ch_rufifacies_AB112845 A-T--A-----T-----------------A-----T-----T-----T--

Ch_megacephala_AB112847 A-T--A-----T-----------------A-----T-----T-----T--

C_albifrontalis_EU418566 A-T--C-----T-----------------T-----A-----A-----A--

C_dubia_EU418556 G-A--T-----C-----------------T-----A-----A-----A--

* ** ***** ***************** ***** ***** ***** **

Seq SSP 8 C. albifrontalis –C-AT-AC-TC-------T--------------A--A--T-----A---T

Seq SSP 7b C. dubia -T-AT-AC-TT-------T--------------A--A--T-----T---T

Seq SSP 7b Ch. rufifacies -C-TC-TT-AT-------A--------------A--T--A-----T---T

Seq SSP 4b L. sericata -T-AT-AC-TT-------A--------------T--A--T-----A---C

Seq SSP 2b C. dubia -T-AT-AC-TT-------T--------------A--A--T-----T---T

C_Augur_DQ345074 TTTATTACTTTTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATAT 400

L_sericata_AB112833 -T-AT-AC-TT-------A--------------A--A--T-----A---C

Ch_rufifacies_AB112845 -C-TC-TT-AT-------A--------------A--T--A-----T---T

Ch_megacephala_AB112847 -C-AT-AT-AT-------T--------------T--A--T-----T---T

C_albifrontalis_EU418566 -C-AT-AC-TC-------T--------------A--A--T-----A---T

C_dubia_EU418556 -T-AT-AC-TT-------T--------------A--A--T-----T---T

* * * * ******* ************** ** ** ***** ***

Seq SSP 8 C. albifrontalis –A-----A--T-----CC-T-----T-----T-----C--T--T-----A

Seq SSP 7b C. dubia -A-----A--T-----TC-T-----T-----C-----C--A--A-----A

98

Seq SSP 7b Ch. rufifacies -A-----T--T-----TT-A-----T-----C-----T--A--A-----G

Seq SSP 4b L. sericata -T-----A--T-----TC-T-----A-----C-----C--A--A-----A

Seq SSP 2b C. dubia -A-----A--T-----TC-T-----T-----C-----C--A--A-----A

C_Augur_DQ345074 TATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAGCAGGAGGA 450

L_sericata_AB112833 -T-----A--C-----TC-T-----A-----C-----C--T--A-----A

Ch_rufifacies_AB112845 -A-----T--T-----TT-A-----T-----C-----T--A--A-----G

Ch_megacephala_AB112847 -A-----T--C-----TC-A-----T-----C-----T--A--A-----A

C_albifrontalis_EU418566 -A-----A--T-----CC-T-----T-----T-----C--T--T-----A

C_dubia_EU418556 -A-----A--T-----TC-T-----T-----C-----C--A--A-----A

* ***** ** ***** * ***** ***** ***** ** ** *****

Seq SSP 8 C. albifrontalis -----T--T--------C-----T-----------T-----T--C--A--

Seq SSP 7b C. dubia -----T--T--------T-----C-----------T-----T--C--T--

Seq SSP 7b Ch. rufifacies -----C--T--------T-----C-----------C-----T--T--A--

Seq SSP 4b L. sericata -----C--A--------T-----T-----------C-----A--T--T--

Seq SSP 2b C. dubia -----T--T--------T-----C-----------T-----T--C--T--

C_Augur_DQ345074 GGAGATCCTATTTTATATCAACACTTATTTTGATTTTTTGGTCACCCTGA 500

L_sericata_AB112833 -----T--A--------C-----T-----------C-----A--C--T--

Ch_rufifacies_AB112845 -----C--T--------T-----C-----------C-----T--T--A--

Ch_megacephala_AB112847 -----T--T--------T-----T-----------C-----A--T--T--

C_albifrontalis_EU418566 -----T--T--------C-----T-----------T-----T--C--A--

C_dubia_EU418556 -----T--T--------T-----C-----------T-----T--C--T--

***** ** ******** ***** *********** ***** ** ** **

Seq SSP 8 C. albifrontalis ---A-----------------A-----T-----------T--C--T----

Seq SSP 7b C. dubia ---T-----------------//

Seq SSP 7b Ch. rufifacies ---T--------------//

Seq SSP 4b L. sericata ---T-----------------T-----T-----------T--T--T----

Seq SSP 2b C. dubia ---T--//

C_Augur_DQ345074 AGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCACATATTATTA 550

L_sericata_AB112833 ---T-----------------T-----T-----------T--T--T----

Ch_rufifacies_AB112845 ---T-----------------T-----C-----------T--T--C----

Ch_megacephala_AB112847 ---T-----------------T-----C-----------T--T--T----

C_albifrontalis_EU418566 ---A-----------------A-----T-----------T--C--T----

C_dubia_EU418556 ---T-----------------G-----T-----------A--T--T----

*** ***************** ***** *********** ** ** ****

Seq SSP 8 C. albifrontalis -------------T-----------T--C--G--AC----A--A------

Seq SSP 4b L. sericata -------------A-----------A--C--T--AT----A--A------

C_Augur_DQ345074 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGGTCATTAGGAATAATTTAT 600

L_sericata_AB112833 -------------T-----------A--C--T--AT----G--G------

Ch_rufifacies_AB112845 -------------A-----------C--T--A--TT----A--A------

Ch_megacephala_AB112847 -------------A-----------T--C--A--TT----A--G------

C_albifrontalis_EU418566 -------------T-----------T--C--G--AC----A--A------

C_dubia_EU418556 -------------A-----------T--C--G--AT----A--A------

************* *********** ** ** ** **** ** ******

Seq SSP 8 C. albifrontalis --T---C----------TT----------C-----A-----Y--T--T--

Seq SSP 4b L. sericata --T---T----------AT----------T-----T-----T--T--T--

C_Augur_DQ345074 GCCATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCCCACCATAT 650

L_sericata_AB112833 --C---T----------AT----------T-----T-----T--T--T--

Ch_rufifacies_AB112845 --A---T----------AT----------T-----A-----T--T--T--

Ch_megacephala_AB112847 --T---C----------TC----------T-----A-----T--C--C--

C_albifrontalis_EU418566 --T---C----------TT----------C-----A-----T--T--T--

C_dubia_EU418556 --C---T----------AT----------T-----A-----C--C--T--

** *** ********** ********** ***** ***** ** ** **

Seq SSP 8 C. albifrontalis A-TT--A--A-----A--C--A--T--T-----T--T--T--A-//

Seq SSP 4b L. sericata A-TT--A--A-----A--C--T--T--A-----T--T--T--T-----T-

C_Augur_DQ345074 ATCTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACCTCAGCTA 700

L_sericata_AB112833 A-TT--A--A-----A--C--T--T--A-----T--C--T--T-----T-

Ch_rufifacies_AB112845 A-TC--T--A-----G--T--A--T--T-----A--T--C--T-----T-

Ch_megacephala_AB112847 G-TT--T--T-----A--C--A--C--A-----T--T--C--T-----T-

99

C_albifrontalis_EU418566 A-TT--A--A-----A--C--A--T--T-----T--T--T--A-----A-

C_dubia_EU418556 A-TT--A--A-----A--T--A--T--C-----T--T--T--C-----T-

* ** ** ***** ** ** ** ** ***** ** ** ** ***** *

Seq SSP 4b L. sericata -T-----------T--A--------------A-----C-----------A

C_Augur_DQ345074 CTATAATTATTGCGGTACCAACTGGAATTAAAATTTTCAGTTGATTAGCA 750

L_sericata_AB112833 -T-----------T--A--------------G-----T-----------A

Ch_rufifacies_AB112845 -A-----------T--A--------------A-----T-----------A

Ch_megacephala_AB112847 -A-----------T--A--------------G-----C-----------A

C_albifrontalis_EU418566 -T-----------T--T--------------A-----C-----------C

C_dubia_EU418556 -T-----------G--A--------------A-----C-----------A

* *********** ** ************** ***** ***********

Seq SSP 4b L. sericata --------T-----T--------C-----T--T--------------T--

C_Augur_DQ345074 ACTCTTTATGGAACTCAATTAAACTATTCACCAGCTACTTTATGAGCTTT 800

L_sericata_AB112833 --------T-----T--------C-----C--T--------------T--

Ch_rufifacies_AB112845 --------T-----T--------T-----T--A--------------C--

Ch_megacephala_AB112847 --------C-----A--------T-----T--A--------------T--

C_albifrontalis_EU418566 --------T-----T--------T-----C--A--------------A--

C_dubia_EU418556 --------T-----T--------C-----A--A--------------T--

******** ***** ******** ***** ** ************** **

Seq SSP 4b L. sericata ---A--------TT-A--T--T--------T-----------T-------

C_Augur_DQ345074 AGGATTTGTATTTTTATTTACAGTAGGAGGATTAACTGGAGTTGTTTTAG 850

L_sericata_AB112833 ---A--------TT-A--C--T--------T-----------T-------

Ch_rufifacies_AB112845 ---G--------TT-A--T--T--------A-----------A-------

Ch_megacephala_AB112847 ---A--------TT-A--T--T--------A-----------T-------

C_albifrontalis_EU418566 ---G--------CC-T--C--A--------A-----------T-------

C_dubia_EU418556 ---A--------TT-A--T--A--------A-----------T-------

*** ******** * ** ** ******** *********** *******

Seq SSP 4b L. sericata ----C--T--AA-T--T-----TC-A-----T--T--T--------A---

C_Augur_DQ345074 CTAACTCATCTGTAGATATTATCCTTCATGATACTTATTATGTAGTTGCT 900

L_sericata_AB112833 ----C--T--AG-T--T-----TT-A-----T--A--C--------A---

Ch_rufifacies_AB112845 ----T--A--TA-T--T-----TT-A-----C--A--C--------A---

Ch_megacephala_AB112847 ----T--A--AA-T--C-----TT-A-----T--A--T--------A---

C_albifrontalis_EU418566 ----T--T--TG-T--T-----CC-T-----T--A--C--------T---

C_dubia_EU418556 ----C--T--TG-A--T-----CC-T-----T--T--T--------T---

**** ** ** * ** ***** * ***** ** ** ******** ***

Seq SSP 4b L. sericata --C------------T-A--A--A--------------T--------A--

C_Augur_DQ345074 CATTTCCATTATGTTTTATCAATAGGAGCTGTATTTGCCATTATAGCAGG 950

L_sericata_AB112833 --C------------T-A--A--G--------------T--------A--

Ch_rufifacies_AB112845 --C------------C-T--A--A--------------T--------A--

Ch_megacephala_AB112847 --C------------C-A--A--G--------------T--------A--

C_albifrontalis_EU418566 --T------------C-A--T--A--------------T--------C--

C_dubia_EU418556 --T------------T-A--A--A--------------C--------A--

** ************ * ** ** ************** ******** **

Seq SSP 4b L. sericata ------T--T----AC--TT-------A--A-----T------ACT--GA

C_Augur_DQ345074 ATTTGTTCATTGATACCCTCTATTTACAGGTTTAACTTTAAATGGAAAAA

1000

L_sericata_AB112833 ------T--C----AT--TT-------A--A-----T------ACT--GA

Ch_rufifacies_AB112845 ------A--T----TC--AT-------T--A-----C------AAT--AA

Ch_megacephala_AB112847 ------T--T----TC--TC-------T--A-----T------AGC--GT

C_albifrontalis_EU418566 ------A--C----AC--TC-------A--A-----T------GGA--AA

C_dubia_EU418556 ------T--T----AC--TC-------A--T-----T------GGA--AA

****** ** **** ** ******* ** ***** ****** **

100

Seq SSP 4b L. sericata -AT----A---------G-------------T--A----A-T-A--A--//

C_augur_DQ345074 TACTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAGTATTACATTT

1050

L_sericata_AB112833 -AT----A---------G-------------T--G----A-T-A--A--C

Ch_rufifacies_AB112845 -AC----A---------G-------------T--A----A-T-A--A--C

Ch_megacephala_AB112847 -AT----G---------G-------------C--A----A-T-A--A--C

C_albifrontalis_EU418566 -GT----A---------A-------------T--A----A-A-T--T--C

C_dubia_EU418556 -AC----A---------A-------------T--A----A-A-T--A--T

* **** ********* ************* ** **** * * ** **

Figure 4.12: Representation of the sequenced data obtained from optimised SSP pairs. The

identifying nucleotides for each species and the corresponding nucleotide within the

sequence data are highlighted as follows C. dubia -, C. albifrontalis -, Ch. megacephala -,

Ch. rufifacies – and L. sericata -. Variation between a species and sequence data alignment

is identified with -. End of sequenced data is signified by //. * denotes conserved sites. A

blank signifies a variable site. º denotes missing sequence not obtained using the Big Dye

terminator kit. – denotes conserved sequence information.

Phylogenetic analysis was performed to determine if the variation observed in the sequence

data for L. sericata was the result of contamination during testing. To confirm this

sequences for all species tested were selected from Genbank (http://www.ncbi.nlm.nih.gov)

(full list of sequences utilised is provided in the Appendix 4) to be grouped, based on the

similarity and differences between chosen characters. All species sequences were aligned

with the test L. sericata sequence to determine if the variation observed were due to

intraspecific or interspecific difference. Using this alignment a pair-wise comparison of all

selected sequences was performed using the MEGA 3.1 programme to produce a

neighbour-joining phylogenetic tree (Figure 4.13). From Figure 4.13 it is clear that the test

L. sericata sequence groups with the other L. sericata sequences, confirming that the

variations observed were not the result of contamination. It is also evident from Figure

4.13 that intraspecific variation is exhibited within the L. sericata complex, which accounts

for the variation observed during sequence analysis. The statistical reliability of the

inferred tree was determined via the random resampling of nucleotide sites within the

sequence (bootstrapping). This gives an indication as to the proportion of replication in

which a specific clustering occurred. For Figure 4.13, 500 bootstrap replications were

performed resulting in a clustering percentage of 97 for the L. sericata group being the

species of origin for the test sequence.


101

EU418579 L sericata AB112844 L sericata AB112864 L sericata AB112859 L sericata AB112843 L sericata AB112833 L sericata

EF531193 L sericata AY092814 L sericata AY092818 L sericata AY092817 L sericata AY092816 L sericata AY092815 L sericata

EU418578 L sericata AB112850 L sericata

L sericata TEST SEQ EU418568 C albifrontalis EU418567 C albifrontalis

EU418566 C albifrontalis EU418553 C dubia EU418556 C dubia EU418555 C dubia EU418554 C dubia EU418552 C dubia

DQ119593 Ch megacephala DQ119592 Ch megacephala DQ279746 Ch megacephala

DQ345076 Ch megacephala AB112841 Ch megacephala

AY092761 Ch megacephala EU418537 Ch megacephala

DQ647350 Ch megacephala DQ647352 Ch megacephala

DQ647353 Ch megacephala DQ647351 Ch megacephala

AB112848 Ch megacephala EU418535 Ch megacephala AB112846 Ch megacephala AB112830 Ch megacephala EU418536 Ch megacephala AB112856 Ch megacephala AB112861 Ch megacephala AB112847 Ch megacephala

AY092760 Ch rufifacies DQ345079 Ch rufifacies

DQ647359 Ch rufifacies DQ647358 Ch rufifacies DQ647360 Ch rufifacies

DQ647361 Ch rufifacies DQ647357 Ch rufifacies

AB112845 Ch rufifacies AB112828 Ch rufifacies

EU418549 Ch rufifacies EU418548 Ch rufifacies EU418547 Ch rufifacies



AH015279 Ch rufifacies AH015278 Ch rufifacies

AH015277 Ch rufifacies AH015276 Ch rufifacies 99

81 99

64 81

13 5

7

6

50

27

47

42

80

68

20 44

51

41

34

23

37

32

72

95 99

87 36 42

99

89

99 52

9

85

97

0.02 Figure 4.13: Neighbouring joining phylogenetic tree using pair-wise comparison of all

species tested to confirm species grouping of the L. sericata test sequence data. L.

sericata sequence has been identified as L. sericata TEST SEQ. Bootstrap values are

identified at the base of each branch

102

For SSP 1b and SSP 9, the purpose of the direct sequencing was to determine the reason for

the continual amplification of non-selected species after optimisation attempts. Direct

sequencing data for these SSP pairs were aligned with all species tested and the nucleotide

variations were isolated and identified (Figure 4.14). SSP 1b (C. dubia) and SSP 9 (Ch.

megacephala) sequenced data, amplified both the forward and reverse primer and were

aligned accurately. This alignment confirmed the successful amplification of the selected

region, species and fragment length. The partial sequence data for the other species tested

using SSP 1b and SSP 9 could only provide information on the region and species amplified.

Comparisons of species-specific nucleotide differences within the sequence were identified

and appear to align accurately suggesting both accurate regions and species amplified. From

this information it is not possible for a reason to be determined that would explain the

continual non-selected amplification of these species during PCR.

C1-J-1718


Seq SSP 9 L. sericata -GAGGATTTGGAAATTGATTAGTTCC-T----GT-------T--------

Seq SSP 9 Ch. rufifacies --AGGATTTGGAAATTGATTAGTTCC-C----AC-------C--------

Seq SSP 9 Ch. megacephala --AGGATTTGGAAATTGATTAGTTCC-T----GT-------T--------

Seq SSP 1b C. dubia ---GGATTTGGAAATTGATTAGTTCC-T----GC-------T--------

Seq SSP 1b Ch. megacephala -GAGGATTTGGAAATTGATTAGTTCC-T----GT-------T--------

C_augur_DQ345074 GGAGGATTTGGAAATTGATTAGTTCCTTTAATGCTAGGAGCTCCAGATAT 50

Ch_megacephala_AB112847 --------------------------------------------------

L_sericata_AB112833 --------------------------------------------------

C_rufifacies_AB112845 --------------------------------------------------


C_dubia_EU418556 --------------------------------------------------

******************************** ******* ********

Seq SSP 9 L. sericata -G-T-T---A---A----------------C---C-TT----T--T----

Seq SSP 9 Ch. rufifacies -G-T-T---A---A----------------T---C-TT----C--T----

Seq SSP 9 Ch. megacephala -G-T-T---A---A----------------C---C-TT----T--T----

Seq SSP 1b C. dubia -G-A-T---T---T----------------C---C-TT----T--T----

Seq SSP 1b Ch. megacephala -G-T-T---A---A----------------C---C-TT----T--T----

C_augur_DQ345074 AGCATCCCCTCGATTAAATAATATAAGTTTCTGACTTTTACCTCCTGCAT 100

C_megacephala_AB112847 ----------------------------------C-TT----T--T----

L_sericata_AB112833 ----------------------------------C-TT----T--T----

C_rufifacies_AB112845 ----------------------------------C-TT----C--T----

C_albifrontalis_EU418566 ----------------------------------T-AC----T--C----

C_dubia_EU418556 ----------------------------------C-TT----T--T----

** * *** *** ******************** * **** ** ****

Seq SSP 9 L. sericata ----TT--T-------A------------G----T--G-----A----//

Seq SSP 9 Ch. rufifacies ----TT--C-------A------------G----T--A-----A------

Seq SSP 9 Ch. megacephala ----TT--T-------A------------G----T--G-----A------

Seq SSP 1b C. dubia ----AC--T-------A------------G----T--A-----A------

Seq SSP 1b Ch. megacephala ----TT--T-------A------------G----T--G-----A------

C_augur_DQ345074 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA 150

C_megacephala_AB112847 ----TT--T-------A------------C----T--G-----A------

L_sericata_AB112833 ----TT--T-------T------------G----C--A-----A------

C_rufifacies_AB112845 ----TT--C-------A------------G----T--A-----A------

103

C_albifrontalis_EU418566 ----TT--T-------A------------G----T--A-----G------

C_dubia_EU418556 ----AC--T-------A------------G----T--A-----A------

**** ** ******* ************ **** ** ***** ******

Seq SSP 9 Ch. rufifacies -----T-----T--A---T----A--------//

Seq SSP 9 Ch. megacephala -----T-----C--A---T----T--------T--T-----A-----A--


Seq SSP 1b Ch. megacephala -----T-----C--A---T----T//

C_augur_DQ345074 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC 200

Ch_megacephala_AB112847 -----T-----C--A---T----T--------T--T-----A-----A--

L_sericata_AB112833 -----A-----C--T---C----T--------T--T-----A-----T--

Ch_rufifacies_AB112845 -----T-----T--A---T----A--------T--A-----T-----A--

C_albifrontalis_EU418566 -----T-----C--T---T----T--------T--T-----A-----T--

C_dubia_EU418556 -----T-----C--C---T----T--------C--T-----A-----T--

***** ***** ** *** **** ******** ** ***** ***** **

Seq SSP 9 Ch. megacephala A-----------------C--TT-A--C-----A--------T-------


C_augur_DQ345074 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT 250

Ch_megacephala_AB112847 A-----------------C--TT-A--C-----A--------T-------

L_sericata_AB112833 T-----------------C--TC-T--T-----A--------T-------

Ch_rufifacies_AB112845 A-----------------T--TT-A--C-----T--------A-------

C_albifrontalis_EU418566 T-----------------T--AC-T--T-----T--------T-------

C_dubia_EU418556 T-----------------T--TT-A--T-----A--------C-------

***************** ** * ** ***** ******** *******

SSP 9 ATCTGTAATTAATATACGATC

Seq SSP 9 Ch. megacephala ----A--T--------------ATCTGTAATTAATATAC-----------

Seq SSP 1b C. dubia ----A--T--------------TA-T--A--------A-----A-----T

C_augur_DQ345074 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT 300

C_megacephala_AB112847 ----A--T--------------AA-T--A--------A-----T-----A

L_sericata_AB112833 ----A--T--------------TA-A--T--------A-----A-----A

Ch_rufifacies_AB112845 ----G--C--------------AA-T--T--------A-----T-----A

C_albifrontalis_EU418566 ----A--A--------------TA-C--A--------G-----A-----G

C_dubia_EU418556 ----A--T--------------TA-T--A--------A-----A-----T

**** ** ************** * ** ******** ***** *****

SSP 1b GTAACTTTTGACCGAATACC

Seq SSP 1b C. dubia GTAACTTTTGACCGAATACC

C_augur_DQ345074 GTAACTTTTGACCGAATACC350

Ch_megacephala_AB112847 A-T--A-----T--------

L_sericata_AB112833 A-T--T-----T--------

Ch_rufifacies_AB112845 A-T--A-----T--------

C_albifrontalis_EU418566 A-T--C-----T--------

C_dubia_EU418556 G-A--T-----C--------

* ** ***** ********

Figure 4.14: Representation of the sequenced data obtained from testing of SSP 1b and SSP

9. The identifying nucleotides for each species and the corresponding nucleotide within the

SSP 1b and SSP 9 sequences are highlighted as follows C. dubia -, C. albifrontalis -, Ch.

megacephala -, Ch. rufifacies – and L. sericata -. Variation between a species and sequence

data alignment is identified with -. End of sequenced data is signified by //. * denotes

conserved sites. A blank signifies a variable site. – denotes conserved available sequence

information from a species to highlight variable regions.

104

The SSP pairs still lack an internal control, which would provide assurance that the PCR

is working and the DNA specimens have been successfully amplified and detected. For

expected results the internal controls provide a secondary signal that confirms successful

amplification. Without an internal control, there is no surety that the lack of an amplified

species, was not instead due to reaction failure. Lack of an internal control does not

detract totally from the results obtained which were found to be reproducible, but would

have provided on extra confirmation test for the results.

From the results of the SSP pair optimisation testing, two multiplex PCR will be

developed due to the range of primer annealing temperatures. One multiplex PCR will be

tested using SSP 2b and 7b, which will amplify C. dubia and C. rufifacies. The second

multiplex PCR will use SSP 4b, 5b, 6b and 8 and should amplify the species C.

albifrontalis, Ch. megacephala, Ch. rufifacies and L. sericata.

4.4 Conclusion

In an attempt to retain similarity between SSP pairs for potential multiplex PCR

development the initial condition altered was the annealing temperature. Altering only

the annealing temperature, 6 of the 8 SSP pairs amplified expected species and region.

SSP 1b and SSP 9 were subjected to further testing but were unable to be optimised and

were removed from further testing. With the remaining SSP pairs two multiplex PCRs

can be developed and tested, which will identify all species tested in this study.

If the primers were to be optimised without multiplexing as a consideration, alternative

conditions could have been tested to obtain optimisation. Analysis of sequence data

obtained for SSP 1b confirms the primer alignment position and the expected species to

be amplified suggesting that the unspecific amplification is due to conditions within the

PCR and not the target sequence. The strength of the amplified product observed for C.

dubia compared to other species tested suggests that further investigation of MgCl2

concentrations between 1.5mM and 3mM in the temperature range 48-62ºC could be

tested.

105

The target region of SSP 9 was similarly analysed via the sequencing data to confirm

primer alignment, design and expected amplified species. As no unexpected variations

were observed, it suggests, as with SSP 1b, that the problem exists with the conditions of

the PCR. Further testing of the temperature in the range of 58-60ºC and MgCl2

concentration of 1.5-3mM may have prevented the amplification of L. sericata and thus

resulted in optimisation of the primer.

The noted intra-specific variation found in L. sericata, occurs mainly at the 5‟ end of the

sequence and at sites of diagnostic inter-specific variation for the other species. The

intra-specific variation has previously been observed within the COI region of the Lucilia

complex, and has the potential to be applicable to forensic entomology. Potential

research could be conducted to determine the degree of variation within the species and

whether the observed variations are specific to geographical regions. If the variation

were geographically specific specimens could be traced back to a specific site instead of a

region such as Western Australia.

106

Chapter 5

Development Of Two Multiplex SSP-PCR Assays

For The Identification Of Forensically Important

Calliphoridae.

107

5.1 Introduction

Multiplex PCR is a variant of the standard PCR, whereby multiple primer pairs are used

instead of a single primer pair. The advantage of this technique is the considerable time,

resources and effort that can be saved. Multiplex PCR has been used as a tool for the

identification of viruses (Heredia et al., 1996), bacteria (Malkawi et al., 2003 and

Kawaguchi et al., 2005), parasites (Orlandi et al., 2003) and insects (Pavan et al., 2007

and Dang et al., 2005, Phuc et al., 2003, Kengne et al., 2001 and Noel et al., 2004).

Within the realm of forensic science the utilisation of the multiplex PCR technique has

become more frequent. The most common application of the multiplex PCR within

forensic science has been in relation to wildlife forensics. This has included the the

prevention of illegal trade, via the identification of endangered species (Frasier et al.,

2006), threatened species (McInnes et al., 2005) and identification of fish species for

fishing regulations (Marshall et al., 2006).

The limitations for this technique is the extensive optimisation of all reagents and

conditions required within the multiplex PCR. Though the same reagents are used both

in the standard and the multiplex PCRs, the reagents influence on the reaction can vary.

The conditions that need to be optimised include the primer-template concentration,

MgCl2 concentration, dNTP concentration and the annealing temperature.

Primer-template concentration is very important as it can affect the efficiency, specificity,

reaction sensitivity, preferential amplification and the formation of primer-dimers

(Markoulatos et al., 2002). If the primer-template ratio is too high the primer will anneal

to itself instead of the template, resulting in the formation of primer-dimers.

Alternatively if the primer-template ratio is too low, re-synthesis of the template will

occur after denaturation, reducing the amount of primer attachment and resulting in a

decrease of the overall yield of the reaction.

To prevent the preferential amplification of one primer over another, optimisation of the

primer concentration is essential. It is recommended by Henegariu (1997) that equimolar

108

amounts of primer should be used in initial optimisation tests. After identification of

weak and strong primers within a multiplex PCR the concentrations can be altered

accordingly.

The concentration of the dNTP and MgCl2 are important during the multiplex PCR

optimisation. If the concentration of dNTPs is too high the overall yield of the reaction

will be inhibited, whereas if the concentration is too low, the overall yield will be reduced

(Henegariu et al., 1997). It is recommended by Henegariu (1997) that the concentration

of dNTPs should be between 100µM and 500µM. The concentration of the MgCl2

affects the activity of the dNTPs, Taq DNA polymerase, template and the primers. If the

Mg++

is in excess the double-stranded DNA will be stabilised preventing denaturation,

resulting in overall reduced yield of the reaction (Markoulatos et al., 2002). If

alternatively the concentration of the MgCl2 is too low the product yield will be reduced

(Markoulatos et al., 2002).

As with standard PCR, the annealing temperature is important and can be difficult to

optimise. The optimal annealing temperature required within single primer reactions can

be reduced by up to 4ºC or 6 ºC for successful amplification (Henegariu et al., 1997).

This can be important if the primers intended for multiplexing vary slightly in their

annealing temperatures.

Reagents used within multiplex PCRs are more susceptible to loss of stability and

efficiency, and care must be taken with their use. All reagents utilised must be

thoroughly mixed to ensure total distribution of chemicals. The dNTPs used in the

multiplex PCR are susceptible to loss of stability through the continual freezing and

thawing of the reagent. It is recommended by Henegariu (1997) that aliquots of dNTPs

be made to ensure the stock dNTPs integrity is maintained as the dNTPs can only be

frozen and thawed no more than 3 or 4 times.

109

5.2 Methods




DNeasy Tissue Kit as described by Harvey (2006) with some modifications as specified

in Chapter 3. DNA Extraction method DNA samples was performed as described in

Chapter 3 and the Appendix 1. Purity of DNA samples was confirmed via the 260/280

ratio using a spectrophotometer (Appendix 2).

5.2.2 Primers

Six optimised SSP primer pairs from Chapter 4 (SSP 2b, SSP 4b, SSP 5b, SSP 6b, SSP

7b and SSP 8) were utilised in the development of the two multiplex PCRs.

Extracted DNA quality was confirmed using the forward primer C1-J-1718 (5‟

GGAGGATTTGGAAATTGATTAGTTCC 3‟) (Simon et al., 1990) and the reverse

primer TL2-N-3014 (5‟ TCCAATGCACTAATCTGCCATATTA 3‟) (Simon et al.,

1994) producing a fragment of 1270bp in length (Figure 4.1).

5.2.3 Multiplex PCR

Multiplex PCR master-mix conditions were followed from the Qiagen Multiplex PCR

handbook. Final multiplex PCR mix consisted of: 25µl of Qiagen multiplex PCR master-

mix, 3µl of each primer (2µM), 3µl (< 1 µg DNA/50µl) of template DNA and made-up to

50µl with RNase-free water.

All PCRs were performed using the BioRad iCycler or GeneAmp PCR system 2700

(Applied Biosystems). Cycling conditions were 95ºC for 15 minutes initial activation

step, followed by 36 cycles of 94ºC for 30 seconds denaturation, annealing temperature

(refer to Table 5.1) for 90 seconds and extension at 72ºC for 90 seconds. A final

extension period of 72ºC for 10 minutes was used followed by holding at 4ºC.

110


The original aim of this thesis was the development of a single multiplex PCR for the

identification of forensically important Calliphoridae. Subsequent to optimisation of the

individual SSP primer pairs, SSP pairs were analysed for potential multiplexing. After a

review of the annealing temperatures it was found that a range of 12ºC was present

between the SSP primer pairs (Table 4.2). It became apparent that a single multiplex

PCR would be implausible and alternatively two multiplex PCRs were designed.

Multiplex PCR 1 was developed to include SSP 4b, 5b, 6b and 8, which has a

temperature range from 58ºC to 62ºC and would result in an identifiable band fragment

for C. albifrontalis, Ch. megacephala, Ch. rufifacies and L. sericata. Multiplex PCR 2

will be developed with SSP 2b and 7b, which have annealing temperatures of 50ºC and

52ºC respectively and produce bands for C. dubia and Ch. rufifacies. In the development

of two multiplex PCRs it was essential that all test species were amplified by the

presence of at least one and preferably multiple fragments and all fragments were of

equal intensity.

Multiplex PCR 1 was initially tested to include SSP pairs 4b, 5b, 6b and 8. The expected

fragment sizes and species are represented in Table 5.1. The only species not expected

to amplify with Multiplex PCR 1 is C. dubia. Due to the difficulties associated with

optimisation of multiplex PCRs, initial testing of SSP pairs was done using the Qiagen

Multiplex PCR kit.

111

Table 5.1: SSP pairs associated with each multiplex PCR and the expected species and

fragment lengths to be amplified.

Multiplex PCR 1 Multiplex PCR 2

Primer Name SSP 4b SSP 5b SSP 6b SSP 8 SSP 2b SSP 7b

Expected Fragment Size (bp) 1100-1400 300-370 770-820 770-850 550-600 650-700

Optimised Annealing Temperature of Individual SSP pairs (ºC) (Tm) 58 60 62 60 50 52

Species

C. albifrontalis X

C. dubia X X

Ch. megacephala X

Ch. rufifacies X X

L. sericata X X

During initial testing it became clear that SSP 4b could not be amplified. To alleviate

this the primer concentration of SSP 4b was increased to 50pmol, and the annealing

temperature tested was varied from 58ºC to 62ºC at 2ºC increments, yet no product was

visible. A possible reason for the SSP 4b primers‟ inability to amplify could be due to

degradation of stock primer solution. To confirm this a repeat optimisation test was run,

where SSP 4b produced the expected clear band for L. sericata at approximately 1100-

1400bp in length (Figure 5.1), which established that the SSP 4b primer stock solution

was not degraded. The weak amplification and the large product size of SSP4b suggest

that further optimisation of the singleplex reaction should be conducted. Possible

alterations include increasing the amount of DNA added to 5µl or increasing the

extension time within the PCR from 90 seconds to 2 minutes, to compensate for the large

fragment size. Regrettably due to the inability of the SSP 4b primer to produce a

fragment and that L. sericata could also be identified by SSP 6b, SSP 4b was removed

from further multiplex testing.

112

1 2 3 4 5 6 7

1100bp

400bp

100bp

Figure 5.1: Electrophoresis gel image for the confirmation of SSP 4b primer stock

solution at 58ºC. Lane 1 is the DNA molecular Ladder. Lane 2 is C. albifrontalis. Lane

3 C. dubia. Lane 4 is Ch. megacephala. Lane 5 is Ch. rufifacies. Lane 6 is L. sericata

and Lane 7 is the negative control sample. Arrows indicate the 100bp, 400bp and 1100bp

fragments.

Utilising only SSP pairs 5b, 6b and 8 multiplex PCR 1 was further optimised. Using the

Qiagen multiplex PCR kit the initial conditions were tested with equimolar amounts of

primer (30pmol) at 62ºC. These conditions resulted in the expected amplification for this

reaction (Figure 5.2) with all bands present at the expected length and species. C.

albifrontalis produced a single band between 770-850bp in length, C. dubia produced no

product, Ch. megacephala and Ch. rufifacies produced single bands at approximately

300-370bp in length and L. sericata produced a single band at 770-820bp in length.

These fragment lengths were confirmed within expected range using a standard curve

(Appendix 3).

113

1 2 3 4 5 6 7

1200bp

500bp

100bp

Figure 5.2: Gel electrophoresis image of multiplex PCR 1 at 62ºC using the Qiagen

multiplex PCR kit. Lane 1 is the DNA molecular ladder. Lane 2 is C. albifrontalis.

Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5 Ch. rufifacies. Lane 6 is L.

sericata. Lane 7 is the negative control. Arrows indicate the 100bp, 500bp and 1200bp

fragments.

An underlying problem with multiplex PCR 1 was that Ch. megacephala and Ch.

rufifacies are both expected to produce an amplicon of 300-370bp, which indicates there

is no distinction between these species within this reaction. To identify the species

present subsequent sequencing would be required. The second multiplex PCR is

designed to only identify two species via the presence of a fragment, which are C. dubia

and Ch. rufifacies. If multiplex PCR 2 could be optimised it would provide the

distinction required between Ch. megacephala and Ch. rufifacies for specific

identification.

114

Multiplex PCR 2 utilises SSP 2b and SSP 7b and is expected to produce two amplicons

for C. dubia (559bp and 686bp) and a single amplicon for Ch. rufifacies (686bp). Using

the Qiagen Multiplex PCR kit, the initial condition tested included equimolar amounts of

primer (30pmol) at 50ºC. These conditions resulted in a single high intensity fragment

for C. dubia and Ch. rufifacies at 650-700bp in length (Figure 5.3). This result is due to

the amplification of SSP 7b. SSP 2b did not produce a fragment. To increase efficiency

of SSP 2b within the multiplex PCR the primer concentration was increased to 50pmol

and SSP 7b was reduced to 10pmol, yet the same result was produced. Further

optimisation testing was conducted including decreasing the annealing temperature to

48ºC and altering the amount of template DNA to 1µl, yet SSP 2b still failed to produce a

product. Alternatively increasing the DNA concentration should have been trial.

1 2 3 4 5 6 7

1000bp

500bp

100bp

Figure 5.3: Electrophoresis gel image of the Multiplex PCR 2 at 50ºC. Lane 1 is the

DNA molecular ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch.

megacephala. Lane 5 Ch. rufifacies. Lane 6 is L. sericata. Lane 7 is the negative

control. Arrows indicate the 100bp, 500bp and 1000bp fragments.

115

Due to the size of the amplicon exhibited by C. dubia within the multiplex PCR 2 it was

thought that SSP 2b and SSP 7b were not separating properly within a 2% agarose gel,

therefore the percentage was increased to 3% to determine if two bands were present.

The 3% agarose electrophoresis gel failed to indicate the presence of multiple bands.

This lack of amplification of SSP 2b after continual optimisation and separation attempts

suggests that SSP 2b is not binding to the template DNA sequence or that the primer has

degraded.

As with SSP 4b, SSP 2b was re-tested individually to determine the condition of the stock

primer solution (Figure 5.4). The expected species C. dubia and Ch. rufifacies both

amplified with a 550-600bp fragment, which confirmed that the primer stock had not

degraded and that an alternative reason must exist for the lack of amplification of SSP 2b.

An alternative reason is that SSP 2b is unable to maintain its specificity when in the

presence of SSP 7b. This is potentially due to the primers been designed relatively close

together, with SSP 7b exhibiting the greater specificity and therefore preventing

annealing of SSP 2b.

116

1 2 3 4 5 6 7

1100bp

500bp

100bp

Figure 5.4: Electrophoresis gel image for the confirmation of SSP 2b stock solution at

50ºC. Lane 1 is the DNA molecular ladder. Lane 2 is C. albifrontalis. Lane 3 is C.

dubia. Lane 4 is Ch. megacephala. Lane 5 Ch. rufifacies. Lane 6 is L. sericata. Lane 7

is the negative control. Arrows indicate the 100bp, 500bp and 1100bp fragments.

Though Multiplex PCR 2 was unable to be optimised in combination with multiplex PCR

1, every species can be identified. Additionally Ch. rufifacies is amplified by both

multiplex PCR 1 and SSP 7b and could therefore be distinguished from Ch. megacephala

allowing for identification of all species tested.

For this technique to be taken further an internal control should be added. This would

provide a secondary signal to indicate that the reaction functioned correctly and that the

fragments (present or absent) are an accurate representation of the results. Without the

internal control, lack of an amplified product (even if expected) cannot be confirmed, as

there is always potential for false negative results.

117

5.4 Conclusion

After reviewing the annealing temperatures of the individual SSP pairs it was determined

that two multiplex PCR would be developed. Multiplex PCR 1 was initially designed to

include SSP 4b, 5b, 6b and 8, yet after optimisation SSP 4b was removed and the final

multiplex PCR contained only SSP 5b, 6b and 8 (set-up has been summarised in

Appendix 5). The failure of SSP4 may be due to the large fragment size of 1204bp and

the relatively faint initial singleplex amplification that prevented it from working within

the multiplex. This could be resolved through further optimisation trials.

Multiplex PCR 2 was initially intended to contain SSP 2b and 7b, yet during optimisation

it became clear that the SSP 2b primer set did not amplify any products. The lack of

amplification may be the result of poor primer specificity when in the presence of SSP 7b

as primers were designed within a 100bp region. Possible future research would include

designing a new primer set in a different region of the COI, to replace SSP 2b within the

multiplex.

Ultimately only one Multiplex PCR could be fully optimised in the identification of three

forensically important Calliphoridae. With the additional PCR using SSP 7b, it is

possible for all test species to be identified by the presence of at least one specific

fragment.

118

Chapter 6

Discussion And Conclusions

119

The aim of this thesis was the development of a multiplex SSP PCR system for the

identification of forensically important Calliphoridae species. Molecular techniques for

the identification of forensically important arthropods have greatly advanced and are now

considered more reliable than traditional taxonomic identification. DNA-based

techniques are fast, reliable, reproducible and do not require extensive training or

knowledge to apply. The purpose of this thesis was to develop an existing preliminary

study on SSP pairs as a means of identification of forensically important Calliphoridae

and improve on this technique by developing it into a multiplex PCR. The advantage of

this would be a cost-effective, time, and effort efficient technique, which is still reliable

and reproducible. To accomplish this the following steps were followed; i) optimisation

of preliminary designed SSP pairs by Harvey (2006); ii) re-design of sub-optimal SSP

pairs to increase specificity and binding efficiency; iii) optimisation of newly designed

and re-designed SSP pairs; and iv) development of multiplex PCR using optimised SSP

pairs.

SSP utilise unique base pairs at the 3‟ end to identify between different species Harvey

(2006) used this idea to develop 7 SSP pairs (SSP 1, 2, 3, 4, 5, 6 and 7) for the

identification of 5 species and 3 species complexes of forensically important

Calliphoridae. These SSP pairs were known to be sub-optimal and the original aim of

this thesis was to optimise, and re-design where required, these primer pairs for

subsequent multiplex PCR. Re-design included the presence of a species-specific base at

the 3‟ end of the primer sequence of the SSP pairs, addition of a mismatch base pair at

the second position from the 3‟ end, suitable length and GC content and lack of

complementarity to itself and other primers. Taking all these guidelines into

consideration 6 SSP pairs were re-designed (SSP 1b, 2b, 4b, 5b, 6b and 7b) and 2 SSP

pairs were newly designed (SSP 8 and 9) for the identification of 5 forensically important

Calliphoridae species (C. albifrontalis, C. dubia, Ch. megacephala, Ch. rufifacies and L.

sericata).

Optimisation is the process of testing the reaction variables until the expected result is

obtained. Conditions altered included MgCl2 concentration, primer concentration and

120

annealing temperature. Of the 8 re-designed and new SSP pairs tested only 6 could be

optimised (2b, 4b, 5b, 6b, 7b and 8) and therefore utilised in the development of a

multiplex PCR. The two primers removed from further testing were SSP 1b and SSP 9,

both of which failed to be optimised by altering only the annealing temperature. Analysis

of the sequence data showed no unexpected variation, therefore suggesting that the

problem with amplification lies within the PCR conditions. Further testing taking into

consideration alternative parameters such as MgCl2 concentration over ranging

temperatures may result in the optimisation of these primers.

Multiplex PCR is a variant of the standard PCR where instead of using a single primer

pair, multiple primer pairs are utilised. The advantage of this technique is that it is both

cost-effective, due to the reduced amount of reagents required to perform a reaction and

also time and effort efficient due to the requirement of only a single reaction. After

reviewing the annealing temperatures obtained from the individual SSP results, it was

deemed implausible to produce a single multiplex PCR to be designed, and alternatively

two would be developed.

Multiplex PCR 1 originally contained SSP 4b, 5b, 6b and 8, yet after optimisation

attempts SSP 4b was removed from testing. The final multiplex PCR 1 utilised SSP 5b,

6b and 8 at 62ºC for the amplification of C. albifrontalis, Ch. megacephala, Ch. rufifacies

and L. sericata. SSP 4b was removed from the reaction due to lack of amplification

despite optimisation attempts. Possible reasons explaining the failure of the primer to

amplify within the multiplex include the large fragment size of 1204bp for SSP 4b and

the weak amplification of the singleplex product. Further optimisation as both a

singleplex and multiplex reaction utilising alternative parameters, such as MgCl2 and

DNA concentration and increased extension times should be considered in potential re-

trials of this study.

A potential problem associated with multiplex PCR 1 reaction was Ch. megacephala and

Ch. rufifacies both amplified a 350bp product. Therefore confirmation of species identity

could only be made through the use of multiplex PCR 2. The second multiplex PCR was

121

designed to amplify SSP 2b and 7b, for the identification of C. dubia and Ch. rufifacies.

After optimisation attempt it became clear that SSP 2b in the presence of SSP 7b was

unable to anneal to the template and produce a product. Potential further optimisation

attempts should include alternative parameters such as DNA and primer concentrations,

to alleviate the lack of amplification by SSP 2b. Alternatively as SSP 2b and SSP 7b are

located within a similar region of the COI target sequence, re-designing the primer in a

new region will potentially produce an optimal multiplex. Due to this lack of

amplification by SSP 2b multiplex PCR 2 could not be developed further.

Though it was originally intended that two multiplex PCRs would be designed and

optimised, identification of all species tested is still possible. Using the optimised

multiplex PCR 1 in combination with a single SSP 7b reaction it is possible for

identification of all species tested, including the separation of Ch. megacephala and Ch.

rufifacies. This would use the same amount of effort and resources required for two

multiplex PCR, and still allow for the identification of all species tested.

The forensic significance behind the potential of this technique lies in its efficiency and

accuracy of identification. Current technologies are aiming to develop markers for the

identification of a large range of entomologically related species, yet in terms of

efficiency it has become generally accepted that current technique including PCR and

sequencing provide a sufficient identification time. Forensic entomologists require this

initial identification, prior to subsequent testing and resulting conclusions. If the time

taken for an accurate identification is decreased, then so to is the time taken for the

determination of PMI, movement of corpse or evidence of neglect to be determined. By

improving the efficiency of specimen identification through multiplex PCR, the

application of entomology within forensic investigation could be greatly improved.

Future research that can be conducted to further this thesis would include the design and

testing of the proposed internal control to assist in the validation of the multiplex PCR

primer set. In addition, new primer sets could be designed to provide secondary markers

for the species tested, same species from different geographical regions (especially the

122

Eastern states of Australia) and also new species commonly encountered on corpse from

within Australia and around the world. This would allow for a more thorough

representation of the applicability of a multiplex PCR system and its potential to be easily

incorporated into the area of forensic entomology. Furthermore, research into the

observed intra-specific variation of L. sericata could be expanded to determine if

geographical placement of specimens is possible. The potential advantages this could

have to the area of forensic entomology would be significant in identifying where a crime

was committed and also in determining if movement of the body had occurred.

For this technique to be further developed and validated an internal control would be

helpful. An internal control co-amplifies within the reaction, allowing for distinction

between negatives and false negatives. A positive result from the internal control

indicates that amplification was not inhibited therefore validating a negative result. The

internal control could be within the target sequence, which for this thesis would have

been the COI gene or alternatively genes containing highly conserved domains such as

the D-loop (control region) or tRNA genes. It was originally intended during this study

that an internal control would be explored, as this would have provided a secondary

signal confirming the performance of the PCR. As this was not accomplished, the above

thesis is a representation of an attempted experimental improvement of the effectiveness

of both SSP primer pairs as a means of identification and the potential use of multiplex

PCR in relation to forensically important Calliphoridae species.

123

Chapter 7

References

124

Amendt, J., Campobasso, C. P., Gaudry, E., Reiter, C., LeBlanc, H. N., and Hall, M. J. R.

(2007) Best practice in forensic entomology-standards and guidelines. Int. J. Legal. Med,

121, 90-104.

Ames, C., Turner, B., and Daniel, B. (2006) The use of mitochondrial cytochrome

oxidase I gene (COI) to differentiate two UK blowfly species – Calliphora vicina and

Calliphora vomitoria. Forensic Science International, 164, 179-182.

Arnaldos, M. I., Garcia, M. D., Romera, E., Presa, J. J., and Luna, A. (2005) Estimation

of postmortem interval in real cases based on experimentally obtained entomological

evidence. Forensic Science International, 149, 57-65.

Balogh, M. K., Burger, J., Bender, K., Schneider, P. M., and Alt, K. W. (2003) STR

genotyping and mtDNA sequencing of latent fingerprints on paper. Forensic Science

International, 137, 188-195.

Barker, D. F. (2000) Direct genomic multiplex PCR for BRCAI and application to

mutation detection by single-stranded conformation and heteroduplex analysis. Human

Mutations, 16, 334-344.

Bass, W. M. (1997) Outdoor decomposition rates in Tennessee. In Forensic Taphonomy:

The post-mortem fate of human remains, (Eds. Haglund, W. D., and Sorg, M. A). CRC

Press, Boston, 181-186.

Benecke, M. (1998) Random amplified polymorphic DNA (RAPD) typing of

necrophagous insecta (Diptera, Coleoptera) in criminal forensic studies: validation and

use in practice. Forensic Science International, 98, 157-168.

Benecke, M. (2001) A brief history of forensic entomology. Forensic Science

International, 120, 2-14.

125

Benecke, M., and Lessig, R. (2001b) Child neglect and forensic entomology. Forensic

Science International, 120, 155-159.

Benecke, M., Josephi, E., and Zweihoff, R. (2004) Neglect of the elderly: forensic

entomology cases and considerations. Forensic Science International, 146, 195-199.

Bombieri, C., Bonizzato, A., Castellani, C., Assael, B. M., and Pignatti, P. F. (2005)

Frequency of large CFTR gene rearrangements in Italian CF patients. European Journal

of Human Genetics: EJHG, 13(5), 687-689.

Byrd, J. H. and Castner, J. L. (2001) Forensic entomology the utility of arthropods in

legal investigations. CRC Press, New York, 43-81.

Cagliani, R., Sironi, M., Ciafaloni, E., Bardoni, A., Fortunato, F., Prelle, A., Serafini, M.,

Bresolin, N., and Comi, G. P. (2004) An intragenic deletion/inversion event in the DMD

gene determines a novel exon creation and results in a BMB phenotype. Human Genetics,

115(1), 13.

Campobasso, C. P., Vella, G. D., and Introna, F. (2001) Factors affecting decomposition

and Diptera colonization. Forensic Science International, 120, 18-27.

Catts, E. P., and Haskell, N. H. (1990) Entomology and death. A procedural guide.

Joyce‟s Print Shop Inc. USA, 9-37.

Clague, H. D., Fung, Y. L., and Minchinton, R. M. (2003) Human neutrophil antigen-4a

gene frequencies in an Australian population, determined by a new polymerase chain

reaction method using sequence specific primers. Transfusion Medicine, 13, 149-152.

Dadour, I. R., Cook, D. F., Fissioli, J. N., and Bailey, W. J. (2001) Forensic entomology:

application, education and research in Western Australia. Forensic Science International,

120, 48-52.

126

Dang, X. L., Wen, S. Y., He, X. F., and Pang, X. F. (2005) M-PCR: a powerful method

for rapid molecular identification of Trichogramma wasps (Hymenoptera:

Trichogrammatidae). Insect Science, 12, 77-85.

Dix, J., and Graham, M. (2001) Time of death, decomposition and identification An atlas.

CRC Press, London, 1.

DuPonte, M. W and Larish, L. B. (2003) Oriental blow fly. Livestock Management Insect

Pests, 1.

Erlich, H. (1993) How to optimize, modify and/or troubleshoot PCR reactions. Clinical

Immunology, 13 (12), 163.

Erzinclioglu, Z. (2000) Maggots, murder and men. Memories and reflections of a forensic

entomologist. Harley Book, England, p 23.

Fettene, M., Kockemoer, L., Hunt, R. and Coetzee, M. (2002) PCR assay for

identification of Anopheles quadriannulatus species B from Ethiopia and other sibling

species of the Anopheles gambiae complex. Medical and Veterinary Entomology, 16,

214-217.

Frankie, G. W., and Koehler. (1978) Perspectives in urban entomology. Academic Press,

New York, ix.

Frasier, T. R., Rastogi, T. R., Brown, M. W., Hamilton, P. K., Kraus, S. D., and White, B.

N. (2006) Characterisation of tetranucleotide microsatellite loci and development and

validation of multiplex reaction for the study of right whale species (genus Eubalaena).

Molecular Ecology Notes, 6, 1025-1029.

127

Galloway, A., Birkby, W. H., Jones, A. M., Henry, T. E., and Parks, B. O. (1989) Decay

rates of human remains in an arid environment. Journal of Forensic Science, 34, 607-

616.

Gelfand, D. H. (1989) Taq DNA polymerase. In PCR technology. Principles and

applications for DNA amplification (Ed Erlich, H. A) M Stockton Press, New York, 17-

23.

Glick, B. R. and Pasternak, J. J. (2003) Molecular biotechnology. Principles and

applications of recombinant DNA. Third edition. ASM Press, Washington D.C. 23-42.

Goff, M. L. (2000), A fly for the prosecution. How insect evidence helps solve crimes.

Harvard University Press, Cambridge, p52.

Gonzalez, S., Rodriguez-Rodero, S., Martinez-Borra, J., Lopez-Vazquez, A., Rodrigo, L.,

and Lopez-Larrea, C. (2003) MICB typing by PCR amplification with sequence specific

primers. Immunogenetics, 54, 850-855.

Goswami, G., Raghavendra, K., Nanda, N., Gakhar, S. K., and Subbarao, S. K. (2005)

PCR-RFLP of mitochondrial cytochrome oxidase subunit II and ITS2 of ribosomal DNA:

Markers for the identification of members of the Anopheles cullicifacies complex

(Diptera: Culicidae). Acta Tropica, 95, 92-99.

Grahn, A., Elmgren, A., Aberg, L., Svensson, L., Jansson, P., Lonnroth, P., and Larson,

G. (2001) Determination of Lewis FUT3 gene mutation by PCR using sequence-specific

primers enables efficient genotyping clinical samples. Human Mutation, Mutation In

Brief, 450, 1-8.

Griffith, A. J. F., Wessler, S. R., Lewontin, R. C., Gelbart, W. M., Suzuki, D. T. and

Miller, J. H. (2005) Introduction to genetic analysis. Eighth edition. W. H. Freeman and

Company, New York, 227-255.

128

Gunn, A. (2006) Essential Forensic Biology. John Wiley &Sons, Ltd. England, 14-18.

Gunson, R., Gillespie, G., and Carmen, W. F. (2003) Optimisation of PCR reactions

using primer chessboarding. Journal Of Virology, 26, 369-373.

Hale, W. G., Margham, J. P. and Saunders, V. A. (1994) Collins dictionary of biology.

Second edition. Harper Collins Publishers, Glasgow, 214, 411.

Hall, R. D. (2001) Introduction: Perceptions and status of forensic entomology. In

Forensic Entomology. The utility of arthropods in legal investigations (Eds. Byrd, J. H.,

and Castner, J. L). CRC Press, New York, 1-16.

Harvey, M., Dadour, I. and Gaudieri, S. (2003) Mitochondrial DNA cytochrome oxidase

I gene: potential for distinction between immature stages of some forensically important

fly species (Diptera) in Western Australia. Forensic Science International, 131, 134-139.

Harvey, M. (2006) Thesis; A molecular study of the forensically important Calliphoridae

(Diptera): Implications and applications for the future of forensic entomology. University

of Western Australia.

He, L., Wang, S., Miao, X., Wu, H., and Huang, Y. (2007) Identification of necrophagous

fly species using ISSR and SCAR markers. Forensic Science International, 168, 148-

153.

Henegariu, O., Heerema, N. A., Dlouhy, S. R., Vance, G. H., and Vogt, P. H. (1997)

Multiplex PCR: Critical parameters and step-by-step protocols. Bio Techniques, 23, 504-

511.

Heredia, A., Soriano, V., Weiss, S. H., Bravo,R., Valleju, A., Denny, T. N., Epstein, J. S.,

and Hewlett, K. (1996) Development of a multiplex PCR assay for the simultaneous

129

detection and discrimination of HIV-1, HIV-2, HTLV-I and HTLV-II. Clinical and

Diagnostic Virology, 7, 85-92.

Hoy, M. A. (1994) Insect molecular genetics. An introduction to principles and

applications. Academic Press, New York, 201-212.

Hurley, C. K. and Kukuruga, D. (1993) How to design and optimize PCR primers and

sequence-specific oligonucleotide probes for DNA typing. Clinical Immunology, 13(12),

157-163.

Junqueira, A. C. M., Lessinger, A. C., Torres, T. T., da Silva, F. R., Vettore, A. L.,

Arrunda, P., and Azeredo Espin, A. M. L. (2004) The mitochondrial genome of the

blowfly Chrysomya chloropyga (Diptera: Calliphoridae). Gene, 339, 7-15.

Kambhampati, S., and Smith, P. T. (1995) PCR primers for the amplification of four

insect mitochondrial gene fragments. Insect Molecular Biology, 4(4), 233-236.

Kampne, H., Sternberg, A., Proft, J., Bastian, S., Schaffner, F., Maier, W. and Seitz, H.

(2003) Polymerase chain reaction based differentiation of the mosquito sibling species

Anopheles claviger s.s. and Anopheles petragnami (Diptera: Culicidae). American

Journal of Tropical Medicine and Hygiene, 69, 195-199.

Kawaguchi, A., Sawada, H., Inoue, K., and Nasu, H. (2005) Multiplex PCR for the

identification of Agrobacterium biovar 3 strains. Journal of Genetic Plant Pathology, 71,

54-59.

Kengne, P., Trung, H. D., Baimai, V., Coosemans, M., and Manguin, S. (2001) A

multiplex PCR-based method derived from random amplified polymorphic DNA

(RAPDS) markers for the identification of species of the Anopheles minimus group in

Southeast Asia. Insect Molecular Biology, 10(5), 427-435.

130

Kumar, P. L., Fenton, B., and Jones, A. T. (1999) Identification of Cecidophyopsis mites

(Acari: Eriophyidae) based on variable simple sequence repeats of ribosomal DNA

internal transcribed spacer-1 sequence via multiplex PCR. Insect Molecular Biology 8(3),

347-357.

Kwok, S., Chang, S. Y., Sninsky, J. J., and Wang, A. (1994) A guide to the design and

use of mismatched and degenerate primers. PCR Methods Appl. 3, 39-47.

Lawyer, F. C., Stoffel, S., Saiki, R. K., Chang, S., Landre, P. A., Abramson, R. D and

Gelfand, D. H. (1993) High-level expression, purification, and enzymatic characterization

of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5‟ to

3‟ exonuclease activity. PCR Methods Appl. 2 (4), 275-287.

Lessinger, A. C., and Azeredo-Espin, M. L. (2000) Evolution and structural organisation

of mitochondrial DNA control region of myiasis-causing flies. Medical and Veterinary

Entomology, 14, 71-80.

Lunt, D., Zhang, D. X., Szymura, J. and Hewitt, G. (1996) The insect cytochrome

oxidase I gene: evolutionary patterns and conserved primers for phylogenetic study.

Insect Molecular Biology, 5, 153-165.

Ma, Y., Li, S., and Xu, J. (2006) Molecular identification and phylogeny of the

Maculatus group of Anopheles mosquitoes (Diptera: Culicidae) based on nuclear and

mitochondrial DNA sequences. Acta Tropica, 99(2-3), 272-280.

Malgorn, Y. and Coquoz, R. (1999) DNA typing for identification of some species of

Calliphoridae: an interest in forensic entomology. Forensic Science International, 102,

111-119.

131

Malkawi, H. I., and Gharaibeh, R. (2003) Multiplex PCR for the direct detection of

Salmonella enterica from chicken, lamb and beef food products. Journal of Basic

Microbiology, 4, 328-336.

Manonmani, A., Townson, H., Adeniran, T., Jambulingam, P., Sahu, S. and Vijayakumar,

T. (2001) rDNA-ITS2 polymerase chain reaction assay for the sibling species Anopheles

fluviatilis. Acta Tropica, 78, 3-9.

Markoulatos, P., Siafakas, N., and Moncany, M. (2002) Multiplex polymerase chain

reaction: A practical approach. Journal Of Clinical Laboratory Analysis, 16, 47-51.

Marshall, H.D., Johnstone, K.A. and Carr, S.M. (2007) Species-specific oligonucleotides

and multiplex PCR for forensic discrimination of two species of scallops, Placopecten

magellanicus and Chlamys islandica. Forensic Science International, 167 (1), 1-7.

McInnes, L. M., Dadour, I. R., Stewart, M. E., Ditcham, W. G. F., Mawson, D., and

Spencer, P. B. S. (2005) Characterisation of polymorphic microsatellite markers for the

Carnaby‟s cockatoo (Calyptor hynchus latirostris) and related black cockatoo species.

Molecular Ecology Notes, 5, 504-506.

Morin, N. J., Gong, Z., and Li, X. F. (2004) Reverse transcription-Multiplex PCR assay

for simultaneous deletion of Escherichia coli 0157:H7, Vibrio cholerae O‟, and

Salmonella typhi. Clinical Chemistry, 50(11), 2037-2045.

Nei, M. (1996) Phylogenetic analysis in molecular evolutionary genetics. Annuals

Reviews of Genetics, 30, 371-403.

Noel, S., Tessier, N., Angers, B., Wood, D.M. and Lapointe, F. -J. (2004) Molecular

identification of two species of myiasis causing Cuterebra by multiplex PCR and RFLP.

Medical and Veterinary Entomology, 18, 161-166.

132

Ota, M., Shimada, K., Asamura, H., Takayanagi, K., Katsuyama, Y., and Fukushima, H.

(2006) Validation of sensitive human leukocyte antigen-sequence-specific primer and

probe typing in forensic DNA examination. Legal Medicine, 8, 203-209.

Orlandi, P. A., Carter, L., Brinker, A. M., da Silva, A. J., Chu, D. M., Lampel, K. A., and

Monday, S. R. (2003) Targeting single-nucleotide polymorphisms in the 18S rRNA gene

to differentiate Cyclospora species from Eimeria species by multiplex PCR. Applied and

Environmental Microbiology, 69(8), 4806-4813.

Otranto, D., and Stevens, J. R. (2002) Molecular approaches to the study of myiasis-

causing larvae. International Journal for Parasitology, 32, 1345-1360.

Pantelidis, P., Lambert-Hammill, M., and Wierzbicki, A. S. (2003) Simple sequence-

specific-primer-PCR method to identify the three main apolipoprotein E haplotypes.

Clinical Chemistry, 49(11), 1945-1948.

Pavan, M. G., and Monteiro, F. A. (2007) A multiplex PCR assay that separates Rhodnius

prolixus from members of the Rhodnius robustus cryptic species complex (Hemiptera:

Reduviidae). Tropical Medicine and International Health, 12(6), 751-758.

Phuc, H., Ball, A., Son, L., Hanh, N., Tu, N., Lien, N., Verardi, A. and Townson, H.

(2003) Multiplex PCR assay for malaria vector Anopheles minimus and four related

species in the Myzomyia series from Southeast Asia. Medical and Veterinary

Entomology, 17, 423-428.

Pizzamiglio, M., Mameli, A., My, D., and Garofano, L. (2004) Forensic identification of

a murder by LCN DNA collected from the inside of the victims car. International

Congress Series, 1261, 437-439.

Ramose de Pablo, R., Salona, M., Sarasola, E., Cardoso, S., and Martinez de Pancorbo,

M. (2006) Molecular identification of Stearibia nigriceps: An examples of the usefulness

133

of cytochrome b gene for the identification of entomofauna species. International

Congress Series, 1288, 864-868.

Ratcliffe, S. T., Webb, D. W., Weinzievr, R. A., and Robertson, H. M (2003) PCR-RFLP

identification of Diptera (Calliphoridae, Muscidae and Sarcophagidae) - A generally

applicable method. Journal of Forensic Science, 48(4), 1-3

Rees, D. (2004) Insects of stored products. Manson Publishing, Victoria, 1-6.

Ridgwell, K. (2004) Genetic tools: PCR and sequencing. Vox Sanguinis, 87, 6-12.

Rudin, N., and Inman, K. (2002). An Introduction to Forensic DNA Analysis Second

Edition. CRC Press LLC, London.

Rychlik, W., Spencer, W. J., and Rhoads, R. E. (1990) Optimization of the annealing

temperature for DNA amplification in vitro. Nucleic Acid Research, 18 (21), 6409-6412.

Saigusa, K., Takamiya, M., and Aoki, Y. (2005) Species identification of the forensically

important flies in Iwate prefecture, Japan based on mitochondrial cytochrome oxidase

gene sub-unit I (COI) sequence. Legal Medicine, 7, 175-178.

Saiki, R. K. (1989) The design and optimisation of the PCR In PCR technology.

Principles and applications for DNA amplification (Ed Erlich, H. A). Stockton Press,

U.S.A, 7-16.

Schroeder, H., Klotzbach, H., Elias, S., Augustin, C. and Pueschel, K. (2003) Use of

PCR-RFLP for differentiation of calliphorid larvae (Diptera, Calliphoridae) on human

corpses. Forensic Science International, 132, 76-81.

Sharrocks, A. D. (1994) The design of primers for PCR. In PCR technology, current

innovations (Eds. Griffin, H. G., and Griffin, A. M). CRC Press, London, 5-9.

134

Simon, C. (1990) In Molecular Techniques in Taxonomy, Vol 57 (Eds. Hewitt, G.M.,

Johnston, A.W.B. and Young, J.P.W.) Springer-Verlag, Berlin, pp. 33-71.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994) Evolution,

weighting and phylogenetic utility of mitochondrial gene-sequences and a compilation of

conserved polymerase chain-reaction primers. Annals of the Entomological Society of

America, 87.

Smith, K. G. V. (1986) A manual of forensic entomology. Cornell University Press,

Ithaca.

Stevens, J., and Wall, R. (2001) Genetic relationship between blowflies (Calliphoridae)

of forensic importance. Forensic Science International, 120, 116-123.

Stevens, J. R., Wall, R., and Wells, J. D. (2002) Paraphyly in Hawaiian hybrid blowfly

populations and the evolutionary history of anthropophilic species. Insect Molecular

Biology, 11(2), 141-148.

Stevens, J. R. (2003) The evolution of myiasis in blowflies (Calliphoridae). International

Journal of Parasitology, 33, 1105-1113.

Stewart, J. B., and Beckenbach, A. T. (2003) Phylogenetic and genomic analysis of the

complete mitochondrial DNA sequence of the spotted asparagus beetle Crioceris

duodecimpunctata. Molecular Phylogenetics and Evolution, 26(3), 513-526.

Suggs, S. V., Hirose, T., Miyake, E. H., Kawashima, M. J., Johnson, K. I. and Wallace,

R. B. (1981) Using purified genes, in ICN-UCLA. Symp. Developmental Biology, 23,

683.

135

Sukontason, K., Sukontason, K. L., Piangjai, S., Boonchu, N., Chaiwong, T., Ngern-

Klun, R., Sripakdee, D., Vogtsberger, R. C., and Olson, J. (2004a) Antennal sensilla of

some forensically important flies in families Calliphoridae, Sarcophagidae and Muscidae.

Micron, 35, 67-679.

Sukontason, K., Sukontason, K. L., Piangjai, S., Boonchu, N., Kurahashi, H., Hope, M.,

and Olson, J. (2004b) Identification of forensically important fly eggs using potassium

permanganate staining technique. Micron, 35, 391-395.

Sukontason, K. L., Narongchai, P., Kanchai, C., Vichairat, K., Piangjai, S., Boonsriwong,

W., Bunchu, N., Sripakdee, D., Chaiwong, T., Kuntalue, B., Siriwattanarungsee, S., and

Sukontason, K. (2006) Morphological comparison between Chrysomya rufifacies

(Macquart) and Chrysomya villeneuvi Patton (Diptera: Calliphoridae) puparia,

forensically important blow flies. Forensic Science International, 164, 230-234.

Sukontason, K. L., Bunchu, N., Chaiwong, T., Kuntalue, B., and Sukontason, K. (2007)

Fine structure of the eggshell of the blowfly, Lucilia cuprina. Journal of Insect Science, 7

(9), 1-8.

Tobin, A. J. and Morel, R. E. (1997) Asking about cells. Saunders College Publishing,

New York, 332-355.

Vidal, J. R., Delavault, P., Coarer, M. and Defontaine, A. (2000) Design of grapevine

(Vitis Vinifera L.) cultivar-specific SCAR primers for PCR fingerprinting. Theory of

Applied Genetics, 101, 1194-1201.

Wallman, J. and Donnellan, S. (2001) The Utility of mitochondrial DNA sequences for

the identification of forensically important blowflies (Diptera: Calliphoridae) in

Southeast Australia. Forensic Science International, 120, 60-67.

136

Withrow, A. G., Sikorsky, J., Downs, J. C. U., and Fenger, T. (2003) Extraction and

analysis of human nuclear and mitochondrial DNA from electron beam irradiated

envelopes. Journal of Forensic Science, 48, 1302-1308.

Wells, J. and Sperling, F. (2001) DNA-based identification of forensically important

Chrysomyinae (Diptera: Calliphoridae). Forensic Science International, 120, 110-115.

Zehner, R., Amendt, J., Schutt, S., Sauer, J., Krettek, R., and Povolny, D. (2004) Genetic

identification of forensically important flesh flies (Diptera: Sarcophagidae). Int. J. Legal.

Med, 118, 245-247.

137

APPENDICIES

138

APPENDIX 1

Purification of genomic DNA from insects, using the DNeasy Tissue Kit.

1. Place up to 50mg insects in 1.5ml microcentrifuge tube.

2. Add 180µl PBS (Phosphate Buffered Saline) and homogenize the sample using an

electric homogenizer or a disposable microtube pestle.

3. Add 30µl proteinase K and 200µl Buffer AL to the sample, mix thoroughly by

vortexing, and incubate at 70ºC for 10 minutes.

4. Add 200µl ethanol (96-100%) to the sample, and mix thoroughly by vortexing.

5. Pipet the mixture from step 4 (including any precipitate) into the DNeasy Mini

spin column placed in a 2ml collection tube. Centrifuge at >6000 x g (8000rpm)

for 1 minute. Discard the flow-through and collection tube.

6. Place the DNeasy Mini spin column in a new 2ml collection tube, add 500µl

Buffer AW1, and centrifuge for 1 minute at >6000 x g (8000rpm). Discard flow-

through and collection tube.

7. Place the DNeasy Mini spin column in a new 2ml collection tube, add 500µl

Buffer AW2, and centrifuge for 3 minutes at 20,000 x g (14,000rpm) to dry the

DNeasy membrane. Discard flow-through and collection tube.

8. Place the DNeasy Mini spin column in a clean 1.5ml or 2ml microcentrifuge tube

and pipet 100µl Buffer AE directly onto the DNeasy membrane. Incubate at

room temperature for 1 minute, and the centrifuge for 1 minute at 6000 x g

(8000rpm) to elute.

9. Repeat elution once as described in step 8. Purified DNA is stored at -20ºC until

required.

139

Extraction and purification of previously amplified DNA fragments using the Wizard SV

Gel and PCR Clean-Up systems.

1. Amplify target of choice using standard amplification conditions.

2. Add an equal volume of Membrane Binding Solution to the PCR reaction.

3. Place one SV Minicolumn in a collection tube for each PCR reaction.

4. Transfer the prepared PCR product to the SV Minicolumn assembly and incubate

for 1 minute at room temperature.

5. Centrifuge the SV Minicolumn assembly in a microcentrifuge at 16,000 x g

(14,000rpm) for 1 minute. Remove the SV Minicolumn from the Spin Column

assembly and discard the liquid in the collection tube. Return the SV Minicolumn

to the Collection Tube.

6. Wash the column by adding 700µl of Membrane Wash Solution, to the SV

Minicolumn. Centrifuge the SV Minicolumn assembly for 1 minute at 16,000 x g

(14,000rpm). Empty the collection tube as before and place the SV Minicolumn

back in the collection tube. Repeat the wash with 500µl of Membrane Wash

Solution and centrifuge the SV Minicolumn assembly for 5 minutes at 16,000 x g

(14,000rpm).

7. Remove the SV Minicolumn assembly from the centrifuge, being careful not to

wet the bottom of the column with the flow-through. Empty the collection tube

and recentrifuge the column assembly or 1 minute with the microcentrifuge lid

open to allow for the evaporation of residual ethanol.

8. Carefully transfer the SV Minicolumn to a clean 1.5ml microcentrifuge tube.

Apply 50µl of Nuclease Free Water directly to the centre of the column without

touching the membrane with the pipette tip. Incubate at room temperature for 1

minute. Centrifuge for 1 minute at 16,000 x g (14, 000rpm).

9. Discard the SV Minicolumn and store the microcentrifuge tube containing the

eluted DNA at 4ºC or -20ºC

140

APPENDIX 2

Table 8.1: Purity of newly extracted DNA samples prior to testing. Value measured is

the 268/280 ratios using the spectrophotometer. Expected ratio is 1.8, yet due to high

content of A and T within fly DNA sequence this ratio is increase to be between 2.1 and

2.4.

Extraction1 Extraction 2 Extraction 3

Species ng/µl 260/280 ratio ng/µl 260/280 ratio ng/µl 260/280 ratio

C. albifrontalis 20.4 2.35 43.3 2.35

C. dubia 44.7 2.17 23.3 2.08 140 2.17

Ch. megacephala 428.5 2.2 54.8 2.37 125.2 2.14

Ch. rufifacies 7 2.22 118.6 2.43

L. sericata 42.6 2.18 10.3 2.17

141

APPENDIX 3

Standard curve for DNA quality test using

universal COI primers

100

1000

10000

0 10 20 30 40 50 60 70 80 90 100 110

Distance from well (mm)

DN

A l

ad

de

r fr

ag

me

nt

siz

e (

bp

)

Data Points Line of Best Fit

Standard curve for determination of COI fragment sizes (Figure 4.1). Included are the

measurements of DNA ladder marker used to develop standard curve, equation for

determining unknown fragment length, R2 value, calculated fragment size and

confirmation of size within expected fragment size range.


DNA Ladder Fragment Size (bp)

46 1400

47.4 1300

49.5 1200

51.2 1100

53.5 1000

55.8 900

58.5 800

61.8 700

65.8 600

69.6 500

75.2 400

81.2 300

88.5 200

99 100

Species


Calculated fragment size (bp) using below equation

Expected fragment size based on visual analysis of electrophoresis gel (bp)

C. dubia 49.5 1225 1100-1300

Ch. megacephala 50.4 1174 1100-1300

Ch. rufifacies 49 1254 1100-1300

L. sericata 49.8 1208 1100-1300

Equation Y = 12737e-0.0473x

R2 Value R

2 = 0.9927

142

Standard curve for SSP 1b at 48oC

100

1000

10000

0 10 20 30 40 50 60 70 80


DN

A l

ad

de

r fr

ag

me

nt

siz

e (

bp

)


Standard curve for determination of SSP 1b fragment sizes at 48ºC (Figure 4.2).

Included are the measurements of DNA ladder marker used to develop standard curve,

equation for determining unknown fragment length, R2 value, calculated fragment size

and confirmation of size within expected fragment size range.



30.5 900

32 800

34 700

36.2 600

39.5 500

43.6 400

49 300

57.5 200

66.4 100

Species




C. albifrontalis 48.4 299 300-350

C. dubia 51.4 257 250-350

Ch. megacephala 33.6 726 700-750

36.5 613 600-650

40.5 485 450-500

46.6 340 300-350

49.4 289 250-300

57.2 183 150-200

66.5 106 100

Ch. rufifacies 46 352 300-350

66.2 108 100

L. sericata 45.8 356 300-350 Equation Y = 5150.2e

-0.0583x

R2 Value R

2 =0.9952

143


100

1000

10000

0 10 20 30 40 50 60 70 80


DN

A lad

der

frag

men

t siz

e (

bp

)




51 200

43.4 300

38.4 400

34.2 500

31 600

28.6 700

26.8 800

25.2 900

24.8 1000

Equation Y= 3963.8e-0.0594x

R2 Value R

2 = 0.9929





Species




C. dubia 40.8 351 300-350


60.6 108 100

Ch. megacephala 60 112 100-150

Ch. rufifacies 43.5 299 300-350

59.4 116 100-150

L. sericata 59.2 117 100-150

144


100

1000

10000

0 10 20 30 40 50 60 70 80 90


DN

A l

ad

de

r fr

ag

me

nt

siz

e (

bp

)







DNA ladder fragment size (bp)

43 1000

44 900

46.5 800

49.3 700

52.5 600

55.5 500

61 400

66 300

72 200

81.5 100

Species




C. dubia 53.7 551 550-600


R2 Value R

2 = 0.9918

145


100

1000

10000

0 10 20 30 40 50 60 70 80 90


DN

A l

ad

de

r fr

ag

me

nt

siz

e (

bp

)




33 1300

34.4 1200

36 1100

43 1000

44 900

46.5 800

49.3 700

52.5 600

55.5 500

61 400

66 300

72 200

81.5 100




and confirmation of size within expected range.

Species




L. sericata 34.7 1355 1100-1400

Equation Y = 7874.9e-0.0507x

R2 Value R

2 = 0.9759

146


100

1000

10000

0 10 20 30 40 50 60 70 80 90


DN

A lad

der

frag

men

t siz

e (

bp

)






Species




Ch. megacephala 62 308 300-370



R2 Value R

2 = 0.992



78.6 100

69.5 200

64.5 300

59 400

54.4 500

50.8 600

48.4 700

45.8 800

43.8 900

42.4 1000

147


100

1000

10000

0 10 20 30 40 50 60 70 80 90 100


DN

A lad

er

frag

men

t siz

e (

bp

)




86.8 100

76.2 200

69.8 300

63.2 400

58.2 500

54.6 600

50.8 700

48 800

45.5 900

43.8 1000





Species




L. sericata 48 824 770-820

Equation Y = 9718.3e-0.0514x

R2 Value R

2 = 0.9929

148


100

1000

10000

0 10 20 30 40 50 60 70 80 90


DN

A l

ad

de

r fr

ag

me

nt

siz

e (

bp

)








79.6 100

70.4 200

64.8 300

59.4 400

54.5 500

51 600

48 700

45 800

43.3 900

41.6 1000

Species




C. dubia 49.6 647 650-700

Ch. rufifacies 49.6 647 650-700


R2 Value R

2 = 0.991

149

Standrd curve for SSP 8 at 60oC

100

1000

10000

0 10 20 30 40 50 60 70 80 90


DN

A lad

der

frag

men

t siz

e (

bp

)


Standard curve for determination of SSP 8 fragment sizes at 60ºC (Figure 4.9). Included

are the measurements of DNA ladder marker used to develop standard curve, equation for


confirmation of size within expected range.



80 100

70.5 200

63.8 300

57.8 400

52.8 500

49 600

45.6 700

42.8 800

40.5 900

38.8 1000

Species




C. albifrontalis 43 820 770-850

Equation Y = 8078.5e-0.0532x

R2 Value R

2 = 0.9916

150

Standard curve for SSP 9 at 48oC

100

1000

10000

0 10 20 30 40 50 60 70 80 90


DN

A l

ad

de

r fr

ag

me

nt

siz

e (

bp

)


Standard curve for determination of SSP 9 fragment sizes at 48ºC (Figure 4.10).






82.8 100

69.6 200

59.8 300

52.8 400

47.4 500

43.6 600

40.5 700

37.4 800

35.2 900

34.2 1000

Species




C. dubia 59.4 300 290-320


Ch. rufifacies 58.5 312 290-320

L. sericata 62.2 264 290-320

Equation Y = 4477.6e-0.0455x

R2 Value R

2 = 0.9978

151

Standard curve for SSP 9 at 58oC

100

1000

10000

0 10 20 30 40 50 60 70 80


DN

A lad

der

frag

men

t siz

e (

bp

)


Standard curve for determination of SSP 9 fragment sizes at 58ºC (Figure 4.11).






67.5 100

55.8 200

49.6 300

43.6 400

39 500

36.6 600

32.5 700

30.4 800

28.8 900

28.2 1000

Species






L. sericata 47.4 319 290-320

Equation Y = 4602.6e-0.0563x

R2 Value R2 = 0.9971

152

Standard curve for SSP 4b stock test

100

1000

10000

0 10 20 30 40 50 60 70 80


DN

A lad

der

frag

men

t siz

e (

bp

)


Standard curve for confirmation of SSP 4b stock solution (Figure 5.1). Included are the






23.2 1200

24.2 1100

26 1000

27 900

28.8 800

30.6 700

33.5 600

37.2 500

42 400

49 300

58.2 200

71.2 100

Species




L. sericata 22.4 1131 1100-1400

Equation Y = 3484.3e-0.0502x

R2 Value R

2 = 0.9934

153

Standard curve for Multiplex PCR 1

100

1000

10000

0 10 20 30 40 50 60 70 80 90 100


DN

A lad

der

frag

men

t siz

e (

bp

)


Standard curve for the measurement of amplicon sizes obtained using Multiplex PCR 1 at

62ºC (Figure 5.2). Included are the measurements of DNA ladder marker used to

develop standard curve, equation for determining unknown fragment length, R2 value,

calculated fragment size and confirmation of size within expected range.



31.2 1000

33 900

35 800

38.2 700

41.5 600

45.8 500

51.6 400

60 300

71.2 200

89 100

Species






Ch. rufifacies 55.5 360 300-350

L. sericata 34.6 814 770-820

Equation Y = 3141.6e-0.039x

R2 Value R

2 = 0.9971

154

Standard curve for Multiplex PCR 2

100

1000

10000

0 10 20 30 40 50 60 70 80 90 100 110


DN

A lad

der

frag

men

t siz

e (

bp

)

Data points Line of Best Fit

Standard curve for the measurement of amplicon sizes obtained from using Multiplex

PCR 2 at 50ºC (Figure 5.3). Included are the measurements of DNA ladder marker used

to develop standard curve, equation for determining unknown fragment length, R2 value,

calculated fragment size and confirmation of size within expected range.



36.2 1000

38.4 900

41.2 800

44.6 700

49.2 600

55.2 500

63 400

71.2 300

85 200

103.2 100

Species Distance from well (mm)



C. dubia 46.4 682 650-700

Ch. rufifacies 46.4 682 650-700

Equation Y = 3185.9e-0.0332x

R2 Value R

2 = 0.998

155

Standard curve SSP 2b stock test

100

1000

10000

0 10 20 30 40 50 60 70 80 90


DN

A lad

der

frag

men

t siz

e (

bp

)




28.2 1000

29.5 900

31.8 800

34.2 700

37.4 600

41.8 500

47.4 400

55.8 300

66.2 200

81 100

Standard curve for confirmation of SSP 2b stock solution (Figure 5.4). Included are the




Species Distance from well (mm)



C. dubia 39 589 550-600


R2 Value R

2 = 0.9963

156

APPENDIX 4

Table 8.2: Accession number and locality of sequences utilised in the construction of

neighbour-joining phylogenetic tree. Information was obtained from Genbank at

http://www.ncbi.nlm.nih.gov

Species Locality Accession Number

C. dubia Australia, Toodyay EU418556

Australia, Western Australia EU418555

Australia, New Norcia EU418554

Australia, Perth EU418553

Australia, Geralton EU418552

C. albifrontalis Australia, New Norcia EU418566



Ch. rufifacies India DQ098943

India DQ098942

India DQ0989451

India DQ098944

India AH015277

India AH015276

India AH015279

India AH015278

Taiwan AY092760

Australia, Perth AB112845


USA, Hawaii EU418549

USA, Tennessee EU418548

Australia, Tasmania EU418547

China DQ345079

Australia, Black Mountains, ACT DQ647361

Australia, Kuranda, QLD DQ647360

Australia, Mt. Sampson, QLD DQ647359

Australia, Tinaroo Falls, QLD DQ647358

Australia, Mt. Stuart, QLD DQ647357

Ch. megacephala Malaysia EU418537

USA, Hawaii EU418536

Australia, Sydney EU418535

South Korea DQ279746

China DQ345076

Australia, Kuranda, QLD DQ647353

Australia, Karuah, NSW DQ647352

Australia, Mt. Stuart, QLD DQ647351

Australia, Hornsby Heights, NSW DQ647350


157

India DQ119593

India DQ119592

Taiwan AY092761

Zambia, Kitwe AB112861

Zambia, Kitwe AB112856

South Africa, Pretoria AB112848



Australia, Brisbane AB112841

Australia, Natal AB112830

L. sericata France EU418579

France EU418578

Denmark EF531193



South Africa, Graaf-Reinet AB112850

South Africa, Graaf-Reinet AB112843

Zimbabwe, Harare AB112844


United Kingdom, London, England AY092818





Australia AY842612

USA, California, Davis DQ868503

USA, Michigan, East Lansing DQ868523

USA, Michigan, East Lansing DQ868524

USA, West Virginia, Morgantown DQ062660

158

Appendix 5

Summary of multiplex PCR 1; including set-up and PCR conditions.

Forward Primer 5‟ GGAGGATTTGGAAATTGATTAGTTCC 3‟

SSP 5b 5‟ GCAGTAATAACTACAGATCTT 3‟

SSP 6b 5‟ CCTAAAGCTCATAAAGTAGGA 3‟

SSP 8 5‟ TTAATCCTCCTACTGTGAAAAG 3‟

Reagents x1

Qiagen Multiplex PCR master mix 25µl

Forward Primer 3µl

SSP 5b 3µl

SSP 6b 3µl

SSP 8 3µl

Template 3µl

RNase-free Water 10µl

50 µl

PCR Cycling Conditions

1x 95ºC for 15 minutes

36x 94ºC for 30 seconds

62ºC for 90 seconds

72ºC for 90 seconds

1x 72ºC for 10 minutes

4ºC for ∞

Documents

DEVELOPEMNT OF A MULTIPLEX SEQUENCE …research-repository.uwa.edu.au/files/3248158/Hitchen...1 DEVELOPEMNT OF A MULTIPLEX SEQUENCE SPECIFIC PRIMER (SSP)-PCR SYSTEM TO IDENTIFY FORENSICALLY