Developmental analysis of transformation in legumes Nguyen ......Developmental analysis of transformation in legumes Nguyen, Hoai An ... except where due reference has been made in

i

Developmental analysis of transformation in legumes

Nguyen, Hoai An

Master of Environmental Science

This thesis is presented for the degree of Doctor of Philosophy of The University of Western Australia

School of Agriculture and Environment

2017

ii

THESIS DECLARATION

I, Nguyen, Hoai An, certify that:

This thesis has been substantially accomplished during enrolment in the degree.

This thesis does not contain material which has been accepted for the award of any other

degree or diploma in my name, in any university or other tertiary institution.

No part of this work will, in the future, be used in a submission in my name, for any other

degree or diploma in any university or other tertiary institution without the prior approval

of The University of Western Australia and where applicable, any partner institution

responsible for the joint-award of this degree.

This thesis does not contain any material previously published or written by another

person, except where due reference has been made in the text.

The work(s) are not in any way a violation or infringement of any copyright, trademark,

patent, or other rights whatsoever of any person.

The following approvals were obtained prior to commencing the relevant work described

in this thesis:

NLRD 5/1/406, the Office of the Gene Technology Regulator (Australia), the University

of Western Australia Institutional Biosafety Committee

ED 5/4/156, the Office of the Gene Technology Regulator (Australia), the University of

Western Australia Institutional Biosafety Committee.

The work described in this thesis was funded by [The Australian Award, Australian

Government, ADS1101909.

This thesis contains published works, which have been co-authored.

Signature:

Date: 27/06/2017

iii

ABSTRACT

Narrow leafed lupin (Lupinus angustifolius L. - NLL) is a valuable protein source for livestock and

enriches the soil by providing nitrogen. It is one of the major crops in Western Australia, where

it accounts for about 65% of total world lupin production, and contributes around 100 million

dollars to Australian revenue annually.

The three major constraints to lupin production are diseases, pests and especially weeds, which

directly affect lupin yield. Although traditional breeding contributes an enormous role in

production of new lupin varieties that resist these restrictions, it is limited to traits existing in

the genome. For example, weed infestation is the main threat to lupin cropping systems and

herbicides that have been used widely to control dicotyledonous weeds are accidently

threatening NLL production as herbicide tolerance does not exist in this species. Inserting the

specific desired traits via transformation will broaden the lupin genome to achieve preferred

results and may tackle the disadvantage of conventional breeding.

Genetic transformation of lupins via Agrobacterium tumefaciens is based on the method

developed by Pigeaire and her group in 1997, in which new genes are introduced into cells of

the shoot apical meristem that are wounded by stabbing and transgenic shoots are selected

with the herbicide phosphinothricin. This method is time consuming and inefficient, as the

derived shoot materials are in low abundance, chimeric and gene transfer to the progeny due

to chimerism is low. It is proposed that analysis of the developmental biology of NLL shoots

whilst following the current protocols will provide information that will enable an efficient

transformation protocol to be established.

The project initially investigated the shoot apical meristem structure of NLL to discover which

group of cells in the wounded meristem generated the new shoots following in vitro cultivation.

Transformation experiments were carried out using the A. tumefaciens strain AGL0 containing

iv

two desired marker genes to select and visualise the transgenic plant. Two reporter genes: GUS

(Beta-glucuronidase) and GFP (Green fluorescent protein) have been employed to visualize the

development of the transformed shoots. The hptII gene (encoding hygromycin B resistance) was

used as an alternative selectable marker instead of the bar gene (phosphinothricin tolerance) to

test whether the choice of a non-selective herbicide as the selectable marker trait predisposes

transgenic shoots to be chimeric by maintaining the normal developmental pathway.

Investigation of hygromycin as an alternative selection screen in combination with expression

of green fluorescent protein indicated that transformation of NLL apical cells was not the rate

limiting step to achieve transgenic shoot materials. In this research, it was identified that despite

ready transformation, apical cells were not competent to regenerate. However, a deep and

broad wounding procedure to expose underlying axillary shoot and vascular cells to

Agrobacterium, in combination with delayed selection proved successful, increasing initial

explant transformation efficiency up to 75% and generating axillary shoots with significant

transgenic cells. Based on knowledge gained from studies of plant chimeras, it is hypothesised

that further subculture of these initial axillary shoots will result in development of low chimeric

transgenic materials with heritable content. Furthermore, the method was also tested

successfully on other Lupinus species, faba bean and field pea. These results demonstrate that

development of a high yielding transformation methodology for pulse legume crops is

achievable.

v

TABLE OF CONTENTS

Chapter 1. General introduction 1

1.1. Introduction 1

1.2. Genetic manipulation in narrow leafed lupin 3

1.3. Major issues for NLL transformation and approaches to improve its efficiency

5

1.3.1 Totipotent cells in transformation and regeneration 5

1.3.2. Chimerism in putative transgenic plants 7

1.3.3. Selection methodology 8

1.4. Aims and Approaches 12

Chapter 2. General materials and methods 13

2.1. Plasmid constructs 13

2.1.1. pCAMBIA vectors 13

2.1.2. Gateway vectors 13

2.1.3. Drawing of plasmid maps 14

2.2. Molecular methods 14

2.2.1. Polymerase chain reaction (PCR) 14

2.2.2. Agarose Gel Electrophoresis 15

2.2.3. Restriction cloning 15

2.2.4. Gateway cloning 15

2.2.5. Transformation of Escherichia coli competent cells 16

2.2.6. Transformation of Agrobacterium cells 16

2.2.7. Isolate plasmid DNA from the bacterial cells 17

2.2.8. DNA sequencing 18

2.3. Plant transformation protocol 18

2.3.1. Plant materials 18

2.3.2. Agrobacterium-mediated transformation 19

2.3.2.1 Preparation of bacteria 19

2.3.2.2 Application of Agrobacterium to prepared NLL explants 19

2.3.3. Culture media 20

2.4. Plant tissue fixation and sectioning 20

vi

2.5. Analysis of reporter gene expression 20

2.5.1. GUS assay 20

2.5.2. GFP imaging 21

Chapter 3. Developmental competence for narrow leafed lupin regeneration

23

3.1. Introduction 23

3.2. Materials and methods 25

3.3. Results 26

3.3.1. Narrow leafed lupin shoot apical meristem 26

3.3.2. In vitro morphogenesis of wounded shoot apical meristems 27

3.4. Discussion 29

3.4.1. Narrow leafed lupin shoot apical meristem structure 29

3.4.2. Wounding methods and the fate of the cell in apical meristem 31

Chapter 4. Hygromycin as an alternative selection marker for Narrow leafed lupin transformation

35



4.2.1. Transformation materials 37

4.2.2. Hygromycin selection concentration 38

4.2.4. Reporter gene and statistical analysis 39

4.3. Results 40

4.3.1. Hygromycin selection concentration 40

4.3.2. Screening putative transformed NLL shoots using hygromycin 41

4.3.3. Effect of hygromycin versus PPT on NLL shoots 42

4.3.4. GUS activity of putative transgenic shoots and location of transgenic cells

46

4.3.5. Wounding method 47

4.4. Discussion 47

Chapter 5. GFP sheds light on narrow leafed lupin transformation 51



5.2.1. Vector constructs 53

vii

5.2.2. Plant materials 54

5.2.3. Plant tissue fixation, sectioning and imaging 55

5.3. Results 55

5.3.1. Preliminary transformation with pH35 55

5.3.2. Broad and deeper wounding method 57

5.3.3. Chimerism in transgenic shoots 59

5.4. Discussion 61

Chapter 6. Towards improved methodology for high-throughput transformation in pulse legumes

65



6.2.1. Transformation procedure 66

6.2.2. Sub-culture media and selection protocol 67

6.3. Results 67

6.3.1. Selection methodology in combination with broad and deep wounding method enhanced the transformation efficiency

67

6.3.2. Subculture propagation to reduce chimerism of transformed shoots 68

6.3.3. Preliminary observations with other pulse legumes 71

6.4. Discussion 71

Chapter 7. General discussion 77

7.1. Novel achievements 77

7.2. Concluding remarks and future directions 81

References 83

Appendices 95

Appendix I 95

Appendix II 96

Appendix III 97

Appendix IV 98

Appendix V 109

viii

ACKNOWLEDGEMENTS

This research was supported by the Australian Award funded by Australian Government, and

financial support fom School of Plant Biology, UWA

I would like to acknowledge the enormous support and guidance of my supervisors Dr Susan J.

Barker and Dr. William Erskine, which has proved invaluable throughout my PhD. My deep and

sincere gratitude is to Susan and Willie for their technical support, excellent advice, precious

comments and constructive criticism for building up my scientific view.

I highly appreciate the HTL project team (GRDC grant UWA00129 Erskine and Barker) including

Mr Leon Hodgson, Dr Dumindi Dalugoda, Ms Priya Krishnamurthy, Dr Yuphin Khentry, Dr Margo

Ferguson-Hunt and Dr Moti Quader for their hand guiding me and sharing knowledge of legume

and tobacco transformation and tissue culture techniques and molecular skills.

I also acknowledge support of past and present members and the facilities of Centre for Plant

Genetics and Breeding, School of Agriculture and Environment, The University of Western

Australia (UWA), the facilities of CELLCentral, School of Human Sciences, UWA and the facilities,

scientific and technical assistance of the Australian Microscopy and Microanalysis Research

Facility at the Centre for Microscopy, Characterisation and Analysis (CMCA), UWA, a facility

funded by the University, State and Commonwealth Governments.

I would like to express my sincere gratitude to Professor Kadambot Siddique (The UWA Institute

of Agriculture) for his support and for assisting me to be accepted to the UWA PhD program. I

sincerely thank Dr Mark Waters (School of Molecular Sciences, UWA) for kindness in sharing the

Gateway vectors. I also value the time Ms Uda Karabawe Gedara, Mr Stuart McWhinney, Mr

Francis Nge and Mr Kien Do volunteered for the project. I highly appreciate Mr Cahya Prihatna

for his supports in sharing knowledge and laboratory techniques.

Finally, I greatly acknowledge the personal and emotional support from my family.

ix

AUTHORSHIP DECLARATION: CO-AUTHORED PUBLICATIONS

This thesis contains work that has been published.

Details of the work:

Nguyen, A. H., Wijayanto, T., Erskine, W., and Barker, S. J. (2016). Using Green Fluorescent

Protein sheds light on Lupinus angustifolius L. transgenic shoot development. Plant Cell,

Tissue and Organ Culture (PCTOC), 127(3), pp. 665-674.

Location in thesis:

Chapter 4,5

Student contribution to work:

Project design, vector construct, molecular works, transformation experiments, plant

tissue culture, cryostat sectioning, microscopy imaging, data analysis, figure and

manuscript preparation

Co-author signatures and dates:

12/06/2017

6 June 2017

1 July 2017

x


Nguyen, A. H., Hodgson, L. M., Erskine, W., and Barker, S. J. (2016). An approach to

overcoming regeneration recalcitrance in genetic transformation of lupins and other

legumes. Plant Cell, Tissue and Organ Culture (PCTOC), 127(3), pp.623-635.

Location in thesis:

Chapter 3, 5, 6






6 June 2017

1 July 2017

xi


Nguyen, A. H., Hodgson, L. M., Wijayanto, T., Erskine, W., and Barker, S. J. (2017). A

breakthrough in legume genetic transformation and implications. In: Grains Research

Update, Perth, 27-28 February 2017. Grain Research and Development Corporation.

Location in thesis:

All Chapters






12/06/2017

6 June 2017

1 July 2017

xii

Student signature:

Date: 27/06/2017

I, William Erskine, certify that the student statements regarding their contribution to each

of the works listed above are correct

Coordinating supervisor signature:

Date: 1 July 2017

xiii

LIST OF ABBREVIATIONS

CAMBIA Center for the Application of Molecular Biology to International

Agriculture

Cc Co-cultivation medium

CMC Central Mother Cell

CZ Central zone

DNA Deoxyribonucleic acid

EDTA Ethylene Diamine Triacetic Acid

eGFP Enhanced green fluorescent protein

GFP Green fluorescent protein

GM Genetic manipulation

GUS ß-glucuronidase

LB

MPH

Luria Broth

Micropropagation medium with hygromycin

MS

NLL

Murashige and Skoog salts

Narrow leafed lupin

PCR Polymerase chain reaction

PPT Phosphinothricin

PZ Peripheral zone

Rg Regeneration medium

RZ Rib zone

SAM Shoot apical meristem

SDS Sodium dodecyl sulphate

SOC Super Optimal broth with Catabolite repression

T0 Initial generation of transgenic shoot

T1 Progeny of T0 generation

TAE Tris-acetate

xiv

THESIS OUTLINE

The thesis contains eight chapters. Chapter 1 is a General Introduction that reviews

background information in legumes transformation, especially focussed on narrow leafed

lupin, leading to the main aim of the thesis. Chapter 2 describes general materials and

methods that have been commonly applied within this work to avoid repetitions in

individual subsequent chapters, while specific materials and methods for certain

experiments were included in the result chapters. Four subsequent chapters (Chapter 3 to

Chapter 6) report and discuss the results that were achieved from experiments, telling the

story of the project. The content of the two research publications and the conference

technical report (page viii) are distributed through these four Chapters. Chapter 7 gives a

general discussion of major findings in the thesis and their implications for future

research. References (Chapter 8) provides a complete list of citation literature mentioned

in the thesis. Finally, Appendices deliver additional information from this study.

1

CHAPTER 1

GENERAL INTRODUCTION

1.1. Introduction

Australian production of lupins accounts for about 85% of world lupin production,

making Australia the world’s leading lupin producer and the only country in the world

that exports lupin seeds, of which around 80% are narrow leafed lupin (NLL Lupinus

angustifolius L.) (Lawrance 2007; ABARES 2012; Wolko et al. 2011). The adaptation of

NLL to the sandy and acidic soils prevalent in Western Australia has resulted in it

becoming the principal grain legume crop of the state, making the state the center of lupin

production, contributing 80% of national lupin production (Keogh et al. 2010). Although,

the area of NLL has decreased sharply recently, it remains the predominant legume field

crop in Western Australia (ABARES 2014).

In common with other legumes, NLL seeds are rich in protein content, which ranges from

30% to 35% of the whole seed and about 40% of the kernel (Wolko et al. 2011;

Kaczmarek et al. 2014). This high protein content makes NLL valuable as livestock feed,

especially for ruminants. Additionally, recent research into nutrition of NLL seed

discovered that consumption of Australian sweet lupin has some unique health benefits

of value to humans. It has a high dietary fibre content (30%), low fat (6%) (Kaczmarek

et al. 2014), is gluten free, and is relatively low in alkaloid content (Wolko et al. 2011),

has no cholesterol and an especially low glycaemic index, making NLL seeds a healthier

food than soybeans, which have been used for more than 2000 years as the main protein

source for Buddhist monks in Eastern Asia (Burstin et al. 2011; Martin et al. 2013).

2

Consequently, from the nutritional viewpoint, NLL now is a highly desirable substitute

source of dietary animal proteins for humans.

Additionally, NLL has the ability of biological nitrogen fixation in association with

rhizobial bacteria, in common with other legumes, so it plays an important role in soil

improvement. A study on nitrogen fixed per hectare reported that among principal crop

legumes lupins were the second-most effective in nitrogen fixation, surpassed only by

soybeans (Unkovich and Pate 2000; Wolko et al. 2011). NLL was able to fix about 200

kg N ha-1 per annum (Pálmason et al. 1992). Furthermore, NLL also contributes to

disease, weed and pest breaks in intercropping systems (Graham and Vance 2003; Lewis

2005; Wijayanto 2006).

The three major constraints to Australian sweet lupin production are weeds, diseases and

pests, which directly affect yield (Atif et al. 2013). Although traditional breeding efforts

can produce new NLL varieties that resist these problems, it costs considerable time and

effort to develop a successful cultivar. Furthermore, due to their self-pollinating habit

under most circumstances, as with many other legumes, NLL grown for cropping does

not accumulate natural variation for biotic and abiotic stresses (Atif et al. 2013; Graham

and Vance 2003; Sinclair and Vadez 2012; Chandra and Pental 2003).

Plant transformation mediated via Agrobacterium has become a powerful experimental

tool in biotechnology. Application of transformation in plant biotechnology not only

enables generation of new phenotypic variations such as resistance to diseases and

herbicide, tolerance to severe environmental factors for higher quality and yield of crops,

but also contributes to an understanding of gene function. In the NLL crop improvement

landscape, genetic transformation clearly has a major role to play.

Chapter 1: General introduction

3

1.2. Genetic manipulation in narrow leafed lupin

The genomics era is now progressing in legumes as in many other crops, although they

are regarded as recalcitrant to transformation. An example of a successful transgenic

legume is Roundup Ready® (RR) soybean, incorporating glyphosate tolerance, which

has been sown commercially since 1996. RR soybean dominates the soy market and

accounts for about 85-90% in the United States, 83% in Brazil, 100 % in Argentina and

around 75% global soy production (Du Bois and Tan 2008; Bøhn et al. 2014). The

accumulated area of transgenic soybean accounted for around 1 billion hectares,

representing 50% of the commercialization of biotech crops in over 20 years (James

2015). As this example shows, transformation can be a successful approach to improve

legumes in general and should be applicable to NLL in particular. While the main

constraint of NLL is weeds, the commercial cultivars are susceptible to herbicide that has

been used widely to control dicotyledonous weeds and genetic tolerance to these

herbicides does not occur in the available NLL gene pool. Therefore, if NLL production

is to be continued in the current cropping regimes, supplementing the genetic characters

by transformation is necessary (Tabe and Molvig 2007, SJ Barker, personal

communication).

From the mid-1990s, NLL transformation was achieved via mediator Agrobacterium

tumefaciens (Pigeaire et al. 1997, Molvig et al. 1997). Since then genetic manipulation

technology has had potential application in NLL towards herbicide tolerance (Pigeaire et

al. 1997; Barker et al. 2016), disease resistance (Wijayanto et al. 2009), seed protein

quality and content improvement (Molvig et al., 1997) and pod set and productivity

enhancement (Atkins et al. 2011).

In the early stage of NLL transformation, two independent groups demonstrated the

feasibility of using genetic engineering to improve the nutritive value of the L.

4

angustifolius grain crop and developed a protocol for producing transgenic NLL. Both

studies applied the same reporter marker (GUS) and herbicide phosphinothricin (PPT)

selectable marker (bar gene). Transformation efficiencies were assessed as the percent of

surviving explants following growth on PPT selection media. Transformation efficiency

from one group was relatively low (0.01%) (Molvig et al. 1997). Methodology described

by Pigeaire et al. (1997) resulted in a higher transformation efficiency (0.4 - 2.8%) and

therefore was subsequently applied by other researchers.

Following the methodology of Pigeaire et al. (1997), a significant reduction of fungal

disease symptoms in transgenic NLL was achieved (Wijayanto et al. 2009). A binary

vector containing both the baculovirus anti-apoptotic p35 and bar genes was used for

Agrobacterium tumefaciens-mediated gene transfer to NLL cultivar Unicrop seedlings.

Fourteen transgenic independent NLL lines were obtained (p35-NLL). Modifications of

tissue culture media and the rooting step enhanced the transformation efficiency to 3.3%

overall (Wijayanto 2006).

To enhance fruit formation and grain yield, the isopentenyl pyrophosphate transferase

(ipt) gene was transferred to NLL (Atkins et al. 2011). Cytokinin level increase in various

organs resulted in improvement of pod set, but there was no significant increase in the

grain size compared to the control and no reported improvement in transformation

efficiency (Atkins et al. 2011).

In other approaches to investigate alternative genetic manipulation procedures for NLL,

Ratanasanobon (2014) examined direct gene transfer and Agrobacterium-mediated floral

dip methods (successful in Arabidopsis), in comparison with the wounded shoot dome

method developed by Pigeaire et al. (1997). That research demonstrated that the closed

structure of the NLL flower is a hindrance to the floral dip method. The author’s

conclusion was that the Agrobacterium-mediated transformation developed by Pigeaire


5

et al. (1997) is the most successful for transformation of NLL (Ratanasanobon 2014).

1.3. Major issues for NLL transformation and approaches

to improve its efficiency

Although efficient meristem transformation protocols have been developed for a number

of legume species and NLL in particular, the success rates are relatively low and

unpredictable, with operator -to-operator variation (Pigeaire et al. 1997; Akcay et al.

2009; Saini and Jaiwal 2005; Jube and Borthakur 2009; Eapen 2008; Yamada et al. 2012;

Anwar, F. et al. 2011; Somers et al. 2003). Moreover, the initial transformation event is

chimeric, thus more than the expected Mendelian ratio (25%) of progeny seeds are not

transgenic, which lowers the efficiency of the process even further (Somers et al. 2003;

Wijayanto 2006). Difficulties with legume transformation derive from totipotent cell

culture ability and co-cultivation conditions, which relate to the efficient regeneration of

transgenic cells (Eapen 2008; Somers et al. 2003; Sugimoto et al. 2011; Atif et al. 2013).

1.3.1 Totipotent cells in transformation and regeneration

The three essential components of transformation methods are: (a) a source of totipotent

cells for transformation to ensure regeneration, (b) a suitable method for DNA transfer,

and (c) a screening system for transgenic materials (Somers et al. 2003; Carlos Popelka

et al. 2004). Among these, targeting the tissue that is competent to transform and

regenerate is the most challenging.

In tobacco, the model plant for tissue culture research, explants grow readily from leaf

cells in tissue culture conditions. However, as for other legumes, regeneration of NLL in

tissue culture is considered challenging (Tabe and Molvig 2007). In fact, transformation

of most plants is challenging compared to transformation of tobacco, and research to

6

transform all other plant species has required amendment from the original tobacco

transformation methodologies. With other species or tissues in culture, different pathways

of development of new plants are involved, for example, de novo organogenesis from

callus, somatic embryogenesis and proliferation of the meristem (Somers et al. 2003;

Chandra and Pental 2003; Eapen 2008). Because the regeneration via organogenesis

pathway and embryoids in many species of legumes is difficult to achieve, meristematic

areas are preferred as sources of totipotent cells for most legume regeneration (Somers et

al. 2003; Eapen 2008; Pigeaire et al. 1997; Akcay et al. 2009; Pierik 1999).

Whilst methods of gene modification via Agrobacterium which have a high frequency of

success in other plants such as floral dip and protoplast methods are not efficacious in

many legumes (Pigeaire et al. 1997; Somers et al. 2003; Atif et al. 2013; Ratanasanobon

2014), hypocotyl transformation has been developed and successfully applied to produce

transgenic legume crops and also Australian sweet lupin (Somers et al. 2003; Atif et al.

2013; Tabe and Molvig 2007; Pigeaire et al. 1997; Eapen 2008; Paz et al. 2006; Kartha

et al. 1981; Yamada et al. 2012). As reported for NLL transformation, the most widely

used and efficient method for plantlet regeneration is direct shoot organogenesis from the

shoot apical meristem (SAM) of seedlings (Pigeaire et al. 1997; Tabe and Molvig 2007;

Wijayanto et al. 2009). The basic principle of this transformation method is to

mechanically pre-wound seedling meristems to enhance subsequent bacterial

transformation. Transgenic shoots regenerate directly from transformed meristem tissue

or totipotent cells existing in the original explant (Somers et al. 2003; Atif et al. 2013;

Pigeaire et al. 1997; Eapen 2008; Paz et al. 2006; Kartha et al. 1981; Yamada et al. 2012;

Tabe and Molvig 2007). However, none of these research programs examined in detail

the source location of the regenerating cells.

One reason for poor efficiency of SAM plant transformation methods may come from the

technical difficulty of localizing and distinguishing the meristem cells that contribute to


7

formation of new transgenic shoots. Another difficulty is that the SAM can rebuild the

meristematic region after being wounded or sliced, showing the plasticity of the

meristematic region (Sticklen and Oraby 2005). While testing two wounding methods for

Lupinus mutabilis transformation, Babaoglu et al. (2000) discovered that removing the

extreme tip of the apical dome including all leaf primordia using a scalpel, enhanced

transformation efficiency. Similarly, in an unpublished report, Wijayanto suggested that

the wounding method in NLL transformation affected the development of the wounded

shoot. The report showed that transformation efficiency was highest (25%) when the

operator wounded the SAM by stabbing 10-15 times with a smaller needle than had been

previously used (Wijayanto, Barker, Erskine and others, unpublished observations). This

was a remarkable discovery that needed further detailed investigation to demonstrate that

it should be applied in NLL transformation. It was proposed that a research project to

examine the nature of these results combined with an understanding of the structure of

the NLL SAM would provide significant information to enhance NLL transformation.

1.3.2. Chimerism in putative transgenic plants

Chimerism in NLL transformation was discussed by Pigeaire et al. (1997) and Wijayanto

(2006) as a major issue that resulted in poor transmission of the transgene from first

transgenic plant generation (T0) to progeny (T1). Transformation had been visualised

using reporter gene expression in epidermis, cortex or vascular bundles of transgenic

plants (Wijayanto 2006). Vascular tissue is involved in the formation of lateral shoots

(Grbic and Bleecker 2000), suggesting that the recovery of more axillary shoots with

transgenic content would improve overall transformation success (Mordhorst et al. 2002;

Wijayanto 2006).

Adventitious shoot development has been applied in sub-culturing putative transformed

shoots to overcome chimerism in transformation including strawberry (Mathews et al.,

8

1995), tobacco (Maliga and Nixon 1998), Lesquerella fendleri (Chen 2011) and coffee

(Mishra and Slater 2012). According to Chen (2011) the chimera rate of Lesquerella

fendleri transformation dropped from around 80% to 2% after four rounds of successive

regeneration. Hence a reduction in chimerism and optimization of plant transformation

through an efficient regeneration protocol is a promising approach for transformation of

“recalcitrant” plants.

1.3.3. Selection methodology

Genetic manipulation in plants usually requires marker genes for rapid and efficient

screening and selection. When the putative transgenic shoots obtained are non-transgenic

or chimeric as with NLL, a possible means of improvement is to focus on the selection

methodology.

In plant transformation, the most commonly employed selection agents are antibiotic or

herbicidal (Eapen 2008), which is categorized as negative selection. Selectable marker

genes widely used in legume transformation are nptII gene (encoding neomycin

phosphotransferase II) which confers kanamycin resistance (Atif et al. 2013), and bar

gene (encoding phosphinothricin acetyltransferase), which imparts tolerance to

herbicides such as bialaphos (a natural broad-spectrum herbicide) and glufosinate-

ammonium (manufactured non-selective contact and systemic herbicide) (Nguyen 2002;

Pigeaire et al. 1997, Ujváry 2010). Recently, the hpt gene (encoding hypoxanthine

(Guanine) phosphoribosyltransferase) has been introduced into soybean transformation

allowing the use of the antibiotic hygromycin B in selection media (Sauer and Nygaard

1999; Olhoft et al. 2003). By using hygromycin B, an efficient selection system that

rapidly selects transgenic shoots and reduces selection escape frequency was developed.

Lulsdorf et al. (1991) compared the effectiveness of kanamycin and hygromycin as

selective agents in Pisum sativum transformation by showing that a higher percentage of


9

transformed calli grew in hygromycin media than in kanamycin media. This result is

consistent with the work of Schmidt and Willmitzer (1988) in transformation of

Arabidopsis thaliana leaf and cotyledon explants.

In NLL transformation, PPT resistance was the main selection method applied (Pigeaire

et al. 1997; Ratanasanobon 2014; Wijayanto et al. 2009; Atkins et al. 2011; Molvig et al.

1997). However, low frequency and chimerism are nevertheless limitations of NLL

transformation. PPT is a non-selective postemergence contact chemical (Ujváry 2010),

meaning it kill the contacted plant cells only, that may lead to nontransgenic or chimeric

plants that escaped the selection. Barker et al. 2016 examined glyphosate resistance

(systemic herbicide) transformation recently, but did not improve transformation

efficiency.

A negative selection approach is expeditious as it rapidly eliminates unsuccessful events

from the transformation procedure and only selects genetically modified individuals

(Miki and McHugh 2004). However, aside from possible lack of public acceptance of the

added antibiotic resistant or herbicide tolerant trait in a commercial crop, from a

transformation efficiency perspective there is also the potential issue that the dead cells

surrounding transgenic ones may reduce the capacity of the transformed cells to develop

into shoots. Dying cells which are killed by the selective agent may release toxic

substances or block nutrient uptake in a way that impairs regeneration of the transformed

cells. Therefore, some explants that are chimeric might be eliminated during the selection

process (Joersbo and Okkels 1996).

Another approach to optimize plant transformation is through the direct visual

observation of gene expression using reporter genes for the transformation process. By

observing the colour of transgenic cells via reporter systems, the analysis of gene activity

has been simplified, saving time, and the gene expression can be easily quantified in vitro

10

or by real-time imaging in planta (de Ruijter et al. 2003). The detailed analysis of the

expression pattern of a plant gene allows examination of the developmental process of

the transformation, enabling more targeted transformation procedures, cell differentiation

and proliferation (Rakosy-Tican et al. 2007). Reporter genes allow the visual detection of

transformed tissue, therefore confirm transgenic status of plants and the detection of

escape events.

The most commonly used reporter genes in plant transformation are ß-glucuronidase or

colorimetric (GUS), firefly luciferase (ff-LUC) and green fluorescent protein (GFP) (de

Ruijter et al. 2003). The drawback of the ff-LUC is that its measurement needs to be

performed in darkness and depends on three different substrates (luciferin, ATP and O2),

thus in planta LUC activity analysis may interfere with plant physiology activities (de

Ruijter et al. 2003; Quaedvlieg et al. 1998). The GUS gene has been the main reporter

gene used in legume genetic modification, including NLL (Atif et al. 2013). ß-

glucuronidase is an enzyme that catalyses hydrolysis of a wide variety of ß-glucuronides

and ß-galacturonides (de Ruijter et al. 2003). The indoxyl derivative produced from

hydrolysis activity of GUS enzyme is detected through extremely sensitive histochemical

assays (Jefferson et al. 1987). The simplicity of the colorimetric assay has made the GUS

gene the most practical marker for localizing the activity of genes in plants (de Ruijter et

al. 2003). The gene has been cloned into a binary vector together with a selectable marker

to improve transformation efficiencies for example with Lesquerella fendleri

transformation (Chen 2011) and peanut (Tiwari and Tuli 2012). Although the GUS

reporter gene is a highly useful tool to visualise gene expression in transgenic plants, its

observation is through a destructive assay (Jefferson et al. 1987; Atif et al. 2013), which

is a disadvantage for further analysis.

In contrast to other reporter genes that rely on substrate for colour staining, green

fluorescent protein (GFP) has shown exceptional promise. The assay involving


11

illumination by UV light excitation has enabled manual selection of transgenic tissues

prior to application of selective agents (de Ruijter et al. 2003). GFP visualisation has the

advantage of being both highly sensitive and easy to quantify. The capability of real-time

visualization in living tissue makes GFP valuable as a non-destructive marker for further

gene activity analysis (Stewart Jr 2001; Miki and McHugh 2004). It has proven to be a

powerful tool in plant genetic transformation studies that has contributed to enhanced

transformation efficiency in various crops (Duan et al. 2012; Pérez-Clemente et al. 2005;

Xiao et al. 2010; Chudakov et al. 2010), with identification of transgenic events at early

stages of transformation (Stewart Jr 2001; Millwood et al. 2010), thus reducing the

number of escape events and chimerism (de Ruijter et al. 2003).

First introduced by Joersbo and Okkels (1996), applying positive selectable marker genes

is another approach to improve the genetic manipulation process. The principle of the

positive selection system is use of a conjugate that will be converted from the inactive

form to an active form for plant development by transgenic cells, therefore promoting the

growth of successful transformation events and preventing the proliferation of

untransformed cells. Consequently, this method can potentially eradicate chimerism in

transformation without causing a large number of cells to die. Danisco Biotechnology,

Copenhagen, Denmark (Joersbo and Okkels 1996) and Center for the Application of

Molecular Biology to International Agriculture (CAMBIA), Black Mountain, Australia

attempted to develop positive selection systems for plant transformations by using the

GUS reporter gene as a selectable marker. The former group examined the use of benzyl-

adenine N-3-glucuronide as the inactive cytokinin (Joersbo and Okkels 1996), while the

latter group trialled disaccharide cellobiouronic acid (CbA) as the inactive carbon source

(Jefferson 2001). These substrates are hydrolysed by different GUS enzymes in

transformed cells to release active forms for plant regenerations. However, these two

approaches are rarely applied in plant genetic modification, perhaps because substrate

12

availability is limited or expensive or the selection technology was not sufficiently

effective to proceed with (RA Jefferson personal communication). Therefore, by default,

using a negative selectable marker remains the approach of choice in transformation.

1.4. Aims and Approaches

Widening the NLL genome via Agrobacterium-mediated shoot apical meristem (SAM)

transformation is to this point the most applicable method. The main advantage of the

SAM for plant transformation is that it contains a pool of stem cells, thus it can be

hypothesised that transgenic cells from SAM would maintain meristematic function and

can be rapidly regenerated to a shoot. Despite having over 15 years of research input,

NLL transformation still has low success rates that cost time and energy. The limitation

of understanding the localization and early differentiation of transformed explants led to

the aims of this thesis. It is hypothesised that i. Understanding early differentiation in

legume shoot apical meristem will enable methodological improvements to enhance the

efficiency of legume transformation, ii. Normal shoot development and transgenic shoots

emerge from multiple cells in the Central Mother Cell (CMC) zone of the shoot apical

meristem and iii. The chimeric structure of transgenic shoots is due to the biochemistry

of selection methodology. Experiments conducted in this study aim to answer the

following questions:

1. Does the development of shoots from the wounded meristem normally involve a

multi-cellular origin?

2. Does the choice of a contact herbicide as the selectable marker trait predispose

the transgenic shoots to be chimeric by maintaining the normal developmental

pathway?

3. Which meristematic cells are the most susceptible to Agrobacterium tumefaciens

mediated transformation?

4. Can the efficiency of generating transformed shoots that pass the gene to the next

generation be improved by more specific targeting of the region of the apical

meristem that is wounded?

13

CHAPTER 2

GENERAL MATERIALS AND METHODS

2.1. Plasmid constructs

2.1.1. pCAMBIA vectors

Two pCAMBIA vectors were sourced from the Center for the Application of Molecular

Biology to International Agriculture (CAMBIA), Black Mountain, Australia. Both

vectors utilized kanamycin resistance selection in bacteria and included a plant-expressed

β-glucuronidase (GUS) reporter gene. The GUS reporter gene in pCAMBIA 3301 was

uidA (Arul et al. 2008), while pCAMBIA-1305.2 carried the hygromycin resistance gene

(HygR) and the GusPlusTM version (Nguyen 2002) of this reporter gene. The GusPlusTM

gene is fused to a sequence encoding a glycine rich protein secretion signal peptide. As a

result, in the histochemical assay, the β-glucuronidase (GUS) enzyme will be activated

in the periplasmic (or apoplastic) space. This allows non-destructive in vivo staining and

analysis of living whole plants. The GUS positive transgenic plants therefore are able to

be grown further after GUS assay (Nguyen 2002).

2.1.2. Gateway vectors

Two GFP expression vectors (pH35 and pB35) from Gateway contained a GFP-GUS

fusion with plant expression and spectinomycin/streptomycin resistance (Sm/SpR) for

bacterial transformation (Karami et al. 2009).

The vector pH35 was constructed from Gateway promoter-reporter vector pHGWFS7

http://en.wikipedia.org/wiki/%CE%92-glucuronidase

14

with hygromycin resistance gene (HygR) for plant transformation. The GFP and GUS-

encoding genes in this vector were reported to be expressed in Arabidopsis thaliana if

functional promoters were inserted (Wiszniewski 2011; Cai 2014). In this study, the

CaMV35S eukaryotic promoter with duplicated enhancer region (35Sx2) was amplified

from pCAMBIA 1305.2 and cloned into pHGWFS7 to control GFP and GUS expression

in plants.

The construct pB35 was made by subcloning the bar gene from pCAMBIA 3301 into

pH35 at MauBI and XbaI restriction sites to replace the HygR gene. This construct was

used to test bar gene selection in comparison with the new hygromycin construct pH35.

2.1.3. Drawing of plasmid maps

Plasmid maps were created by SnapGene® and modified by Adobe Illustrator. The

circular maps of all plasmids are presented in Appendix I.

2.2. Molecular methods

2.2.1. Polymerase chain reaction (PCR)

A typical PCR mix (15 µl) consisted of 1 unit of Taq DNA polymerase (Bioline

MyTaqTM), 1 x compatible buffer, 0.5 μM primers and 2 μl DNA. Primer sequences are

listed in Appendix II. Thermocycler (Eppendorf) incubation cycles followed general

conditions: 94 oC for 5 min; 35 cycles of 94 oC for 15 s, Tm for 15 s, 72 oC for 60 s;

72 oC for 10 min, hold at 15 oC.

Chapter 2: General materials and methods

15

2.2.2. Agarose Gel Electrophoresis

Gel electrophoresis was performed by mixing agarose powder 0.8-1% in TAE buffer

(Tris base 40 mM, EDTA 2 mM, Acetic acid 20 mM) with ethidium bromide (0.2 μg mL-1)

for DNA visualisation.

2.2.3. Restriction cloning

Restriction enzyme digestion of donor and recipient plasmids was performed at 37 oC for

1 hour, following New England Biolabs restriction digest protocol. The insert DNA was

separated and cut from agarose TAE gels. DNA purifications of insert and recipient

plasmid backbone were achieved using Wizard® SV Gel and PCR Clean-Up System

(Promega). Nano drop 1000 Spectrophotometer (NanoDrop Technologies, Wilmington,

DE, USA) was used to quantify the recovered DNA. Ligation reactions with ratio of

recipient plasmid to insert of approximately 1:3 were incubated overnight at room

temperature in a 20 µl volume consisting of 100 ng DNA, 1 unit of T4 DNA ligase, 1 x

Ligation Buffer (Promega).

2.2.4. Gateway cloning

CaMV35S eukaryotic promoter with duplicated enhancer region (35Sx2) was amplified

from pCambia 1305.2 by PCR with designed primers that included attB sites for Gateway

cloning. PCR product was cut from the agarose TAE gel, purified by using Wizard® SV

Gel and PCR Clean-Up System (Promega) and cloned into pHGWFS7 following protocol

1 in the Single step Gateway reaction (Liang et al. 2013). The recombination reaction was

performed at room temperature for 3 h in a 200 µl tube containing 200 ng attB-PCR

fragment, 300 ng Donor vector (pDONR221), 600 ng Destination vector and 2 μl of LR

Clonase II enzyme mix. The reaction was terminated by adding Proteinase K solution to

16

the sample and incubating at 37 °C for 10 min.

2.2.5. Transformation of Escherichia coli competent cells

The Gateway cloning solution (Section 2.2.4) was transferred to chemically competent

NEB® 5-alpha Competent E. coli (High Efficiency). The E. coli competent cells mixed

with 5 μL cloning solution were incubated for 30 min on ice, heat shocked at 42 °C in a

water bath for 30 s, then placed on ice for 5 min as described in the NEB high efficiency

transformation protocol. The mixture was added to 950 μL Super Optimal broth with

Catabolite repression (SOC) (Outgrowth medium supplied with NEB® 5-alpha

Competent E. coli) and rotated at 37 °C for 1 hour to enable cell recovery and the

expression of antibiotic resistance. Cells were collected by centrifugation at 5,000 rpm

for 2 min then re-suspended in SOC medium and spread on a Luria-Bertani (LB) agar

plate (Appendix III) supplemented with an appropriate antibiotic for overnight incubation

at 37 oC. Colony PCR to rapidly screen for insert-containing (positive) colonies was

performed the next day using a specific primer pair.

2.2.6. Transformation of Agrobacterium cells

NLL transformation experiments were carried out using the Agrobacterium tumefaciens

strain AGL0 (Lazo et al. 1991), as this strain was found the most efficient for NLL

transformation (Pigeaire et al. 1997). AGL0 competent cells were prepared from AGL0

control lacking T-DNA in Ti plasmid (Kiyokawa et al. 2009). Competent cells were

achieved by growing a single colony of this bacterium overnight in 20 ml of LB medium

supplemented with 150 μg mL-1 rifampicin (Wiszniewski 2011; Holsters et al. 1978).

Cultures were chilled on ice for 15 min, then the cells were collected by centrifugation at

5,000 rpm for 10 min at 4 °C. Cell resuspension with 20 ml of ice cold 20 mM CaCl2 was

followed by incubation on ice for 30 min. Centrifugation for 10 min at 4 °C was applied


17

to harvest the cells. This pellet was then re-suspended in 1 ml ice cold 20 mM CaCl2 and

held on ice for plasmid transformation.

The freeze thaw transformation method (Holsters et al. 1978) was applied for the

transformation of A. tumefaciens. A mixture of 200 μL freshly competent Agrobacterium

and 1 μg of a binary vector was kept on ice for 5 min, then frozen in liquid nitrogen for

10 min and thawed in a water bath at 37 °C for 5 min. To the mixture was added 800 μl

of SOC medium without antibiotics, and the mix was incubated at 28 °C for 3 to 4 h in a

rotating mixer. Centrifugation at 5,000 rpm for 2 min was performed to collect the cells.

The pellet was re-suspended in 100 μL of SOC medium, then spread on an LB agar plate

with selective antibiotic for plasmid and incubated 28 oC for 48 to 72 h. Positive colonies

were detected by colony PCR with the specific primer pair for the desired insert.

2.2.7. Isolate plasmid DNA from the bacterial cells

Plasmids were purified by the alkaline lysis plasmid miniprep protocol (Sambrook et al.

1989). Bacterial cells were collected from overnight culture by centrifugation at

maximum speed for 5 min. The cells were re-suspended in resuspension buffer (25 mM

Tris-HCl (pH 8), 50 mM glucose, 10 mM EDTA), then lysed in denaturing solution (0.2

N NaOH, 1.0% SDS). The plasmid was separated from precipitated proteins, genomic

DNA and cellular debris by adding renaturing solution (3M potassium acetate, 11.5%

glacial acetic acid) to the mixture and centrifuging at high speed for 10 min. Supernatant

containing plasmid DNA was transferred to a new tube and run through a DNA binding

column (Wizard® SV Minicolumns Promega). The column with bound plasmid DNA

was washed with 70% ethanol to remove excess salt, then allowed to air dry at room

temperature in a laminar flow hood for 15-30 min. The plasmid DNA was recovered from

the column with Nuclease-Free Water supplied with the Wizard® SV Gel and PCR

Clean-Up System (Promega).

18

2.2.8. DNA sequencing

DNA sequencing was undertaken by the Australian Genome Research Facility (AGRF)

(http://www.agrf.org.au). Sequences were analysed using Nucleotide Basic Local

Alignment Search Tool (BLAST) (National Center for Biotechnology Information, USA)

(https://blast.ncbi.nlm.nih.gov/Blast.cgi) and Pairwise Sequence Alignment

(NUCLEOTIDE) tool from The European Bioinformatics Institute (EMBL-EBI)

(http://www.ebi.ac.uk/Tools/psa/emboss_needle/nucleotide.html).

2.3. Plant transformation protocol

2.3.1. Plant materials

Mature seeds of NLL, cultivar Mandelup, were used for this project. Seedlings were

prepared for transformation following the method described by Pigeaire et al. (1997) and

modified by Wijayanto (2006).

Explant preparation for transformation took place one day prior to the experiment. The

germination rate determined the number of seeds to be prepared for a given number of

explants, so approximately 120 seeds were appropriate for achieving 100 treated

seedlings and controls. Surface sterilised Mandelup NLL seeds were transferred into 10

x 1.5 cm petri dishes on autoclaved filter papers (20 seeds per dish). Sterile Milli Q water

(8 ml) was added to each petri dish. The dishes were then sealed with clear plastic wrap

and placed in the dark in a growth room, overnight.

To perform the transformation, first the seedling apices were exposed by pressing down

the cotyledons and young foliage leaves (usually two) until they detached. The shoot axis

was carefully separated from the two halves of the cotyledons, after the germinated seed

coat was removed. The separation of the shoot was best achieved when the germinated


19

root was approximately 2 to 10 mm long. By removing the two pairs of leaves present in

the plumule, the apical dome and primordia of the third pair of leaves became visible

under stereomicroscope examination. The apical dome region was stabbed 10 to 12 times

with a needle prior to application of the A. tumefaciens. The explants then were

transferred to co-cultivation medium (25 explants per plate) and left covered for the next

step in transformation (2.3.2.2). Specific details of the wounding and co-cultivation steps

are provided in subsequent chapters.

2.3.2. Agrobacterium-mediated transformation

2.3.2.1 Preparation of bacteria

A. tumefaciens strain AGL0 negative control and the strain containing the desired vector

were transferred from a glycerol stock stored at minus 80 oC, streaked onto LB agar

medium plates and incubated for 2 days at 28 oC. These plates were kept at 4 oC for 2

weeks. One day before transformation, a colony of bacteria from the plate was grown

overnight at 28 oC in 10 ml of agitated liquid LB medium (Appendix III) supplemented

with appropriate antibiotic. The following morning a fresh culture was made from the

overnight culture, starting with a 1/10 dilution, and shaken until the bacterial culture

density reached the optimum biomass (optical density at 550 nm of 0.4 to 0.8).

The bacteria were pelleted for 2 min at 5000 rpm and re-suspended in 1 ml of liquid MS

solution (Appendix III).

2.3.2.2 Application of Agrobacterium to prepared NLL explants

The transformation procedure was continued by gently placing a 1 µl drop of the AGL0

suspension (2.3.2.1) onto the top of the stabbed shoot apex of each explant (2.3.1). Six

explants per experiment were used as negative controls, which involved inoculation with

AGL0 control. Transgenic targeted explants were inoculated with AGL0 containing the

20

desired vector.

Treated explants were incubated on co-cultivation media for 2 to 3 days at 22 oC day and

18 oC night under low light (~2 μmol m-2s-1) in the growth room before being transferred

to regeneration medium. In the original protocol (Pigeaire et al. 1997) the regeneration

medium contained a selective biochemical appropriate to the T-DNA construct, to select

positive (transgenic) shoots. Detail of the selection protocols tested in this thesis research

are provided in Results Chapters.

2.3.3. Culture media

Agar-solidified medium preparation followed Pigeaire et al. (1997). Some modifications

to enhance the regeneration and rooting formation were described by Wijayanto et al.

(2009) and Barker et al. (2016). Culture media are detailed in Appendix III.

2.4. Plant tissue fixation and sectioning

The apical dome was excised from the explant, submerged in 30% sucrose solution

overnight, embedded into optimum cutting temperature (OCT) compound (TISSUE-

TEK®) and frozen at minus 20 °C. The frozen block with the sample was trimmed and

sectioned by the cryostat CM3050 S (Leica) (Tirichine et al. 2009) until the region of

interest was reached. Sections (20 - 40 µm) containing the intact plant material were

placed onto adhesive glass slides (Fischer et al. 2008).

2.5. Analysis of reporter gene expression

2.5.1. GUS assay

Assays of transient GUS expression in shoot apices were carried out according to


21

Jefferson et al. (1987). Shoots were immersed into freshly made X-Gluc solution

(5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid in 50 mM NaH2PO4 buffer, pH 7.0) in

24 well plates and incubated overnight at 37 oC. Samples for microscope analysis were

washed in 50% to 70% ethanol and cleared in chloral hydrate (Jefferson et al. 1987;

Beeckman and Engler 1994).

2.5.2. GFP imaging

Putative transformed shoot explants were longitudinal or cross sectioned by hand or

cryostat for confocal microscopy analysis. GFP expression was detected using a Nikon

Ti-E inverted motorised microscope with Nikon A1Si spectral detector confocal system

running NIS-C Elements software at the Centre for Microscopy, Characterisation and

Analysis (CMCA), The University of Western Australia.

Images were captured by a confocal microscopy system using objective lenses of 4x, 10x

and 20x, with laser wavelength 488 nm and 500-550 nm for GFP excitation and emission,

respectively. Surviving shoots from selection medium were imaged to detect in vivo

fluorescence using a CRi Maestro 2 in combination with Maestro software including

CPSTM (Compute Pure Spectrum) and RCATM (Real Component Analysis) spectral

library generation tools. For GFP imaging, the samples were scanned with a blue filter,

with parameters of excitation filter 435-480 nm, emission range from 500 – 550 nm.

23

CHAPTER 3

DEVELOPMENTAL COMPETENCE

FOR NARROW LEAFED LUPIN REGENERATION

3.1. Introduction

Narrow leafed lupin (NLL) (Lupinus angustifolius L.) is an important crop in Western

Australia that significantly contributes to national lupin production and commercial

export. Genetic transformation to widen the NLL gene pool started in the 1990s

(Molvig et al. 1997; Pigeaire et al. 1997). Agronomic traits which do not exist in the NLL

genome have been engineered, for example herbicide tolerance (Pigeaire et al. 1997;

Barker et al. 2016), necrotrophic fungal pathogen resistance (Wijayanto et al. 2009),

protein quality enhancement (Molvig et al., 1997) and improved pod set along with grain

yield (Atkins et al. 2011).

However, genetic manipulation of NLL is difficult as with many other legume species,

reportedly because regeneration in vitro is highly genotype specific and only rarely are

cultivated varieties responsive to regeneration (Somers et al. 2003; Olhoft et al. 2003;

OGTR 2013; Tabe and Molvig 2007). NLL has been reported to be successfully

regenerated from callus via hypocotyl (Sroga 1983), organogenesis (Sroga 1987),

immature cotyledons (Nadolska-Orczyk 1992), and from shoot apical meristem (Kartha

et al. 1981) via direct shoot organogenesis. However, in vitro plant regeneration from

shoot apical meristem is the most commonly applicable technique for gene transformation

(Ratanasanobon 2014; Tabe and Molvig 2007; Pigeaire et al. 1997; Atif et al. 2013).

The current NLL genetic transformation methodology developed by Pigeaire et al. (1997)

24

has been reported as the most successful method (Ratanasanobon 2014). The basis of this

method is to excise the germinated seedling hypocotyl followed by wounding the shoot

apical meristem (SAM). Transgenic shoots are presumed to regenerate directly from

transformed totipotent cells existing in the original explant. Derived shoot materials are

sub-cultured to optimise the number of transgenic events. However, this transformation

methodology remains time-consuming and inefficient; gene transfer to the progeny is

relatively low, resulting in a low overall transformation frequency (Pigeaire et al. 1997,

Wijayanto et al. 2009; Barker et al. 2016). The difficulty with NLL transformation derives

from limited understanding of how to effectively target and regenerate totipotent cells in

the SAM. Genetic transformation to introduce novel genes into NLL requires an efficient

method to improve transgene integration and regeneration of transformed plants.

Shoot apical meristem structure has been well studied in the Solanaceae, and in other

species where clonal propagation and grafting have led to an understanding of the layers

of cells that contribute to SAM structure and development (Szymkowiak and Sussex

1996). More recently, genetic dissection of plant development using Arabidopsis as a

model has added to knowledge of the typical dicotyledon SAM structure (Carraro et al.

2006; Aida et al. 1999; Bowman and Eshed 2000). There are two regions in the shoot

apical meristem: the tunica and the corpus. The tunica consists of two functional layers:

protoderm or primitive epidermal layer (L1) and sub-epidermal layer (L2). These coat the

central cells in the meristem, which are collectively called the corpus. A second

cytohistological zone concept has been developed from observations in a number of

flowering plants (Evert 2006; Steeves and Sussex 1989). In this concept, the shoot apex

is organized into three distinct zones of differentiation and function: central zone (CZ);

peripheral zone (PZ); and rib zone (RZ). The pluripotent cells in this meristem structure

initially provide precursors for a primary shoot that later develops laterally. The

reproductive organs also develop later from the pluripotent cells. However there exists

Chapter 3: Developmental competence for narrow leafed lupin regeneration

25

little information about SAM structure and meristem development derived directly from

legume species. It was hypothesised that an improved understanding of the structure of

the NLL SAM and determination of the origin of shoots that developed from wounded

embryonic axis whilst following the current method of transformation would provide

information that would enable the design of a more efficient transformation protocol. This

initial study therefore aimed to reveal the NLL SAM along with a developmental analysis

of the wounded shoot.

3.2. Materials and methods

NLL seedling treatment followed the standard technique to remove seed coat and leaf

primordia with a Leica stereo-microscope (Chapter 2, 2.3.1). For shoot apical meristem

structure analysis, the seedlings were grown in co-cultivation (Cc1) medium (Appendix

III) and collected from day one to day ten for early shoot development analysis.

To test the effect of wound size on the development of the shoot, two needles of different

wounding sizes were tested; an ultra-micro-needle with tip radius 5µm (Proscitech) and

a BD MicrolanceTM 30 ½ -gauge needle. The shoots were excised from the seed,

wounded and analysed immediately (day zero) or cultivated as explants in co-cultivation

(Cc1) medium for one to ten days after wounding for early wounded shoot development

analysis. Thirty shoots were examined for each wounding treatment at each time point.

Normal and wounded shoots were collected at day 3, 5, 7 and 10 and sectioned for

microscopy analysis as described in Section 2.4 General materials and methods (Chapter

2). Samples were stained with 10% toluidine blue or 0.1% Fluorescent Brightener 28

(Calcofluor White) (Yeung et al. 2015), then visualised by Olympus BH2 microscopy or

Nikon A1Si Confocal microscopy, respectively.

26

3.3. Results

3.3.1. Narrow leafed lupin shoot apical meristem

Microscopy imaging and analysis of the shoot apex of NLL revealed that the SAM is

formed in a cone shape with 20-25 cell layers. The structure is a typical tunica and corpus

design, as can be seen in Fig. 3.1b, c.

Figure 3.1. Shoot apical meristem (SAM) of narrow leafed lupin (NLL).

a Longitudinal section of NLL SAM stained with Calcofluor White, captured by Nikon

A1Si confocal microscopy. Bar 100µm. CZ, Central zone; PZ, Peripheral zone; RZ, Rib

zone; LP, Leaf primordia. b-e were stained with Toluidine blue, captured by Olympus

microscopy. b Longitudinal section of NLL SAM. Bar 20µm. L1, Layer one; L2, Layer

two; white arrows indicate the cells of L1; yellow arrows indicate the cells of L2; red

arrows indicate the direction of development of meristem cell derivatives. c Longitudinal

section of NLL SAM. Bar 100µm. Red circle dashed lines show the formation and

emergence of axillary bud from PZ. d - e Axillary bud formation from vascular tissue in

transverse section of NLL shoot (red circle dashed lines). Bar 200 µm.


27

However, Fig. 3.1 also shows that the NLL SAM develops in concordance with the

cytohistological zone concept that the shoot apex is organized into three distinct zones of

differentiation and function: central zone (CZ); peripheral zone (PZ); and rib zone (RZ).

3.3.2. In vitro morphogenesis of wounded shoot apical meristems

Preliminary microscope analysis of the wounded shoots from day 0 (D0) to day 10 (D10)

showed the early development of wounded shoots (Fig. 3.2). The wounded shoot apices

had elongated (Fig. 3.2) and axillary buds were visible from day 3 of culture (Fig.

3.2b,c,d).

Figure 3.2. The apical meristem of wounded shoots

Development of explant SAM after wounding methods. Images are Toluidine blue

stained cryostat sections at the designated days.

a is day zero (D0) sample; b is day 3 (D3) sample; c is day 5 (D5) sample; d is day 7 (D7)

sample; e is day 10 (D10) sample. Black circle dashed lines show the area of shoot dome,

red circle dashed lines show axillary buds, LP. Leaf primordia. Images were captured by

Olympus microscopy, bar 200 µm.

28

Observing the wounded shoot structure also showed the wounding in the meristem, which

fell into three categories (Fig. 3.3): 1. Vertical wounding (Fig. 3.3a-c) occurred when the

needle injured the meristem in a longitudinal direction and the shoot apical meristem was

longitudinally divided into several sections; 2. Angle wounding (Fig. 3.3d-f) occurred

when the needle issued an oblique stab to the dome; 3. Compound wounding was the

mixture of angle and vertical styles (Fig. 3.3g-i).

Figure 3.3. Injuries in the apical meristem of wounded shoots

a-c. Vertical wounding; d-f. Angle wounding; g-i. Compound wounding.

Meristem areas are marked by dashed lines. Red arrows show stabbing directions.

Samples were stained with Toluidine blue and images were captured by Olympus

microscopy, bar 200 µm.


29

Examination of the effect of an ultra-micro needle with tip radius 5 µm (new needle)

compared to the BD MicrolanceTM 30½ gauge needle (old needle) on the shoot meristem

of seedlings is shown in Fig. 3.4. The tip of the new needle is sharper and more acute than

the old needle (Fig. 3.4a). Observation of the sections of injured meristem revealed that

the old needle caused more destruction of the meristem than the new finer needle.

However, because there were samples lost at the sectioning stage, no statistical analysis

from different injuries was performed.

Figure 3.4. Damage in shoot apical meristem by two types of needle

a. Two needles, upper (ultra-micro needle); lower (BD MicrolanceTM 30 ½ gauge needle);

b. Typical damage from the BD MicrolanceTM needle; c. Typical damage from the ultra-

micro-needle. Meristem area is marked by dashed lines. Samples were stained with

Toluidine blue and images were captured by Olympus microscopy, bar 200 µm.

3.4. Discussion

3.4.1. Narrow leafed lupin shoot apical meristem structure

The overarching aim of this thesis was to overcome recalcitrance to transformation of

NLL. This Chapter tested methods and prior assumptions about wounding and shoot

regeneration potential by determination of the structure of the NLL SAM (Fig. 3.1) to

discover from which zone new shoot development occurred following wounding. The

development of plants is mainly divided into two stages: embryonic and post-embryonic.

Embryogenesis in plants provides a basic body plan for the seedling and stem cell

30

populations for the generation of all post-embryonic tissues. At the embryo stage, cell

proliferation occurs throughout the body, while in the latter phase many regions

discontinue cell division and become more specialized (Steeves and Sussex 1989).

Described as the centre of post-embryonic organ formation in the shoot, the SAM first

produces the plumule, which develops into the vegetative and reproductive components

of the plant body (Chien et al. 2011). The literature on plant anatomy has largely focused

on tobacco and tomato species, and some fruit trees and ornamental horticulture species.

Researchers have taken advantage of the ease with which the former species undergo

growth in tissue culture and the existence of genetic mutations across this range of plants

that allow the layers of the SAM to be distinguished (Steeves and Sussex 1989; Tilney

Bassett 1986; Szymkowiak and Sussex 1996). No similar information about pulse

legumes could be found. However, the SAM of NLL (Fig. 3.1) was observed to be very

similar to reports from species in other dicot plant clades.

Specifically, observations of NLL SAM structure are consistent with the published SAM

structure of eudicot plants that follows the tunica-corpus configuration characteristic of

angiosperm shoot apices (Evert 2006; Bowman and Eshed 2000; Satina et al. 1940;

Barton and Poethig 1993; Lenhard et al. 2002; Steeves and Sussex 1989; Murray et al.

2012). The tunica consists of small populations of pluripotent undifferentiated

meristematic cells. Anticlinal division and differentiation of tunica cells gives rise to

lateral organs and provides distal meristematic growth, whereas corpus cell division is

responsible for the formation of the stem. The outer tunica layer (L1) produces shoot

epidermal cells, whereas the inner layer (L2) forms the other tissues, including cortex and

undifferentiated germline cells. The vascular tissues and pith comprise L3 of the

developed stem; these tissues form subsequent to initiation of floral bud development in

tobacco explants (Wilms and Sassen 1987). The majority of cells remain associated with

their originating layer, however some mixing can occur so that occasionally there can be


31

contribution of the L1 to the germ cells. Periclinal division of the corpus or layer three

(L3) results in mixing with L2, creating structural integrity among lateral appendages and

the stem (Satina et al. 1940; Tilney Bassett 1986).

The NLL shoot apex also shows concordance with the cytohistological zone concept that

the shoot apex is organized into three distinct zones of differentiation and function. CZ

cells divide anticlinally, producing the initial cells for the PZ and RZ, whilst cells in the

PZ and RZ undergo a combination of periclinal, anticlinal and oblique divisions (Fig.

1C). PZ and RZ divisions form the main stem. Cortex and procambium originate from

the PZ, while RZ gives rise to pith meristem. Anticlinal division elongates the bud, while

periclinal division expands the diameter of the shoot. Leaves and axillary buds arise from

the PZ although lateral buds usually originate from deeper layers and thus slightly deeper

initials in the corpus, than the leaves (Tilney Bassett 1986; Steeves and Sussex 1989;

Bowman and Eshed 2000; Evert 2006).

3.4.2. Wounding methods and the fate of the cell in apical meristem

Comparison of the effects of wounding with two different sized needles followed a

suggestion from unpublished research by Teguh Wijayanto that using a smaller needle

caused less damage and may improve transformation efficiency. However, without a way

to differentially mark cells according to their origin, it is only possible to determine an

approximate prediction of the meristem origin of wounded shoots. Therefore, no

conclusions could be made at this point in the Thesis study about whether the smaller

sized needle might improve regeneration potential following Agrobacterium

transformation. This question was reassessed in Chapter 5 following visualization of

transgenic shoots using GFP. Analysis of the wound orientation in the context of the

identified SAM structure was also limited by this lack of marking potential. However, it

was determined that vertical wounding (Fig. 3.2 a-c) creates several sections in the

32

meristem and more than one shoot might arise from the meristem. In this case, the CZ

was lightly injured and might continue to be functional in the meristem and contribute to

form one primary shoot. If each piece of wounded meristem develops into a new shoot,

the outer part of the new shoots might be comprised not only of L1 or L2 cells, but also

might be derived from PZ or RZ cells along the wound to the primary meristem caused

by the needle. Agrobacterium could approach cells along the injury and that might include

cells that have more potential to be transformed.

The angle wounding style (Fig. 3.2 d-f) damaged one side of PZ and RZ. Transgenic

shoots are predicted to be formed from the rest of the PZ and RZ cells. CZ that was

preserved in this wounding method could potentially form new PZ and RZ (Evert 2006)

Therefore, the primary shoot emerging from this wounding method would have

originated from CZ and might not carry the desired gene from the transformation

procedure. Only shoots containing transgenic cells from the PZ and RZ might survive

further selection.

The third wounding method was the mixture of angle and vertical styles (Fig. 3.2 g-i).

This wounding technique would eliminate the central zone requiring differentiation of

cells in PZ and RZ to form a lateral meristem.

Cells in CZ are undifferentiated meristematic cells or stem cells that play a crucial role in

maintaining the activity of apical meristem. Therefore, if the central zone cells are

competent to transformation, this could produce a transgenic meristem that will generate

a transgenic shoot. However, transfer of genes only to cells in CZ of the main SAM is

technically impossible by the current method, because of the inability to target the needle

to the central zone only.

The information gained from analysis of the NLL meristem structure, combined with the

detail of how shoots are derived in the original method, leads to the proposal that if a


33

transformed cell in PZ or RZ can dedifferentiate to stem cell, it will generate a

transformed shoot. Also, it is noted that removing the extreme tip of the SAM also

removes the CZ. That damage will cause loss of apical dominance and may stimulate

totipotent cells in PZ and RZ to de-differentiate to form lateral meristem, as reported by

Babaoglu et al. (2000) in a study on sweet lupin (Lupinus mutabilis L.) transformation.

The study compared two methods - one with the apical meristem intact and the other with

the removal of apical layers by a horizontal cut at the extreme tip of the SAM with a

scalpel to a depth of approximately 300 µm. The authors showed that without apical

layers, explants were more likely to generate transgenic shoots. Their report is compatible

with the third method of wounding meristem observed in narrow leafed lupin. The

preliminary observation of wounded NLL SAM (this Chapter), along with consideration

of the report from Babaoglu’s group led to a hypothesis that applying the compound

wounding method to NLL would generate competent cells in PZ and RZ and as a

consequent produce more transgenic shoots. This hypothesis will be tested in Chapter 4.

35

CHAPTER 4

HYGROMYCIN AS AN ALTERNATIVE SELECTION

MARKER FOR NARROW LEAFED LUPIN

TRANSFORMATION

4.1. Introduction

Genetic manipulation (GM) of plants has resulted in commercial uptake of the technology

that might be compared to the green revolution. In the 20-year period 1996 to 2015 there

were 2.0 billion accumulated hectares of biotech crops grown globally, of which 1.0

billion hectares were biotech soybean [Glycine max (L.) Merrill]. The only other

significantly cultivated biotech-enhanced legume was alfalfa (Medicago sativa L.) in the

USA (James 2015). Additionally, the importance of Medicago truncatula Gaertn. and

Lotus japonicus L. as genome models has driven development of a functional

transformation system for these legume species. However, despite the importance of

pulse legumes to both human and agroecosystem health, research on any of these crop

species has been hampered by the lack of a high throughput genetic transformation system

(Somers et al. 2003; Atif et al. 2013; Iantcheva et al. 2013).

Narrow leafed lupin (Lupinus angustifolius L. - NLL) is among the principal grain

legume crops in Western Australia that contributes around 65% of world lupin production

(Lawrance 2007; Agtrans Research 2012; ABARES 2015). However the area of NLL

cultivation has decreased dramatically recently due to poor weed control options (Bowran

and Hashem 2008; Agtrans Research 2012). The NLL gene pool has limited herbicide

tolerance, early vigour or short season productivity, hampering conventional breeding

approaches.

36

Genetic manipulation has produced NLL lines with added agronomic or improvement

traits that were unavailable naturally in the NLL genepool (Pigeaire et al. 1997; Molvig

et al. 1997; Wijayanto 2006; Atkins et al. 2011; Barker et al. 2016). However, the current

transformation methodology in NLL, like other crop legumes, has been hampered by

significantly by low success rate (Somers et al. 2003). The successful transformation

efficiency of the T0 generation has been measured to average no more than 3.3% of

inoculation attempts in previous studies (Wijayanto et al. 2009), with generation of

chimeric shoots, which resulted in 0.8% success rate when measured at the T1 generation.

The screening system is one of the most crucial steps of the transformation process. It

was observed by researchers in the Plant Genetics and Breeding (PGB- formerly

CLIMA), UWA research laboratory that the general health of shoots arising from the

existing transformation process, which used PPT tolerance (encoded by the bar gene) as

the selectable marker, was poor (SJ Barker personal communication). Furthermore, when

this project was initiated, no efforts towards achieving NLL transformation using other

selectable marker technologies had been published. It was hypothesised that changing the

selection biochemistry might result in an improved transformation frequency or reduced

chimerism or both. Trial of 5-enolpyruvylshikimate-3-phosphate synthase gene encoding

glyphosate tolerance required development of a modified selection methodology (Barker

et al. 2016). Although the outcome had agronomic potential, transformation issues of

chimerism and low efficiency still needed to be solved (Barker et al. 2016). This study

therefore examined hygromycin B as an alternative selection marker to PPT tolerance for

NLL genetic manipulation.

Hygromycin B is an aminoglycoside antibiotic that inhibits protein synthesis in

prokaryotes and eukaryotes by interfering with ribosomal translocation and with

aminoacyl- tRNA recognition (Gritz and Davies 1983). This means of selection applied

in a range of other legumes has been assessed as expeditious and successful (Somers et

Chapter 4: Hygromycin as an alternative selection marker for NLL transformation

37

al. 2003; Atif et al. 2013). Transformation combining this character with a GUS reporter

gene was performed, to enable comparison of the results with those from bar gene (PPT)

selection. As well, in performing these experiments, the information gained from the

examination of the NLL SAM structure and wounding methodology (Chapter 3) was

assessed for relevance to the transformation success rate. Some of the results from this

Chapter were included in Nguyen et al. (2016b) (Appendix IV).


4.2.1. Transformation materials and methods

Plant materials were prepared following the standard technique described in Section 2.3.1

General materials and methods (Chapter 2) to remove seed coats and leaf primordia and

reveal the apical meristem for the wounding step. As discussed in Chapter 3, it was

proposed that the wounding style that removes the central zone (CZ) of the SAM and

exposes more cells in the peripheral zone (PZ) to the applied Agrobacterium strain would

stimulate more competent cells to form more transgenic shoots. Therefore, besides the

original wounding technique applied in most of the transformation experiments, 25

explants were also examined following the central zone removal wounding method. The

extreme tip of the apical dome was detached using the BD MicrolanceTM 30 ½ gauge

needle and the rest of the SAM was stabbed 10-12 times with a fine needle (Fig. 3.4).

Agrobacterium-mediated transformation was performed with AGL0:pCAMBIA1305.2

and AGL0:pCAMBIA3301 (Chapter 2, 2.1.1). The transformed explants then were

treated with the varied selection processes described in section 4.2.3.

38

4.2.2. Hygromycin selection concentration

To determine whether hygromycin would be suitable as a selection agent for NLL

transformation, the lethal concentration of hygromycin B on NLL was evaluated

following two different application methods as follows. For the droplet method of

selection (Pigeaire et al. 1997) a drop (1 µl) of hygromycin at concentrations from 0.2 to

2 mg ml-1 was applied on the cut surface of the SAM of 4 day old and 14 day old stabbed

NLL explants (25 explants were used to test each concentration). For selection media

testing without droplet application (reported by Barker et al. 2016), the effect of

hygromycin on NLL was examined in two ways as follows:

1. Lethal test 1 examined the effect of an acute dose of hygromycin and followed

method 3 for glyphosate selection described by Barker et al. (2016): stabbed explants

were grown on co-cultivation medium for seven days and transferred to regeneration

medium containing 2, 4, 5, 10 and 30 mg L-1 hygromycin for 10 days, followed by two

to four weeks on non-selection media.

2. Lethal test 2 examined the effect of a chronic dose of hygromycin on NLL plants:

stabbed shoots were grown in co-cultivation medium for seven days and transferred to

regeneration medium containing 2, 4, 5 and 10 mg L-1 hygromycin (25-30 plants each).

These plants were transferred to new hygromycin medium every two weeks and time to

death, if it occurred, was recorded.

4.2.3. Hygromycin selection protocol

Selection protocols for hygromycin were trialled based on the concentrations identified

from the lethal dose testing as follows.

1. Droplet and in medium selection: Post transformation, explants were incubated


39

on co-cultivation medium for two days in dark conditions, then two days under normal

light conditions (Fluorescent cool white PAR: 100–170 μmol m-2 s-1). The explants then

were transferred to regeneration medium (Rg) and a droplet of hygromycin was placed

onto the dome of the explant as described by Pigeaire et al. (1997). After two weeks in

Rg, surviving explants were excised individually and moved to micro-propagation

selection media (MPH; Pigeaire et al. 1997, substituting 20 mg L-1 PPT with 10 mg L-1

hygromycin). Surviving shoots were sub-cultured on MPH with transfer to fresh medium

every two weeks. The GUS assay was conducted on surviving shoots after three months.

2. Droplet selection: The explant treatments followed the initial conditions of droplet

and in medium selection as described above. After two weeks in Rg, surviving explants

were excised individually and moved to micro-propagation media but without selection.

The GUS assay was employed to discover the number of GUS positive shoots after two

weeks. Timing of droplet application was initially four days after transformation.

3. Non-selection: Post transformation, explants were incubated on co-cultivation

medium and transferred to regeneration medium (Rg) following method 1 above but

without droplet or media selection. The GUS assay was implemented to discover the

number of GUS positive shoots that were growing from explants after two weeks in the

Rg medium.

The results were compared to PPT selection in the same scheme.

4.2.4. Reporter gene and statistical analysis

Assays of transient GUS expression, sectioning and microscopy analysis are described in

Section 2.5.1. General materials and methods (Chapter 2).

Treatments were compared by chi squared test for statistical significance using Microsoft

Excel software.

40

4.3. Results

4.3.1. Hygromycin selection concentration

Preliminary experiments demonstrated that hygromycin was a suitable agent for selection

in NLL. As the existing PPT selection protocol utilised both droplet and in medium

selection, the lethal dose concentrations of hygromycin on untransformed NLL for each

of these selection conditions was examined separately. Fig. 4.1 shows the NLL explants

in medium selection with acute and chronic doses of hygromycin. This initial test also

scrutinizes hygromycin concentration that inhibit development rather than kill non-

transgenic cells in NLL transformation.

Regarding droplet selection, 14 out of 25 explants were killed by a drop of hygromycin

at a concentration of 0.5 mg ml-1 and all NLL explants died following droplet treatment

of 1 mg ml-1. For in media selection, NLL explants were not killed by an acute dose of

hygromycin up to 10 mg L-1 for one week at any of the tested concentrations in lethal test

1. Explants in media with concentrations between 2-5 mg L-1 of hygromycin recovered

strongly when moved to non-selection medium (Fig. 4.1, and data not shown). Explants

treated with an acute dose of 10 mg L-1 hygromycin in medium looked unhealthy in the

first week but recovered in the next two weeks, and were totally rehabilitated five weeks

after movement to non-selection medium. At 30 mg L-1 all explants were dead after 10

days. In lethal test 2 (chronic dose), NLL explants did not produce shoots. Explants

eventually were killed by a chronic dose of 10 mg L-1 hygromycin regeneration medium

after six weeks, but remained alive on concentrations from 2-5 mg L-1 (Fig. 4.1 and data

not shown).


41

Figure 4.1. The effect of acute and chronic doses of hygromycin on NLL plants.

a. Acute (10 days, left plate) and chronic (4 week, right plate) treatment of untransformed

NLL explants on 5 mg L-1 hygromycin. Both treatments remain alive; b. Acute (10 days,

left plate) and chronic (4 week, right plate) treatment of untransformed NLL explants on

10 mg L-1 hygromycin. Only the acute dose treatment explants remain healthy

4.3.2. Screening putative transformed NLL shoots using hygromycin

The hygromycin lethal trial in 4.3.1 showed that hygromycin concentration at 1 mg ml-1

is suitable for droplet selection and 10 mg L-1 hygromycin acute dose in selection media

has inhibition ability to the development of NLL explants and can be used to screen

hygromycin transformation NLL. Initial research followed the existing protocol for PPT

selection, which was 1 mg ml-1 hygromycin in droplet selection followed by 10 mg L-

1 hygromycin selection in media. As high as 20% T0 transformation efficiency was

achieved from one experiment. Overall, in five experiments, 12 shoots were obtained

from a total of 457 seedling explants. However, these surviving shoots originated from

one explant. Therefore, the percentage of surviving transformed explants that grew on

the selection medium from the total NLL explants inoculated was 0.2%. (Table 4.1).

42

Table 4.1. Summary of narrow leafed lupin transformation experiments in

hygromycin selection medium

Experiment 1 2 3 4 5 Total

a. Number of explants 60 105 60 157 75 457

b. Number of explants surviving after droplet

selection

5 9 8 12 11 45

c. Number of shoots surviving in selection

media

d. (transformed explants)

12

(1)

0 0 0 0 12

(1)

e. Transformation efficiency: surviving shoots

(c) /original explants (a)

f. Transformation efficiency: Transformed

explants (d) /original explants (a)

20%

(1.6%)

2.6%

(0.2%)

a Explants at the start of treatment following application of AGL0:pCAMBIA 1305.2 and

cultivation in co-cultivation media for four days; b All explants were moved to

regeneration (Rg) media at day 4 post transformation and hygromycin droplet treatment

of 1 mg ml-1 was applied. Number of explants is the number that survive seven days after

droplet treatment; c After 2-3 weeks on Rg, shoots were excised from transformed

explants (d) and moved to micro-propagation selection media (10 mg L-1 hygromycin),

surviving shoots were counted after 2-3 weeks in selection media; e are the ratio of

surviving shoots in selection media (c) to explants at the start of treatment (a); f are the

ratios of transformed explants produced shoots that survived in selection media (d) to

explants at the start of treatment (a)

4.3.3. Effect of hygromycin versus PPT on NLL shoots

Hygromycin and PPT selection are both negative selection methods; they kill

untransformed cells from the transformation procedure. The result in Table 4.1 led to

more careful consideration that if the transgenic shoots were chimeric as had been

proposed from heritability in previous research, the existing standard selection protocol

would reduce the apparent success rate. Only shoots that contained a majority of

transgenic tissue would survive the media selection methodology.

Therefore, alternative approaches to selection were investigated. These were selection


43

method 2. droplet selection and method 3. no selection. Shoots generated from these two

selection methods were also tested for reporter gene expression using the GUS assay. The

results of hygromycin transformation were compared to PPT transformation as shown in

Fig. 4.2, Table 4.2 and Fig. 4.3. The response to a 1 mg ml-1 droplet of hygromycin

compared to the 2 mg ml-1 PPT droplet selection is shown in Fig. 4.2. A PPT droplet

caused significant browning across the top of the explants and in some cases also quickly

killed the basal tissue (Fig. 4.2c, e). In contrast, hygromycin killed the top dome tissue

but underlying tissues remained quite healthy, with the exception that some vascular

tissue browning could be observed (Fig. 4.2b, d).

Figure 4.2. Effect of hygromycin and PPT droplet on NLL shoots.

a. Top view of control explant following stabbing and Agrobacterium treatment but no

selection; b. Droplet selection with 1 mg L-1 hygromycin seven days after treatment

showing death of the apical dome but otherwise general health of the explant; c. Top view

of explant seven days following droplet selection with PPT; d. Longitudinal section

through b. showing overall tissue health, except for progression of browning into the

vascular tissues; e. Longitudinal section through c. showing most tissues are already dead;

f. NLL explant seven days after treatment with hygromycin droplet showing development

of shoots occurring from below the dead tissues; g. NLL explant seven days following

droplet treatment with PPT showing less tissue damage than e. and emergence of a shoot

(behind the dome), but this shoot later died. All scale bars are 500µm long.

44

Three approaches were trialled for hygromycin selection following co-cultivation of the

NLL explants with Agrobacterium, and the outcomes were compared with PPT selection

(Table 4.2). There was a significant difference between survival even at the earliest step

(survival on Rg) between PPT and hygromycin selection and the trend for percent shoots

that expressed GUS from experiments on different selection methods with both selectable

markers was the same (Fig. 4.3). Following droplet application, 32 explants survived out

of 438 seedlings from transformation with pCAMBIA 1305.2, of which 30 explants

produced shoots expressing GUS, whilst for PPT selection there were only three shoot-

producing explants from 382 treated explants, all three of which explants produced GUS

positive shoots. Transformation with method 3. no selection resulted in a much larger

frequency of marker gene-expressing shoots than method 2. droplet only selection

(Fig. 4.3).

Table 4.2. Statistical comparison of selection agents

on narrow leafed lupin transformation results

Data shown are combined results where n is the total number of explants in each category

and # is the number of experiments that were performed.

Experiment pCAMBIA3301

PPT selection

Survive to Rg (n,#)

pCAMBIA1305

Hyg selection

Survive to Rg (n,#)

2

statistica

Statistical

significanceb

Droplet selection 3 (382,4) 32 (438,4) 23.2319 *

Droplet and in

media selection 13 (1035,14) 45 (457,5) 62.6202 *

2 statisticc 0.5537 1.8363

Statistical

significanceb nsd nsd

Rg: regeneration media; PPT: phosphinothricin; Hyg: hygromycin

a Comparison of explant survival between selectable markers within selection methods

b * = significant at p = 0.05; nsd = not significantly different at p = 0.05

c Comparison of explant survival between selection methods within selectable markers


45

However, there was not a significant difference for survival to the earliest stage (Rg)

between the droplet only and the droplet and in media selection methods if the same

selectable marker was applied (Table 4.2), indicating that marker gene expression

differences resulted from a developmental process that was detected later in the

transformation method. Transformation with pCAMBIA 1305.2 (hygromycin selection)

with no selection resulted in 378 explants out of 590 seedlings developing shoots that

were GUS-positive, whereas transformation with pCAMBIA 3301 (PPT selection)

resulted in 42 successful explants out of 120 (Fig. 4.3). Method 1. droplet and selection

in media was the least successful method (Fig. 4.3).

Figure 4.3. Outcome of different selection methodologies

on T0 transformation rates.

Percentage of GUS expression in NLL explants following transformation with

AGL0:pCAMBIA1305.2 (hygromycin resistance) and AGL0:pCAMBIA3301 (PPT

resistance) and selection protocols. The data extracted from table 4.1 and 4.2.

0.0%

10.0%

20.0%

30.0%

40.0%

50.0%

60.0%

Droplet and in media

selection Droplet selection

No selection

0.2%6.8%

64.1%

0.1% 0.8%

35.0%

pCAMBIA 1305.2

pCAMBIA 3301

46

Figure 4.4. GUS expression in NLL transgenic explants of different selection

methodologies

a. GUS expression in NLL explants from the selection method 3 following transformation

with pCAMBIA3301; b. GUS expression in NLL explants from the selection method 3

following transformation with pCAMBIA1305.2;

4.3.4. GUS activity of putative transgenic shoots and location of transgenic cells

Analysis of surviving shoots from preliminary hygromycin transformations revealed that

although all were GUS positive, they were also probably chimeric as emerging shoots

following further subculture stained with different intensities (Fig. 4.5 a, b). Further

analysis with subculture of shoots emerging from the different selection methods

demonstrated that a range of staining intensity was observed (Fig. 4.5 and data not

shown). This result suggested that shoots were developing from more than one initial cell.

To identify how these shoots were developing, GUS-positive explants were sectioned to

examine whether specific cell layers were transformed (periclinal chimeras) or whether

the chimerism was sectoral (mericlinal chimeras). Fig. 4.5c shows a representative

stained section. Blue colour was clearly not confined to intact cells. There appeared to

have been leakage and diffusion in the cryostat sectioning process which could lead to a


47

misleading concept of transgenic cell location. For this reason, the structure of chimeras

could not be ascertained by these experiments.

Figure 4.5. GUS expression in NLL transgenic explants.

a. Subcultured shoots from a single explant from the selection method 1 three months

after transformation with pCAMBIA1305.2; b. Close-up of a sub-cultured shoot from c.

showing chimerism c. Longitudinal cryostat section of a GUS positive shoot (bar 500µm)

4.3.5. Wounding method

The new wounding approach (4.2.1) was trialled for hygromycin transformation

following co-cultivation of the NLL explants with Agrobacterium, then regeneration and

GUS staining of transformed explants. The outcomes were compared with the original

wounding method. From 25 explants that were treated by the central zone removal

technique, 22 explants produced GUS-positive shoots, making the initial transformation

success rate 88%, while transformation with the original wounding method showed 361

GUS positive shoot-producing explants out of 565 explants (63.9% success rate).

However, although this trend was promising, there was no significant different at p = 0.05

(2 = 1.1471, p = 0.284165).

4.4. Discussion

Research on NLL transformation since the mid-1990s has relied on selection with the

48

herbicide PPT. Although the developed methodology could be used to achieve single

copy events the overall efficiency was very low (Wijayanto et al. 2009). The lack of an

efficient means to generate transgenic NLL limits both the capacity for basic research on

gene function to follow from emerging genome information (Nelson et al. 2006) and

commercial opportunities that might arise from improved gene function understanding.

Research efforts have subsequently focused on the potential of alternative selection

methodologies to improve transformation outcomes. The use of glyphosate selection was

developed as part of that initiative (Barker et al. 2016). However, although that research

generated NLL plants with strong agronomic potential, the efficiency of the

transformation was not improved. Hygromycin selection had been reported to greatly

improve transformation efficiency in soybean (Olhoft et al. 2003) and was found in this

research to be a suitable alternative selection for NLL transformation.

The initial test of acute versus chronic doses of hygromycin determined the lethal

concentration of hygromycin for NLL explants, and also examined the outcome of

applying a low concentration of hygromycin to inhibit development rather than kill non-

transgenic cells. Application of 10 mg L-1 hygromycin in selection media was able to

achieve this outcome (Fig. 4.1). It was hypothesised that this selection scheme presented

a means to create opportunity for transgenic cells to divide, proliferate and differentiate

whilst surrounding tissues remained reasonably healthy, thus supporting transgenic shoot

growth. This might reduce chimerism (Fig. 4.5a compared to Fig. 4.4), but would not

improve the frequency of obtaining transgenic shoots (Table 4.2) unless the selection was

applied later (Fig. 4.3).

Three selection methodologies were trialled for hygromycin transformation and the

outcomes were compared with PPT transformation events. The GUS expression results

between the two selectable markers (hygromycin and phosphinothricin) could not be

directly compared because two different GUS gene constructs were present in the


49

pCAMBIA Ti plasmids. The hygromycin selectable marker was combined with a more

easily detected GUS gene (GusPlusTM). However, Fig. 4.3 showed the same trend for

both selectable markers. Method 1. Droplet and selection in media, which was the

selection method used in previous research, was the least successful method.

Both hygromycin and PPT selections are negative selection methods that eliminate

unsuccessful events from the transformation process. These negative selections also stress

living transgenic cells. Dying plant cells may release toxic substances or block nutrient

uptake in a way that impairs regeneration of the transformed ones. Therefore, a number

of explants that are partially transformed (chimeric) might be eliminated in the selection

process (Joersbo and Okkels 1996).

Observation of the response to two selective agent activities on NLL shoots revealed that

hygromycin killed apical dome cells selectively, unlike PPT, which although reportedly

poorly translocated (Wild and Wendler 1991) was more generally toxic (Fig. 4.1).

Explants treated with PPT were unhealthy and unable to support growth of emerging

putative transformed shoots, whereas explants treated with hygromycin had healthier

tissue and emerging shoots more frequently survived (Fig. 4.2, Table 4.2). This outcome

was combined with the observation of Wijayanto et al. (2009) that transformation with

the anti-apoptosis gene construct P35 led to a higher transformation frequency than had

previously been achieved in NLL. The hypothesis developed from that study was that

prevention of cell death in the zone of transformation might improve survival of

transgenic shoots.

Removal of the central zone to expose the cells in the peripheral zone of the shoot apical

meristem to Agrobacterium was trialled, as the derived cells from the peripheral zone

potentially form axillary buds. This wounding method releases apical dominance

(Medford 1992) which might stimulate more axillary bud cells to differentiate into shoots.

50

The removal of apical layer(s) by a wounding method that uncovers the tunical cells of

the SAM was trialled due to supportive evidence from de Kathen and Jacobsen (1995)

and Babaoglu et al. (2000) that genetic manipulation without apical layers of SAM in

studied species was more likely to generate transgenic shoots. There was no significant

difference between the two wounding methods in this study; however only 25 explants

were assessed in the trial. A larger sample size should clarify if the trend observed was

demonstrative of a real difference.

Olhoft et al. (2003) proposed that because the mode of action of hygromycin involved

inhibition of protein synthesis, transgenic cells were unlikely to cross-feed non-transgenic

cells to over-ride the selective agent, unlike what might occur with PPT selection.

Furthermore, heritability of the transgene by the T1 generation requires it to be located in

the tissue that develops into reproductive cell layers of the floral meristem (Szymkowiak

and Sussex 1992; Huala and Sussex 1993). For these reasons, determining the structure

of chimeric shoots obtained with hygromycin selection compared to PPT would be

informative. However, in pursuing that goal, analysis of expression of the GUS reporter

gene in the initial experiments on selection methodology gave unexpected evidence that

transformation efficiency of NLL cells was not in itself the rate-limiting step for

generation of heritable transgenic shoots (Fig. 4.5, Fig. 4.3, Fig. 4.4). Due to the limitation

of the GUS staining methodology to clearly visualise the transgenic sectoring (Fig. 4.2c),

it was decided to utilise GFP gene expression as a means of ascertaining how the

transgenic shoot structure developed and what type/s of chimerism were occurring (See

Chapter 5).

51

CHAPTER 5

GFP SHEDS LIGHT ON NARROW LEAFED LUPIN

TRANSFORMATION

5.1. Introduction

In the Mediterranean cropping systems of Australia, the dominant legume is Lupinus

angustifolius L. (narrow leaf lupin; NLL) (Dracup and Kirby 1996). Genetic manipulation

in NLL has expanded its genome and generated new phenotypic variation for crop

improvement and herbicide resistance (Pigeaire et al. 1997; Molvig et al. 1997; Wijayanto

et al. 2009; Atkins et al. 2011). Although NLL transformation has been reported for nearly

20 years, it remains inefficient. Considerable efforts have been made to improve the NLL

transformation (Wijayanto et al. 2009; Atkins et al. 2011; Ratanasanobon 2014; Barker

et al. 2016). The challenges were not only transformation frequencies but also the

chimeric nature of transformants, deduced from the low (non Mendelian) inheritance

ratios of the transgene in the offspring of the primary (T0) transformant. (Pigeaire et al.

1997; Wijayanto et al. 2009; Barker et al. 2016). Because untransformed tissues in the T0

plants have potential to give rise to non-transgenic gametes and therefore non-transgenic

progenies, the objective is to eliminate the incorporation of untransformed cells into the

primary transformants in order to achieve uniform transgenic plants.

The most crucial step for improving NLL transformation is optimization of the screening

system. Reporter genes are means of visual screening and documenting chimeras; they

are also useful for recovering transformation events from low-efficiency transformation

52

systems (West et al. 1999; de Ruijter et al. 2003). By enabling transformed cells to be

identified visually, the use of reporter genes can provide detail about transgenic sectoring,

therefore enabling research to optimize the transformation procedure. Reporter genes

applied in plant transformation are luciferase, ß-glucuronidase (GUS), green fluorescent

protein (GFP), and regulators of anthocyanin biosynthesis (Ludwig et al., 1990; de Ruijter

et al., 2003). In NLL genetic manipulation, prior research has primarily used the GUS

gene for visualising transformed cells. However, GUS assays rely on a chemical reaction

that requires the addition of a substrate at optimized levels to activate enzyme activity.

GUS imaging in Chapter 4 showed leakage and diffusion of GUS blue colour which could

lead to a misinterpretation of transgenic cell location.

Ascertaining the structure of chimeras requires a marker which can be visualised either

in living tissue or at least, without disruption of the cellular materials. GFP is a substrate-

independent marker that allows continuous monitoring of gene expression and tracing of

the origin of transformed cells. GFP has emerged as a reporter gene of broad utility

because its detection is non-destructive and the protein requires no exogenous substrate

to fluoresce (Haseloff et al. 1997; Reichel et al. 1996; Stewart Jr 2001; Kurup et al. 2005).

The gene for enhanced GFP (eGFP) (Stewart Jr 2001) was therefore obtained to observe

transgenic shoot structure from the initial stages of their development and with more

detail than was possible with the GUS reporter gene. The additional advantage was that

the GFP gene could be combined with the hygromycin resistance gene (Chapter 4) to

allow a better understanding of how that selectable marker was improving the outcome

of transgenic shoot development in NLL.

Chapter 5: GFP sheds light on narrow leafed lupin transformation

53


5.2.1. Vector constructs

Three binary vectors with green fluorescent protein (GFP) markers were constructed for

the transformation experiments. Initially, two GFP constructs were sub-cloned to

pCAMBIA vectors (Appendix I) by a restriction enzyme cloning approach (Chapter 2,

2.2.4). Fragment CaMV35S-GFP from an existing plasmid pGFP73 (provided by Dr M

Ferguson-Hunt, UWA) was digested at KpnI and XbaI restriction sites and inserted into

pCAMBIA 1305.2 to form pGFP73H. This GFP vector utilised a hygromycin selection

marker (HygR) for the plant selection scheme and a kanamycin resistance gene (KanR)

for selection in bacteria. The second GFP vector (pUbqGFP73B) originated from

pCAMBIA 3301 and pUbqGFP73 (provided by Dr Margo Ferguson-Hunt, UWA). A

fragment of promoter-reporter gene Ubq-GFP73 was digested from pUbqGFP73 at

EcoRI and XbaI restriction enzyme sites before cloning into the target vector pCAMBIA

3301. Selection markers in pCAMBIA3301 were the bar gene (Bar) encoding PPT

resistance for plant cells and KanR for bacteria.

Subsequently a Gateway vector pH35 was constructed (Appendix I) following Gateway

cloning from pHGWFS7, that cannot be expressed in the bacterial host (Chapter 2, 2.1.2

and 2.2.5). Maps of these GFP vectors are shown in Appendix I.

The recombinant vectors were transferred into E. coli (DH5α) by a heat- shock method

(Chapter 2, 2.2.6). Plasmids isolated from transformed E.coli were transferred into AGL0

by a freeze-thaw method (Chapter 2, 2.2.7). PCR reactions were performed to detect

successfully transformed bacterial colonies (Chapter 2, 2.2.1). Transformed AGL0 were

maintained as a glycerol stock stored at minus 80 oC for genetic transformation of NLL

explants.

54

Constructs pGFP73H and pUbqGFP73B were firstly transformed into tobacco to test for

GFP detection, because of the high efficiency and time-saving advantages of

transformation in tobacco, following Barker et al. 1988. Although the tobacco explants

resulting from transformation with the two pCAMBIA-GFP constructs showed blue

colour in GUS assays, they did not perform any GFP expression. Therefore, the vector

pH35 was constructed as a substitute source of a GFP gene. Green fluorescence in tobacco

transformation events was achieved to confirm GFP expression from transformation with

pH35 prior to starting the NLL transformation experiments (data not shown).

5.2.2. Plant materials

For developmental analysis of transformed shoots, following the standard technique to

remove seed coats and leaf primordia with a Leica stereo-microscope (Chapter 2, 2.3.1),

the apical dome area was wounded by two methods:

1. SAM wounding only: The NLL SAM was stabbed with a fine needle 10-12 times

following Pigeaire et al. (1997) and further observations of Wijayanto (unpublished

report).

2. Deep and broad stabbing: A new wounding method was designed to examine

preliminary GFP observation that regeneration competence did not originate from

tissue exposed to Agrobacterium in the original method but from deeper tissues. It is

hypothesised that transformation efficiency may improve if the deeper tissue is

exposed to the gene carrier. The dome of NLL seedlings was stabbed from 1 to 1.5 mm

depth in a wider area but also still including the SAM.

Explants then went into Cc1 medium and were transformed with Agrobacterium

harbouring the designed plasmid. The explant treatments followed the initial conditions

of droplet as described in Chapter 4. Explants were collected from four (D4) to ten (D10)


55

days after transformation for microscopy analysis.

5.2.3. Plant tissue fixation, sectioning and imaging

Putative transformed samples were sectioned for microscopy analysis as described in

Section 2.4. and 2.5 General materials and methods (Chapter 2).

5.3. Results

5.3.1. Preliminary transformation with pH35

Microscopy analysis of the positive transformed explants described in Chapter 4 showed

the disadvantage of the GUS reporter marker and the need for an alternative reporter gene

for visual monitoring of the development from transformed cells to shoots. The Gateway

binary vector pH35 was constructed to achieve the capability to monitor NLL shoot

development from initiation.

Initially, visualisation of NLL samples transformed with the pH35 construct showed that

at the earliest stage (4 days after droplet selection) the stabbing tool had caused significant

damage to the primary apical meristem. Fig. 5.1 shows GFP expression of pH35

transformed explants imaged by confocal microscopy.

It was apparent that even at this very early stage, transformation appeared to have

occurred in every cell that had been exposed to Agrobacterium carrying pH35. This

included not just the areas of stabbing, whether the damage was shallow or deep, but also

included the entire epidermal layer of the explants (Fig. 5.1a). The veracity of this result

was demonstrated by comparison with explants following treatment with Agrobacterium

AGL0 without the GFP binary vectors (Fig. 5.1b). At seven days after droplet treatment

the death of the remaining apical dome tissues was apparent (Fig. 5.1c). As well, in

explants where deeper stabbing had occurred, GFP could be observed in the vascular cells

56

of the meristem and development of GFP expressing shoots from deeper tissue could be

observed (Fig. 5.1c-5.1e). Whilst epidermal cell transformation was also observed in

older explants and in shallow stabbed regions, no new shoot development was observed

from shallow tissues.

Figure 5.1. GFP expression of pH35 transformed explants.

All exposed and wounded cells of NLL explants are competent for transformation with

AGL0. a. Image showing eGFP expression through a sectioned NLL shoot, four days

after transformation with pH35 and droplet selection with hygromycin. b. Negative

control four days after transformation with AGL0 and droplet selection with hygromycin.

c. eGFP expression through a sectioned NLL shoot, seven days after transformation with

pH35 and droplet selection with hygromycin. d. Light field (transmitted light) microscopy

of transgenic NLL 12 days after transformation with pH35 showing initial shoot

development (white boxed region) and stabbing damage of the meristem (arrows). e.

Panel d section imaged with fluorescent microscopy illustrating eGFP expression

throughout the emerging side shoot (white boxed region), also in the epidermal cells and

cells surrounding the stabbing damage of the meristem (arrows). The length of the scale

bar is 500 µm.


57

5.3.2. Broad and deeper wounding method

The hypothesis that the wounded apical meristem has capability to rebuild itself is the

basis for the approach taken in previous studies, with the idea that the interference in

meristem integrity by stabbing will activate new groups of stem cells to produce shoots.

This method therefore aimed only to wound the meristem area without significant

damage, to retain as much meristem structure as possible. However, the preliminary

results with GFP expression suggested that regeneration competence was restricted to

deeper tissues than those being exposed by the current method. Therefore, a broad and

deeper stabbing method was tested (Fig. 5.2).

Observation of GFP expression revealed that deep and broad stabbing exposed more

meristematic cells to Agrobacterium than the original wounding method. Moreover,

following the deep and broad wounding method, vascular cells were more frequently

transformed than in the conventional method. Fig. 5.3 shows the anatomy of GFP

transformed NLL explants following the two wounding methods from D4 to D10 post-

transformation.

Imaging the development of GFP-expressing shoots following both wounding methods

determined that meristem cells along the damaged areas were not competent to

differentiate into shoots. There was no evidence that new meristem cells were generated

or differentiated from wounded shoot apical meristem. Axillary shoots produced by the

transformed explant were apparently generated from an unwounded area or cells at the

base or side of a deeper wound. It appeared that the dominance of the SAM was disabled

by the wounding procedure, releasing axillary meristem cells to activate shoot

development. This result achieved the first aim of this research, namely to determine

which cells in the shoot apex were developing into transgenic shoots after the exposure

to Agrobacterium.

58

Figure 5.2. Shoot wounding method.

a, c, e original (shallow) stabbing. b, d, f broad and deeper wounding method;

a-b Germinated seedling with plumule excised to expose the SAM at the day of

transformation (D0). Black arrows show the zone that was targeted in the original method.

b Black and white arrows show the zone to target; c-d transgenic explant after seven days

(D7) showing where stabbing has occurred in the two methods. Arrows as for a and b. e-

f longitudinal section of NLL germinated seedling with plumule excised at D0, after

wounding has occurred. e has undergone the original stabbing and has some shallow

damage to the SAM. f has undergone the broad and deep wounding method.

Scale bar 500 µm.


59

Figure 5.3. Development of explant SAM with GFP expression post transformation

(a-c) original and (d-f) new wounding methods. GFP was imaged by confocal

microscopy. Images are cryostat sections at the designated days after treatment with A.

tumefaciens AGL0:pH35. a, d are day 4 (D4) samples. b, e are day 7 (D7) samples. c, f

are day 10 (D10) samples. Scale bars are 500 µm.

5.3.3. Chimerism in transgenic shoots

Another aim of this research was to determine the chimeric structure of the shoots that

developed following NLL transformation in order to develop an approach to reduce the

chimerism in the outcomes of the current method. Observation of GFP in longitudinal

and cross sections of putative transformed axillary shoots after droplet selection, by use

of confocal microscopy, confirmed that a range of different chimeric structures were

being generated. Transgenic cells were visualised clearly in L1, L2 and L3 of the shoots.

They were abundant, being present in many parts of the stem. Some shoots appeared to

have uniform expression of GFP (Fig. 5.4).

60

Figure 5.4. Chimeric structure of original axillary buds

following the deep and broad wounding method.

a-c are cryostat sections. d-i are hand sections of living tissue. GFP fluorescence in these

sections is green and red fluorescence is chlorophyll. a eGFP expressed in leaf axil but

not in axillary shoots b Transformed cells located in vascular tissue of the explants

meristem, and a lateral axillary shoot. The SAM of axillary bud was a mericlinal chimera.

c GFP in axillary shoot showed that the outer layer (L1) of the shoot received the gene. d

Arrows indicate GFP expression in L1 (epidermal cells) and in vascular tissue (L3) e

initial formation of axillary shoot with GFP in L2 (arrow) and scattered in vascular tissue

f GFP in L2 (group of parenchyma cells is green) and L3 (xylem is green) as indicated

with arrows g a vascular bundle with GFP expression (arrow) and parenchyma cells. Scale

bars are all 500 µm.


61

5.4. Discussion

This study is the first to report the introduction of GFP to NLL explants. Previously only

GUS had been applied as a reporter marker for NLL transformation (Pigeaire et al. 1997;

Wijayanto et al. 2009; Ratanasanobon 2014). Although it has been used as a standard in

plant transformation studies, GUS has the disadvantage of chemical reaction dependence.

The leaking blue substrate formed in the GUS assay prevented its use for the microscopy

analysis that was essential for this study (Chapter 4). In addition, GFP could be visualised

four days post transformation, while GUS assay positive results required at least two

weeks after co-cultivation with Agrobacterium (unpublished observation). This result

means GFP was more sensitive and suitable for this early development study than GUS.

Investigation of GFP expression from the Gateway vector construct pH35 (Appendix I;

Fig. 5.1) proved even more illuminating than had initially been expected: rather than

development of chimeric shoots resulting from an occasional transformation event along

with significant recruitment of non-transgenic tissue, as had previously been supposed, it

became apparent that potentially uniformly transformed shoots might be obtained if

tissues below the apical dome were exposed to Agrobacterium (Fig. 5.1e). Green

fluorescence was clearly observed essentially for all cells that were exposed to

Agrobacterium in the transformation of NLL (Fig. 5.3), confirming and extending the

unexpected observations in earlier experiments (Chapter 4, 4.3.5). This result therefore

was consistent with the observed higher frequency of transformation when apical

meristem cell layers were removed from the treated explant in the experiments reported

by Babaoglu et al. (2000). The outcome of this research also suggested a complete

revision of the transformation approach was required. Investigation of which cells or

tissues were competent to regenerate following exposure to Agrobacterium, along with

consideration of the effect of selection on explant health, might provide vital information

62

to enable development of a more efficient transformation methodology.

The use of eGFP as a marker gene demonstrated a significant source of relevant

information to assist testing of the experimental hypotheses, as would be expected from

the wide range of successful applications that have been reported (Voss et al. 2013). There

was no evidence that competent cells in NLL meristem tissue generated any new shoots.

Instead, these results were consistent with the reassessment of plant regeneration

proposed by Sugimoto et al. (2011), the original observations of Pigeaire et al. (1997) that

transformants were generated from axillary buds, the report by Babaoglu et al. (2000) that

genetic manipulation without apical layers of L. mutabilis was more likely to generate

transgenic shoots and the study of Sena et al. (2009) showing that regeneration of new

organs does not require a functional apical meristem.

All the observations about axillary shoot development following SAM wounding are

dedicated with the concept that damage to the apical meristem causes loss of apical

dominance. This finding rejected the suggestion by Teguh Wijayanto (unpublished

report) that using smaller needle caused less damage in the wounded SAM and might

improve transformation efficiency in NLL, which led to the comparison of wounding by

two different size needles in chapter 3. The new deep and broad wounding method in

addition to that outcome creates the opportunity for cells around the vascular tissue to be

transformed, which as summarised by Sugimoto et al. (2011) is the origin of cells that are

competent to regenerate.

Of significance to the aims of this research is the contribution of the distinct layers

identified from research on chimeric plants to the development of axillary buds and,

subsequently to the gametes (Tilney Bassett 1986). Successful selection of T0 transgenic

shoots requires a combination of resistance across layers. It is proposed that in the original

wounding method, shoots originated from non-transgenic axillary shoots regenerating


63

from below the damaged section of the SAM, with transgenic cells being recruited during

early shoot development in the explants, resulting in the observed pattern of transgenic

cells in predominantly non-transgenic shoot tissues. In contrast, the broad and deep

wounding method results in transformation of cells that are competent to develop into

shoots such that the majority of shoots that are generated contain significant proportions

of transgenic tissue (Figs. 5.3, 5.4).

Transfer of a transgene through NLL and other legume gametes usually requires L2 to be

transgenic (Tilney Bassett 1986). Results from Chapter 4 identified that vascular tissue

damage as well as SAM destruction resulted from hygromycin treatment of explants; with

this selection (Chapter 4, Fig.4.2), therefore L3 tolerance is also essential. Theoretically,

lateral organs originate from procambium in PZ of SAM and vascular cambium in plant

stems (Evert 2006). Visualising the cross section of NLL showed that the axillary buds

originated from a group of cells in vascular tissue (Chapter 3, Fig. 3.1d, e). The wide and

deep wounding method (Fig. 5.2) achieved access to the requisite cells, and thus enabled

L2 and L3 transformation within emerging axillary shoots.

From the negative effect of selective agents on NLL shoots (Chapter 4) and the potential

effect of dying cells on transgenic cells in the selection scheme (Joersbo and Okkels

1996), along with the earlier observation that transgenic shoots were emerging from

below the damaged region (Fig. 4.2f, 4.2g, Chapter 4) and the GFP-facilitated observation

that transgenic shoots were generated from axillary buds, it is proposed that if the axillary

meristematic cells could be directly transformed, it would not be necessary to select early

and so the toxic effects could be avoided by later selection. These preliminary

observations therefore led to the hypothesis that applying droplet selection early (day 4

post-transformation according to the original methodology developed by Pigeaire et al.

1997) might reduce transformation efficiency. Therefore, a further experiment was

designed to test this hypothesis (see Chapter 6).

65

CHAPTER 6

TOWARDS IMPROVED METHODOLOGY FOR HIGH-

THROUGHPUT TRANSFORMATION

IN PULSE LEGUMES

6.1. Introduction

Genetic manipulation (GM) of NLL has been possible for approximately two decades.

Transformation of NLL has been achieved through the generation of shoots from

wounded embryonic axes (Tabe and Molvig 2007). However, broad biotechnological

approaches to NLL and other pulse crop improvement are hampered by the extreme

inefficiency of the current methodology (Somers et al. 2003). Barriers that impede NLL

transformation are not only a poor success rate but also that the developing shoots are

usually a chimera, which leads to a low level of transgene transfer to progeny (Wijayanto

2006; Barker et al. 2016). The achievement of transgenic events in previous studies

ranged from 0.4% to 3.3 % of inoculation attempts with generation of chimeric shoots

(Wijayanto et al. 2009; Pigeaire et al. 1997).

These problems with NLL transformation led to an examination of alternative selection

methods (Chapter 4). However, results from the use of hygromycin as a selectable marker

in Chapter 4, along with expression of the green fluorescent protein (GFP) in Chapter 5,

led to the unexpected realisation that the transformation of NLL cells exposed to A.

tumefaciens was essentially universal. The majority of cells exposed by the current

wounding method did not appear to develop into shoots (Chapter 5). Only development

of shoots from deeper tissue could be observed, presumably when stabbing went deeper

than originally intended as these shoots were partially or fully expressing GFP.

66

Observations of the origin of transformed shoots from wounded embryonic axis in

Chapter 5 along with results from three selection regimes in Chapter 4 led to a hypothesis

that applying droplet selection at Day 4 post-transformation might negatively affect the

development of transformed cells. This study, therefore, tested selection schemes with a

new wounding method that would provide information for the design of a more efficient

transformation protocol.

The aims of this chapter were three-fold: first, to markedly improve the frequency of

generation of transgenic NLL shoots; second, to reduce or remove the chimeric structure

of such transgenic shoots; third, to determine if the transformation protocol was

transferable to other pulse legume crops.


6.2.1. Transformation procedure

Narrow leafed lupin explants were wounded following two methods described in

Chapter 5: 1. SAM wounding only and 2. Deep and broad stabbing. Transformation

experiments used AGL0 pH35 (Chapter 5) that harboured GFP-GUS reporter genes,

hygromycin resistance gene (HygR) for plant transformation and

spectinomycin/streptomycin resistance (Sm/SpR) for bacterial transformation. An

additional Gateway vector carrying the bar gene was constructed from pH35 and

pCAMBIA 3301 (Chapter 2, 2.1.2 and 2.2.4, Appendix I). The GFP-bar gene construct

(pB35) was used to evaluate PPT selection versus hygromycin selection (pH35).

Other legumes were germinated as described for NLL and were used for pH35

transformation when seed imbibition was apparent, 2-3 days after initial exposure to

moisture. Species treated were white lupin (L. albus L.), pearl lupin (L. mutabilis L.), L.

pilosus L., field pea (Pisum sativum L.) and faba bean (Vicia faba L.) (large seeded form).

Chapter 6: Towards improved methodology for high-throughput transformation …

67

6.2.2. Sub-culture media and selection protocol

Droplet selection was applied by adding a drop of hygromycin (1 mg ml-1) to the apical

dome of transformed explants on days 4, 10, 13, 16 and 18 post-transformation. Numbers

of surviving explants were recorded one week after droplet treatment.

Transformed explants were cultured in Cc1 media for two days in dark conditions,

then two days under normal light conditions (Fluorescent cool white PAR:

100–170 μmol m-2 s-1). Each explant was washed in 100 mg ml-1 Timentin® and

transferred to new Cc media adding 150 mg L-1 Timentin® (Cc2) to eliminate further

growth of Agrobacterium in the shoots. Two weeks after co-cultivation, transformed

seedlings were moved to regeneration media (Rg). This medium contained the same

components as Cc2 medium except the BAP and NAA were reduced to 1.0 mg L-1 BAP,

0.1 mg L-1 NAA. After two weeks in Rg, emerged shoots were excised individually from

each explant and transferred to Cc3 medium, which is the same as Cc2, but the containers

were labelled differently to indicate in which phase of the experiment that the shoots are.

Shoots were also transferred to another Cc3 for two more weeks to generate more axillary

shoots. All surviving shoots were then subcultured onto micro-propagation media

(Appendix III) with 10 mg L-1 hygromycin selection (MPH10) for two weeks followed

by two weeks on RM-1 (Appendix III) with 30 mg L-1 hygromycin selection (RMH30).

6.3. Results

6.3.1. Selection methodology in combination with broad and deep wounding method

enhanced the transformation efficiency

Application of a 1 mg ml-1 hygromycin droplet onto the apical dome following co-

cultivation of the NLL explants with Agrobacterium, in combination with the two

68

stabbing methods, resulted in data shown in Table 6.1. A comparison of the two wounding

methods showed that with delayed droplet application, the survival of explants increased

dramatically, from 8.6% after application at D4, to 33.6% after application at D16 for the

original wounding method, and up to 75% when the new wounding method was employed

and droplet application was delayed to D18. Statistical analysis of these data indicated

that the trend for differences in explant survival between the old and new wounding

methods was statistically significant (Table 6.1). Due to the very low success rate of the

PPT selection protocol, application of a droplet at 4 days after Agrobacterium treatment

resulted in 0% survival (30 explants were treated with pB35) compared to 4% survival

treated with pH35, examination of eGFP expression was only performed with pH35

transformed explants.

6.3.2. Subculture propagation to reduce chimerism of transformed shoots

Previous results in Chapters 4 and 5 demonstrated visually that the first generation of

transformed shoots were chimeric. The green fluorescence in GFP transformation

explants showed that every cell exposed to Agrobacterium appeared to be transformed.

Transgenic cells therefore were abundant and can be observed clearly in L1, L2 and L3

of the shoot (Fig. 5.4, chapter 5). These results were the initial confirmation of the

abundance by which transgenic shoots could be generated by the improved wounding

methodology in combination with selection on MPH. These outcomes indicated that

further sub-culturing of such materials to generate additional axillary buds from each

original shoot might prove a way to generate more uniformly transgenic materials. Table

6.1 provides the results of a subculture trial to test this hypothesis.


69

Table 6.1. Transformation efficiency at T0 using in media selection

following delayed droplet selection.

In columns Rg, Cc3 and RMH30, value in parentheses is the percent of explants that

produced transgenic shoots, also described as frequency of transformation events as it is

assumed for that calculation that only one genetic transformation occurs per explant.

Cc cocultivation media, Rg regeneration media, MPH 10 micropropagation media with 10 mg L-

1 hygromycin, RMH 30 rooting medium 1 with 30 mg L-1

hygromycin.

Experimenta Cc b Cc2 b Rg c Cc3d MPH 10e RMH 30f

Explants Explants Explants Explants Shoots Explants Shoots Explants Shoots

O-D4 895 895 77 (8.6)

O- D16 125 125 42 (33.6) 34 (27.2) 79 34 85 4 (3.2) 4

O total 1020 1020 119* 4/125***

N-D4 25 25 1 (4.0)

N-D13 96 96 46(47.9) 28 (29.2) 61 28 65 10 (10.4)x 12

N -D16 144 144 100(69.4) 82 (56.9) 99 82 136 17 (11.8)x 31

N- D18 48 48 36 (75) 35 (72.9) 69 35 79 5 (10.4)x 12

N total 313 313 183** 32/288****

a. O -original wounding method, N—broad and deep wounding method. D4, D13, D16 and D18 are

days after transformation at which the droplet selection was implemented. O-D4 data are extracted

from Table 4.2 (Chapter 4) for hygromycin transformation, because restriction of time for the project,

experiment in which explants treated original wounding method with droplet selection at D4 was not

repeated.; b. Number of explants at the start of treatment following application of AGL0:pH 35 (Cc)

and transfer to Cc2 four days after application (100 % survival); c. All explants were moved to Rg at

D18. Number of explants is those surviving seven days after droplet treatment, which was applied

from D13 to D18 as indicated. These data are a subset of those shown in Fig. 5.4. *, **Significant

difference between the combined data for old versus new wounding method following droplet

selection (χ2 = 299.37; p < 0.001). The O-D16 data are also significantly different from the N-D13 to

N-D18 data combined (χ2 = 6.86; p < 0.01); d. After two weeks on Rg, explants and excised shoots

were moved back to Cc (Cc3). Number of explants is the number that were producing shoots. Number

of shoots is the total number of separate shoots excised from explants at time of transfer to Cc3. These

shoots were also propagated on Cc3 for a further two weeks; e. Number of shoots is the total number

of individual or clumped shoots produced after incubation of explants and original excised shoots on

Cc3 for two more weeks. Number of explants remained the same as the previous step; f. Shoots/shoot

clumps (as shown in Fig. 6.1b) were moved to RMH30 after two weeks on MPH10. Shoot tally is the

total still surviving two weeks after transfer. Tally of explants is the number of explants from which

the surviving shoots originated. ***, ****O-D16 explant survival data are statistically significantly

different from the combined N-[D13–D18] (χ2 = 47.49; p < 0.001); x indicates that N-D13, N-D16

and N-D18 data are not significantly different from each other (χ2 = 0.14; p > 0.05).

70

Visualisation in vivo of whole axillary shoots that had emerged from different explants

and had survived further propagation on MPH suggested that these were quite uniform in

eGFP expression within one shoot, but showed some variation between shoots from

different explants (Fig. 6.1a). Clumps of axillary shoots that were obtained from one

round of subsequent sub-culturing on Cc media are shown in Fig. 6.1b. Visualisation of

eGFP expression in subcultured clumps showed variation of expression (Fig. 6.1c).

Figure 6.1. Subculture propagation to reduce chimerism of shoots.

a-c plate cultures. a In vivo imaging of GFP fluorescence in transgenic shoots visualised

using Maestro. Shoots were derived from several explants following one round of media

selection. b typical shoot clumps that develop following two weeks of subculture on Cc3,

c plate of distinct shoots separated after micropropagation of a single original axillary

shoot such as those shown in panel a, with different eGFP abundance apparent in different

subcultured shoots and in sectors of shoot clumps. d transverse cryostat section of the

base of a subcultured shoot, with eGFP expression detected by confocal microscopy.

Scale bar 500 µm


71

All shoot clumps on the plate originated from a single original shoot and segregation of

GFP expression levels was clearly visible. Fig. 6.1d is a cross section through the base of

a piece from a subcultured shoot clump with eGFP expression visualised by confocal

microscopy. Only some vascular tissue in the primary (central) axillary shoot showed

eGFP expression, but both secondary axillary shoots showed abundant GFP expression

in vascular tissue. Together these results support the hypothesis that with appropriate sub-

culturing steps genetically uniform transgenic shoots can be generated.

6.3.3. Preliminary observations with other pulse legumes

The final aim of this research was to investigate the transferability of the new NLL

transformation methodology to other pulse legumes. Fig. 6.2 demonstrates that the

transformation potential of wounded surface cells of other lupin species, field pea and

faba bean is identical to the observations with NLL. Furthermore, development of GFP-

expressing axillary buds was observed in white lupin, L. pilosus, and field pea. The results

shown for faba bean and field pea are from a single experiment performed by a second

operator who had not previously performed the deep and broad wounding method;

furthermore, all results in Fig. 6.2 are the outcome of treatment of fewer than 10

germinated seedling explants for each species. This result confirmed that the data

obtained with NLL were reproducible and provided a robust regeneration methodology

for future genetic transformation of a range of pulse legume species.

6.4. Discussion

The three aims of this research were achieved. First, by applying a change to the

wounding technique enabling genetic transformation of the deeper meristem cells from

which axillary buds develop, and delayed droplet selection improving transgenic shoot

survival, the frequency of generation of transgenic NLL shoot materials was significantly

72

Figure 6.2. GFP expression imaged by confocal microscopy in explants of various

legumes following the deep and broad wounding transformation method.

a-f Samples were hand sectioned. GFP fluorescence is green, whilst chlorophyll

fluorescence is red. g-i Samples were cryostat sectioned. All scale bars are 500 µm.

a-c White lupin. Boxed region in a is an axillary bud enlarged in b and c. b and c are z

sections through the axillary bud showing eGFP fluorescence in different layers. b white

arrow is GFP expression in epidermis (L1). c white arrow points to vascular tissue (L3)

expressing eGFP, double ended white arrow points to PZ tissue and expression in RZ is

circled. d L. mutabilis (pearl lupin) showing eGFP expression along the wounded areas

e-f L. pilosus. e is section through the centre of the SAM. f is a section through an axillary

bud showing expression of eGFP in the epidermis and deeper tissues. g faba bean section

showing eGFP expression around wounded areas. h-i field pea. Axillary shoot

development (boxed region from h) is enlarged in i, showing extensive GFP expression

as was observed for axillary shoots of NLL.


73

improved (Table 6.1). Second, by subsequent propagation in selection the chimeric

structure of transgenic NLL shoots was reduced, with a larger proportion of transgenic

tissues compared to non-transgenic tissues and potential reduction of multiple chimeric

events (Fig. 6.1). Third, the enhanced frequency of generating transgenic shoots was

demonstrably transferable to other pulse legume crops (Fig. 6.2).

Observations described in Chapters 4 and 5 that transgenic shoots were emerging from

the cells below the wounded meristem area led to the hypothesis that early droplet

selection at Day 4 post-transformation might be inappropriate and decrease survival rate.

Therefore, hygromycin droplet selection approaches were trialled for transformations

following co-cultivation of the NLL explants with Agrobacterium.

Early selection in combination with the original wounding method was a less successful

approach than deep and broad stabbing combined with delayed hygromycin droplet

selection, which was the most effective method to achieve transgenic shoot material

(Table 6.1). This result supports the observed effect of delayed selection in Chapter 4,

where improved survival of explants was observed with PPT selection as well as

hygromycin. A moderately enhanced frequency of heritable transgenic shoots was

achieved using the original wounding and selection method by Wijayanto et al. (2009).

In that research, transgenic NLL that had less susceptibility to fungal pathogen due to

expression of the anti-apoptotic baculovirus gene P35 was generated. However, in that

study it was not possible to separate the effects due to operator from those due to the

transgene. By contrast these new results are consistent with the suggestion that reduced

plant cell stress due to inhibition of apoptosis may have enhanced the frequency of

transgenic shoot survival in that example.

Although GFP-expressing shoots were abundant, different extents of chimerism amongst

the transgenic shoots investigated were still observed (Fig. 5.4 Chapter 5, Fig. 6.1).

74

Indeed, in terms of generating transgenic shoot material, the outcome of this research has

been a good example of moving “from rags to an embarrassment of riches”. A further

step in the propagation of transgenic shoots was trialled to reduce multiple transgenic cell

chimerism. It is clear that in NLL shoots that have been generated following culture

selection, there will be abundant transgenic L2 cells (Fig. 6.1d), which contribute to the

formation of gametes (Tilney Bassett 1986) and therefore ensure that the transgenic DNA

is passed to the next generation. Once generated, periclinal chimeras (where one or more

layers are uniformly genetically distinct) are stably maintained during propagation, and a

mericlinal chimera (sectoral through layers) can be stabilised as a periclinal chimera by

propagation from axillary buds (Szymkowiak and Sussex 1996). Two to three rounds of

regenerations were recommended to reduce chimeras in tobacco (Maliga and Nixon

1998) and in strawberry (Mathews et al. 1995). Fig. 6.1 provided strong evidence that

reduction of chimerism can be achieved by sub-culturing putative NLL transformed

shoots.

The results reported here demonstrate that a high frequency of transgenic shoots can be

produced with little effort across pulse legume species by following the methodology as

described. In fact, some of the species transformed here (L albus, L mutabilis) were not

previously successfully transformed using the earlier protocol and the species that were

transformable did not have an abundant outcome of transgenic shoots (SJ Barker,

personal communication). These results and observations in previous chapters are closely

aligned with those described for cereal seedling shoot apical meristem transformation,

which has been applied with success across a range of cereal crop species (Sticklen and

Oraby 2005; Komari et al. 1998). In the case of cereals, transformability of apical cells

also has proven not to be the rate limiting issue as initially reported, and as with pulse

crops, selectable marker use has proven difficult and chimerism of primary transformants

has been reduced significantly by producing and multiplying shoots without selection for


75

several weeks prior to transfer to selection media (Sticklen and Oraby 2005). Based on

the fact that the focus on axillary cells has resulted in successful transformation in both

recalcitrant legumes and in cereals, it is proposed that the same successful outcome by

application of this general methodology is also likely for other dicot species where

transformation has proven difficult to achieve, such as many of the Solanaceae, and many

ornamental species, and also for other monocots such as palms.

In conclusion, if combined with further propagation and selection, it is feasible that this

approach to transgenic shoot regeneration can provide an affordable means of high

throughput genetic transformation that is within the capabilities of personnel in most

pulse research or improvement programs.

77

CHAPTER 7

GENERAL DISCUSSION

Narrow leafed lupin is one of the set of important crop legumes that are recalcitrant to

transformation. The best transformation procedure for legumes is mediated by

Agrobacterium via wounding the shoot apex. Efforts to improve transformation

efficiency and chimerism in transgenic plants have been undertaken (Wijayanto 2006;

Ratanasanobon 2014; Barker et al. 2016), but progress has been hampered globally by

the lack of understanding of the early development of transformed explants. It is the

overarching hypothesis of this thesis that a fundamental investigation of shoot

development would provide vital information to enable generation of an efficient genetic

transformation method. Three keys to achieve this target are: 1. Understanding NLL shoot

apical meristem structure and development; 2. Identification of an alternative selection

method that might stimulate transformed cells and inhibit non-transgenic cells; 3

Visualisation of the transformed shoot developmental processes, in order to determine

whether the limitations of low frequency and chimerism of transgenic shoots could be

overcome. The outcome of this research was expected to be applicable in other

recalcitrant crop legume species because the original transformation methodology had

proven transferable.

7.1. Novel achievements

The study has achieved novel outcomes that satisfied the research aims. Firstly, by

understanding SAM structure and observation of meristem tissues following wounding

with novel reporter gene expression, a change to the wounding technique and

78

implementation of delayed droplet selection enabled genetic transformation of the

meristem cells that generate adventitious shoots. These changes significantly enhance the

transformation efficiency. Secondly, exploration of an alternative selection biochemical,

namely use of antibiotic hygromycin in combination with expression of green fluorescent

protein shed light on transformation and provided an affordable means of high throughput

genetic transformation. Thirdly, the application of subculture regeneration in selection

demonstrably decreased chimeric tissue structure of T0 NLL transformants. The new

protocol gave a higher percentage of transgenic tissues and the preliminary screening

evidence of uniform GFP expression levels support that sub-cultured shoots were derived

from single transformation events. However, DNA evidence would be required to

confirm that observation.

The key to the success of this work was the use of eGFP as a reporter gene to monitor

and localize transgenic cells. Thereby it was possible to understand the differentiation of

the meristem. The easily visualised fluorescent green expression pattern of transgenic

cells in transformed explants and shoots provided information that led to detailed analysis

and important evidence of the early formation and development of transformed shoots

(Chapter 5). The outstanding value of GFP versus GUS which had been used in prior

NLL transformation lay not only in substrate independence but also increased sensitivity

(Chapter 4 and 5). There are several advantages to the use of GFP for plant development

monitoring, such as the ability to follow cell lineages in living tissue (Kurup et al. 2005),

and observations leading to understanding the infection mechanisms of pathogens of host

plants (Nizam et al. 2010). In this study, GFP illuminated shoot meristem differentiation

and chimeric development in plant transformation.

Investigation of selection methodology showed that the antibiotic hygromycin was a more

suitable selection marker for NLL transformation than the herbicide PPT. Comparison of

the effects of these two selective agent activities on NLL shoots revealed that PPT was

Chapter 7: General discussion

79

more toxic in activity, whereas hygromycin performed more selectively (Chapter 4). This

result supports the observation and hypothesis of Wijayanto et al. (2009) that prevention

of cell death in the zone of transformation might improve the survival of transgenic

shoots. Selection with hygromycin was also found efficient in soybean (Olhoft et al.

2003), strawberry (Oosumi et al. 2006), and common bean (Amugune et al. 2011). The

test of acute versus chronic doses of hygromycin in the preliminary experiment (Chapter

4) examined the suggestion of Joersbo and Okkels (1996) that the selection agent inhibits

non-transgenic cell development that would otherwise partially support transformed

shoot growth. Transformation frequency was greater when the selection treatment was

reduced or delayed, supporting this hypothesis (Chapter 6).

Efforts to improve transformation frequency and reduce chimerism of NLL and other

legumes were initiated following observations by Wijayanto (2006) that occasionally,

following early non-transgenic shoot growth, an apparently non-chimeric transgenic

axillary bud could be achieved from the current methodology. Initially attention was

focused on the wounding method. The observation that excessive damage destroyed the

SAM led to testing a reduction in the extent and depth of SAM stabbing. However, this

initiative did not improve transformation frequency either with the original bar gene

selection (unpublished results) or with glyphosate as a novel selection methodology

(Barker et al. 2016).

The combination of hygromycin and eGFP in pH35 proved even more illuminating than

had initially been expected in that it demonstrated the wounded apical meristem was not

competent to regenerate into new shoots, in contrast to the cells that lie in the shoot

axillary buds (Chapter 5). Observations of NLL transformed SAM showed that damage

to the apical meristem caused loss of apical dominance and created the opportunity for

adventitious shoot development (Chapter 5). This result has been discussed in the original

methodology of Pigeaire et al. (1997), who proposed that putative transgenic shoots were

80

regenerated from axillary buds, but that possibility had not been followed by further

developmental analysis until this thesis study. The removal of the apical layer of meristem

in NLL transformation (Chapter 4) did not show any significant difference compared to

the original wounding technique, unlike the positive results for L. mutabilis genetic

manipulation studied by Babaoglu et al. (2000). However, the GFP observations of

transformed meristem were consistent with supportive evidence from de Kathen and

Jacobsen (1995) and Babaoglu et al. (2000), both of which studies indicated that genetic

manipulation after removal of the apical meristem was more likely to generate transgenic

shoots. This is also consistent with the suggestions from Sena et al. (2009) and Sugimoto

et al. (2011) that plant regeneration does not require a functional apical meristem.

From that outcome, a new wounding method that made broad and deep injuries was

examined. The objective was to enable Agrobacterium to reach the deeper tissue,

especially vascular cells, that were hypothesised to be competent and therefore to

generate more transgenic lateral buds as intimated in the theory of Evert (2006) and by

the adventitious shoot formation observed in Chapter 3. Green (by eGFP) transformed

cells were clearly observed wherever Agrobacterium reached (Chapter 5). The

amalgamation of the new wounding method and selection regime led to the development

of more uniformly transgenic shoots at a much higher frequency than in the standard

method, increasing initial explant transformation efficiency up to 75% and generating

axillary shoots with significant transgenic cells (Chapter 6).

Although the number of putative transgenic shoots with GFP expression evidently

increased, a further step to reduce chimerism remained a challenging task. Two rounds

of subculturing were applied to NLL post transformation following recommendation

from Maliga and Nixon (1998) and Mathews et al. (1995). The GFP visualisation

following these subculture steps showed that this approach might enable the target to be

achieved (Chapter 6, Fig. 6.1). Transgenic cells in L2 and L3 are essential to the

Chapter 7: General discussion

81

development of gametes (Tilney Bassett 1986) and of axillary buds (Chapter 4, Fig.4.2,

Evert 2006). A longer time frame study will be required to determine the heritability of

transgenes by the methodologies described here.

7.2. Concluding remarks and future directions

The hypothesis-driven study achieved a number of novel outcomes. Through discovery

of the early development of transformed shoots, an improved efficiency in NLL genetic

engineering has been shown feasible by the application of a novel reporter marker, and

new wounding and selection methods. The enhanced frequency of generating transgenic

shoots was demonstrably transferable to other pulse legume crops meaning that this

technology might be achievable in many other recalcitrant dicot plants.

The increased frequency of events observed in this research means that approaches to

GM crop development that avoid the retention of foreign DNA, such as the CRISPR-

Cas9 methodology (Quétier 2016) could be applied to achieve tailored genetic events that

meet the regulatory requirements of the international community, opening the way for a

range of legume crop improvements that currently are not being attempted. Future work

with T1 materials to examine heritability and DNA structure via methods such as Thermal

asymmetric interlaced PCR or TAIL-PCR (Liu and Whittier 1995) will however be

necessary to finalize this aspect of the transformation methodology.

References

83

References

ABARES (Australian Bureau of Agricultural and Resource Economics and Sciences),

2012. Australian Crop Report, Department of Agriculture, Fisheries and Forestry.

Australia. Available from: http://www.agriculture.gov.au/abares/publications [10

January 2013]

ABARES, 2014. Australian Crop Report, Department of Agriculture, Fisheries and

Forestry, Australia. Available from: http://www.agriculture.gov.au/abares/

publications [15 January 2017]

ABARES, 2015. Agricultural commodity statistics 2015, Department of Agriculture,

Fisheries and Forestry, Australia. Available from: http://www.agriculture.gov.au/

abares/publications [25 August 2016]

Agtrans Research, 2012. An economic analysis of GRDC investment in national lupin

breeding for Southern Australia. GRDC (Grains Research and Development

Corporation) impact assessment report series, Canberra, Australia. Available from:

https://grdc.com.au/about/our-investment-process/impact-assessment [13 February

2015]

Aida, M., Ishida, T. and Tasaka, M., 1999. Shoot apical meristem and cotyledon

formation during Arabidopsis embryogenesis: interaction among the CUP-

SHAPED COTYLEDON and SHOOT MERISTEMLESS genes. Development

(Cambridge, England), 126(8), pp.1563–70. Available from: https://onesearch.

library.uwa.edu.au [16 October 2012]

Akcay, U.C. et al., 2009. Agrobacterium tumefaciens-mediated genetic transformation of

a recalcitrant grain legume, lentil (Lens culinaris Medik). Plant Cell Reports, 28(3),

pp.407–17. Available from: https://onesearch.library.uwa.edu.au [7 November

2012]

Amugune, N., Anyango, B. and Mukiama, T., 2011. Agrobacterium-mediated

transformation of common bean. African Crop Science Journal, 19(3), pp.137–147.

Available from: https://onesearch.library.uwa.edu.au [7 November 2012]

Anwar, F. et al., 2011. An efficient in vitro regeneration protocol for faba bean (Vicia

faba L.). Journal of Medicinal Plants Research, 5(28), pp.6460–6467. Available

from: https://onesearch.library.uwa.edu.au [26 November 2012]

Arul, L., Benita, G. and Balasubramanian, P., 2008. Functional insight for β-

glucuronidase in Escherichia coli and Staphylococcus sp. RLH1. Bioinformation,

2(8), pp.339–343. Available from: https://onesearch.library.uwa.edu.au [28 June

2016]

Atif, R.M. et al., 2013. Gene transfer in legumes. In U. Lüttge et al., eds. Progress in

Botany. Berlin, Heidelberg: Springer, pp. 37–100. Available from:

https://onesearch.library.uwa.edu.au [30 June 2016]

84

Atkins, C.A., Emery, R.J.N. and Smith, P.M.C., 2011. Consequences of transforming

narrow leafed lupin (Lupinus angustifolius [L.]) with an ipt gene under control of a

flower-specific promoter. Transgenic Research, 20(6), pp.1321–32. Available

from: https://onesearch.library.uwa.edu.au [22 January 2015 ]

Babaoglu, M. et al., 2000. Agrobacterium-mediated transformation of Lupinus mutabilis

L. using shoot apical explants. Acta Physiologiae Plantarum, 22(2), pp.111–119.

Available from: https://onesearch.library.uwa.edu.au [7 November 2012]

Barker, S.J., Harada, J.J. and Goldberg, R.B., 1988. Cellular localization of soybean

storage protein mRNA in transformed tobacco seeds. Proceedings of the National

Academy of Sciences, USA, 85(2), pp.458–462. Available from: https://onesearch.

library.uwa.edu.au [19 January 2017]

Barker, S.J. et al., 2016. Regeneration selection improves transformation efficiency in

narrow-leaf lupin. Plant Biotechnology, (Plant Cell, Tissue and Organ Culture

(PCTOC)), Vol.126(2), pp.219-228. Available from: https://onesearch.library.

uwa.edu.au [28 June 2016]

Barton, M.K. and Poethig, R.S., 1993. Formation of the shoot apical meristem in

Arabidopsis thaliana: an analysis of development in the wild type and in the shoot

meristemless mutant. Development (Cambridge, England), 119, pp.823–831.

Available from: https://onesearch.library.uwa.edu.au [11 September 2012]

Beeckman, T. and Engler, G., 1994. An easy technique for the clearing of histochemically

stained plant tissue. Plant Molecular Biology Reporter, 12(1), pp.37–42. Available

from: https://onesearch.library.uwa.edu.au [11 September 2012]

Bøhn, T. et al., 2014. Compositional differences in soybeans on the market: glyphosate

accumulates in Roundup Ready GM soybeans. Food Chemistry, 153, pp.207–215.

Available from: https://onesearch.library.uwa.edu.au [6 May 2017]

Bowman, J.L. and Eshed, Y., 2000. Formation and maintenance of the shoot apical

meristem. Trends in Plant Science, 5(3), pp.110–115. Available from:

https://onesearch.library.uwa.edu.au [15 October 2012]

Bowran, D. and Hashem, A., 2008. The role of weed management in sustaining systems

for lupin production. In Lupins for Health and Wealth Proceedings of the 12th

International Lupin Conference. pp. 14–18. Available from:

https://www.researchgate.net/profile/Abul_Hashem/publication [26 June 2016]

Burstin, J. et al., 2011. Improving protein content and nutrition quality. In A. Pratap and

J. Kumar, eds. Biology and Breeding of Food Legumes. Wallingford, Oxfordshire,

UK, p. 432. Available from: The University of Western Australia, Barry J Marshall

Library, Science main collection 2nd floor 583.74 2011 BIO. [26 June 2014]

Cai, W., 2014. Transcriptional regulation of chloroplast ascorbate peroxidases in

Arabidopsis thaliana. PhD thesis, Freie Universität Berlin. Available from:

http://www.diss.fu-berlin.de [01 May 2016]

Carlos Popelka, J., Terryn, N. and Higgins, T.J.., 2004. Gene technology for grain

References

85

legumes: can it contribute to the food challenge in developing countries? Plant

Science, 167(2), pp.195–206. Available from: https://onesearch.library.uwa.edu.au

[2 December 2012]

Carraro, N. et al., 2006. Cell differentiation and organ initiation at the shoot apical

meristem. Plant Molecular Biology, 60(6), pp.811–26. Available from:

https://onesearch.library.uwa.edu.au [11 September 2012]

Chandra, A. and Pental, D., 2003. Regeneration and genetic transformation of grain

legumes: an overview. Current Science, 84(3), pp.381–387. Available from:

http://dx.doi.org/10.1016/j.plantsci.2004.03.027 [2 December 2012]

Chen, G.Q., 2011. Effective reduction of chimeric tissue in transgenics for the stable

genetic transformation of Lesquerella fendleri. HortScience, 46(1), pp.86–90.

Available from: http://hortsci.ashspublications.org [20 April 2016]

Chien, C.-T. et al., 2011. Deep simple epicotyl morphophysiological dormancy in seeds

of two Viburnum species, with special reference to shoot growth and development

inside the seed. Annals of Botany, 108(1), pp.13–22. Available from:

http://www.pubmedcentral.nih.gov [10 October 2012]

Chudakov, D.M. et al., 2010. Fluorescent proteins and their applications in imaging living

cells and tissues. Physiological Reviews, 90(3), pp.1103–63. Available from:

http://www.pubmedcentral.nih.gov [1 July 2016]

de Kathen, A. and Jacobsen, H.J., 1995. Cell competence for Agrobacterium-mediated

DNA transfer in Pisum sativum L. Transgenic Research, 4(3), pp.184–191.

Available from: https://www.researchgate.net/publication/300155959_

Transformation_in_Pea_Pisum_sativum_L [14 September 2016]

de Ruijter, N.C.A. et al., 2003. Evaluation and comparison of the GUS, LUC and GFP

reporter system for gene expression studies in plants. Plant Biology, 5(2), pp.103–

115. Available from: http://doi.wiley.com/10.1055/s-2003-40722 [20 December

2015]

Dracup, M. and Kirby, E.J.M., 1996. Lupin Development Guide, University of Western

Australia Press.

Du Bois, C.M. and Tan, C.-B., 2008. The world of Soy, University of Illinois Press.

Duan, Y. et al., 2012. An efficient and high-throughput protocol for Agrobacterium-

mediated transformation based on phosphomannose isomerase positive selection in

Japonica rice (Oryza sativa L.). Plant Cell Reports, 31(9), pp.1611–1624. Available

from: https://onesearch.library.uwa.edu.au [18 May 2015]

http://hortsci.ashspublications.org/

http://doi.wiley.com/10.1055/s-2003-40722%20%5b20

86

Eapen, S., 2008. Advances in development of transgenic pulse crops. Biotechnology

Advances, 26(2), pp.162–168. Available from: https://onesearch.library.uwa.edu.au

[8 January 2013]

Evert, R.F., 2006. Esau’s Plant Anatomy, Hoboken, NJ, USA: John Wiley and Sons, Inc.

Fischer, A.H. et al., 2008. Fixation and permeabilization of cells and tissues. Cold Spring

Harbor Protocols, 2008(5), pp.pdb-top36. Available from: http://cshprotocols.

cshlp.org [09 August 2013]

Graham, P.H. and Vance, C.P., 2003. Legumes: importance and constraints to greater

use. Plant Pysiology, 131(3), pp.872–877. Available from: https://onesearch.

library.uwa.edu.au [02 February 2012]

Grbić, V. and Bleecker, A.B., 2000. Axillary meristem development in Arabidopsis

thaliana. The Plant Journal, 21(2), pp.215-223. Available from: https://onesearch.

library.uwa.edu.au [28 April 2015]

Gritz, L. and Davies, J., 1983. Plasmid-encoded hygromycin B resistance: the sequence

of hygromycin B phosphotransferase gene and its expression in Escherichia coli

and Saccharomyces cerevisiae. Gene, 25(2–3), pp.179–188. Available from:


Haseloff, J. et al., 1997. Removal of a cryptic intron and subcellular localization of green

fluorescent protein are required to mark transgenic Arabidopsis plants brightly.

Proceedings of the National Academy of Sciences, USA, 94(6), pp.2122–2127.

Available from: https://onesearch.library.uwa.edu.au [8 January 2013]

Holsters, M. et al., 1978. Transfection and transformation of Agrobacterium tumefaciens.

Molecular and General Genetics MGG, 163(2), pp.181–187.

Huala, E. and Sussex, I.M., 1993. Determination and Cell Interactions in Reproductive

Meristems. The Plant Cell, 5(10), pp.1157–1165. Available from:


Iantcheva, A., Mysore, K.S. and Ratet, P., 2013. Transformation of leguminous plants to

study symbiotic interactions. International Journal of Developmental Biology,

57(6-7–8), pp.577–586. Available from: https://onesearch.library.uwa.edu.au [30

November 2015]

James, C., 2015. Global status of commercialized biotech/GM crops: 2015. Ithaca:

International Service for the Acquisition of Agri-Biotech Applications (ISAAA),

NY, 51.

Jefferson, R.A., 2001. Preparation of cellobiuronic acid from polysaccharide. U.S. Patent

6,268,493. Available from: http://appft1.uspto.gov/netacgi [11 May 2014]

Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W., 1987. GUS fusions: beta-

glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The

EMBO journal, 6(13), p.3901. Available from: https://onesearch.library.

uwa.edu.au [30 November 2012]

References

87

Joersbo, M. and Okkels, F.T., 1996. A novel principle for selection of transgenic plant

cells: positive selection. Plant Cell Reports, 16(3–4), pp.219–21. Available from:


Jube, S. and Borthakur, D., 2009. Development of an Agrobacterium-mediated

transformation protocol for the tree-legume Leucaena leucocephala using

immature zygotic embryos. Plant Cell, Tissue and Organ Culture, 96(3), pp.325–

333. Available from: https://onesearch.library.uwa.edu.au [13 January 2013]

Kaczmarek, S.A., Kasprowicz-Potocka, M., Hejdysz, M., Mikuła, R. and Rutkowski, A.,

2014. The nutritional value of narrow-leafed lupin (Lupinus angustifolius) for

broilers. Journal of Animal and Feed Sciences, 23(2), pp.160-166. Available from:

https://onesearch.library.uwa.edu.au [12 February 2017]

Karami, O. et al., 2009. Agrobacterium-mediated genetic transformation of plants: The

role of host. Biologia Plantarum, 53(2), pp.201–212. Available from:


Kartha, K.K. et al., 1981. Plant regeneration from meristems of grain legumes: soybean,

cowpea, peanut, chickpea, and bean. Canadian Journal of Botany, 59(9), pp.1671–

1679. Available from: http://www.nrcresearchpress.com [14 February 2013]

Keogh, R.C., Robinson, A.P.W. and Mullins, I.J., 2010. Case study 17: Lupins.

Pollination Aware: Raising the Profile of an Undervalued Service. Rural Industries

Research and Development Corporation, Australian Government. Publication No

10.

Kiyokawa, K., Yamamoto, S., Sakuma, K., Tanaka, K., Moriguchi, K. and Suzuki, K.,

2009. Construction of disarmed Ti plasmids transferable between Escherichia coli

and Agrobacterium species. Applied and environmental microbiology, 75(7),

pp.1845-1851. Available from: https://onesearch.library.uwa.edu.au [30 September

2013]

Komari, T. et al., 1998. Advances in cereal gene transfer. Current Opinion in Plant

Biology, 1(2), pp.161–165. Available from: https://onesearch.library.uwa.edu.au

[09 November 2012]

Kurup, S. et al., 2005. Marking cell lineages in living tissues. The Plant Journal, 42(3),

pp.444–453. Available from: https://onesearch.library.uwa.edu.au [13 March 2013]

Lawrance, L., 2007. Lupins: Australia’s Role in World Markets. Agricultural

Commodities, 14(2), p.353.

Lazo, G.R., Stein, P.A. and Ludwig, R.A., 1991. A DNA transformation–competent

Arabidopsis genomic library in Agrobacterium. Nature Biotechnology, 9(10),

pp.963-967. Available from: http://www.ncbi.nlm.nih.gov/pubmed/1368724 [09

December 2014]

88

Lenhard, M., Jürgens, G. and Laux, T., 2002. The WUSCHEL and

SHOOTMERISTEMLESS genes fulfil complementary roles in Arabidopsis shoot

meristem regulation. Development (Cambridge, England), 129(13), pp.3195–206.

Available from: https://onesearch.library.uwa.edu.au [21 March 2013]

Lewis, G., 2005. Legumes of the world, Kew: Royal Botanic Gardens.

Liang, X. et al., 2013. Single step BP/LR combined Gateway reactions. Biotechniques,

55(5), pp.265–268. Available from: https://onesearch.library.uwa.edu.au [01 August

2015]

Liu, Y.-G. and Whittier, R.F., 1995. Thermal asymmetric interlaced PCR: automatable

amplification and sequencing of insert end fragments from P1 and YAC clones for

chromosome walking. Genomics, 25(3), pp.674–681. Available from:

https://onesearch.library.uwa.edu.au [05 August 2016]

Ludwig, S.R. et al., 1990. A regulatory gene as a novel visible marker for maize

transformation. Science, 247(4941), pp.449–451. Available from: https://

onesearch.library.uwa.edu.au [29 May 2015]

Lulsdorf, M.M. et al., 1991. Optimizing the production of transformed pea (Pisum

sativum L.) callus using disarmed Agrobacterium tumefaciens strains. Plant Cell

Reports, 9(9), pp.479–483. Available from: https://onesearch.library.uwa.edu.au

[20 April 2015]

Maliga, P. and Nixon, P.J., 1998. Judging the homoplastomic state of plastid

transformants. Trends in Plant Science, 3(10), pp.376–377.

Martin, C.J.H., Watson, R.R. and Preedy, V.R., 2013. Nutrition and Diet in

Menopause (Google eBook), Springer Science and Business Media. Dordrecht,

Boston, Kluwer Academic Publishers

Mathews, H. et al., 1995. Genetic transformation of strawberry: stable integration of a

gene to control biosynthesis of ethylene. In Vitro Cellular and Developmental

Biology-Plant, 31(1), pp.36–43. Available from: https://onesearch.library.

uwa.edu.au [20 April 2016]

Medford, J.I., 1992. Vegetative apical meristems. The Plant Cell, 4(9), pp.1029-1039.

Available from: https://onesearch.library.uwa.edu.au [20 April 2016]

Miki, B. and McHugh, S., 2004. Selectable marker genes in transgenic plants:

applications, alternatives and biosafety. Journal of Biotechnology, 107(3), pp.193–

232. Available from: https://onesearch.library.uwa.edu.au [25 February 2013]

Millwood, R.J., Moon, H.S. and Stewart Jr, C.N., 2010. Fluorescent proteins in transgenic

plants. In Reviews in Fluorescence 2008. Springer, pp. 387–403. Available from:

https://onesearch.library.uwa.edu.au [20 May 2014]

Mishra, M.K. and Slater, A., 2012. Recent advances in the genetic transformation of

coffee. Biotechnology Research International, 2012. Available from:

https://onesearch.library.uwa.edu.au [03 December 2012]

References

89

Molvig, L. et al., 1997. Enhanced methionine levels and increased nutritive value of seeds

of transgenic lupins (Lupinus angustifolius L.) expressing a sunflower seed albumin

gene. Proceedings of the National Academy of Sciences, USA, 94(16), pp.8393–

8398. Available from: https://onesearch.library.uwa.edu.au [30 November 2011]

Mordhorst, A.P. et al., 2002. Somatic embryogenesis from Arabidopsis shoot apical

meristem mutants. Planta, 214(6), pp.829–36. Available from:

http://www.ncbi.nlm.nih.gov/pubmed/11941458 [21 March 2013]

Murray, J.A., Jones, A., Godin, C. and Traas, J., 2012. Systems Analysis of Shoot Apical

Meristem Growth and Development: Integrating Hormonal and Mechanical

Signaling. The Plant Cell, 24(10), pp.3907–3919. Available from:


Nadolska-Orczyk, A., 1992. Somatic embryogenesis of agriculturally important lupin

species (Lupinus angustifolius, L. albus, L. mutabilis). Plant Cell, Tissue and Organ

Culture, 28(1), pp.19–25. Available from: https://onesearch.library.uwa.edu.au [25

May 2016]

Nelson, M.N. et al., 2006. The first gene-based map of Lupinus angustifolius L.-location

of domestication genes and conserved synteny with Medicago truncatula.

Theoretical and Applied Genetics, 113(2), pp.225–238. Available from:


Nguyen, T.A., 2002. An Improved Reporter System Based on Novel [beta]-glucuronidase

(GUS) from Staphylococcus Sp, Ph.D. thesis, Australian National University.

Available from: http://www.bios.net/daisy/cambia-old/3707.html

Nizam, S., Singh, K. and Verma, P.K., 2010. Expression of the fluorescent proteins

DsRed and EGFP to visualize early events of colonization of the chickpea blight

fungus Ascochyta rabiei. Current Genetics, 56(4), pp.391–399. Available from:

https://onesearch.library.uwa.edu.au [28 April 2016]

OGTR, 2013. The Biology of Lupinus L . (lupin or lupine ) Version 1, Office of the Gene

Technology Regulator, Department of Health and Ageing, Canberra.

Olhoft, P.M. et al., 2003. Efficient soybean transformation using hygromycin B selection

in the cotyledonary-node method. Planta, 216(5), pp.723–35. Available from:

https://onesearch.library.uwa.edu.au [22 July 2013]

Oosumi, T. et al., 2006. High-efficiency transformation of the diploid strawberry

(Fragaria vesca) for functional genomics. Planta, 223(6), pp.1219–30. Available

from: http://www.ncbi.nlm.nih.gov/pubmed/16320068 [10 September 2012]

Pálmason, F., Danso, S.K.A. and Hardarson, G., 1992. Nitrogen accumulation in sole and

mixed stands of sweet-blue lupin (Lupinus angustifolius L.), ryegrass and oats.

Plant and Soil, 142(1), pp.135–142. Available from: https://onesearch.library.

uwa.edu.au [28 April 2013]

90

Paz, M.M. et al., 2006. Improved cotyledonary node method using an alternative explant

derived from mature seed for efficient Agrobacterium-mediated soybean

transformation. Plant Cell Reports, 25(3), pp.206–13. Available from:


Pérez-Clemente, R.M. et al., 2005. Transgenic peach plants (Prunus persica L.) produced

by genetic transformation of embryo sections using the green fluorescent protein

(GFP) as an in vivo marker. Molecular Breeding, 14(4), pp.419–427. Available

from: https://onesearch.library.uwa.edu.au [18 May 2015]

Pierik, R.L., 1999. In vitro Culture of Higher Plants, Springer Science and Business

Media. Dordrecht, Boston, Kluwer Academic Publishers.

Pigeaire, A. et al., 1997. Transformation of a grain legume (Lupinus angustifolius L.) via

Agrobacterium tumefaciens-mediated gene transfer to shoot apices. Molecular

Breeding, 3(5), pp.341–349. Available from: https://onesearch.library.uwa.edu.au

[08 November 2012]

Quaedvlieg, N.E. et al., 1998. Fusions between green fluorescent protein and β-

glucuronidase as sensitive and vital bifunctional reporters in plants. Plant

Molecular Biology, 37(4), pp.715–727. Available from: https://onesearch.library.

uwa.edu.au [03 December 2012]

Quétier, F., 2016. The CRISPR-Cas9 technology: closer to the ultimate toolkit for

targeted genome editing. Plant Science, 242, pp.65-76. Available from:


Rakosy-Tican, E. et al., 2007. The usefulness of the gfp reporter gene for monitoring

Agrobacterium-mediated transformation of potato dihaploid and tetraploid

genotypes. Plant Cell Reports, 26(5), pp.661–71. Available from:


Ratanasanobon, K., 2014. Investigation of alternative approaches to narrow-leafed lupin

(Lupinus angustifolius) genetic transformation. PhD thesis, Murdoch University.

Available from: http://researchrepository.murdoch.edu.au [02 September 2014]

Reichel, C. et al., 1996. Enhanced green fluorescence by the expression of an Aequorea

victoria green fluorescent protein mutant in mono-and dicotyledonous plant cells.

Proceedings of the National Academy of Sciences, USA, 93(12), pp.5888–5893.

Available from: https://onesearch.library.uwa.edu.au [29 May 2015]

Saini, R. and Jaiwal, P.K., 2005. Transformation of a recalcitrant grain legume, Vigna

mungo L. Hepper, using Agrobacterium tumefaciens-mediated gene transfer to

shoot apical meristem cultures. Plant Cell Reports, 24(3), pp.164–71. Available

from: https://onesearch.library.uwa.edu.au [10 January 2013]

Sambrook, J. et al., 1989. Molecular cloning: a laboratory manual (No. Ed. 2), Cold

Spring Harbor laboratory press, New York.

References

91

Satina, S., Blakeslee, A.F. and Avery, A.G., 1940. Demonstration of the three germ layers

in the shoot apex of Datura by means of induced polyploidy in periclinal chimeras.

American Journal of Botany, 27(10), pp.895–905.

Sauer, J. and Nygaard, P., 1999. Expression of the Methanobacterium

thermoautotrophicum hpt gene, encoding hypoxanthine (guanine)

phosphoribosyltransferase, in Escherichia coli. Journal of Bacteriology, 181(6),

pp.1958–1962.

Schmidt, R. and Willmitzer, L., 1988. High efficiency Agrobacterium tumefaciens-

mediated transformation of Arabidopsis thaliana leaf and cotyledon explants. Plant

Cell Reports, 7(7), pp.583–586.

Sena, G. et al., 2009. Organ regeneration does not require a functional stem cell niche in

plants. Nature, 457(7233), pp.1150–3. Available from: http://www.nature.com.

ezproxy.library.uwa.edu.au/nature/journal [11 November 2012]

Sinclair, T.R. and Vadez, V., 2012. The future of grain legumes in cropping systems.

Crop and Pasture Science, 63(6), p.501. Available from: http://www.publish.

csiro.au/view/journals [08 January 2013]

Somers, D.A., Samac, D.A. and Olhoft, P.M., 2003. Recent advances in legume

transformation. Plant Physiology, 131(3), pp.892–899. Available from:

http://www.plantphysiol.org [08 October 2012]

Sroga, G.E., 1983. Callus and suspension culture of Lupinus angustifolius cv. turkus.

Plant Science Letters, 32(1–2), pp.183–192. Available from: http://linkinghub.

elsevier.com [05 September 2015]

Sroga, G.E., 1987. Plant regeneration of two Lupinus spp. from callus cultures via

organogenesis. Plant Science, 51(2–3), pp.245–249. Available from:

http://linkinghub.elsevier.com [05 September 2015]

Steeves, T.A. and Sussex, I.M., 1989. Patterns in Plant Development, Cambridge:

Cambridge University Press.

Stewart Jr, C.N., 2001. The utility of green fluorescent protein in transgenic plants. Plant

Cell Reports, 20(5), pp.376–382. Available from: http://www.springerlink.com [10

September 2012]

Sticklen, M.B. and Oraby, H.F., 2005. Shoot apical meristem: A sustainable explant for

genetic transformation of cereal crops. In Vitro Cellular and Developmental

Biology - Plant, 41(3), pp.187–200. Available from: http://www.springerlink.com

[10 September 2012]

Sugimoto, K., Gordon, S.P. and Meyerowitz, E.M., 2011. Regeneration in plants and

animals: dedifferentiation, transdifferentiation, or just differentiation? Trends in

Cell Biology, 21(4), pp.212–8. Available from http://dx.doi.org/10.1016 [09

November 2012]

http://www.plantphysiol.org/

http://dx.doi.org/10.1016%20%5b09

92

Szymkowiak, E.J. and Sussex, I.M., 1992. The internal meristem layer (L3) determines

floral meristem size and carpel number in tomato periclinal chimeras. The Plant

Cell, 4(9), pp.1089–100.

Szymkowiak, E.J. and Sussex, I.M., 1996. What chimeras can tell us about plant

development. Annual Review of Plant Biology, 47(1), 351-376. Available from:


Tabe, L.M. and Molvig, L., 2007. Lupins. In E.-C. Pua and M. R. Davey, eds.

Biotechnology in Agriculture and Forestry: Transgenic crop VI. Biotechnology in

Agriculture and Forestry. Springer Berlin Heidelberg, pp. 397–408. Available from

http://link.springer.com [30 November 2012]

Tilney-Bassett, R.A., 1986. Plant chimeras, Edward Arnold (Publishers) Ltd, UK.

Tirichine, L. et al., 2009. 3D fluorescent in situ hybridization using Arabidopsis leaf

cryosections and isolated nuclei. Plant Methods, 5(1), p.11. Available from:

http://www.plantmethods.com/content/5/1/11 [13 March 2013]

Tiwari, S. and Tuli, R., 2012. Optimization of factors for efficient recovery of transgenic

peanut (Arachis hypogaea L.). Plant Cell, Tissue and Organ Culture (PCTOC),

109(1), pp.111-121. Available from: https://onesearch.library.uwa.edu.au [20 April

2016]

Ujváry, I., 2010. Pest control agents from natural products. In Hayes' Handbook of

Pesticide Toxicology (Third Edition) (pp. 119-229). Available from:


Unkovich, M.J. and Pate, J.S., 2000. An appraisal of recent field measurements of

symbiotic N2 fixation by annual legumes. Field Crops Research, 65(2), pp.211–

228. Available from: https://onesearch.library.uwa.edu.au [06 May 2014]

Voss, U., Larrieu, A. and Wells, D.M., 2013. From jellyfish to biosensors: the use of

fluorescent proteins in plants. International Journal of Developmental Biology,

57(6-7–8), pp.525–533. Available from: https://onesearch.library.uwa.edu.au [11

May 2016]

West, P. et al., 1999. Green fluorescent protein (GFP) as a reporter gene for the plant

pathogenic oomycete Phytophthora palmivora. FEMS Microbiology Letters,

178(1), pp.71–80. Available from: https://onesearch.library.uwa.edu.au [22 June

2016]

Wijayanto, T., 2006. Genetic manipulation of programmed cell death (PCD) for reduced

susceptibility to necrotrophic fungi in narrow-leafed lupin (Lupinus angustifolius).

PhD thesis, The University of Western Australia. Available from:


Wijayanto, T. et al., 2009. Significant reduction of fungal disease symptoms in transgenic

lupin (Lupinus angustifolius) expressing the anti-apoptotic baculovirus gene p35.

Plant Biotechnology Journal, 7(8), pp.778–90. Available from: https://onesearch.

library.uwa.edu.au [31 July 2014]

References

93

Wild, A. and Wendler, C., 1991. Effect of glufosinate (phosphinothricin) on amino acid

content, photorespiration and photosynthesis. Photosynthesis Research, 24(1), pp

55-61.

Wilms, F.H.A. and Sassen, M.M.A., 1987. Origin and development of floral buds in

tobacco explants. New Phytologist, 105(1), pp.57–65. Available from:


Wiszniewski, A., 2011. Dissecting functions of members of beta-oxidation multi-gene

families in Arabidopsis. PhD thesis, The University of Western Australia. Available

from: https://onesearch.library.uwa.edu.au [21 March 2015]

Wolko, B. et al., 2011. Lupinus. In C. Kole, ed. Wild Crop Relatives: Genomic and

Breeding Resources - Legume Crops and Forages. Berlin, Heidelberg: Springer

Berlin Heidelberg, pp. 153–206. Available from: http://link.springer.com [08

January 2013]

Xiao, Y.-L. et al., 2010. High throughput generation of promoter reporter (GFP)

transgenic lines of low expressing genes in Arabidopsis and analysis of their

expression patterns. Plant Methods, 6(1), p.18. Available from: http://www.

plantmethods.com/content/6/1/18 [03 December 2012]

Yamada, T., Takagi, K. and Ishimoto, M., 2012. Recent advances in soybean

transformation and their application to molecular breeding and genomic analysis.

Breeding Science, 61(5), pp.480–494. Available from: http://www.pubmedcentral.

nih.gov [30 November 2012]

Yeung, E.C.T. et al. eds., 2015. Plant Microtechniques and Protocols, Cham: Springer

International Publishing. Available from: http://link.springer.com [01 March 2013]

95

APPENDICES

Appendix I

The circular map of constructs created by SnapGene(R).

Sm/SpR: streptomycin/spectinomycin resistance to bacteria; KanR: kanamycin resistance

to bacteria; HygR: Hygromycin resistance gene; Bar: phosphinothricin resistance gene;

2x35S: CaMV35S eukaryotic promoter with duplicated enhancer region; 35S: CaMV35S

eukaryotic promoter; GUS: β-glucuronidase reporter gene – uidA; GUSPlus: GUSPlusTM

reporter gene; eGFP: enhanced green fluorescent gene; T-NOS, P-NOS: nopaline

synthase terminator/promoter; Kpnl, XbaI, EcoRI, MauBI: restriction enzymes; LB: left

border of T-DNA; RB: Right border of T-DNA;

96

Appendix II

Primer sequences

Primer Sequence

Nos H+B F AAGACCGGCAACAGGATTCA

Nos H+B R CGTTCCATAAATTCCCCTCGG

EgfpF ACAAGCAGAAGAACGGCATCA

EgfpR CGATCCAGACTGAATGCCCA

attb1-2x35S F GGGGACAAGTTTGTACAAAAAAGCAGGCTYYGAGGCGGTTTGCGTATTG

attb2-2x35S R GGGGACCACTTTGTACAAGAAAGCTGGGTYGCGAAAGCTCGAGAGAGATAGA

SHBAR1_F TCTGCACCATCGTCAACCAC

SHBAR1_R ACTTCAGCAGGTGGGTGTAG

Appendices

97

Appendix III

Tissue culture media and solutions

Media Medium components

Tissue culture media

CC-1 Co-cultivation medium - 1 1xMS salts, 3% (w/v) sucrose, pH to 5.7, 0.3% (w/v) phytagel. Autoclave. 1X B5 vitamins, 10.0 mg L-1 BAP, 1.0 mg L-1 NAA

CC-2,3

Co-cultivation medium - 2,3 Co-cultivation medium - 1, 150 mg L-1 timentin.

Rg Regeneration medium 1xMS salts, 3% (w/v) sucrose, pH to 5.7, 0.3% (w/v) phytagel. Autoclave. 1X B5 vitamins, 1.0 mg L-1 BAP, 0.1 mg L-1 NAA, 150 mg L-1 timentin.

MP Micropropagation medium 1xMS salts, 3% (w/v) sucrose, 0.5 g L-1 MES, pH to 5.7, 0.7% (w/v) phytoblend. Autoclave. 1X B5 vitamins, 0.1 mg L-1 BAP, 0.01 mg L-1 NAA, 150 mg L-1 timentin.

RM -1 Rooting medium -1 1xMS salts, 3% (w/v) sucrose, 0.5 g L-1 MES, pH to 5.7, 0.6% (w/v) phytoblend. Autoclave. 1X B5 vitamins, 0.1 mg L-1 BAP, 0.01 mg L-1 NAA, 150 mg L-1 timentin, 3.0 mg L-1 IBA, 0.1 mM aromatic amino acids, 1 mg L-1 ascorbic acid.

RM -2 Rooting medium -2 Rooting medium -1, 2 mg L-1 activated charcoal

Other media

LB broth 10 g L-1 Bacto™ tryptone, 5 g L-1 yeast extract, 10 g L-1 NaCl, pH 7.0. Autoclave

LB agar LB broth, 15 g L-1 Bacto agar. Autoclave

MS based solution Autoclaved 1xMS salts, pH to 5.7, 20 µM acetosyringone (3, 5-dimethoxy-4-hydroxyacetophenone), 10 mM D-glucose, 0.1% silwet L77.

98

Appendix IV

Using green fluorescent protein sheds light on Lupinus angustifolius L. transgenic shoot

development. Plant Cell, Tissue and Organ Culture (PCTOC), pp. 665–674.

Appendices

99

ORI INAL ARTICLE

SIG5B #. B5F?9F

[email protected]

1 C9BHF9 :CF )@5BH 9B9Hi7G 5B8 BF998iB; () B), S7hCC@ C:

)@5BH BiC@C;M &080, ,h9 -BiJ9FGiHM C: /9GH9FB AIGHF5@i5,

CF5K@9M, /A 6009, AIGHF5@i5

2 S7hCC@ C: )@5BH BiC@C;M &090, ,h9 -BiJ9FGiHM C: /9GH9FB

AIGHF5@i5, CF5K@9M, /A 6009, AIGHF5@i5

3 F57I@HM C: BiC@C;M, H5BCi -BiJ9FGiHM C: S7i9B79, H5BCi,

.i9HB5A

4 F5?I@H5G )9FH5Bi5B, -BiJ9FGiH5G H5@I (@9C, K9B85Fi,

SI@5K9Gi ,9B;;5F5, IB8CB9Gi5

5 IBGHiHIH9 C: A;Fi7I@HIF9 &082, ,h9 -BiJ9FGiHM C: /9GH9FB

AIGHF5@i5, CF5K@9M, /A 6009, AIGHF5@i5

*979iJ98: 30 #IB9 2016 / A779DH98: 26 AI;IGH 2016

T SDFiB;9F S7i9B79+BIGiB9GG &98i5 DCF8F97hH 2016

Using green fluorescent protein sheds light on Lupinus

angustifolius L. transgenic shoot development

An H. Nguyen1,2,3 · Teguh Wijayanto2,4 · William Erskine1,5 · Susan J. Barker2,5

DFCHC7C@G. ,C :IFHh9F iBJ9GHi;5H9 HhiG C6G9FJ5HiCB, 5B 9 F)

9LDF9GGiB; 7CBGHFI7H K5G DF9D5F98. (6G9FJ5HiCBG KiHhiB Hh9

first week after Agrobacteriu 9LDCGIF9 C: @IDiB 9LD@5BHG 89ACBGHF5H98 Hh5H HF5BG:CFA5HiCB C: N%% 9LD@5BH 79@@G K5G

BCH 5 F5H9-@iAiHiB; GH9D. IBGH958, Hh9 F9GI@HG iB8i75H98 Hh5H

Hh9 7IFF9BH G9@97HiCB A9HhC8C@C;M K5G ?i@@iB; Hh9 79@@G

Hh5H K9F9 7CAD9H9BH HC F9;9B9F5H9 iBHC HF5BG;9Bi7 GhCCHG.

IH K5G 7CB7@I898 Hh5H :IFHh9F F9G95F7h CB Hh9 89J9@CDA9BH

C: Hh9 HF95H98 9LD@5BHG GhCI@8 :C7IG CB 89@5M98 G9@97HiCB

5B8 9LDCGIF9 HC Agrobacteriu C: 79@@G 69@CK Hh9 5Di75@

A9FiGH9A.

Keywords Narrow leafed lupin · Genetic modification · %9;IA9 HF5BG:CFA5HiCB X HM;FCAM7iB X Agrobacteriu

tu efaciens X ChiA9Fi7 GhCCH 89J9@CDA9BH

AbbreviationseGFP Enhanced green fluorescent protein -S B9H5-;@I7IFCBi85G9

N%% N5FFCK-@95: @IDiB

&)H &i7FCDFCD5;5HiCB A98iIA KiHh hM;FCAM7iB

)C* )C@MA9F5G9 7h5iB F957HiCB

)), )hCGDhiBCHhFi7iB

*; *9;9B9F5HiCB A98iIA

,0 IBiHi5@ ;9B9F5HiCB C: HF5BG;9Bi7 GhCCH

,1 )FC;9BM C: ,0 ;9B9F5HiCB

Introduction

N5FFCK-@95: @IDiB (N%%) (Lupinus angustifolius %.) iG 5 ?9M

@9;IA9 7FCD iB AIGHF5@i5, 5B8 h5G 699B ;FCKB 7CAA9F7i5@@M

for about 50 years, contributing to nitrogen fixation as a EI5@iHM @iJ9GHC7? :998 Hh5H iG Ki89@M 9LDCFH98. IH h5G A5jCF

58J5BH5;9G 5G 5 FCH5HiCB5@ 7FCD iB 79F95@ 7FCDDiB; GMGH9AG,

Abstract N5FFCK-@95: @IDiB (N%%) iG Hh9 A5iB @9;IA9 7FCD ;FCKB iB FCH5HiCB KiHh Kh95H 5B8 CHh9F 79F95@G iB

/9GH9FB AIGHF5@i5. E::CFHG HC iADFCJ9 N%% ;9FAD@5GA 6M

IG9 C: ;9B9Hi7 H97hBC@C;i9G h5J9 699B h5AD9F98 6M Hh9

lack of an efficient genetic transformation method, an issue Hh5H iG iB 7CAACB KiHh 8CAiB5BH 7FCD @9;IA9G ;@C65@@M.

)FiCF F9G95F7h h5G DFiA5Fi@M IG98 Hh9 bar ;9B9 :CF DhCG-

DhiBCHhFi7iB ()),) F9GiGH5B79. ,h9 5iA C: F979BH F9G95F7h

h5G 699B HC iBJ9GHi;5H9 5@H9FB5HiJ9 G9@97HiCB A9HhC8C@C;i9G,

iB CF89F HC 89H9FAiB9 Kh9Hh9F Hh9 @iAiH5HiCBG C: @CK :F9-

EI9B7M C: HF5BG;9Bi7 GhCCHG, 7CA6iB98 KiHh 7hiA9FiGA 5H

,0 7CI@8 69 CJ9F7CA9. IBJ9GHi;5HiCB C: hM;FCAM7iB F9GiG-

H5B79 5G 5 G9@97H56@9 A5F?9F 7CAD5F98 HC )), iG F9DCFH98

h9F9. ,h9 F9GI@HG GI;;9GH98 Hh5H hM;FCAM7iB F9GiGH5B79 K5G

5 ACF9 GIiH56@9 G9@97H56@9 A5F?9F :CF N%% HF5BG:CFA5HiCB

Hh5B )),. SIFDFiGiB;@M, :FCA iBJ9GHi;5HiCB C: HF5BG:CFA5-

HiCB IGiB; Hh9 -S F9DCFH9F ;9B9, iH K5G 5@GC C6G9FJ98

Hh5H HF5BG:CFA5HiCB :F9EI9B7M K5G ;F95H9F Kh9B G9@97HiCB

HF95HA9BH K5G F98I798 CF 89@5M98, 7CAD5F98 HC Hh9 9LiGHiB;

1 3

Plant Cell Tiss Organ Cult (2016) 127:665–674DOI 10.1007/s11240-016-1079-1

/ Published online: 20 October 2016

100

Materials and methods

Agrobacterium strains and vector constructs

,F5BG:CFA5HiCB 9LD9FiA9BHG K9F9 75FFi98 CIH IGiB; Hh9 A.

tu efaciens GHF5iB A;%0 (%5NC 9H 5@. 1991), 5G HhiG GHF5iB

was found to be the most efficient for NLL transformation ()i;95iF9 9H 5@. 1997). FCIF ,i D@5GAi8 J97HCFG K9F9 IG98

:CF N%% HF5BG:CFA5HiCB 9LD9FiA9BHG. IBiHi5@@M, DCA&BIA

J97HCFG DCA&BIA-3301 5B8 DCA&BIA-1305.2 K9F9

GCIF798 :FCA C9BH9F :CF Hh9 ADD@i75HiCB C: &C@97I@5F

BiC@C;M HC IBH9FB5HiCB5@ A;Fi7I@HIF9 (CA&BIA), B@57?

&CIBH5iB, AIGHF5@i5. BCHh J97HCFG IHi@iG98 ?5B5AM7iB F9GiG-

H5B79 G9@97HiCB iB 657H9Fi5 5B8 iB7@I898 5 D@5BH-9LDF9GG98

β-glucuronidase (GUS) reporter gene. The plant selectable A5F?9F ;9B9 iB DCA&BIA-3301 K5G Hh9 bar ;9B9 9B7C8-

iB; )), F9GiGH5B79, 5B8 Hh9 -S F9DCFH9F ;9B9 K5G uidA

(AFI@ 9H 5@. 2008) Khi@9 DCA&BIA-1305.2 75FFi98 hM;FC-

AM7iB F9GiGH5B79 ;9B9 hptII 5B8 Hh9 IG)@IGS J9FGiCB C:

HhiG F9DCFH9F ;9B9.

SI6G9EI9BH@M K9 7CBGHFI7H98 HKC 588iHiCB5@ ,i D@5G-

Ai8 J97HCFG; DH35 5B8 DB35 (Fi;. 1). ,h9 J97HCF DH35

K5G 7CBGHFI7H98 :FCA 5H9K5M DFCACH9F-F9DCFH9F J97HCF

DH /FS7, Khi7h 7CBH5iB98 5 F)- -S :IGiCB :CF D@5BH

9LDF9GGiCB, hM;FCAM7iB F9GiGH5B79 ;9B9 (HygR) :CF D@5BH

HF5BG:CFA5HiCB 5B8 GD97HiBCAM7iB/GHF9DHCAM7iB F9GiGH5B79

(SA/SD*) :CF 657H9Fi5@ HF5BG:CFA5HiCB (K5F5Ai 9H 5@. 2009).

,h9 F)- 5B8 -S-9B7C8iB; ;9B9G iB HhiG J97HCF K9F9

F9DCFH98 HC 69 9LDF9GG98 iB Arabidopsis thaliana i: :IB7-

HiCB5@ DFCACH9FG K9F9 iBG9FH98 (/iGNBi9KG?i 2011; C5i

2014). IB HhiG GHI8M, Hh9 C5&.35S 9I?5FMCHi7 DFCACH9F

with duplicated enhancer region (35 Sx2) was amplified :FCA DCA&BIA 1305.2 5B8 7@CB98 iBHC DH /FS7 HC 7CB-

HFC@ F) 5B8 -S 9LDF9GGiCB iB D@5BHG. ,h9 7CBGHFI7H DB35

was modified from pH35 by subcloning the bar ;9B9 iBHC &5IBI 5B8 065I F9GHFi7HiCB GiH9G HC F9D@579 Hh9 HygR ;9B9.

,hiG 7CBGHFI7H K5G IG98 HC H9GH bar ;9B9 G9@97HiCB iB 7CA-

D5FiGCB KiHh Hh9 B9K hM;FCAM7iB 7CBGHFI7H DH35.

,h9 :CIF ,i D@5GAi8 J97HCFG K9F9 iBHFC8I798 iBHC A;%0

7h9Ai75@@M 7CAD9H9BH 79@@G 6M :F99N9- Hh5K HF5BG:CFA5HiCB

(/iGNBi9KG?i 2011) 5B8 G9@97H98 CB 5DDFCDFi5H9 5BHi6iCHi7G.

CC@CBM )C@MA9F5G9 7h5iB F957HiCB ()C*) F957HiCBG IGiB;

BiC@iB9 &M,5ES ?iH K9F9 D9F:CFA98 HC 89H97H GI779GG:I@@M

HF5BG:CFA98 A;%0. A HMDi75@ )C* AiL (15 W%) 7CBGiGH98 C: 1

IBiH C: ,5E DNA DC@MA9F5G9, 1× compatible buffer, 0.5 μM primers and 2 μl dilution of Agrobacteriu 7C@CBi9G. ,h9F-AC7M7@9F (EDD9B8CF:) :C@@CK98 ;9B9F5@ 7CB8iHiCBG: 94 VC

:CF 5 AiB; 35 7M7@9G C: 94 VC :CF 15 G, ,A :CF 15 G, 72 VC

for 60 s; 72 °C for 10 min. Pairs of primers amplified HygR 5B8 bar ;9B9G 5H ,A 60 VC 5B8 45 VC, F9GD97HiJ9@M. ,h9G9

DFiA9FG DFC8I798 DNA :F5;A9BHG C: 599 6D :CF HygR 5B8

276 6D :CF bar. )C* DFC8I7HG K9F9 5B5@MG98 CB 5 1 % 5;5-

FCG9 ,AE ;9@. CC@CBM )C* DFiA9FG K9F9:

D5FHi7I@5F@M iB /9GH9FB AIGHF5@i5 Kh9F9 GCi@ 57i8iHM, @CK :9F-

Hi@iHM 5B8 8iG95G9 @iAiH Hh9 DFC8I7HiCB C: CHh9F DI@G9G. ,h9

585DH5HiCB C: N%% HC Hh9 G5B8M, 57i8i7 GCi@G DF9J5@9BH iB

/9GH9FB AIGHF5@i5 DFCD9@@98 iH HC 697CA9 Hh9 A5jCF ;F5iB

@9;IA9 7FCD C: Hh9 GH5H9, 7CBHFi6IHiB; 80 % C: B5HiCB5@ @IDiB

DFC8I7HiCB (A;HF5BG *9G95F7h 2012; ABA*ES 2015). HCK-

9J9F GiB79 1999 Hh9 AIGHF5@i5B @IDiB iB8IGHFM h5G IB89F;CB9

a severe decline, largely due to difficulties with weed con-HFC@ 5;;F5J5H98 6M 89J9@CDA9BH C: h9F6i7i89 F9GiGH5B79 iB

A5jCF K998 GD97i9G C: @IDiB–Kh95H FCH5HiCBG (BCKF5A 5B8

H5Gh9A 2008; A;HF5BG *9G95F7h 2012). ,h9 N%% ;9B9 DCC@

h5G @iAiH98 h9F6i7i89 HC@9F5B79, 95F@M Ji;CIF CF GhCFH G95GCB

DFC8I7HiJiHM, h5AD9FiB; 7CBJ9BHiCB5@ 6F998iB; 5DDFC57h9G.

9B9Hi7 HF5BG:CFA5HiCB A9HhC8C@C;M DF9G9BHG 5B 5@H9FB5-

HiJ9 5DDFC57h HC 5;FCBCAi7 iADFCJ9A9BH iB N%% ()i;95iF9 9H

5@. 1997; &C@Ji; 9H 5@. 1997) 5B8 5 GA5@@ BIA69F C: GI779GG-

:I@ CIH7CA9G h5J9 699B 57hi9J98 29.;. (&C@Ji; 9H 5@. 1997;

/ij5M5BHC 9H 5@. 2009; ,569 9H 5@. 2010; AH?iBG 9H 5@. 2011;

B5F?9F 9H 5@. 2016)3. ,h9 CFi;iB5@ A9HhC8C@C;M 5@GC DFCJ98

5DD@i756@9 HC CHh9F 7FCD @9;IA9G 8IFiB; Hh9 1990PG 5B8 95F@M

2000PG 5@HhCI;h Hh9F9 K5G BC 7CAA9F7i5@ CIH7CA9 :FCA

Hh9G9 9::CFHG (%i 9H 5@. 2000; (@hC:H 9H 5@. 2003; SCA9FG 9H 5@.

2003; ( ,* 2013). BFC58 6iCH97hBC@C;i75@ 5DDFC57h9G HC

N%% 5B8 CHh9F DI@G9 7FCD iADFCJ9A9BH 5F9 h5AD9F98 6M Hh9

extreme inefficiency of the current methodology (Somers et 5@. 2003). ,h9 GI779GG F5H9 HC ;9B9F5H9 ,0 HF5BG;9Bi7 9J9BHG

h5G 699B A95GIF98 HC 5J9F5;9 BC ACF9 Hh5B 3.3 % C: iBC7I-

@5HiCB 5HH9ADHG iB DF9JiCIG GHI8i9G (/ij5M5BHC 9H 5@. 2009),

KiHh ;9B9F5HiCB C: 7hiA9Fi7 GhCCHG, Khi7h F9GI@H98 iB 0.8 %

GI779GG F5H9 Kh9B A95GIF98 5H Hh9 ,1 ;9B9F5HiCB.

IH K5G hMDCHh9GiG98 Hh5H 7h5B;iB; Hh9 G9@97HiCB 6iC7h9A-

iGHFM Ai;hH F9GI@H iB 5B iADFCJ98 HF5BG:CFA5HiCB :F9EI9B7M CF

F98I798 7hiA9FiGA CF 6CHh. SI6GHiHIHiB; Hh9 CFi;iB5@ G9@97HiCB

A9HhC8C@C;M 2Hh9 bar ;9B9 9B7C8iB; HC@9F5B79 HC DhCGDhi-

BCHhFi7iB ()),)3 KiHh 5 5-9BC@DMFIJM@Ghi?iA5H9-3-DhCGDh5H9

GMBHh5G9 ;9B9 9B7C8iB; ;@MDhCG5H9 HC@9F5B79 DFCJ98 5 BCB

HFiJi5@ H5G?, F9EIiFiB; 89J9@CDA9BH C: 5B 5@H9FB5HiJ9 G9@97HiCB

A9HhC8C@C;M. A@HhCI;h Hh9 CIH7CA9 h58 5;FCBCAi7 DCH9B-

Hi5@ (Si 9H 5@. GI6AiHH98), issues with chimerism and low effi-7i9B7M K9F9 BCH GC@J98 (B5F?9F 9H 5@. 2016). -G9 C: 5 8i::9F9BH

D@5BH G9@97H56@9 A5F?9F, hM;FCAM7iB F9GiGH5B79, K5G Hh9F9:CF9

9L5AiB98. HM;FCAM7iB B iG 5B 5AiBC;@M7CGi89 5BHi6iCHi7

Hh5H iBhi6iHG DFCH9iB GMBHh9GiG iB DFC?5FMCH9G 5B8 9I?5FMCH9G

6M iBH9F:9FiB; KiHh Fi6CGCA5@ HF5BG@C75HiCB 5B8 KiHh 5AiBC-

57M@-H*NA F97C;BiHiCB ( FiHN 5B8 D5Ji9G 1983). ,hiG A95BG

C: G9@97HiCB h5G 699B F9DCFH98 GI779GG:I@ iB 5 F5B;9 C: CHh9F

@9;IA9G (SCA9FG 9H 5@. 2003; AHi: 9H 5@. 2013). CCA6iBiB;

HhiG 7h5F57H9F KiHh Hh9 IG9 C: F9DCFH9F ;9B9G 9B7C8iB; -S

5B8 F) 5@@CK98 7CAD5FiGCB C: Hh9 F9GI@HG KiHh bar ;9B9

G9@97HiCB. ,h9 5iA C: HhiG F9G95F7h K5G HC iADFCJ9 IB89F-

GH5B8iB; C: Hh9 89J9@CDA9BH C: HF5BG;9Bi7 79@@G iB Hh9 N%%

meristem in order to achieve a more efficient, affordable and F9@i56@9 A9HhC8C@C;M HC HF5BG:CFA N%%.

1 3

Plant Cell Tiss Organ Cult (2016) 127:665–674666

Appendices

101

HF95HA9BHG Hh5H K9F9 H9GH98 HC G9@97H :CF HF5BG;9Bi7 A5H9Fi5@G

5F9 89H5i@98 69@CK.

Hygromycin selection concentration

,C 89H9FAiB9 Kh9Hh9F hM;FCAM7iB KCI@8 69 GIiH56@9 5G 5

G9@97HiCB 5;9BH :CF N%% HF5BG:CFA5HiCB, Hh9 @9Hh5@ 7CB79B-

HF5HiCB C: hM;FCAM7iB B CB N%% K5G 9J5@I5H98 :C@@CKiB;

HKC 8i::9F9BH 5DD@i75HiCB A9HhC8G 5G :C@@CKG. FCF Hh9 8FCD-

@9H A9HhC8 C: G9@97HiCB ()i;95iF9 9H 5@. 1997) 5 8FCD (1 W%)

C: hM;FCAM7iB 5H 7CB79BHF5HiCBG :FCA 0.2 HC 2 A; A@−1 K5G 5DD@i98 CB Hh9 7IH GIF:579 C: Hh9 SA& C: :CIF 85MG C@8 5B8

14 85MG C@8 GH56698 N%% 9LD@5BHG (25 9LD@5BHG K9F9 IG98 HC

H9GH 957h 7CB79BHF5HiCB). FCF G9@97HiCB A98i5 H9GHiB; KiHh-

CIH 8FCD@9H 5DD@i75HiCB (F9DCFH98 6M B5F?9F 9H 5@. 2016), Hh9

9::97H C: hM;FCAM7iB CB N%% K5G 9L5AiB98 iB HKC K5MG

5G :C@@CKG:

1. %9Hh5@ H9GH 1 9L5AiB98 Hh9 9::97H C: 5B 57IH9 8CG9 C:

hM;FCAM7iB 5B8 :C@@CK98 A9HhC8 3 :CF ;@MDhCG5H9 G9@97HiCB

89G7Fi698 6M B5F?9F 9H 5@. (2016): GH56698 9LD@5BHG K9F9

;FCKB CB 7C-7I@HiJ5HiCB A98iIA :CF G9J9B 85MG 5B8 HF5BG-

:9FF98 HC F9;9B9F5HiCB A98iIA 7CBH5iBiB; 2, 4, 5, 10 5B8

30 A; %−1 hM;FCAM7iB :CF 10 85MG, :C@@CK98 6M 2–4 K99?G CB BCB-G9@97HiCB A98i5.

2. %9Hh5@ H9GH 2 9L5AiB98 Hh9 9::97H C: 5 7hFCBi7 8CG9

C: hM;FCAM7iB CB N%% D@5BHG: GH56698 GhCCHG K9F9 ;FCKB

iB 7C-7I@HiJ5HiCB A98iIA :CF G9J9B 85MG 5B8 HF5BG:9FF98

HC F9;9B9F5HiCB A98iIA 7CBH5iBiB; 2, 4, 5 5B8 10 A; %-1

hM;FCAM7iB (25–30 D@5BHG 957h). ,h9G9 D@5BHG K9F9 HF5BG-

:9FF98 HC B9K hM;FCAM7iB A98iIA 9J9FM 2 K99?G 5B8 HiA9

HC 895Hh, i: iH C77IFF98, K5G F97CF898.

Hygromycin selection protocol

S9@97HiCB DFCHC7C@G :CF hM;FCAM7iB K9F9 HFi5@@98 65G98 CB

the concentrations identified from the lethal dose testing as :C@@CKG.

1. DFCD@9H 5B8 iB A98iIA G9@97HiCB: )CGH HF5BG:CFA5-

HiCB, 9LD@5BHG K9F9 iB7I65H98 CB 7C-7I@HiJ5HiCB A98iIA :CF

2 85MG iB 85F? 7CB8iHiCBG, Hh9B 2 85MG IB89F BCFA5@ @i;hH

conditions (Fluorescent cool white PAR: 100–170 μmol A−2 G−1). ,h9 9LD@5BHG Hh9B K9F9 HF5BG:9FF98 HC F9;9B9F5-HiCB A98iIA (*;) 5B8 5 8FCD@9H C: hM;FCAM7iB K5G D@5798

CBHC Hh9 8CA9 C: Hh9 9LD@5BH 5G 89G7Fi698 6M )i;95iF9 9H

5@. (1997). A:H9F 2 K99?G iB *;, GIFJiJiB; 9LD@5BHG K9F9

9L7iG98 iB8iJi8I5@@M 5B8 ACJ98 HC Ai7FC-DFCD5;5HiCB G9@97-

HiCB A98i5 (&)H; )i;95iF9 9H 5@. 1997, GI6GHiHIHiB; 20 A;

%−1 )), KiHh 10 A; %−1 hM;FCAM7iB). SIFJiJiB; GhCCHG K9F9 GI67I@HIF98 CB &)H KiHh HF5BG:9F HC :F9Gh A98iIA

9J9FM 2 K99?G. ,h9 -S 5GG5M K5G 7CB8I7H98 CB GIFJiJiB;

GhCCHG 5:H9F 3 ACBHhG.

2. DFCD@9H G9@97HiCB: ,h9 9LD@5BH HF95HA9BHG :C@@CK98

Hh9 iBiHi5@ 7CB8iHiCBG C: 8FCD@9H 5B8 iB A98iIA G9@97HiCB 5G

Hyg_F 5′: GCGTGGATATGTCCTGCGGGHyg_R 5′: CCATACAAGCCAACCACGGBAR_F 5′: TCTGCACCATCGTCAACCACBAR_R 5′: ACTTCAGCAGGTGGGTGTAG

NLL transformation methodology, selection and generation of putative transformed shoots

,h9 N%% HF5BG:CFA5HiCB DFCHC7C@ IGiB; Agrobacteriu

tu efaciens K5G 65G98 CB Hh9 GhCCH 5Di75@ A9FiGH9A KCIB8-

iB; H97hBiEI9 89J9@CD98 6M )i;95iF9 9H 5@. (1997). SCA9

modifications to enhance the efficiency were described by /ij5M5BHC 9H 5@. (2009) 5B8 B5F?9F 9H 5@. (2016). ,h9 N%%

transformation protocol involves first germination of sur-:579 GH9Fi@iG98 G998 Hh9B 9L7iGiCB C: Hh9 ;9FAiB5H98 G998@iB;

hMDC7CHM@G 5B8 iB7I65HiCB C: Hh9G9 9LD@5BHG CB 5;5F-65G98

7I@HIF9 A98iIA. (B Hh9 G5A9 85M 5G 9L7iGiCB, Hh9 GhCCH

5Di75@ A9FiGH9A (SA&) iG GH56698 G9J9F5@ HiA9G KiHh 5

fine needle then a drop of Agrobacteriu iG 5DD@i98 HC Hh9 85A5;98 GIF:579. )IH5HiJ9 HF5BG;9Bi7 GhCCHG 89J9@CD :FCA

Hh9 85A5;98 GIF:579 C: Hh9 SA& C: 9LD@5BHG. D9H5i@G C:

Fig. 1 ,h9 7iF7I@5F A5D C: DH35 7F95H98 6M SB5D 9B9(*). CCBGHFI7H

DH35 K5G 89FiJ98 :FCA 5H9K5M J97HCF DH /FS7. S /SpR GHF9DHC-

AM7iB/GD97HiBCAM7iB F9GiGH5B79 HC 657H9Fi5, LB @9:H 6CF89F C: ,-DNA,

HygR hM;FCAM7iB B G9@97H56@9 A5F?9F ;9B9 (hpt) IB89F HF5BG7FiD-

HiCB5@ F9;I@5HiCB C: Hh9 BCD5@iB9 GMBHh5G9 (nos) DFCACH9F ()-N(S)

5B8 nos H9FAiB5HCF (,-N(S), Egfp enhanced green fluorescent pro-H9iB F9DCFH9F ;9B9, GUS β-glucuronidase (gus) F9DCFH9F ;9B9, :F5A9 :IGiCB KiHh E;:D 7C8iB; F9;iCB IB89F HF5BG7FiDHiCB5@ F9;I@5HiCB C: Hh9

9Bh5B798 C5&.35S ()-35 S) 5B8 35 S H9FAiB5HCF (,35S), RB ,-DNA

Fi;hH 6CF89F. CCBGHFI7H DB35 h58 i89BHi75@ GHFI7HIF9 9L79DH Hh5H Hh9

&5IBIR065I :F5;A9BH 9B7C8iB; Hh9 hM;FCAM7iB F9GiGH5B79 ;9B9 K5G

F9D@5798 6M Hh9 DhCGDhiBCHhFi7iB F9GiGH5B79 ;9B9 (bar) IB89F 7CBHFC@ C:

Hh9 nos DFCACH9F, iB Hh9 G5A9 CFi9BH5HiCB

1 3

Plant Cell Tiss Organ Cult (2016) 127:665–674 667

102

K9F9 D@5798 CBHC 58h9GiJ9 ;@5GG G@i89 :CF JiGI5@iGiB; 5B8

iA5;9 75DHIF9 5G 56CJ9.

Results

Hygromycin selection concentration

)F9@iAiB5FM 9LD9FiA9BHG 89ACBGHF5H98 Hh5H hM;FCAM7iBB

K5G 5 GIiH56@9 5;9BH :CF G9@97HiCB iB N%%. AG Hh9 9LiGHiB;

DhCGDhiBCHhFi7iB G9@97HiCB DFCHC7C@ IHi@iG98 6CHh 8FCD@9H

and in medium selection, we first determined the lethal 8CG9 7CB79BHF5HiCBG C: hM;FCAM7iB CB IBHF5BG:CFA98 N%%

:CF 957h C: Hh9G9 G9@97HiCB 7CB8iHiCBG G9D5F5H9@M. *9;5F8-

iB; 8FCD@9H G9@97HiCB, 14 CIH C: 25 9LD@5BHG K9F9 ?i@@98 6M 5

8FCD C: hM;FCAM7iB 0.5 A; A%−1 5B8 5@@ N%% 9LD@5BHG 8i98 :C@@CKiB; 8FCD@9H HF95HA9BH C: 1 A; A%−1. FCF iB A98i5 G9@97HiCB, Hh9 F9GI@H C: @9Hh5@ H9GH 1 C: hM;FCAM7iB CB N%%

GhCK98 Hh5H N%% 9LD@5BHG K9F9 BCH ?i@@98 6M 5B 57IH9 8CG9

C: hM;FCAM7iB ID HC 10 A; %−1 :CF 1 K99? 5H 5BM C: Hh9 H9GH98 7CB79BHF5HiCBG. ELD@5BHG iB A98i5 KiHh 7CB79BHF5HiCBG

69HK99B 2 5B8 5 A; %−1 C: hM;FCAM7iB F97CJ9F98 GHFCB;@M Kh9B ACJ98 HC BCB-G9@97HiCB A98iIA (Fi;. 2:, ; 5B8 85H5

BCH GhCKB). ELD@5BHG HF95H98 KiHh 10 A; %−1 hM;FCAM7iB medium acute dose looked unhealthy in the first week but F97CJ9F98 iB Hh9 B9LH 2 K99?G, 5B8 K9F9 HCH5@@M F9h56i@iH5H98

5 K99?G 5:H9F ACJ9A9BH HC BCB-G9@97HiCB A98iIA. IB @9Hh5@

H9GH 2, N%% D@5BHG 8i8 BCH ;FCK. AH 30 A; %−1 5@@ 9LD@5BHG K9F9 8958 5:H9F 10 85MG. ELD@5BHG 9J9BHI5@@M K9F9 ?i@@98

6M 5 7hFCBi7 8CG9 C: 10 A; %−1 hM;FCAM7iB F9;9B9F5HiCB A98iIA 5:H9F 6 K99?G, 6IH F9A5iB98 5@iJ9 CB 7CB79BHF5HiCBG

:FCA 2 HC 5 A; %−1 (Fi;. 2:, ; 5B8 85H5 BCH GhCKB). ,h9 F9GDCBG9 HC 5 1 A; A%−1 8FCD@9H C: hM;FCAM7iB 7CAD5F98 KiHh Hh9 2 A; A%−1 )), 8FCD@9H G9@97HiCB iG 5@GC GhCKB iB Fi;. 2. A PPT droplet caused significant browning across Hh9 HCD C: Hh9 9LD@5BHG 5B8 iB GCA9 75G9G 5@GC EIi7?@M ?i@@98

Hh9 65G5@ HiGGI9 (Fi;. 28, 9, i). IB 7CBHF5GH, hM;FCAM7iB ?i@@98

Hh9 HCD 8CA9 HiGGI9 6IH IB89F@MiB; HiGGI9G F9A5iB98 EIiH9

h95@HhM, KiHh Hh9 9L79DHiCB Hh5H GCA9 J5G7I@5F HiGGI9 6FCKB-

iB; 7CI@8 69 C6G9FJ98 (Fi;. 26, 7, h).

Hygromycin selection protocol

,hF99 5DDFC57h9G K9F9 HFi5@@98 :CF hM;FCAM7iB G9@97HiCB

:C@@CKiB; 7C-7I@HiJ5HiCB C: Hh9 N%% 9LD@5BHG KiHh Agro-

bacteriu , 5B8 Hh9 CIH7CA9G K9F9 7CAD5F98 KiHh DhCG-

DhiBCHhFi7iB G9@97HiCB. ,h9 GIAA5FM C: F9GI@HG iG GhCKB

iB Fi;. 3. IBiHi5@ F9G95F7h :C@@CK98 Hh9 9LiGHiB; DFCHC7C@ :CF

DhCGDhiBCHhFi7iB G9@97HiCB, Khi7h K5G CB9. 8FCD@9H G9@97-

HiCB :C@@CK98 6M G9@97HiCB iB A98i5. .9FM @iAiH98 F9GI@HG

K9F9 57hi9J98 :C@@CKiB; A9HhC8 (1) 5:H9F 5DD@i75HiCB C:

1 A; A%−1 hM;FCAM7iB iB 8FCD@9H 5B8 10 A; %−1 hM;FC-AM7iB iB A98iIA, :FCA 457 G998@iB; 9LD@5BHG CB@M 12

89G7Fi698 56CJ9. A:H9F 2 K99?G iB *;, GIFJiJiB; 9LD@5BHG

K9F9 9L7iG98 iB8iJi8I5@@M 5B8 ACJ98 HC Ai7FC-DFCD5;5HiCB

A98i5 6IH KiHhCIH G9@97HiCB. ,h9 -S 5GG5M K5G 9AD@CM98

HC 8iG7CJ9F Hh9 BIA69F C: -S DCGiHiJ9 GhCCHG 5:H9F

2 K99?G. ,iAiB; C: 8FCD@9H 5DD@i75HiCB K5G iBiHi5@@M 4 85MG

5:H9F HF5BG:CFA5HiCB. D9@5M98 HiAiB; C: 8FCD@9H G9@97HiCB HC

10 85MG 5:H9F HF5BG:CFA5HiCB K5G HFi5@@98 GI6G9EI9BH@M.

3. NCB-G9@97HiCB: )CGH HF5BG:CFA5HiCB, 9LD@5BHG K9F9

iB7I65H98 CB 7C-7I@HiJ5HiCB A98iIA 5B8 HF5BG:9FF98 HC

F9;9B9F5HiCB A98iIA (*;) :C@@CKiB; A9HhC8 1 56CJ9 6IH

KiHhCIH 8FCD@9H CF A98i5 G9@97HiCB. -S 5GG5M K5G iAD@9-

A9BH98 HC 8iG7CJ9F Hh9 BIA69F C: -S DCGiHiJ9 GhCCHG

Hh5H K9F9 ;FCKiB; :FCA 9LD@5BHG 5:H9F 2 K99?G iB Hh9 *;

A98iIA.

Statistical analysis

Di::9F9BH HF95HA9BHG K9F9 7CAD5F98 6M 7hi GEI5F98 H9GH :CF

statistical significance using Microsoft Excel software.

Analysis of reporter gene expression

GUS assay

AGG5MG C: HF5BGi9BH -S 9LDF9GGiCB iB GhCCH 5Di79G K9F9

75FFi98 CIH 577CF8iB; HC #9::9FGCB 9H 5@. (1987). ShCCHG K9F9

iAA9FG98 iBHC :F9Gh@M A589 0- @I7 GC@IHiCB (5-6FCAC-4-

chloro-3-indolyl-β-D- glucuronic acid in 50 mM NaH2PO4 6I::9F, DH 7.0) iB 24 K9@@ D@5H9G 5B8 iB7I65H98 CJ9FBi;hH

5H 37 VC. S5AD@9G :CF Ai7FCG7CD9 5B5@MGiG K9F9 K5Gh98 iB

50–70 % 9Hh5BC@ 5B8 7@95F98 iB 7h@CF5@ hM8F5H9 (#9::9FGCB 9H

5@. 1987; B997?A5B 5B8 EB;@9F 1994).

GFP i aging and analysing

)IH5HiJ9 HF5BG:CFA98 GhCCHG K9F9 @CB;iHI8iB5@ CF 7FCGG G97-

HiCB98 HC 5B5@MG9 6M 7CB:C75@ Ai7FCG7CDM. F) 9LDF9GGiCB

K5G 89H97H98 6M Ni?CB ,i-E iBJ9FH98 ACHCFiG98 Ai7FCG7CD9

KiHh Ni?CB A1Si GD97HF5@ 89H97HCF 7CB:C75@ GMGH9A FIBBiB;

NIS-C E@9A9BHG GC:HK5F9 5H Hh9 C9BHF9 :CF &i7FCG7CDM,

Ch5F57H9FiG5HiCB & AB5@MGiG (C&CA), ,h9 -BiJ9FGiHM C:

/9GH9FB AIGHF5@i5. IA5;9G K9F9 75DHIF98 6M 7CB:C75@ GMG-

H9A 5DD@MiB; C6j97HiJ9 4×, 10× 5B8 20× KiHh @5G9F K5J9-@9B;Hh 488 BA 5B8 500–550 BA :CF F) 9L7iH5HiCB 5B8

9AiGGiCB, F9GD97HiJ9@M.

Cryostat sectioning

For better images, samples were fixed in 30 % sucrose over-Bi;hH 5H 4 VC, 9A698898 iBHC CDHiAIA 7IHHiB; H9AD9F5HIF9

((C,) 7CADCIB8 (,ISS-E-,EKU), :FCN9B 5H −20 VC 5B8 G97HiCB98 6M C&3050 S CFMCGH5H (%9i75) (,iFi7hiB9 9H 5@.

2009). S97HiCBG (20–40 WA) 7CBH5iBiB; iBH57H D@5BH A5H9Fi5@

1 3


Appendices

103

GhCCHG GIFJiJ98. ,h9G9 GIFJiJiB; GhCCHG CFi;iB5H98 :FCA CB9

9LD@5BH. ,h9F9:CF9 5@H9FB5HiJ9 5DDFC57h9G HC G9@97HiCB K9F9

iBJ9GHi;5H98. ,h9G9 K9F9 G9@97HiCB A9HhC8 (2) 8FCD@9H G9@97-

HiCB 5B8 A9HhC8 (3) BC G9@97HiCB.

,h9 -S 9LDF9GGiCB F9GI@HG 69HK99B Hh9 HKC G9@97H56@9

A5F?9FG (hM;FCAM7iB 5B8 DhCGDhiBCHhFi7iB) 7CI@8 BCH 69

8iF97H@M 7CAD5F98 6975IG9 HKC 8i::9F9BH -S ;9B9 7CB-

GHFI7HG K9F9 DF9G9BH iB Hh9 DCA&BIA ,i D@5GAi8G. ,h9

hM;FCAM7iB G9@97H56@9 A5F?9F K5G 7CA6iB98 KiHh 5 ACF9

95Gi@M 89H97H98 -S ;9B9 ( IG)@IGS). SiAi@5F@M, GIFJiJ5@

C: 9LD@5BHG :C@@CKiB; Hh9 OBC G9@97HiCBP A9HhC8 7CI@8 BCH

69 8iF97H@M 7CAD5F98 KiHh Hh9 HKC CHh9F G9@97HiCB A9HhC8G

5B8 Hh9G9 7CI@8 CB@M 69 7CAD5F98 KiHh 957h CHh9F 5H Hh9

95F@i9GH G9@97HiCB GH5;9 5G @5H9F ;FCKHh 5B8 HF95HA9BHG 8i:-

:9F98 69HK99B 957h A9HhC8. AG 9LD97H98 Hh9F9 K5G BC Gi;-

nificant difference within selectable marker treatments for Hh9 HKC D@IG G9@97HiCB A9HhC8G. ,h9F9 K5G hCK9J9F 5 Gi;-

nificant difference between survival even at the earliest step (GIFJiJ5@ CB *;) 69HK99B )), 5B8 hM; G9@97HiCB (,56@9 1)

5B8 Hh9 HF9B8 :CF D9F79BH GhCCHG Hh5H 9LDF9GG98 -S :FCA

9LD9FiA9BHG CB G9@97HiCB A9HhC8 KiHh 6CHh G9@97H56@9 A5F?-

9FG K5G Hh9 G5A9 (Fi;. 3). FC@@CKiB; 8FCD@9H 5DD@i75HiCB,

32 9LD@5BHG GIFJiJ98 CIH C: 438 G998@iB;G :FCA HF5BG:CFA5-

HiCB KiHh DCA&BIA 1305.2, iB Khi7h 30 9LD@5BHG DFC8I798

GhCCHG 9LDF9GGiB; Gus, Khi@GH :CF DhCGDhiBCHhFi7iB G9@97-

HiCB Hh9F9 K5G CB@M HhF99 GhCCH-DFC8I7iB; 9LD@5BHG :FCA

382 HF95H98 9LD@5BHG, 5@@ HhF99 C: Khi7h 9LD@5BHG DFC8I798

0.0%

10.0%

20.0%

30.0%

40.0%

50.0%

60.0%

Droplet and inmedia

selectionDropletselection No selection

0.2%6.8%

64.1%

0.1% 0.8%

35.0%

Fig. 3 F5Dh GhCKiB; CIH7CA9 C: 8i::9F9BH G9@97HiCB A9HhC8C@C-

;i9G CB ,0 HF5BG:CFA5HiCB F5H9G. Dark bars 5F9 N%% HF5BG:CFA5HiCB

KiHh DCA&BIA1305.2. Light bars 5F9 N%% HF5BG:CFA5HiCB KiHh

DCA&BIA3301

Fig. 2 E::97H C: hM;FCAM7iB CF )), G9@97HiCB CB N%% HF5BG;9Bi7

9LD@5BHG. A@@ scale bars 5F9 500 WA @CB;. a ,CD Ji9K C: 7CBHFC@ 9LD@5BH :C@@CKiB; GH566iB; 5B8 Agrobacteriu HF95HA9BH 6IH BC G9@97HiCB. b

DFCD@9H G9@97HiCB KiHh 1 A; %−1 hM;FCAM7iB 7 85MG 5:H9F HF95HA9BH GhCKiB; 895Hh C: Hh9 5Di75@ 8CA9 6IH CHh9FKiG9 ;9B9F5@ h95@Hh C: Hh9

9LD@5BH. c %CB;iHI8iB5@ G97HiCB HhFCI;h b. ShCKiB; CJ9F5@@ HiGGI9 h95@Hh, 9L79DH :CF DFC;F9GGiCB C: 6FCKBiB; iBHC Hh9 J5G7I@5F HiGGI9G.

d ,CD Ji9K C: 9LD@5BH 7 85MG :C@@CKiB; 8FCD@9H G9@97HiCB KiHh )),. e %CB;iHI8iB5@ G97HiCB HhFCI;h d. ShCKiB; ACGH HiGGI9G 5F9 5@F958M 8958. f A7IH9 (10 85MG, left D@5H9) 5B8 7hFCBi7 (4 K99?, right D@5H9)

HF95HA9BH C: IBHF5BG:CFA98 N%% 9LD@5BHG CB 5 A; %−1 hM;FCAM7iB. BCHh HF95HA9BHG F9A5iB 5@iJ9. g A7IH9 (10 85MG, left D@5H9) 5B8 7hFCBi7

(4 K99?, right D@5H9) HF95HA9BH C: IBHF5BG:CFA98 N%% 9LD@5BHG CB

10 A; %−1 hM;FCAM7iB. (B@M Hh9 57IH9 8CG9 HF95HA9BH 9LD@5BHG F9A5iB h95@HhM (h). N%% 9LD@5BH 7 85MG 5:H9F HF95HA9BH KiHh hM;FCAM7iB 8FCD-

@9H GhCKiB; 89J9@CDA9BH C: GhCCHG C77IFFiB; :FCA 69@CK Hh9 8958 HiG-

GI9G (i). N%% 9LD@5BH 7 85MG :C@@CKiB; 8FCD@9H HF95HA9BH KiHh )),

GhCKiB; @9GG HiGGI9 85A5;9 Hh5B 9. 5B8 9A9F;9B79 C: 5 GhCCH (69hiB8

Hh9 8CA9), 6IH HhiG GhCCH @5H9F 8i98

1 3


104

5B5@MGiG KiHh GI67I@HIF9 C: GhCCHG 9A9F;iB; :FCA Hh9 8i:-

:9F9BH G9@97HiCB A9HhC8G 89ACBGHF5H98 Hh5H 5 F5B;9 C: GH5iB-

iB; iBH9BGiHM K5G C6G9FJ98 (Fi;. 48 5B8 85H5 BCH GhCKB). ,C

i89BHi:M hCK Hh9G9 GhCCHG K9F9 89J9@CDiB;, -S-DCGiHiJ9

explants were sectioned to examine whether specific cell @5M9FG K9F9 HF5BG:CFA98 (D9Fi7@iB5@ 7hiA9F5G) CF Kh9Hh9F

Hh9 7hiA9FiGA K5G G97HCF5@ (A9Fi7@iB5@ 7hiA9F5G). Fi;-

IF9 49 GhCKG 5 F9DF9G9BH5HiJ9 GH5iB98 G97HiCB. B@I9 7C@CIF

was clearly not confined to intact cells but there appeared to h5J9 699B @95?5;9 5B8 8i::IGiCB iB Hh9 7FMCGH5H G97HiCBiB;

DFC79GG Khi7h 7CI@8 @958 HC 5 AiG@958iB; 7CB79DH C: HF5BG-

;9Bi7 79@@ @C75HiCB. FCF HhiG F95GCB Hh9 GHFI7HIF9 C: 7hiA9F5G

7CI@8 BCH 69 5G79FH5iB98 6M Hh9G9 9LD9FiA9BHG. ,h9 ;9B9 :CF

9Bh5B798 F) (9 F)) K5G Hh9F9:CF9 C6H5iB98 iB CF89F HC

C6G9FJ9 HF5BG;9Bi7 GhCCH GHFI7HIF9 KiHh ACF9 89H5i@ 5B8 95F-

@i9F iB Hh9 HF5BG:CFA5HiCB DFC79GG Hh5B h58 DFCJ9B DCGGi6@9

KiHh Hh9 -S GH5iBiB; 5GG5M 5B8 G97HiCBiB;.

Use of GFP constructs for transgenic cell imaging

The difference between efficiency of shoot survival between DCA&BIA 1305.2 5B8 DCA&BIA 3301 HF5BG:CFA5HiCBG

Ai;hH h5J9 699B 5B 5FH9:57H C: CD9F5HCF HF5iBiB;, CF iH Ai;hH

have been an inherent difference in efficiency between the HKC D@5GAi8G. ,C 5DD@M 5 ACF9 9J9B HF95HA9BH Hh9F9:CF9

5@CB; KiHh F) JiGI5@iG5HiCB, HKC 588iHiCB5@ 7CBGHFI7HG K9F9

DF9D5F98 :FCA Hh9 G5A9 ;9B9Hi7 657?;FCIB8 8i::9FiB; CB@M iB

Hh9 G9@97H56@9 A5F?9F ;9B9. ,h9G9 J97HCFG, DH35 5B8 DB35

5F9 89G7Fi698 iB Fi;. 1. CCAD5FiGCB C: 8FCD@9H CB@M G9@97-

HiCB 69HK99B DH35 5B8 DB35 hCK9J9F GhCK98 Hh9 G5A9

HF9B8 5G C6G9FJ98 DF9JiCIG@M :CF 7CAD5FiGCB C: hM;FCAM7iB

5B8 )), 8FCD@9H G9@97HiCB (Fi;. 3). ADD@i75HiCB C: 5 8FCD-

@9H 5H 4 85MG 5:H9F Agrobacteriu HF95HA9BH F9GI@H98 iB 4 %

GIFJiJ5@ (DH35) 6IH 0 % GIFJiJ5@ (DB35). DI9 HC Hh9 J9FM

@CK GI779GG F5H9 C: Hh9 )), G9@97HiCB DFCHC7C@, 9L5AiB5HiCB

C: 9 F) 9LDF9GGiCB K5G CB@M D9F:CFA98 KiHh DH35 HF5BG-

:CFA98 9LD@5BHG.

Fi;IF9 5 GhCKG F) 9LDF9GGiCB C: DH35 HF5BG:CFA98

9LD@5BHG iA5;98 6M 7CB:C75@ Ai7FCG7CDM. IH K5G 5DD5F9BH iB

-S DCGiHiJ9 GhCCHG. ,F5BG:CFA5HiCB KiHh A9HhC8 3. NC

G9@97HiCB, F9GI@H98 iB 5 AI7h @5F;9F :F9EI9B7M C: A5F?9F

;9B9-9LDF9GGiB; GhCCHG Hh5B A9HhC8 2. 8FCD@9H CB@M G9@97-

HiCB (Fi;. 3) even though there was not a significant differ-9B79 69HK99B GIFJiJ5@ HC Hh9 95F@i9GH GH5;9 (*;) 69HK99B Hh9

8FCD@9H CB@M 5B8 Hh9 8FCD@9H 5B8 iB A98i5 G9@97HiCB A9HhC8G

i: Hh9 G5A9 G9@97H56@9 A5F?9F K5G 5DD@i98 (,56@9 1), iB8i75H-

iB; Hh5H A5F?9F ;9B9 9LDF9GGiCB 8i::9F9B79G F9GI@H98 :FCA 5

89J9@CDA9BH5@ DFC79GG Hh5H K5G 89H97H98 @5H9F iB Hh9 HF5BG-

:CFA5HiCB A9HhC8. ,F5BG:CFA5HiCB KiHh DCA&BIA 1305.2

(hM;FCAM7iB G9@97HiCB) KiHh BC G9@97HiCB F9GI@H98 iB 378

9LD@5BHG CIH C: 590 G998@iB;G 89J9@CDiB; GhCCHG Hh5H K9F9

-S-DCGiHiJ9 (Fi;. 45 5B8 85H5 BCH GhCKB) Kh9F95G HF5BG-

:CFA5HiCB KiHh DCA&BIA 3301 ()), G9@97HiCB) F9GI@H98

iB 42 GI779GG:I@ 9LD@5BHG CIH C: 120 (Fi;. 46 5B8 85H5 BCH

GhCKB). &9HhC8 1. 8FCD@9H 5B8 G9@97HiCB iB A98i5 K5G Hh9

@95GH GI779GG:I@ A9HhC8 (Fi;. 3). ,hiG F9GI@H K5G 7CBHF5FM HC

iBiHi5@ 9LD97H5HiCB. iJ9B Hh9 @CK GI779GG F5H9G DF9JiCIG@M

C6G9FJ98 :CF HF5BG:CFA5HiCB C: N%% ;9B9F5@@M, Hh9 5DD5F-

9BH 95G9 C: HF5BG:CFA56i@iHM 5B8 F9;9B9F5HiCB C: HF5BG;9Bi7

GhCCHG Hh5H K5G iB8i75H98 6M Hh9 hi;h9F F5H9 C: HF5BG:CFA98

GhCCHG DFC8I798 KiHhCIH G9@97HiCB Hh5B KiHh G9@97HiCB, :CF

6CHh hM;FCAM7iB 5B8 DhCGDhiBCHhFi7iB, GI;;9GH98 GCA9

5FH9:57H GI7h 5G 657H9Fi5@ 7CBH5AiB5HiCB K5G F9GI@HiB; iB

iB7F95G98 -S GH5iBiB;. HCK9J9F ACF9 75F9:I@ 7CBGi89F-

5HiCB @98 HC Hh9 7CB7@IGiCB Hh5H i: Hh9 HF5BG;9Bi7 GhCCHG K9F9

7hiA9Fi7 5G h58 699B DFCDCG98 :FCA h9FiH56i@iHM iB DF9Ji-

CIG F9G95F7h, G9@97HiCB DFiCF HC 7I@HiJ5HiCB KCI@8 F98I79 Hh9

5DD5F9BH GI779GG F5H9. (B@M GhCCHG Hh5H 7CBH5iB98 5 A5jCF-

iHM C: HF5BG;9Bi7 HiGGI9 KCI@8 GIFJiJ9 Hh9 A98i5 G9@97HiCB

A9HhC8C@C;M. CCAD5FiGCB C: Fi;. 47 KiHh Fi;. 45, 6 GID-

DCFHG HhiG hMDCHh9GiG.

Chimerism in NLL transformation

AB5@MGiG C: GIFJiJiB; GhCCHG :FCA G9@97HiCB A9HhC8 1.

F9J95@98 Hh5H 5@HhCI;h 5@@ K9F9 -S DCGiHiJ9, Hh9 9LD@5BHG

K9F9 7hiA9Fi7 5G 9A9F;iB; GhCCHG :C@@CKiB; :IFHh9F GI6-

7I@HIF9 GH5iB98 KiHh 8i::9F9BH iBH9BGiHi9G (Fi;. 47). FIFHh9F

Table 1 SH5HiGHi75@ 7CAD5FiGCB C: 9LD@5BH GIFJiJ5@

ELD9FiA9BH DCA&BIA3301 )), G9@97-

HiCB GIFJiJ5@ HC *; (B, #)

DCA&BIA1305 HM; G9@97-

HiCB SIFJiJ5@ HC *; (B, #)

χ2 GH5HiGHi75 SH5HiGHi75@

significance6

DFCD@9H G9@97HiCB 3 (382,4) 32 (438,4) 23.2319 *

DFCD@9H 5B8 iB A98i5 G9@97HiCB 13 (1035,14) 45 (457,5) 62.6202 *

χ2 GH5HiGHi77 0.5537 1.8363

Statistical significance6 BG8 BG8

D5H5 GhCKB 5F9 7CA6iB98 F9GI@HG Kh9F9 B iG Hh9 HCH5@ BIA69F C: 9LD@5BHG iB 957h 75H9;CFM 5B8 # iG Hh9 BIA69F C: 9LD9FiA9BHG Hh5H K9F9 D9F-

:CFA985CCAD5FiGCB C: 9LD@5BH GIFJiJ5@ 69HK99B G9@97H56@9 A5F?9FG KiHhiB G9@97HiCB A9HhC8G6,*Significant at p = 0.05, nsd not significantly different at p = 0.057CCAD5FiGCB C: 9LD@5BH GIFJiJ5@ 69HK99B G9@97HiCB A9HhC8G KiHhiB G9@97H56@9 A5F?9FG

1 3


Appendices

105

,hiG DF9@iAiB5FM C6G9FJ5HiCB, 5@CB; KiHh Hh9 95F@i9F

C6G9FJ5HiCB Hh5H HF5BG;9Bi7 GhCCHG K9F9 9A9F;iB; :FCA

69@CK Hh9 85A5;98 F9;iCB (Fi;. 2h, i) @98 HC Hh9 hMDCHh9GiG

Hh5H 5DD@MiB; 8FCD@9H G9@97HiCB 95F@M (85M 4 DCGH-HF5BG:CF-

A5HiCB 577CF8iB; HC Hh9 CFi;iB5@ A9HhC8C@C;M Hh5H K9 K9F9

following) might reduce transformation efficiency. Applica-HiCB C: 5 8FCD@9H 5H 10 85MG 5:H9F Agrobacteriu HF95HA9BH

F9GI@H98 iB 18 % GIFJiJ5@ (DH35) 5B8 0.8 % GIFJiJ5@ (DB35),

7CAD5F98 HC 4 5B8 0 % GIFJiJ5@ F9GD97HiJ9@M, :FCA Hh9 4 85M

HF95HA9BH CIH@iB98 56CJ9, GIDDCFHiB; HhiG hMDCHh9GiG.

Discussion

*9G95F7h CB N%% HF5BG:CFA5HiCB GiB79 Hh9 Ai8 1990G h5G

F9@i98 CB G9@97HiCB KiHh Hh9 h9F6i7i89 DhCGDhiBCHhFi7iB.

A@HhCI;h Hh9 89J9@CD98 A9HhC8C@C;M 7CI@8 69 IG98 HC

achieve single copy events the overall efficiency was very @CK (/ij5M5BHC 9H 5@. 2009). The lack of an efficient means

Hh9 95F@i9GH GH5;9 (4 85MG 5:H9F 8FCD@9H G9@97HiCB) Hh5H GH56-

bing caused significant damage to the primary apical meri-GH9A (Fi;. 55, 6). IH K5G 5@GC 5DD5F9BH 9J9B 5H HhiG J9FM 95F@M

GH5;9, Hh5H HF5BG:CFA5HiCB 5DD95F98 HC h5J9 C77IFF98 iB

9J9FM 79@@ Hh5H h58 699B 9LDCG98 HC Agrobacteriu 75FFMiB;

DH35. ,hiG iB7@I898 BCH jIGH Hh9 5F95G C: GH566iB;, Kh9Hh9F

Hh9 85A5;9 K5G Gh5@@CK CF 899D, 6IH 5@GC iB7@I898 Hh9 9BHiF9

9Di89FA5@ @5M9F C: Hh9 9LD@5BHG (Fi;. 55). ,h9 J9F57iHM C:

HhiG F9GI@H K5G 89ACBGHF5H98 6M 7CAD5FiGCB KiHh 9LD@5BHG

:C@@CKiB; HF95HA9BH KiHh Agrobacteriu A;%0 KiHhCIH Hh9

F) ,i D@5GAi8 (Fi;. 56). AH G9J9B 85MG 5:H9F 8FCD@9H HF95H-

A9BH Hh9 895Hh C: Hh9 F9A5iBiB; 5Di75@ 8CA9 HiGGI9G K5G

5DD5F9BH (Fi;. 57). AG K9@@, iB 9LD@5BHG Kh9F9 899D9F GH56-

6iB; h58 C77IFF98, F) 7CI@8 69 C6G9FJ98 iB Hh9 J5G7I@5F

79@@G C: Hh9 A9FiGH9A 5B8 89J9@CDA9BH C: F) 9LDF9GGiB;

GhCCHG :FCA 899D9F HiGGI9 7CI@8 69 C6G9FJ98 (Fi;. 57–9).

/hi@GH 9Di89FA5@ 79@@ HF5BG:CFA5HiCB K5G 5@GC C6G9FJ98 iB

C@89F 9LD@5BHG 5B8 iB Gh5@@CK GH56698 F9;iCBG, BC B9K GhCCH

89J9@CDA9BH K5G C6G9FJ98 :FCA Gh5@@CK HiGGI9G.

Fig. 4 -S 9LDF9GGiCB iB N%% HF5BG;9Bi7 9LD@5BHG. a -S 9LDF9GGiCB iB N%% 9LD@5BHG :FCA Hh9 BC G9@97HiCB A9HhC8 :C@@CKiB; HF5BG:CFA5-

HiCB KiHh DCA&BIA3301 (Fi;. 3 NC G9@97HiCB light 7C@CIF98 bar). b

-S 9LDF9GGiCB iB N%% 9LD@5BHG :FCA Hh9 BC G9@97HiCB A9HhC8 :C@-

@CKiB; HF5BG:CFA5HiCB KiHh DCA&BIA1305.2 (Fi;. 3 NC G9@97HiCB

dark 7C@CIF98 bar). c SI67I@HIF98 GhCCHG :FCA 5 GiB;@9 9LD@5BH :FCA

Hh9 8FCD@9H 5B8 A98i5 G9@97HiCB A9HhC8 3 ACBHhG 5:H9F HF5BG:CFA5-

HiCB KiHh DCA&BIA1305.2 (Fi;. 3 DFCD@9H 5B8 iB A98i5 G9@97HiCB

dark 7C@CIF98 bar). d C@CG9ID C: 5 GI67I@HIF98 GhCCH :FCA c. ShCK-iB; 7hiA9FiGA. e %CB;iHI8iB5@ 7FMCGH5H G97HiCB HhFCI;h 5 -S-GH5iB98

9LD@5BH 20 85MG 5:H9F HF5BG:CFA5HiCB KiHh DCA&BIA 1305.2 5B8 8FCD-

@9H G9@97HiCB KiHh hM;FCAM7iB

1 3


106

h58 ACF9 h95@HhM HiGGI9 5B8 9A9F;iB; GhCCHG ACF9 :F9-

EI9BH@M GIFJiJ98 (Fi;. 2; ,56@9 1). ,hiG K5G 7CA6iB98 KiHh

Hh9 C6G9FJ5HiCB C: /ij5M5BHC 9H 5@. (2009) Hh5H HF5BG:CFA5-

HiCB KiHh Hh9 5BHi-5DCDHCGiG ;9B9 7CBGHFI7H )35 @98 HC 5

hi;h9F HF5BG:CFA5HiCB :F9EI9B7M Hh5B h58 DF9JiCIG@M 699B

57hi9J98 iB N%%. ,h9 hMDCHh9GiG 89J9@CD98 K5G Hh5H DF9-

J9BHiCB C: 79@@ 895Hh iB Hh9 NCB9 C: HF5BG:CFA5HiCB Ai;hH

iADFCJ9 GIFJiJ5@ C: HF5BG;9Bi7 GhCCHG.

HM;FCAM7iB G9@97HiCB iG 5 B9;5HiJ9 G9@97HiCB A9HhC8

iH ?i@@G IBHF5BG:CFA98 79@@G :FCA Hh9 HF5BG:CFA5HiCB DFC-

798IF9. HCK9J9F iH 5@GC GHF9GG9G @iJiB; HF5BG;9Bi7 79@@G.

DMiB; D@5BH 79@@G A5M F9@95G9 HCLi7 GI6GH5B79G CF 6@C7?

BIHFi9BH IDH5?9 iB 5 K5M Hh5H iAD5iFG F9;9B9F5HiCB C: Hh9

HF5BG:CFA98 CB9G. ,h9F9:CF9, 5 BIA69F C: 9LD@5BHG Hh5H 5F9

D5FHi5@@M HF5BG:CFA98 (7hiA59Fi7) Ai;hH 69 9@iAiB5H98 iB

Hh9 G9@97HiCB DFC79GG (#C9FG6C 5B8 (??9@G 1996). ,h9 iBi-

Hi5@ H9GH C: 57IH9 JG 7hFCBi7 8CG9 C: hM;FCAM7iB 89H9FAiB98

Hh9 @9Hh5@ 7CB79BHF5HiCB C: hM;FCAM7iB CB N%% D@5BH, 5B8

5@GC 9L5AiB98 Hh9 CIH7CA9 C: 5DD@MiB; 5 @CK 7CB79BHF5HiCB

C: hM;FCAM7iB HC iBhi6iH 89J9@CDA9BH F5Hh9F Hh5B ?i@@ BCB-

HF5BG;9Bi7 79@@G. ADD@i75HiCB C: 10 A; %−1 hM;FCAM7iB iB

HC ;9B9F5H9 HF5BG;9Bi7 N%% @iAiHG 6CHh Hh9 75D57iHM :CF 65Gi7

F9G95F7h CB ;9B9 :IB7HiCB HC :C@@CK :FCA 9A9F;iB; ;9BCA9

iB:CFA5HiCB (N9@GCB 9H 5@. 2006) 5B8 7CAA9F7i5@ CDDCFHIBi-

Hi9G Hh5H Ai;hH 5FiG9 :FCA iADFCJ98 ;9B9 :IB7HiCB IB89F-

GH5B8iB;. *9G95F7h 9::CFHG h5J9 GI6G9EI9BH@M :C7IGG98 CB

DCH9BHi5@ C: 5@H9FB5HiJ9 G9@97HiCB A9HhC8C@C;i9G HC iADFCJ9

HF5BG:CFA5HiCB CIH7CA9G. ,h9 IG9 C: ;@MDhCG5H9 G9@97HiCB

K5G 89J9@CD98 5G D5FH C: Hh5H iBiHi5HiJ9 (B5F?9F 9H 5@. 2016).

HCK9J9F 5@HhCI;h Hh5H F9G95F7h ;9B9F5H98 N%% D@5BHG

KiHh GHFCB; 5;FCBCAi7 DCH9BHi5@ (Si 9H 5@. GI6AiHH98), Hh9

efficiency of the transformation was not improved. Hygro-AM7iB G9@97HiCB h58 699B F9DCFH98 HC ;F95H@M iADFCJ9 HF5BG-

formation efficiency in soybean (Olhoft et al. 2003) 5B8 K5G :CIB8 iB HhiG F9G95F7h HC 69 5 GIiH56@9 5@H9FB5HiJ9 G9@97HiCB

:CF N%% HF5BG:CFA5HiCB.

/9 :CIB8 Hh5H 5 8FCD@9H C: hM;FCAM7iB ?i@@98 5Di75@

8CA9 79@@G G9@97HiJ9@M, IB@i?9 )),, Khi7h 5@HhCI;h F9DCFH-

98@M DCCF@M HF5BG@C75H98 (/i@8 5B8 /9B8@9F 1991) K5G ACF9

;9B9F5@@M HCLi7. ELD@5BHG HF95H98 KiHh )), K9F9 IBh95@HhM

5B8 IB56@9 HC GIDDCFH ;FCKHh C: 9A9F;iB; DIH5HiJ9 HF5BG-

:CFA98 GhCCHG, Kh9F95G 9LD@5BHG HF95H98 KiHh hM;FCAM7iB

Fig. 5 A@@ 9LDCG98 5B8 KCIB898 79@@G C: N%% 9LD@5BHG 5F9 7CAD9H9BH

:CF HF5BG:CFA5HiCB KiHh A;%0. A@@ scale bars 5F9 500 WA @CB; a IA5;9 GhCKiB; 9 F) 9LDF9GGiCB HhFCI;h 5 G97HiCB98 N%% GhCCH 4 85MG 5:H9F

HF5BG:CFA5HiCB KiHh DH35 5B8 8FCD@9H G9@97HiCB KiHh hM;FCAM7iB b

B9;5HiJ9 7CBHFC@ 4 85MG 5:H9F HF5BG:CFA5HiCB KiHh A;%0 5B8 8FCD@9H

G9@97HiCB KiHh hM;FCAM7iB c 9 F) 9LDF9GGiCB HhFCI;h 5 G97HiCB98 N%% GhCCH 7 85MG 5:H9F HF5BG:CFA5HiCB KiHh DH35 5B8 8FCD@9H G9@97HiCB

KiHh hM;FCAM7iB d light field (transmitted light) Ai7FCG7CDM C: HF5BG-

;9Bi7 N%% 12 85MG 5:H9F HF5BG:CFA5HiCB KiHh DH35 GhCKiB; iBiHi5@

GhCCH 89J9@CDA9BH (white 6CL98 F9;iCB) 5B8 GH566iB; 85A5;9 C: Hh9

A9FiGH9A (arrows) e Panel d section imaged with fluorescent micros-7CDM i@@IGHF5HiB; 9 F) 9LDF9GGiCB HhFCI;hCIH Hh9 9A9F;iB; Gi89 GhCCH

(white 6CL98 F9;iCB), 5@GC iB Hh9 9Di89FA5@ 79@@G 5B8 79@@G GIFFCIB8iB;

Hh9 GH566iB; 85A5;9 C: Hh9 A9FiGH9A (arrows)

1 3


Appendices

107

Conclusion

HM;FCAM7iB G9@97HiCB A9HhC8C@C;M DFCJi898 5B iADFCJ98

A95BG HC ;9B9F5H9 HF5BG;9Bi7 GhCCHG :FCA N%% Hh5B Hh9

GH5B85F8 A9HhC8C@C;M Khi7h IHi@iG98 )), G9@97HiCB.

(6G9FJ5HiCBG C: -S F9DCFH9F ;9B9 9LDF9GGiCB iB8i75H98

Hh5H BC G9@97HiCB K5G F9EIiF98 HC ;9B9F5H9 D5FHi5@@M HF5BG-

:CFA98 GhCCHG 5B8 HF5BG:CFA5HiCB 7CAD9H9B79 C: 5@@ N%%

79@@G 9LDCG98 HC Agrobacteriu K5G iB8i75H98 IGiB; 9 F)

9LDF9GGiCB. HCK9J9F, iB F9@5HiCB HC Hh9 iGGI9 C: 7hiA9Fi7

GhCCH 89J9@CDA9BH iB Hh9 HF5BG:CFA5HiCB A9HhC8C@C;M, CIF

F9GI@HG GI;;9GH98 Hh5H 7@CG9F iBJ9GHi;5HiCB C: Hh9 GHFI7HIF9

C: Hh9 N%% GhCCH 9LD@5BHG K5G F9EIiF98 HC 89H9FAiB9 Khi7h

79@@G iB Hh9 5Di75@ 8CA9 K9F9 7CAD9H9BH HC F9;9B9F5H9.

Acknowledgments The first author acknowledges with deep grati-HI89 Hh9 AIGHF5@i5B AK5F8 S7hC@5FGhiD :IB898 6M Hh9 AIGHF5@i5B CJ-

9FBA9BH. ,h9 5IHhCFG GiB79F9@M Hh5B? DF &5F? /5H9FG (S7hCC@ C:

Ch9AiGHFM 5B8 BiC7h9AiGHFM, ,h9 -BiJ9FGiHM C: /9GH9FB AIGHF5@i5)

:CF Hh9 5H9K5M J97HCFG DH /FS7,0, DB7/ 2 5B8 DD(N*221.

,h9 5IHhCFG 57?BCK@98;9 Hh9 :57i@iHi9G C: CE%%C9BHF5@, S7hCC@ C:

AB5HCAM )hMGiC@C;M & HIA5B BiC@C;M. ,h9 -BiJ9FGiHM C: /9GH9FB

Australia and the facilities, scientific and technical assistance of the AIGHF5@i5B &i7FCG7CDM & &i7FC5B5@MGiG *9G95F7h F57i@iHM 5H Hh9 C9B-

HF9 :CF &i7FCG7CDM, Ch5F57H9FiG5HiCB & AB5@MGiG (C&CA), ,h9 -Bi-

J9FGiHM C: /9GH9FB AIGHF5@i5, 5 :57i@iHM :IB898 6M Hh9 -BiJ9FGiHM, SH5H9

5B8 CCAACBK95@Hh CJ9FBA9BHG.

References

ABA*ES (AIGHF5@i5B BIF95I C: A;Fi7I@HIF5@ 5B8 *9GCIF79 E7CBCA-

i7G 5B8 S7i9B79G) (2015) A;Fi7I@HIF5@ 7CAAC8iHM GH5HiGHi7G 2015

hHHD://KKK.5;Fi7I@HIF9.;CJ.5I/565F9G/DI6@i75HiCBG/8iGD@5M?IF@=hHHD://143.188.17.20/5BF8@/DAFFS9FJi79/[email protected]?:i8=D645;7GH89567700220154115.LA@

A;HF5BG *9G95F7h (2012) AB 97CBCAi7 5B5@MGiG C: *DC iBJ9GHA9BH

iB B5HiCB5@ @IDiB 6F998iB; :CF SCIHh9FB AIGHF5@i5. *DC (;F5iBG

F9G95F7h 5B8 89J9@CDA9BH 7CFDCF5HiCB) iAD57H 5GG9GGA9BH F9DCFH

G9Fi9G, C5B69FF5

AFI@ %, B9BiH5 , B5@5GI6F5A5Bi5B ) (2008) FIB7HiCB5@ iBGi;hH :CF

β-glucuronidase in Escherichia coli and Staphylococcus sp. *%H1. BiCiB:CFA5HiCB 2:339–343

AHi: *&, )5H5H-(7h5HH E&, SJ56CJ5 %, (B8F9j ., K@9BCHi7CJ5 H,

#575G %, Fi;5 &, (7h5HH S# (2013) 9B9 HF5BG:9F iB @9;IA9G. IB:

%[HH;9 -, B9MG7h@5; /, FF5B7iG D, CIGhA5B # (98G) )FC;F9GG iB

BCH5BM. SDFiB;9F, DD 37–100

AH?iBG CA, EA9FM *#N, SAiHh )&C (2011) CCBG9EI9B79G C: HF5BG-

:CFAiB; B5FFCK @95:98 @IDiB (Lupinus angustifolius 2%.3) KiHh 5B

ipt gene under control of a flower-specific promoter. Transgenic *9G 20:1321–1332

B565C;@I &, &7C569 &S, )CK9F #B, D5J9M &* (2000) Agrobac-

teriu -A98i5H98 HF5BG:CFA5HiCB C: Lupinus utabilis %. IGiB;

GhCCH 5Di75@ 9LD@5BHG. A7H5. )hMGiC@ )@5BH 22:111–119

B5F?9F S#, Si ), HC8;GCB %, F9F;IGCB-HIBH &, Kh9BHFM 1, KFiGh-

B5AIFHhM ), AJ9FiG S, &96IG K, (P%CB9 C, D5@I;C85 D, KCGh-

?IGCB N, F5iHh:I@@ ,, #57?GCB #, EFG?iB9 /. (2016) *9;9B9F5HiCB

selection improves transformation efficiency in narrow-leaf lupin. )@5BH C9@@ ,iGGI9 (F;5B CI@H 8Ci:10.1007/G11240-016-0992-7

B997?A5B ,, EB;@9F (1994) AB 95GM H97hBiEI9 :CF Hh9 7@95FiB; C:

hiGHC7h9Ai75@@M GH5iB98 D@5BH HiGGI9. )@5BH &C@ BiC@ *9D 12:37–42

G9@97HiCB A98i5 K5G 56@9 HC 57hi9J9 HhiG CIH7CA9 (Fi;. 2).

IH K5G hMDCHh9GiG98 Hh5H HhiG G9@97HiCB G7h9A9 DF9G9BH98 5

A95BG HC 7F95H9 CDDCFHIBiHM :CF HF5BG;9Bi7 79@@G HC 8iJi89,

DFC@i:9F5H9 5B8 8i::9F9BHi5H9 Khi@GH GIFFCIB8iB; HiGGI9G

F9A5iB98 F95GCB56@M h95@HhM, HhIG GIDDCFHiB; HF5BG;9Bi7

GhCCH ;FCKHh. ,hiG Ai;hH F98I79 7hiA9FiGA (Fi;. 47 7CA-

D5F98 HC Fi;. 45, 6), 6IH KCI@8 BCH iADFCJ9 Hh9 :F9EI9B7M

C: C6H5iBiB; HF5BG;9Bi7 GhCCHG (,56@9 1) IB@9GG Hh9 G9@97HiCB

K5G 5DD@i98 @5H9F (Fi;. 3).

(@hC:H 9H 5@. (2003) DFCDCG98 Hh5H 6975IG9 Hh9 AC89 C:

57HiCB C: hM;FCAM7iB iBJC@J98 iBhi6iHiCB C: DFCH9iB GMB-

Hh9GiG, HF5BG;9Bi7 79@@G K9F9 IB@i?9@M HC 7FCGG-:998 BCB-

HF5BG;9Bi7 79@@G HC CJ9F-Fi89 Hh9 G9@97HiJ9 5;9BH, IB@i?9 Kh5H

Ai;hH C77IF KiHh )), G9@97HiCB. FIFHh9FACF9, h9FiH56i@iHM C:

Hh9 HF5BG;9B9 iB ,1 ;9B9F5HiCB F9EIiF9G iH HC 69 @C75H98 iB Hh9

tissue that develops into reproductive cell layers of the floral A9FiGH9A (SNMA?CKi5? 5B8 SIGG9L 1992; HI5@5 5B8 SIGG9L

1993). FCF Hh9G9 F95GCBG, 89H9FAiBiB; Hh9 GHFI7HIF9 C: 7hi-

A9Fi7 GhCCHG C6H5iB98 KiHh hM;FCAM7iB G9@97HiCB 7CAD5F98

HC )), KCI@8 69 iB:CFA5HiJ9. HCK9J9F iB DIFGIiB; Hh5H ;C5@,

5B5@MGiG C: 9LDF9GGiCB C: Hh9 -S F9DCFH9F ;9B9 iB Hh9 iBi-

Hi5@ 9LD9FiA9BHG CB G9@97HiCB A9HhC8C@C;M ;5J9 IB9LD97H98

9Ji89B79 (AHi: 9H 5@. 2013) that transformation efficiency of N%% 79@@G K5G BCH iB iHG9@: Hh9 F5H9-@iAiHiB; GH9D :CF ;9B9F5-

HiCB C: h9FiH56@9 HF5BG;9Bi7 GhCCHG (Fi;G. 3, 4). HCK9J9F 8I9

HC Hh9 @iAiH5HiCB C: Hh9 -S GH5iBiB; A9HhC8C@C;M HC 7@95F@M

JiGI5@iG9 Hh9 HF5BG;9Bi7 G97HCFiB; (Fi;. 4), iH K5G 897i898 HC

IHi@iG9 F) ;9B9 9LDF9GGiCB 5G 5 A95BG C: 5G79FH5iBiB; hCK

Hh9 HF5BG;9Bi7 GhCCH GHFI7HIF9 89J9@CD98 5B8 Kh5H HMD9/G C:

7hiA9FiGA K9F9 C77IFFiB;.

IBJ9GHi;5HiCB C: F) 9LDF9GGiCB :FCA Hh9 5H9K5M J97HCF

7CBGHFI7H DH35 (Fi;G. 1, 5) DFCJ98 9J9B ACF9 i@@IAiB5HiB;

Hh5B h58 iBiHi5@@M 699B 9LD97H98. *5Hh9F Hh5B 89J9@CDA9BH

C: 7hiA9Fi7 GhCCHG F9GI@HiB; :FCA 5B C775GiCB5@ HF5BG:CFA5-

tion event along with significant recruitment of non trans-;9Bi7 HiGGI9, 5G h58 DF9JiCIG@M 699B GIDDCG98, iH 6975A9

5DD5F9BH Hh5H DCH9BHi5@@M IBi:CFA@M HF5BG:CFA98 GhCCHG

Ai;hH 69 C6H5iB98 i: HiGGI9G @CK9F Hh5H Hh9 5Di75@ 8CA9 K9F9

9LDCG98 HC A;FC657H9FiIA (Fi;. 59). ,hiG F9GI@H K5G 7CB-

GiGH9BH KiHh Hh9 C6G9FJ98 hi;h9F :F9EI9B7M C: HF5BG:CFA5-

HiCB Kh9B 5Di75@ A9FiGH9A 79@@ @5M9FG K9F9 F9ACJ98 :FCA

Hh9 HF95H98 9LD@5BH iB Hh9 9LD9FiA9BHG F9DCFH98 6M B565C;@I

9H 5@. (2000). ,h9 CIH7CA9 C: HhiG F9G95F7h Hh9F9:CF9 GI;-

;9GH98 5 7CAD@9H9 F9JiGiCB C: Hh9 HF5BG:CFA5HiCB 5DDFC57h

K5G F9EIiF98. IBJ9GHi;5HiCB C: Khi7h 79@@G CF HiGGI9G K9F9

7CAD9H9BH HC F9;9B9F5H9 :C@@CKiB; 9LDCGIF9 HC Agrobacte-

riu , 5@CB; KiHh 7CBGi89F5HiCB C: Hh9 9::97H C: G9@97HiCB CB

9LD@5BH h95@Hh, Ai;hH DFCJi89 JiH5@ iB:CFA5HiCB HC 9B56@9

development of a more efficient transformation methodol-C;M. A GHI8M HC 89H9FAiB9 i: iADFCJ98 A9HhC8C@C;M 7CI@8

F9GI@H :FCA IB89FGH5B8iB; Hh9 N%% SA& GHFI7HIF9 5B8

89J9@CDA9BH K5G IB89FH5?9B 5B8 Hh9 CIH7CA9 iG F9DCFH98 iB

Hh9 577CAD5BMiB; D5D9F (N;IM9B 9H 5@. 2016).

1 3


108

HF5BG:CFA5HiCB C: @IDiBG 5B8 CHh9F @9;IA9G. )@5BH C9@@ ,iGGI9

(F;5B CI@H. 8Ci:10.1007/G11240-016-1087-1

OGTR (Office of the Gene Technology Regulator) (2013) Biology of Lupinus L. (Lupin or lupine). version 1. office of the gene tech-BC@C;M F9;I@5HCF, 89D5FHA9BH C: h95@Hh 5B8 5;9iB;, C5B69FF5

Olhoft PM, Flagel LE, Donovan CM, Somers DA (2003) Efficient soy-695B HF5BG:CFA5HiCB IGiB; hM;FCAM7iB B G9@97HiCB iB Hh9 7CHM@9-

8CB5FM-BC89 A9HhC8. )@5BH5 216:723–735

)i;95iF9 A, A69FB9Hh D, SAiHh )&C, SiADGCB K, F@9H7h9F N, %I C-1,

AH?iBG CA, CCFBiGh E (1997) ,F5BG:CFA5HiCB C: 5 ;F5iB @9;IA9

7FCD (Lupinus angustifolius %.) Ji5 Agrobacteriu tu efaciens

A98i5H98 ;9B9 HF5BG:9F HC GhCCH 5Di79G. &C@ BF998 3:341–349

Si ), F9F;IGCB-HIBH &, #57?GCB #, HC8;GCB %, KFiGhB5AIFHhM ),

B5F?9F S#, EFG?iB9 /. Di::9F9BHi5@ HC@9F5B79 HC ;@MDhCG5H9 7CB-

:9FF98 6M 5B 5@H9FB5HiJ9 E)S)S ;9B9 5ACB; HF5BG;9Bi7 9J9BHG C:

B5FFCK-@95:98 @IDiB (GI6AiHH98)

SCA9FG DA, S5A57 DA, (@hC:H )& (2003) *979BH 58J5B79G iB @9;IA9

HF5BG:CFA5HiCB. )@5BH )hMG 131:892–899

SNMA?CKi5? E#, SIGG9L I& (1992) ,h9 iBH9FB5@ A9FiGH9A @5M9F (%3)

determines floral meristem size and carpel number in tomato D9Fi7@iB5@ 7hiA9F5G. )@5BH C9@@ 4:1089–1100. 8Ci:10.1105/

HD7.4.9.1089

,569 %, /iFHN &, &C@Ji; %, DFCIL &, H9@@ * (2010) (J9F9LDF9GGiCB

C: G9FiB9 579H@MHF5BG:9F5G9 DFC8I798 @5F;9 iB7F95G9G iB (-579HM@-

G9FiB9 5B8 :F99 7MGH9iB9 iB 89J9@CDiB; G998G C: 5 ;F5iB @9;IA9. #

ELD BCH 61:721–733

Tirichine L, Andrey P, Biot E, Maurin Y, Gaudin V (2009) 3D fluores-79BH iB GiHI hM6Fi8iN5HiCB IGiB; Arabidopsis @95: 7FMCG97HiCBG 5B8

iGC@5H98 BI7@9i. )@5BH &9HhC8G 5:11

/ij5M5BHC ,, B5F?9F S#, /M@i9 S#, i@7hFiGH D , CCK@iB; /A (2009)

Significant reduction of fungal disease symptoms in transgenic @IDiB (Lupinus angustifolius) 9LDF9GGiB; th9 5BHi-5DCDHCHi7 657I-@CJiFIG ;9B9 p35. )@5BH BiCH97hBC@ # 7:778–790

/i@8 A, /9B8@9F C (1991) E::97H C: ;@I:CGiB5H9 (DhCGDhiBCHhFi7iB) CB

5AiBC 57i8 7CBH9BH, DhCHCF9GDiF5HiCB, 5B8 DhCHCGMBHh9GiG. )9GHi7

S7i 30:422–424

/iGNBi9KG?i A (2011) DiGG97HiB; :IB7HiCBG C: A9A69FG C: 69H5-CLi-

85HiCB AI@Hi-;9B9 :5Ai@i9G iB Arabidopsis. DiGG9FH5HiCB, ,h9 -Bi-

J9FGiHM C: /9GH9FB AIGHF5@i5

BCKF5A D, H5Gh9A A (2008) ,h9 FC@9 C: K998 A5B5;9A9BH iB GIG-

H5iBiB; GMGH9AG :CF @IDiB DFC8I7HiCB. IB: )5@H5 #A, B9F;9F #B (98G)

%IDiBG :CF h95@Hh 5B8 K95@Hh, )FC7998iB;G C: 12Hh iBH9FB5HiCB5@

@IDiB 7CB:9F9B79, 14–18 S9DH, FF9A5BH@9, DD 11–14

C5i / (2014) ,F5BG7FiDHiCB5@ F9;I@5HiCB C: 7h@CFCD@5GH 5G7CF65H9 D9F-

CLi85G9G iB Arabidopsis thaliana. DiGG9FH5HiCB, FF9i9 -BiJ9FGiHäH

B9F@iB

FiHN %, D5Ji9G # (1983) )@5GAi8-9B7C898 hM;FCAM7iB B F9GiGH5B79:

Hh9 G9EI9B79 C: hM;FCAM7iB B DhCGDhCHF5BG:9F5G9 ;9B9 5B8 iHG

9LDF9GGiCB iB Escherichia coli 5B8 Saccharo yces cerevisiae.

9B9 25:179–188

HI5@5 E, SIGG9L I& (1993) D9H9FAiB5HiCB 5B8 79@@ iBH9F57HiCBG iB

F9DFC8I7HiJ9 A9FiGH9AG. )@5BH C9@@ 5:1157–1165

#9::9FGCB *A, K5J5B5;h ,A, B9J5B &/ (1987) -S :IGiCBG: 69H5-

;@I7IFCBi85G9 5G 5 G9BGiHiJ9 5B8 J9FG5Hi@9 ;9B9 :IGiCB A5F?9F iB

hi;h9F D@5BHG. E&B( # 6:3901

#C9FG6C &, (??9@G F, (1996) A BCJ9@ DFiB7iD@9 :CF G9@97HiCB C: HF5BG-

;9Bi7 D@5BH 79@@G: DCGiHiJ9 G9@97HiCB. )@5BH C9@@ *9D 16:219–221

K5F5Ai (, EGB5-AGh5Fi &, K5FiAi KIF8iGH5Bi , A;h5J5iGi B (2009)

Agrobacteriu -A98i5H98 ;9B9Hi7 HF5BG:CFA5HiCB C: D@5BHG: Hh9

FC@9 C: hCGH. BiC@ )@5BH 53:201–212

%5NC *, SH9iB )A, %I8Ki; *A (1991) A DNA HF5BG:CFA5HiCB-7CA-

D9H9BH Arabidopsis ;9BCAi7 @i6F5FM iB Agrobacteriu . N5H BiC-

H97hBC@ 9:963–967

%i H, /M@i9 S#, #CB9G & K (2000) ,F5BG;9Bi7 M9@@CK @IDiB (Lupinus

luteus). )@5BH C9@@ *9D 19:634–637

&C@Ji; %, ,569 %&, E;;IA B(, &CCF9 AE, CF5i; S, SD9B79F D, Hi;-

;iBG ,#. (1997) EBh5B798 A9HhiCBiB9 @9J9@G 5B8 iB7F95G98 BIHFi-

HiJ9 J5@I9 C: G998G C: HF5BG;9Bi7 @IDiBG (Lupinus angustifolius %.)

expressing a sunflower seed albumin gene. Proc Nat Acad Sci -SA 94:8393–8398

N9@GCB &N, )h5B H,,, E@@KCC8 S*, &CC@hIijN9B )&, B9@@;5F8 &,

Hane J, Williams A, Fosu-Nyarko J, Wolko B, Książkiewicz &, C5?iF &, #CB9G & K, S7C6i9 &, (P%CB9 CE, B5F?9F S#,

Oliver RP, Cowling WA (2006) The first gene-based map of Lupinus angustifolius %.R@C75HiCB C: 8CA9GHi75HiCB ;9B9G 5B8

7CBG9FJ98 GMBH9BM KiHh Medicago truncatula. ,h9CF ADD@ 9B9H

113:225–238

N;IM9B AH, HC8;GCB %&, EFG?iB9 /, B5F?9F S# (2016) AB

5DDFC57h HC CJ9F7CAiB; F9;9B9F5HiCB F975@7iHF5B79 iB ;9B9Hi7

1 3


Appendices

109

Appendix V

An approach to overcoming regeneration recalcitrance in genetic transformation of lupins

and other legumes. Plant Cell, Tissue and Organ Culture (PCTOC), pp.623-635.

110

OR G NAL ART CLE

*HF4A J. B4Ek8E

[email protected]

1 C8AGE8 9BE P?4AG G8A8Gi6F 4A7 BE887iA: (PGB), *6;BB? B9

P?4AG BiB?B:L M080, T;8 ,AiI8EFiGL B9 .8FG8EA AHFGE4?i4,

CE4J?8L, .A 6009, AHFGE4?i4

2 *6;BB? B9 P?4AG BiB?B:L M090, T;8 ,AiI8EFiGL B9 .8FG8EA

AHFGE4?i4, 35 *GiE?iA: Hi:;J4L, CE4J?8L, .A 6009, AHFGE4?i4

3 F46H?GL B9 BiB?B:L, H4ABi ,AiI8EFiGL B9 *6i8A68, H4ABi,

-i8GA4@

4 D8C4EG@8AG B9 A:Ei6H?GHE8 4A7 EAIiEBA@8AG, C8AGE8 9BE CEBC

4A7 DiF84F8 M4A4:8@8AG, CHEGiA ,AiI8EFiGL, B8AG?8L,

.A 6845, AHFGE4?i4

5 AFGiGHG8 B9 A:Ei6H?GHE8 M082, T;8 ,AiI8EFiGL B9 .8FG8EA

AHFGE4?i4, CE4J?8L, .A 6009, AHFGE4?i4

)868iI87: 25 JH?L 2016 / A668CG87: 2 *8CG8@58E 2016

U *CEiA:8E *6i8A68+BHFiA8FF M87i4 DBE7E86;G 2016

An a--.,ach t, ,2e.c,ming .egene.ati,n .ecalcit.ance in genetic

t.ansf,.mati,n ,f l1-ins and ,the. leg1mes

An H,ai Ng14en1,2,3 5 Le,n M. H,dgs,n1,4 5 William E.skine1,5 5 S1san J. Ba.ke.2,5

Agrobacterium, iA 6B@5iA4GiBA JiG; 78?4L87 F8?86GiBA

CEBI87 FH668FF9H?, iA6E84FiA: iAiGi4? 8KC?4AGF GE4AF9BE@4-

tion efficiency up to 75 % and generating axillary shoots with significant transgenic content. Based on knowledge :4iA87 9EB@ FGH7i8F B9 C?4AG 6;i@8E4F, 9HEG;8E FH56H?GHE8

B9 G;8F8 iAiGi4? 4Ki??4EL F;BBGF Ji?? E8FH?G iA 78I8?BC@8AG

B9 ?BJ 6;i@8Ei6 GE4AF:8Ai6 @4G8Ei4?F JiG; ;8EiG45?8 6BA-

G8AG. FHEG;8E@BE8, G;8 @8G;B7 J4F 4?FB G8FG87 FH668FF-

9H??L BA BG;8E Lupinus species, faba bea and field pea. T;8F8 E8FH?GF 78@BAFGE4G8 G;4G 78I8?BC@8AG B9 4 ;i:;

Li8?7iA: GE4AF9BE@4GiBA @8G;B7B?B:L 9BE CH?F8 ?8:H@8

6EBCF iF 46;i8I45?8.

Ke43,.ds N4EEBJ ?84987 ?HCiA Y

Lupinus angustifolius ?8:H@8 GE4AF9BE@4GiBA Y

)8:8A8E4GiBA Y Agrobacterium tumefaciens Y GE88A

fluorescent protein · Shoot axillary bud transformation · M8Ei6?iA4? 4A7 C8Ei6?iA4? 6;i@8E4 Y D8?4L87 F8?86GiBA

@8G;B7B?B:L

A .e2iati,ns

C6 CB-6H?GiI4GiBA @87iH@

C1 C8AGE4? MBA8

eGFP Enhanced green fluorescent proteinGM G8A8Gi6 @4AiCH?4GiBA;

MPH Mi6EBCEBC4:4GiBA @87iH@ JiG; ;L:EB@L6iA

NLL N4EEBJ-?849 ?HCiA

): )8:8A8E4GiBA @87iH@

PPT P;BFC;iABG;Ei6iA

P1 P8EiC;8E4? MBA8

)1 )i5 MBA8

*AM *;BBG 4Ci64? @8EiFG8@

T0 AiGi4? :8A8E4GiBA B9 GE4AF:8Ai6 F;BBG

T1 PEB:8AL B9 T0 :8A8E4GiBA

A st.act FBE CH?F8 ?8:H@8 E8F84E6; GB 9H??L 64Ci-

G4?iF8 BA 78I8?BC@8AGF iA C?4AG @B?86H?4E :8A8Gi6F, 4

;i:; G;EBH:;CHG :8A8Gi6 GE4AF9BE@4GiBA @8G;B7B?B:L

iF E8DHiE87. A .8FG8EA AHFGE4?i4 G;8 7B@iA4AG :E4iA

?8:H@8 iF Lupinus angustifolius L. (A4EEBJ ?84987 ?HCiA;

NLL). *G4A74E7 GE4AF9BE@4GiBA @8G;B7B?B:L HGi?iFiA:

Agrobacterium tumefaciens BA JBHA787 NLL F887?iA:

F;BBG 4Ci68F, iA 6B@5iA4GiBA JiG; GJB 7i998E8AG ;8E5i-

6i78 F8?86GiBAF (C;BFC;iABG;Ei6iA 4A7 :?LC;BF4G8) iF Gi@8

consuming, inefficient, and produces chimeric shoots G;4G B9G8A 94i? GB Li8?7 GE4AF:8Ai6 CEB:8AL. AI8FGi:4GiBA

B9 ;L:EB@L6iA 4F 4A 4?G8EA4GiI8 F8?86GiBA iA 6B@5iA4GiBA

with expression of green fluorescent protein indicated G;4G GE4AF9BE@4GiBA B9 NLL 4Ci64? 68??F J4F ABG G;8 E4G8

?i@iGiA: FG8C GB 46;i8I8 GE4AF:8Ai6 F;BBG @4G8Ei4?F. A

this research it was identified that despite ready trans-9BE@4GiBA, 4Ci64? 68??F J8E8 ABG 6B@C8G8AG GB E8:8A8E-

4G8. HBJ8I8E 4 788C 4A7 5EB47 JBHA7iA: CEB687HE8 GB

8KCBF8 HA78E?LiA: 4Ki??4EL F;BBG 4A7 I4F6H?4E 68??F GB

1 3

Plant Cell Tiss Organ Cult (2016) 127:623–635DOI 10.1007/s11240-016-1087-1

/ Published online: 20 September 2016

Appendices

111

BA8 C8E68AG iA G;8 6HEE8AG NLL 6H?GiI4E (.ij4L4AGB 8G 4?.

2009; N:HL8A 8G 4?. 2016; B4Ek8E 8G 4?. HACH5?iF;87 E8FH?GF).

The difficulty with NLL transformation led to exami-A4GiBA B9 4?G8EA4GiI8 F8?86GiBA @8G;B7B?B:i8F. G?LC;BF4G8

F8?86GiBA 7i7 ABG @4G8Ei4??L i@CEBI8 G;8 E8FH?GF 9EB@ G;8

6HEE8AG @8G;B7B?B:L (B4Ek8E 8G 4?. 2016). HBJ8I8E, E8FH?GF

9EB@ HF8 B9 ;L:EB@L6iA 4F 4 F8?86G45?8 @4Ek8E 4?BA: JiG;

expression of the green fluorescent protein (GFP) led to G;8 HA8KC86G87 E84?iF4GiBA G;4G GE4AF9BE@4GiBA B9 NLL 68??F

8KCBF87 GB A. tumefaciens J4F 8FF8AGi4??L HAiI8EF4?, 4A7

4?FB G;4G G;8 @4jBEiGL B9 68??F G;4G J8E8 8KCBF87 5L G;8 6HE-

E8AG JBHA7iA: @8G;B7 7i7 ABG 4CC84E GB 78I8?BC iAGB F;BBGF

(N:HL8A 8G 4?. 2016). &A?L 78I8?BC@8AG B9 GFP 8KCE8FF-

iA: F;BBGF 9EB@ 788C8E GiFFH8 6BH?7 58 B5F8EI87, CE8FH@-

45?L J;8A FG455iA: J8AG 788C8E G;4A BEi:iA4??L iAG8A787.

.8 ;LCBG;8FiF87 G;4G 58GG8E HA78EFG4A7iA: G;8 FGEH6GHE8 B9

G;8 NLL F;BBG 4Ci64? @8EiFG8@ 4A7 78G8E@iA4GiBA B9 G;8

BEi:iA B9 F;BBGF G;4G BEi:iA4G87 9EB@ JBHA787 8@5ELBAi6

4KiF J;i?FG 9B??BJiA: G;8 6HEE8AG @8G;B7F JBH?7 CEBIi78

information that would enable the design of a more efficient GE4AF9BE@4GiBA CEBGB6B?. T;8 4i@F B9 G;iF E8F84E6; J8E8

threefold: first, to significantly improve the frequency of :8A8E4GiBA B9 GE4AF:8Ai6 NLL F;BBG @4G8Ei4?F; F86BA7, GB

E87H68 BE E8@BI8 G;8 6;i@8Ei6 FGEH6GHE8 B9 GE4AF:8Ai6 NLL

F;BBGF; G;iE7, GB 78G8E@iA8 i9 G;8 GE4AF9BE@4GiBA CEBGB6B?

J4F GE4AF98E45?8 GB BG;8E CH?F8 ?8:H@8 6EBCF.

Mate.ials and meth,ds

Reg1lat,.4 a--.,2al

Approval for this research was obtained from the Office of G;8 G8A8 T86;AB?B:L )8:H?4GBE (AHFGE4?i4) HA78E 4CCEBI4?

AH@58E NL)D 5/1/406 9EB@ G;8 ,AiI8EFiGL B9 .8FG8EA AHF-

GE4?i4 AFGiGHGiBA4? BiBF498GL CB@@iGG88.

Agrobacterium strain and vector construct

TE4AF9BE@4GiBA 8KC8Ei@8AGF J8E8 64EEi87 BHG HFiA: G;8 A.

tumefaciens FGE4iA A:L0 (L4MB 8G 4?. 1991) ;4E5BHEiA: G;8

5iA4EL Ti C?4F@i7 6?BA8 CH35 (N:HL8A 8G 4?. 2016). T;8 I86-

GBE CH35 6BAG4iA87 4 GFP-G,* 9HFiBA 9BE C?4AG 8KCE8FFiBA

HA78E 6BAGEB? B9 C4M-35* 8Hk4ELBGi6 CEB@BG8E JiG; 7HC?i-

64G87 8A;4A68E E8:iBA, ;L:EB@L6iA E8FiFG4A68 :8A8 (H-gR)

9BE C?4AG GE4AF9BE@4GiBA 4A7 FC86GiAB@L6iA/FGE8CGB@L6iA

E8FiFG4A68 (*@/*C)) 9BE 546G8Ei4? GE4AF9BE@4GiBA (K4E4@i

8G 4?. 2009; N:HL8A 8G 4?. 2016). TB CE8C4E8 G;8 A tumefa-

ciens 9BE GE4AF9BE@4GiBA, 4 9E8F; C?4G8 6H?GHE8 J4F :EBJA

9EB@ − 80 WC :?L68EB? FGB6k FGBE4:8. AA BI8EAi:;G ?iDHi7

6H?GHE8 J4F CE8C4E87 9EB@ 4 FiA:?8 6B?BAL, G;4G J4F 7i?HG87

1/10 BA G;8 @BEAiA: B9 G;8 GE4AF9BE@4GiBA 4A7 :EBJA JiG;

Int.,d1cti,n

G8A8Gi6 @4AiCH?4GiBA (GM) B9 C?4AGF ;4F E8FH?G87 iA 6B@-

@8E6i4? HCG4k8 B9 G;8 G86;AB?B:L G;4G @i:;G 58 6B@C4E87

GB G;8 :E88A E8IB?HGiBA. A G;8 20-L84E C8EiB7 1996 GB 2015

G;8E8 J8E8 2.0 5i??iBA 466H@H?4G87 ;86G4E8F B9 5iBG86; 6EBCF

:EBJA :?B54??L, B9 J;i6; 1.0 5i??iBA ;86G4E8F J8E8 5iBG86;

FBL584A 2Gl-cine max (L.) M8EEi??3. T;8 BA?L BG;8E Fi:-

nificantly cultivated biotech-enhanced legume was alfalfa (Medicago sativa L.) iA G;8 ,*A (J4@8F 2015). A77iGiBA-

4??L, G;8 i@CBEG4A68 B9 Medicago truncatula G48EGA. 4A7

Lotus japonicus L. 4F :8AB@8 @B78?F ;4F 7EiI8A 78I8?BC-

@8AG B9 4 9HA6GiBA4? GE4AF9BE@4GiBA FLFG8@ 9BE G;8F8 ?8:H@8

FC86i8F. HBJ8I8E, 78FCiG8 G;8 i@CBEG4A68 B9 CH?F8 ?8:H@8F

GB 5BG; ;H@4A 4A7 4:EB86BFLFG8@ ;84?G;, E8F84E6; BA 4AL

B9 G;8F8 6EBC FC86i8F ;4F 588A ;4@C8E87 5L G;8 ?46k B9 4

;i:; G;EBH:;CHG :8A8Gi6 GE4AF9BE@4GiBA FLFG8@ (*B@8EF 8G

4?. 2003; AGi9 8G 4?. 2013; 4AG6;8I4 8G 4?. 2013).

A G;8 M87iG8EE4A84A 6EBCCiA: FLFG8@F B9 AHFGE4?i4, G;8

7B@iA4AG ?8:H@8 iF Lupinus angustifolius L. (A4EEBJ ?849

?HCiA; NLL) (DE46HC 4A7 KiE5L 1996). .i78AiA: G;8 NLL

:8A8 CBB? 5L GM E8F84E6; ;4F 588A 64EEi87 BHG GBJ4E7F

477iA: 4:EBAB@i6 GE4iGF FH6; 4F ;8E5i6i78 GB?8E4A68 (Pi:8-

4iE8 8G 4?. 1997; B4Ek8E 8G 4?. 2016), A86EBGEBC;i6 9HA:4?

C4G;B:8A E8FiFG4A68 (.ij4L4AGB 8G 4?. 2009), I4?H8-47787

GE4iGF FH6; 4F i@CEBI87 CEBG8iA DH4?iGL (MB?Ii: 8G 4?. 1997)

4A7 HC:E4787 CB7 F8G 4?BA: JiG; :E4iA Li8?7 (AGkiAF 8G 4?.

2011). T;8 54Fi6 CEiA6iC?8 B9 G;iF @8G;B7 iF GB @86;4Ai-

64??L CE8-JBHA7 G;8 F887?iA: F;BBG 4Ci64? @8EiFG8@ (*AM)

GB 8A;4A68 FH5F8DH8AG GE4AF9BE@4GiBA 5L Agrobacterium

tumefaciens. T;8 @8G;B7 B9 Pi:84iE8 8G 4?. (1997) iAIB?I8F

8K6iFiBA B9 :8E@iA4G87 F887?iA: ;LCB6BGL?F 9B??BJ87 5L

stabbing the dome several times with a fine needle, adding 4 7EBC B9 Agrobacterium GH@8946i8AF FGE4iA A:L0 GB G;8

74@4:87 FHE9468, G;8A iA6H54GiBA B9 G;8F8 8KC?4AGF BA 4:4E-

54F87 6H?GHE8 @87i4. TE4AF:8Ai6 F;BBGF E8:8A8E4G8 7iE86G?L

9EB@ GE4AF9BE@87 GBGiCBG8AG 68??F 8KiFGiA: iA G;8 BEi:iA4?

8KC?4AGF 4A7 4E8 CEBC4:4G87 G;EBH:; AH@8EBHF J88kF B9

F8?86GiBA 4A7 GE4AF98E GB BCGi@iF8 G;8 CEBCBEGiBA B9 GE4AF-

:8Ai6 @4G8Ei4?F 5L HF8 B9 G;8 F8?86G45?8 @4Ek8E bar :8A8 G;4G

6BA98EF GB?8E4A68 GB G;8 ;8E5i6i78 C;BFC;iABG;Ei6iA. T;iF

@8G;B7 ;4F 4?FB 588A FH668FF9H??L 4CC?i87 GB L8??BJ ?HCiA

(L. luteus L.; Li 8G 4?. 2000) 4A7 iA BHE ?45BE4GBEL GB BG;8E

pulses such as field pea (Pisum sativum L.), 9454 584A (Vicia

faba L.), 6;i6kC84 (Cicer arietinum L.) 4A7 ?8AGi? (Lens culi-

naris M87ik.) (HACH5?iF;87 E8FH?GF). HBJ8I8E, 4F JiG; BG;8E

@8G;B7B?B:i8F 9BE 7i998E8AG CH?F8F, G;iF NLL GE4AF9BE@4GiBA

methodology is time-consuming and inefficient. Despite the ?8A:G;L @i6EBCEBC4:4GiBA E8:i@8, G;8 78EiI87 F;BBGF 4E8

6;i@8Ei6, FHEIiI4? B9 G;8F8 F;BBGF iA G;8 F8?86GiBA CEB68FF iF

B9 ?BJ 9E8DH8A6L, 4A7 GE4AF:8A8 GE4AF98E GB CEB:8AL iF ?8FF,

E8FH?GiA: iA 4A BI8E4?? GE4AF9BE@4GiBA 9E8DH8A6L B9 ?8FF G;4A

1 3


112

EKC?4AGF J8E8 4?FB @BI87 546k GB C63 9BE 2 J88kF GB :8A-

8E4G8 @BE8 4Ki??4EL F;BBGF. A?? FHEIiIiA: F;BBGF J8E8 G;8A

FH56H?GHE87 BAGB @i6EB-CEBC4:4GiBA @87i4 (1/ M* F4?GF,

3 % (w/v) sucrose, 0.5 g L−1 MES, pH to 5.7, 0.7 % (w/v) P;LGB5?8A7 (C4iFFBA L45BE4GBEi8F A6.), 4HGB6?4I87 G;8A

1/ B5 IiG4@iAF, 0.1 @: L−1 BAP, 0.01 @: L−1 NAA,150

@: L−1 Ti@8AGiAV 47787 BA 6BB?iA:) JiG; 10 @: L−1 ;L:EB-

@L6iA F8?86GiBA (MPH10) 9BE 2 J88kF 9B??BJ87 5L 2 J88kF

BA EBBGiA: @87i4 JiG; 30 @: L−1 ;L:EB@L6iA F8?86GiBA

(RMH30).Rooting medium contains 1X MS salts, 3 % (w/v) FH6EBF8, 0.5 : L−1 MES, pH to 5.7, 0.6 % (w/v) Phytoblend. AHGB6?4I8, 6BB?, G;8A 477 1/ B5 IiG4@iAF, 0.1 @: L−1 BAP,

0.01 @: L−1 NAA, 150 @: L−1 Ti@8AGiAV, 3.0 @: L−1 BA,

0.1 @M 4EB@4Gi6 4@iAB 46i7F (C;8AL?4?4AiA8, GLEBFiA8, 4A7

GELCGBC;4A), 1 @: L−1 4F6BE5i6 46i7.

*8?86GiBA CEiBE GB MPH10 GE84G@8AG, 5L 477iA: 4 7EBC B9

;L:EB@L6iA 1 @: @L−1 GB G;8 4Ci64? 7B@8 B9 GE4AF9BE@87

8KC?4AGF J4F GEi4??87 54F87 BA CE8IiBHF E8FH?GF (N:HL8A 8G

4?. 2016), BA 74LF 4, 10, 13, 16 4A7 18 CBFG-GE4AF9BE@4GiBA.

NH@58EF B9 FHEIiIiA: 8KC?4AGF J8E8 E86BE787 1 J88k 49G8E

7EBC?8G GE84G@8AG.

Plant tissue fixation, sectioning and imaging

T;8 4Ci64? 7B@8 J4F 8K6iF87 9EB@ G;8 6B??86G87

explants,submerged in 30 % sucrose solution and embed-

787 iAGB BCGi@H@ 6HGGiA: G8@C8E4GHE8 (&CT) 6B@CBHA7

(T **,E-TEKV) 4A7 9EBM8A 4G −20 WC iA 4 CM3050 *

CELBFG4G (L8i64) (TiEi6;iA8 8G 4?. 2009). T;8 9EBM8A 5?B6k

JiG; G;8 F4@C?8 J4F GEi@@87, 6EBFF 4A7 ?BA:iGH7iA4? F86-

GiBAF J8E8 G4k8A HAGi? G;8 E8:iBA B9 iAG8E8FG J4F E846;87.

*86GiBAF (20R40 X@) 6BAG4iAiA: G;8 iAG46G C?4AG @4G8Ei4?

J8E8 C?4687 BAGB 47;8FiI8 :?4FF F?i78F (FiF6;8E 8G 4?. 2008).

The sections were stained with 10 % toluidine blue for Olympus BH2 microscopy or 0.1 % Fluorescent Brightener 28 (Calcofluor White) for Nikon A1Si Confocal microscopy IiFH4?iM4GiBA (08HA: 8G 4?. 2015).

GFP imaging and anal4sing

PHG4GiI8 GE4AF9BE@87 F;BBG 8KC?4AGF J8E8 ?BA:iGH7iA4? BE

6EBFF F86GiBA87 GB 4A4?LF8 5L 6BA9B64? @i6EBF6BCL. GFP

8KCE8FFiBA J4F 78G86G87 5L NikBA Ti-E iAI8EG87 @BGBEiF87

@i6EBF6BC8 JiG; NikBA A1*i FC86GE4? 78G86GBE 6BA9B64?

FLFG8@ EHAAiA: N *-C E?8@8AGF FB9GJ4E8 4G G;8 C8AGE8 9BE

Mi6EBF6BCL, C;4E46G8EiF4GiBA & AA4?LFiF (CMCA), T;8

,AiI8EFiGL B9 .8FG8EA AHFGE4?i4. @4:8F J8E8 64CGHE87 5L

6BA9B64? FLFG8@ 4CC?LiA: B5j86GiI8 4K, 10K 4A7 20K JiG;

?4F8E J4I8?8A:G; 488 A@ 4A7 500R550 A@ 9BE GFP 8K6iG4-

GiBA 4A7 8@iFFiBA, E8FC86GiI8?L.

*HEIiIiA: F;BBGF 9EB@ MPH J8E8 i@4:87 GB 78G86G iA

vivo fluorescence using a CRi Maestro 2 in combination JiG; M48FGEB FB9GJ4E8 iA6?H7iA: CP*T (CB@CHG8 PHE8

4:iG4GiBA HAGi? E846;iA: G;8 BCGi@4? 5iB@4FF (BCGi64? 78AFiGL

4G 550 A@ B9 0.4R0.8).

Plant mate.ial

GEBJG; @87i4 J8E8 CE8C4E87 4F 78F6Ei587 5L B4Ek8E 8G 4?.

(2016) 8K68CG 9BE ;L:EB@L6iA FG8CF J;i6; 9B??BJ87 N:HL8A

8G 4?. (2016). M4GHE8 F887F B9 NLL, 6H?GiI4E M4A78?HC, J8E8

FHE9468 FG8Ei?iM87, :8E@iA4G87 iA G;8 74Ek iA 4 :EBJG; EBB@

2R3 74LF 4A7 8K6iF87 GB E8@BI8 G;8 6BGL?87BAF 4A7 LBHA:

?84I8F. FBE 84E?L 78I8?BC@8AG iA ABE@4? F;BBGF 4A4?LFiF, G;8

F887?iA:F J8E8 6H?GiI4G87 iA 6B-6H?GiI4GiBA (C6) @87iH@,

consisting of 1X MS salts, 3 % (w/v) sucrose, pH 5.7, 0.3 % (J/I) P;LG4:8? (*i:@4), 4HGB6?4I87, G;8A 47787 BA 6BB?iA::

1/ B5 IiG4@iAF, 10.0 @: L−1 BAP, 1.0 @: L−1 NAA FBE

GE4AF9BE@4GiBA F;BBG 78I8?BC@8AG4? 4A4?LFiF, 49G8E G;8 F887

6B4G J4F E8@BI87 9EB@ G;8 F;BBG 4KiF, ?849 CEi@B7i4 CE8F-

8AG iA G;8 C?H@H?8 J8E8 E8@BI87 GB E8I84? G;8 4Ci64? 7B@8

HFiA: 4 L8i64 FG8E8B-@i6EBF6BC8. T;8 4Ci64? 7B@8 4E84 J4F

JBHA787 5L G;8 9B??BJiA: @8G;B7F:

*AM JBHA7iA: BA?L: T;8 NLL *AM J4F FG45587

with a fine needle 10–12 times following Pigeaire et al. (1997) 4A7 9HEG;8E B5F8EI4GiBAF B9 .ij4L4AGB (N:HL8A 8G

4?. 2016), G;8A GE4AF98EE87 GB C6 @87iH@ 4A7 GE4AF9BE@87

JiG; A:L0:CH35. EKC?4AGF J8E8 6B??86G87 9EB@ 4 (D4) GB

10 (D10) 74LF 49G8E GE4AF9BE@4GiBA 9BE @i6EBF6BCL 4A4?LFiF.

D88C 4A7 5EB47 FG455iA:: T;8 7B@8 B9 NLL F887?iA:F

J4F FG45587 1R1.5 @@ 78CG; iA 4 Ji78E 4E84 5HG 4?FB FGi??

iA6?H7iA: G;8 *AM. EKC?4AGF G;8A J8AG iAGB 6B-6H?GiI4GiBA

@87iH@ 4A7 J8E8 GE4AF9BE@87 JiG; A:L0:CH35. *4@C?8F

J8E8 6B??86G87 9EB@ D4 GB D10 9BE @i6EBF6BCL 4A4?LFiF.

&G;8E ?8:H@8F J8E8 :8E@iA4G87 4F 78F6Ei587 9BE NLL

4A7 J8E8 HF87 9BE GE4AF9BE@4GiBA J;8A F887 i@5i5iGiBA J4F

4CC4E8AG, 2R3 74LF 49G8E iAiGi4? 8KCBFHE8 GB @BiFGHE8. *C8-

6i8F GE84G87 J8E8 J;iG8 ?HCiA (L. albus L.), C84E? ?HCiA (L.

mutabilis L.), L. pilosus L., field pea and faba bean (large F88787 9BE@).

S1 -c1lt1.e media and selecti,n -.,t,c,l

TE4AF9BE@87 8KC?4AGF J8E8 6H?GHE87 iA C6 @87i4 2 74LF

iA 74Ek 6BA7iGiBAF, G;8A 2 74LF HA78E ABE@4? ?i:;G 6BA7i-

tions (Fluorescent cool white PAR: 100–170 μmol m−2 F−1).

T;8 8KC?4AG J4F J4F;87 iA 100 @: @L−1 Ti@8AGiAV 4A7

GE4AF98EE87 GB A8J C6 @87i4 (C6 2) 477iA: 150 @: L−1

Ti@8AGiAV GB 8?i@iA4G8 9HEG;8E :EBJG; B9 Agrobacterium iA

G;8 F;BBGF. TJB J88kF 49G8E 6B-6H?GiI4GiBA, G;8 GE4AF9BE@87

F887?iA:F J8E8 @BI87 GB E8:8A8E4GiBA @87i4 ():). T;iF

@87iH@ 6BAG4iAF G;8 F4@8 6B@CBA8AGF 4F C62 @87iH@

8K68CG G;8 BAP 4A7 NAA 4E8 E87H687 GB 1.0 @: L−1 BAP,

0.1 @: L−1 NAA. A9G8E 2 J88kF iA ):, 8@8E:87 F;BBGF

J8E8 8K6iF87 iA7iIi7H4??L 9EB@ 846; 8KC?4AG 4A7 GE4AF98EE87

546k GB C6 @87iH@ 6BAG4iAiA: 150 @: L−1Ti@8AGiA (C6 3).

1 3


Appendices

113

BE:4AiM87 GB 9BE@ 4 GLCi64? GHAi64 4A7 6BECHF (Fi:. 1). T;8

GHAi64 iA NLL iF 9HA6GiBA4??L GJB-?4L8E87: CEBGB78E@ BE

CEi@iGiI8 8Ci78E@4? ?4L8E (L1) 4A7 FH58Ci78E@4? ?4L8E (L2).

Fi:HE8 1 4?FB F;BJF 6BA6BE74A68 JiG; G;8 6LGB;iFGB?B:i-

64? MBA8 6BA68CG G;4G G;8 F;BBG 4C8K iF BE:4AiM87 iAGB G;E88

7iFGiA6G MBA8F B9 7i998E8AGi4GiBA 4A7 9HA6GiBA: 68AGE4? MBA8

(C1); C8EiC;8E4? MBA8 (P1); Ei5 MBA8 ()1).

De2el,-ment ,f 3,1nded me.istem sh,,ts

T;8 ;LCBG;8FiF G;4G JBHA787 4Ci64? @8EiFG8@ ;4F 64C45i?-

iGL GB E85Hi?7 iGF8?9 iF G;8 54FiF 9BE G;8 4CCEB46; G4k8A iA

CE8IiBHF FGH7i8F, JiG; G;8 i784 G;4G G;8 iAG8E98E8A68 iA @8Ei-

FG8@ iAG8:EiGL 5L FG455iA: Ji?? 46GiI4G8 A8J :EBHCF B9 FG8@

68??F GB CEB7H68 F;BBGF. T;iF @8G;B7 G;8E89BE8 4i@87 BA?L

to wound the meristem area without significant damage,

*C86GEH@) 4A7 )CAT ()84? CB@CBA8AG AA4?LFiF) FC86GE4?

?i5E4EL :8A8E4GiBA GBB?F. FBE GFP i@4:iA:, G;8 F4@C?8F J8E8

scanned with blue filter, excitation filter 435–480 nm, emis-

FiBA E4A:8 9EB@ 500 GB 550 A@.

Res1lts

NLL sh,,t a-ical me.istem

AA4?LFiF B9 F86GiBAF 9EB@ NLL F;BBGF 2R3 74LF 49G8E :8E-

@iA4GiBA F;BJ87 G;4G G;8 4A4GB@i64? FGEH6GHE8 B9 G;8 F;BBG

4C8K 6B@CEiF8F 20R25 68?? ?4L8EF iA 4 6BA8 F;4C8 (Fi:. 14, 5).

T;iF FGEH6GHE8 iAiGi4??L CEBIi78F CE86HEFBEF 9BE 4 CEi@4EL

F;BBG G;4G ?4G8E 78I8?BCF Fi78 F;BBGF 4A7 G;8 E8CEB7H6-

GiI8 BE:4AF. HiFGB?B:L E8I84?87 G;4G 68??F B9 G;8 NLL J8E8

Fig. 1 *;BBG 4Ci64? @8EiFG8@ (*AM) B9 A4EEBJ ?84987 ?HCiA (NLL).

a LBA:iGH7iA4? F86GiBA B9 NLL *AM FG4iA87 JiG; Calcofluor White,

64CGHE87 5L NikBA A1*i 6BA9B64? @i6EBF6BCL. Bar 100 X@. CZ 68A-

GE4? MBA8, PZ C8EiC;8E4? MBA8, RZ Ei5 MBA8, LP ?849 CEi@BE7i4. Re 4E8

FG4iA87 JiG; Toluidine blue, 64CGHE87 5L &?L@CHF @i6EBF6BCL. LBA-

:iGH7iA4? F86GiBA B9 NLL *AM. Bar 20 X@. L1 ?4L8E BA8, L2 ?4L8E

GJB, white arrows 68??F B9 L1, -ellow arrows 68??F B9 L2, red arrows

7iE86GiBA B9 78I8?BC@8AG B9 @8EiFG8@ 68?? 78EiI4GiI8F. c LBA:iGH7iA4?

F86GiBA B9 NLL *AM. Bar 100 X@. Red circle dashed lines F;BJ G;8

9BE@4GiBA 4A7 8@8E:8A68 B9 4Ki??4EL 5H7 9EB@ P1. dRe AKi??4EL 5H7

9BE@4GiBA 9EB@ I4F6H?4E GiFFH8 iA GE4AFI8EF8 F86GiBA B9 NLL F;BBG (red

circle dashed lines) Bar 200 µm. (Color figure online)

1 3


114

MBE8BI8E, 9B??BJiA: G;8 788C 4A7 5EB47 JBHA7iA: @8G;B7,

I4F6H?4E 68??F J8E8 @BE8 9E8DH8AG?L GE4AF9BE@87 G;4A iA G;8

6BAI8AGiBA4? @8G;B7.

&5F8EI4GiBA B9 G;8 78I8?BC@8AG B9 GFP-8KCE8FFiA:

F;BBGF 9B??BJiA: 5BG; JBHA7iA: @8G;B7F 78G8E@iA87 G;4G

@8EiFG8@ 68??F 4?BA: G;8 74@4:87 4E84F J8E8 7iF45?87 iA

G;8iE @8EiFG8@4Gi6 46GiIiGi8F. T;8E8 J4F AB 8Ii78A68 G;4G

A8J @8EiFG8@ 68??F J8E8 :8A8E4G87 BE 7i998E8AGi4G87 9EB@

JBHA787 F;BBG 4Ci64? @8EiFG8@. AKi??4EL F;BBGF CEB7H687

5L G;8 GE4AF9BE@87 8KC?4AG J8E8 4CC4E8AG?L :8A8E4G87 9EB@

HAJBHA787 4E84 BE 68??F 4G G;8 54F8 BE Fi78 B9 4 788C8E

JBHA7. G 4CC84E87 G;4G G;8 7B@iA4A68 B9 G;8 *AM J4F 7iF-

45?87 5L G;8 JBHA7iA: CEB687HE8, E8?84FiA: 4Ki??4EL @8Ei-

FG8@ 68??F GB 46GiI4G8 F;BBG 78I8?BC@8AG.

Chime.ism in t.ansgenic sh,,ts, selecti,n meth,d,l,g4

and enhanced explant survival

T;8 F86BA7 4i@ B9 G;iF E8F84E6; J4F GB 78G8E@iA8 G;8

:8A8Gi6 FGEH6GHE8 B9 F;BBGF G;4G 78I8?BC87 9B??BJiA: NLL

GE4AF9BE@4GiBA iA BE78E GB 78I8?BC 4A 4CCEB46; GB E87H68

G;8 6;i@8EiF@ G;4G ;4F 588A 4CC4E8AG iA G;8 BHG6B@8F B9

G;8 6HEE8AG @8G;B7. &5F8EI4GiBA B9 ?BA:iGH7iA4? 4A7 6EBFF

F86GiBAF B9 CHG4GiI8 GE4AF9BE@87 4Ki??4EL F;BBGF 49G8E 7EBC?8G

selection, by use of confocal microscopy confirmed that a E4A:8 B9 7i998E8AG 6;i@8Ei6 FGEH6GHE8F J8E8 58iA: :8A8E4G87,

5HG 4?FB F;BJ87 G;4G GE4AF:8Ai6 68??F J8E8 45HA74AG, 58iA:

CE8F8AG iA @4AL C4EGF B9 G;8 FG8@. *B@8 F;BBGF 4CC84E87 GB

;4I8 HAi9BE@ 8KCE8FFiBA B9 GFP (Fi:. 4).

&HE CE8IiBHF FGH7L F;BJ87 G;4G 78?4L87 7EBC?8G F8?86GiBA

post-transformation might enhance the transformation effi-

6i8A6L. DEBC?8G F8?86GiBA 4CCEB46;8F J8E8 GEi4?87 9BE GE4AF-

9BE@4GiBAF 9B??BJiA: 6B-6H?GiI4GiBA B9 G;8 NLL 8KC?4AGF

JiG; Agrobacterium, iA 6B@5iA4GiBA JiG; G;8 GJB FG45-

5iA: @8G;B7F. T;8 FH@@4EL B9 E8FH?GF iF F;BJA iA T45?8 1

4A7 Fi:. 5. A 6B@C4EiFBA B9 G;8 GJB JBHA7iA: @8G;B7F

F;BJ87 G;4G JiG; 78?4L87 7EBC?8G 4CC?i64GiBA, G;8 FHEIiI4?

of explants increased dramatically, from 6.8 % after applica-tion at D4, to 33.6 % after application at D16 for the original wounding method, and up to 75 % when the new wounding @8G;B7 J4F 8@C?BL87 4A7 7EBC?8G 4CC?i64GiBA J4F 78?4L87

GB D18. AA4?LFiF B9 G;8F8 74G4 iA7i64G87 G;4G G;8 GE8A7 9BE

7i998E8A68F iA 8KC?4AG FHEIiI4? 58GJ88A G;8 B?7 4A7 A8J

wounding methods were statistically significant, (Table 1).

-iFH4?iF4GiBA iA IiIB B9 J;B?8 4Ki??4EL F;BBGF G;4G ;47

8@8E:87 9EB@ 7i998E8AG 8KC?4AGF 4A7 ;47 FHEIiI87 9HEG;8E

CEBC4:4GiBA BA MPH FH::8FG87 G;4G G;8F8 J8E8 DHiG8 HAi-

9BE@ iA 8GFP 8KCE8FFiBA JiG;iA BA8 F;BBG, 5HG F;BJ87 FB@8

I4Ei4GiBA 58GJ88A F;BBGF 9EB@ 7i998E8AG 8KC?4AGF (Fi:. 64).

These results were the initial confirmation of the abun-

74A68 5L J;i6; GE4AF:8Ai6 F;BBGF 6BH?7 58 :8A8E4G87 5L G;8

i@CEBI87 JBHA7iA: @8G;B7B?B:L iA 6B@5iA4GiBA JiG; F8?86-

GiBA BA MPH 4A7 FH::8FG87 G;4G 9HEG;8E FH56H?GHEiA: B9 FH6;

iA BE78E GB E8G4iA 4F @H6; @8EiFG8@ FGEH6GHE8 4F CBFFi5?8.

HBJ8I8E BHE CE8?i@iA4EL E8FH?GF FH::8FG87 G;4G E8:8A8E4-

GiBA 6B@C8G8A68 J4F E8FGEi6G87 GB 788C8E GiFFH8F G;4A G;BF8

58iA: 8KCBF87 5L G;8 6HEE8AG @8G;B7. .8 G;8E89BE8 G8FG87 4

788C8E FG455iA: @8G;B7. Fi:HE8 2 i??HFGE4G8F G;8 6HEE8AG 4A7

i@CEBI87 FG455iA: @8G;B7 G4E:8G 4E84 4A7 G;8 8KCE8FFiBA B9

GFP iA G;8 788C8E MBA8. Fi:HE8 3 F;BJF G;8 4A4GB@L B9 GFP

GE4AF9BE@87 NLL 8KC?4AGF 9B??BJiA: G;8 GJB JBHA7iA:

@8G;B7F 9EB@ D4 GB D10 CBFG-GE4AF9BE@4GiBA. &5F8EI4GiBA

B9 GFP 8KCE8FFiBA E8I84?87 G;4G 788C 4A7 5EB47 FG45-

5iA: 8KCBF87 @BE8 @8EiFG8@4Gi6 68??F GB Agrobacterium.

Fig. 2 *;BBG JBHA7iA: @8G;B7. a, c, e &Ei:iA4? (shallow) FG455iA:.

, d, f BEB47 4A7 788C8E JBHA7iA: @8G;B7. a, G8E@iA4G87 F887?iA:

JiG; C?H@H?8 8K6iF87 GB 8KCBF8 G;8 *AM 4G D0. Blac arrows F;BJ G;8

MBA8 G;4G J4F G4E:8G87 iA G;8 BEi:iA4? @8G;B7. Blac 4A7 white arrows F;BJ G;8 MBA8 GB G4E:8G. c, d TE4AF:8Ai6 8KC?4AG 49G8E 7 74LF (D7)

F;BJiA: J;8E8 FG455iA: ;4F B66HEE87 iA G;8 GJB @8G;B7F. Arrows 4F

9BE a 4A7 . e, f LBA:iGH7iA4? F86GiBA B9 NLL :8E@iA4G87 F887?iA: JiG;

C?H@H?8 8K6iF87 4G D0, 49G8E JBHA7iA: ;4F B66HEE87; e ;4F HA78E:BA8

G;8 BEi:iA4? FG455iA: 4A7 ;4F FB@8 F;4??BJ 74@4:8 GB G;8 *AM; f ;4F

HA78E:BA8 G;8 5EB47 4A7 788C JBHA7iA: @8G;B7. Scale bar 500 X@

1 3


Appendices

115

5L G;iF @8G;B7, G;4G 64?6H?4GiBA iF 54F87 BA G;8 4FFH@CGiBA

B9 4 FiA:?8 :8A8Gi6 GE4AF9BE@4GiBA 8I8AG ;4IiA: 588A 64C-

GHE87 JiG;iA 846; 8KC?4AG. T;8 I4Ei4GiBA iA 8GFP 8KCE8FFiBA

B5F8EI87 JiG;iA F;BBG 6?H@CF (Fi:. 66, 7) iF iA7i64GiI8 B9

@H?GiC?8 8I8AGF. HBJ8I8E G;iF iAG8ECE8G4GiBA Ji?? E8DHiE8 DNA

analysis of T1 generation materials to be confirmed.

P.elimina.4 , se.2ati,ns 3ith ,the. -1lse leg1mes

The final aim of this research was to investigate the transfer-45i?iGL B9 G;8 A8J NLL GE4AF9BE@4GiBA @8G;B7B?B:L GB BG;8E

CH?F8 ?8:H@8F. Fi:HE8 7 78@BAFGE4G8F G;4G G;8 GE4AF9BE@4-

GiBA CBG8AGi4? B9 JBHA787 FHE9468 68??F B9 BG;8E ?HCiA FC8-

cies, field pea and faba bean is identical to the observations JiG; NLL. FHEG;8E@BE8, 78I8?BC@8AG B9 GFP-8KCE8FFiA:

4Ki??4EL 5H7 J4F B5F8EI87 iA J;iG8 ?HCiA, L. pilosus, 4A7

field pea. The results shown for faba bean and field pea are 9EB@ 4 FiA:?8 8KC8Ei@8AG C8E9BE@87 5L 4 F86BA7 BC8E4-

GBE J;B ;47 ABG CE8IiBHF?L C8E9BE@87 G;8 788C 4A7 5EB47

JBHA7iA: @8G;B7; 9HEG;8E@BE8 4?? E8FH?GF iA Fi:. 7 4E8 G;8

BHG6B@8 B9 GE84G@8AG B9 98J8E G;4A G8A :8E@iA4G87 F887?iA:

explants for each species. This result confirmed that the data B5G4iA87 JiG; NLL J8E8 E8CEB7H6i5?8 4A7 CEBIi787 4 EB5HFG

@4G8Ei4?F GB :8A8E4G8 477iGiBA4? 4Ki??4EL 5H7F 9EB@ 846; BEi:i-

A4? F;BBG @i:;G CEBI8 4 J4L GB :8A8E4G8 @BE8 HAi9BE@?L GE4AF-

:8Ai6 @4G8Ei4?F. C?H@CF B9 4Ki??4EL F;BBGF G;4G J8E8 B5G4iA87

9EB@ BA8 EBHA7 B9 FH5F8DH8AG FH56H?GHEiA: BA C6 @87i4 4E8

F;BJA iA Fi:. 65. -iFH4?iF4GiBA B9 8GFP 8KCE8FFiBA iA FH5-

6H?GHE87 6?H@CF F;BJ87 I4Ei4GiBA B9 8KCE8FFiBA (Fi:. 66). A??

F;BBG 6?H@CF BA G;8 C?4G8 BEi:iA4G87 9EB@ 4 FiA:?8 BEi:iA4?

F;BBG 4A7 F8:E8:4GiBA B9 GFP 8KCE8FFiBA ?8I8?F J4F 6?84E?L

IiFi5?8. Fi:HE8 67 iF 4 6EBFF F86GiBA G;EBH:; G;8 54F8 B9 4 Ci868

9EB@ 4 FH56H?GHE87 F;BBG 6?H@C JiG; 8GFP 8KCE8FFiBA IiFH-

4?iF87 5L 6BA9B64? @i6EBF6BCL. &A?L FB@8 I4F6H?4E GiFFH8 iA

G;8 CEi@4EL (68AGE4?) 4Ki??4EL F;BBG F;BJ87 8GFP 8KCE8FFiBA,

5HG 5BG; F86BA74EL 4Ki??4EL F;BBGF F;BJ87 45HA74AG GFP iA

I4F6H?4E GiFFH8. TB:8G;8E G;8F8 E8FH?GF FHCCBEG G;8 ;LCBG;8FiF

G;4G JiG; 4CCEBCEi4G8 FH56H?GHEiA: FG8CF :8A8Gi64??L HAi9BE@

GE4AF:8Ai6 F;BBGF 64A 58 :8A8E4G87. AF F88A iA Fi:. 65, F;BBG

6?H@CF 4E8 ABG ;84?G;L iA 4CC84E4A68 4?G;BH:; G;8F8 ;4I8

ABG L8G 588A 8KCBF87 GB F8?86GiBA 58LBA7 G;8 7EBC?8G F8?86-

GiBA FG8C. A77iGiBA4? i@CEBI8@8AG GB G;8 @8G;B7B?B:L iF 4?FB

G;8E89BE8 ?ik8?L GB 58 46;i8I87 5L E87H6iA: G;8 8KCBFHE8 GB

:EBJG; E8:H?4GBEF 7HEiA: FH56H?GHEiA:. T;8F8 E8FH?GF 4?FB

F;BJ G;4G, 4?G;BH:; G;8 64?6H?4G87 9E8DH8A6L B9 GE4AF9BE@4-

tion at T0 is improved about threefold to approximately 10 %

Fig. 3 D8I8?BC@8AG B9 8KC?4AG *AM 49G8E BEi:iA4? (aRc) 4A7 A8J (dR

f) JBHA7iA: @8G;B7F. @4:8F 4E8 6ELBFG4G F86GiBAF 4G G;8 78Fi:A4G87

74LF 49G8E GE84G@8AG JiG; A. tumefaciens A:L0:CH35. GFP J4F i@4:87

5L 6BA9B64? @i6EBF6BCL. *64?8 54EF 4E8 4?? 500 X@. a, d D4 F4@C?8F. ,

e D7 F4@C?8F. c, f D10 F4@C?8F

1 3


116

which axillary buds develop, we significantly improved the 9E8DH8A6L B9 :8A8E4GiBA B9 GE4AF:8Ai6 NLL F;BBG @4G8Ei4?F

(T45?8 1; Fi:F. 1, 2, 3, 5). *86BA7, 5L FH5F8DH8AG CEBC4:4-

GiBA iA F8?86GiBA G;8 6;i@8Ei6 FGEH6GHE8 B9 GE4AF:8Ai6 NLL

F;BBGF J4F E87H687, JiG; ?4E:8E CEBCBEGiBA B9 GE4AF:8Ai6 GiF-

FH8F 6B@C4E87 GB ABA GE4AF:8Ai6 GiFFH8F 4A7 CBG8AGi4? E87H6-

GiBA B9 @H?GiC?8 6;i@8Ei6 8I8AGF (T45?8 1; Fi:F. 4, 6). T;iE7,

G;8 8A;4A687 9E8DH8A6L B9 :8A8E4GiA: GE4AF:8Ai6 F;BBGF

J4F 78@BAFGE45?L GE4AF98E45?8 GB BG;8E CH?F8 ?8:H@8 6EBCF

(Fi:. 7). E99BEGF GB i@CEBI8 GE4AF9BE@4GiBA 9E8DH8A6L 4A7

E8:8A8E4GiBA @8G;B7B?B:L 9BE 9HGHE8 :8A8Gi6 GE4AF9BE@4GiBA

B9 4 E4A:8 B9 CH?F8 ?8:H@8 FC86i8F.

Disc1ssi,n

T;8 G;E88 4i@F B9 G;iF E8F84E6; J8E8 46;i8I87. BL B5F8EI4-

GiBA B9 @8EiFG8@ GiFFH8F 9B??BJiA: JBHA7iA:, 4 6;4A:8 GB

JBHA7iA: G86;AiDH8 4A7 78?4L87 7EBC?8G F8?86GiBA 8A45?iA:

:8A8Gi6 GE4AF9BE@4GiBA B9 G;8 788C8E @8EiFG8@ 68??F 9EB@

Fig. 4 C;i@8Ei6 FGEH6GHE8 B9 BEi:iA4? 4Ki??4EL 5H7F 9B??BJiA: G;8 788C

4A7 5EB47 JBHA7iA: @8G;B7. *64?8 54EF 4E8 4?? 500 X@. aRc CELB-

FG4G F86GiBAF. dRi Hand sections of living tissue. GFP fluorescence in G;8F8 F86GiBAF iF green 4A7 red fluorescence is chlorophyll. a 8GFP

8KCE8FF87 iA ?849 4Ki? 5HG ABG iA 4Ki??4EL F;BBGF. TE4AF9BE@87 68??F

?B64G87 iA I4F6H?4E GiFFH8 B9 G;8 8KC?4AGF @8EiFG8@, 4A7 4 ?4G8E4? 4HKi?-

?4EL F;BBG. T;8 *AM B9 4Ki??4EL 5H7 J4F 4 @8Ei6?iAi64? 6;i@8E4. c GFP

iA 4Ki??4EL F;BBG F;BJ87 G;4G G;8 BHG8E ?4L8E (L1) B9 G;8 F;BBG E868iI87

G;8 :8A8. dArrows iA7i64G8 GFP 8KCE8FFiBA iA L1 (8Ci78E@4? 68??F) 4A7

iA I4F6H?4E GiFFH8 (L3). e AiGi4? 9BE@4GiBA B9 4Ki??4EL F;BBG JiG; GFP

iA L2 (arrow) 4A7 F64GG8E87 iA I4F6H?4E GiFFH8. f GFP iA L2 (:EBHC B9

C4E8A6;L@4 68??F iF green) 4A7 L3 (KL?8@ iF green) 4F iA7i64G87 JiG;

arrows. g A I4F6H?4E 5HA7?8 JiG; GFP 8KCE8FFiBA (arrow) 4A7 C4E8A-

6;L@4 68??F (L2) (arrow). h GFP 8KCE8FFiBA iA L3 CiG; 68??F (arrow),

i GFP 8KCE8FF87 iA G;8 J;B?8 6EBFF F86GiBA B9 G;8 F;BBG (G;iF F;BBG

apparently only contains transgenic tissues). (Color figure online)

1 3


Appendices

117

Ta le 1

Tra

nsfo

rmat

ion

effic

ienc

y at

T0

in m

edia

sele

ctio

n fo

llow

ing

dela

yed

drop

let s

elec

tion

EKC8E

i@8A

G4C

65C

6 2

5)

:6

C6

37

MPH

10

8)

MH

30

9

EKC?4

AGF

EKC?4

AGF

EKC?4

AGF

EKC?4

AGF

*;BBGF

EKC?4

AGF

*;BBGF

EKC?4

AGF

*;BBGF

&-D

4895

895

77 (8.6

)

&-D

16

125

125

42 (33.6

)34 (27.2

)79

34

85

4 (3.2

)4

& GBG4

?1020

1020

119*

4/1

25***

N-D

425

25

1 (4.0

)

N-D

13

96

96

46 (47.9

)28 (29.2

)61

28

65

10 (10.4

)K12

N-D

16

144

144

100 (69.4

)82 (56.9

)99

82

136

17 (11.8

)K31

N-D

18

48

48

36 (75)

35 (72.9

)69

35

79

5 (10.4

)K12

N GBG4

?313

313

183**

32/2

88****

A 6

B?H

@AF )

:, C

63 4

A7 )

MH

30, I4?

H8

iA C

4E8

AG;

8F8

F iF

G;8

C8E6

8AG B9 8K

C?4

AGF

G;4G

CEB

7H68

7 GE4

AF:

8Ai6

F;BBGF

, 4?

FB 7

8F6

Ei587 4

F 9E

8DH8A6L

B9 GE

4AF9

BE@

4GiB

A 8

I8AGF

4F iG iF 4FF

H@

87 9BE G;

4G

64?6

H?4

GiBA G;4G

BA?L

BA8

:8A8G

i6 GE4

AF9

BE@

4GiB

A B

66H

EF C

8E 8K

C?4

AGF

Cc

6B6H

?GiI

4GiB

A @

87i4

, R

g E8:

8A8E4

GiBA @

87i4

, M

PH

10 @

i6EB

CEB

C4:

4GiB

A @

87i4

JiG; 1

0 @

: L

−1 ;

L:EB

@L6i

A, R

MH

30 EBBGiA: @

87i4

JiG; 3

0 @

: L

−1 ;

L:EB

@L6i

A4&

SBEi:iA

4? J

BHA7iA

: @

8G;B7, N

S5EB

47 4

A7 7

88C J

BHA7iA

: @

8G;B7. D

4, D

13, D

16 4

A7 D

18 4

E8 7

4LF

49G8

E GE

4AF9

BE@

4GiB

A 4

G J

;i6

; G;8

7EB

C?8

G F8

?86G

iBA J

4F

i@C?8

@8AG8

7 D

4 7

4G4

4E8

8KGE

46G

87 9EB

@ N

:HL8A 8

G 4?

. (2

016)

5Ex

plan

ts a

t the

star

t of t

reat

men

t fol

low

ing

appl

icat

ion

of A

gL0:

pH 3

5 (C

c) a

nd tr

ansf

er to

Cc2

4 d

ays a

fter

app

licat

ion

(100

% su

rviv

al)

6 A?? 8

KC?4

AGF

J8E8

@BI87 GB )

: 4

G D

18. N

H@

58E B9 8K

C?4

AGF

iF G;

BF8

FHEI

iIiA

: 7

74L

F 49

G8E 7EB

C?8

G GE84G

@8AG, J

;i6

; J

4F 4C

C?i87 9EB

@ D

13 GB D

18 4

F iA

7i6

4G87. T;8F8

74G

4 4E8

4 FH5F8

G B9 G;

BF8

F;BJ

A iA F

i:. 5. *

, **S

igni

fican

t diff

eren

ce b

etw

een

the

com

bine

d da

ta fo

r old

ver

sus n

ew w

ound

ing

met

hod

follo

win

g dr

ople

t sel

ectio

n (χ

2 =

299.

37;

C <

0.0

01). T

;8

&-D

16 7

4G4

4E8

4?F

B Fi:

-

nific

antly

diff

eren

t fro

m th

e N

-D13

to N

-D18

dat

a co

mbi

ned

(χ2 =

6.8

6; C <

0.0

1)7A

9G8E 2 J

88k

F BA )

:, 8K

C?4

AGF

4A7 8K6i

F87 F;BBGF

J8E8

@BI87 5

46k

GB C

6 (C

63). N

H@

58E B9 8K

C?4

AGF

iF G;

8 AH@

58E G;

4G J

8E8

CEB

7H6i

A: F;BBGF

. N

H@

58E B9 F;

BBGF

iF G;

8 GB

G4? AH@

58E B9 F8

C4E4

G8

F;BBGF

8K6i

F87 9EB

@ 8

KC?4

AGF

4G Gi@

8 B9 GE

4AF9

8E GB

C63

. T;8F8

F;BBGF

J8E8

4?F

B C

EBC4:

4G87 B

A C

63 9BE 4

9HEG

;8E 2 J

88k

F8 N

H@

58E B9 F;

BBGF

iF

G;8

GBG4

? AH@

58E B9 iA

7iI

i7H4? BE 6?

H@

C87 F

;BBGF

CEB

7H68

7 4

9G8E iA

6H54G

iBA B

9 8K

C?4

AGF

4A7 B

Ei:iA

4? 8K

6iF8

7 F

;BBGF

BA C

63 9BE GJ

B @

BE8

J88k

F. N

H@

58E B9 8K

C?4

AGF

E8@

4iA

87 G;8

F4@

8 4F G;

8 CE8

IiB

HF FG

8C

9 *;BBGF

/F;BBG 6?

H@

CF

(4F

F;BJ

A iA F

i:. 65)

J8E8

@BI87 GB )

MH

30 4

9G8E 2 J

88k

F BA M

PH

10. *;BBG G4

??L iF

G;8

GBG4

? FG

i?? FH

EIiI

iA: 2

J88k

F 49

G8E GE

4AF9

8E. T

4??L B

9 8K

C?4

AGF

iF

G;8

AH@

58E B9

expl

ants

fro

m w

hich

the

surv

ivin

g sh

oots

orig

inat

ed. *

**, *

***O

-D16

exp

lant

sur

viva

l dat

a ar

e st

atis

tical

ly s

igni

fican

tly d

iffer

ent f

rom

the

com

bine

d N

-[D

13–D

18]

(χ2 =

47.

49; C <

0.0

01).

KN

-D13

, N-D

16 a

nd N

-D18

dat

a ar

e no

t sig

nific

antly

diff

eren

t fro

m e

ach

othe

r (χ2

= 0.14; C >

0.0

5)

1 3


118

F887?iA: 4A7 FG8@ 68?? CBCH?4GiBAF 9BE G;8 :8A8E4GiBA B9 4??

CBFG-8@5ELBAi6 GiFFH8F. AG G;8 8@5ELB FG4:8, 68?? CEB?i98E4-

GiBA B66HEF G;EBH:;BHG G;8 5B7L, J;i?8 iA G;8 ?4GG8E C;4F8

@4AL E8:iBAF 7iF6BAGiAH8 68?? 7iIiFiBA 4A7 586B@8 @BE8

FC86i4?iM87. D8F6Ei587 4F G;8 68AGE8 B9 CBFG-8@5ELBAi6

BE:4A 9BE@4GiBA iA G;8 F;BBG, G;8 F;BBG 4Ci64? @8EiFG8@

(SAM) first produces the plumule, which develops into the I8:8G4GiI8 4A7 E8CEB7H6GiI8 6B@CBA8AGF B9 G;8 C?4AG 5B7L

(C;i8A 8G 4?. 2011). T;8 ?iG8E4GHE8 BA C?4AG 4A4GB@L ;4F

?4E:8?L 9B6HF87 BA GB5466B 4A7 GB@4GB FC86i8F, 4A7 FB@8

9EHiG GE88F 4A7 BEA4@8AG4? ;BEGi6H?GHE8 FC86i8F. )8F84E6;8EF

;4I8 G4k8A 47I4AG4:8 B9 G;8 84F8 JiG; J;i6; G;8 9BE@8E FC8-

6i8F HA78E:B :EBJG; iA GiFFH8 6H?GHE8 4A7 G;8 8KiFG8A68 B9

:8A8Gi6 @HG4GiBAF 46EBFF G;iF E4A:8 B9 C?4AGF G;4G 4??BJ G;8

?4L8EF B9 G;8 *AM GB 58 7iFGiA:HiF;87. (*G88I8F 4A7 *HF-

F8K 1989; Ti?A8L-B4FF8GG 1986; *ML@kBJi4k 4A7 *HFF8K

1996). NB Fi@i?4E iA9BE@4GiBA 45BHG CH?F8 ?8:H@8F 6BH?7 58

9BHA7. HBJ8I8E G;8 Fi@i?4EiGL B9 G;8 *AM B9 NLL (Fi:. 1)

GB E8CBEGF 9EB@ FC86i8F iA BG;8E 7i6BG C?4AG 6?478F, 4A7

G;8 FH5F8DH8AG B5F8EI4GiBAF 45BHG GFP-8KCE8FFiA: BE:4A

78I8?BC@8AG iA7i64G8 G;4G iAG8ECE8G4GiBA B9 BHE E8FH?GF J4F

6BAFiFG8AG JiG; G;8 CH5?iF;87 FGH7i8F.

&HE B5F8EI4GiBA B9 NLL *AM FGEH6GHE8 4E8 6BAFiFG8AG

JiG; G;8 CH5?iF;87 *AM FGEH6GHE8 B9 8H7i6BG C?4AGF G;4G

follows the tunica-corpus configuration as the characteris-Gi6 B9 4A:iBFC8E@ F;BBG 4Ci68F (*4GiA4 8G 4?. 1940; *G88I8F

4A7 *HFF8K 1989; B4EGBA 4A7 PB8G;i: 1993; BBJ@4A 4A7

EF;87 2000; L8A;4E7 8G 4?. 2002; EI8EG 2006; MHEE4L 8G 4?.

2012). T;8 GHAi64 6BAFiFGF B9 F@4?? CBCH?4GiBAF B9 C?HEiCB-

G8AG HA7i998E8AGi4G87 @8EiFG8@4Gi6 68??F. AAGi6?iA4? 7iIiFiBA

4A7 7i998E8AGi4GiBA B9 GHAi64 68??F :iI8 EiF8 GB ?4G8E4? BE:4AF

4A7 CEBIi78 7iFG4? @8EiFG8@4Gi6 :EBJG;, J;8E84F 6BECHF 68??

7iIiFiBA iF E8FCBAFi5?8 9BE 9BE@4GiBA B9 G;8 FG8@. T;8 BHG8E

GHAi64 ?4L8E (L1) CEB7H68F F;BBG 8Ci78E@4? 68??F, J;8E84F

G;8 iAA8E ?4L8E (L2) 9BE@F G;8 BG;8E GiFFH8F, iA6?H7iA: 6BE-

G8K 4A7 HA7i998E8AGi4G87 :8E@?iA8 68??F. T;8 I4F6H?4E GiFFH8F

4A7 CiG; 6B@CEiF8 L3 B9 G;8 78I8?BC87 FG8@; G;8F8 GiFFH8F

form subsequent to initiation of floral bud development in GB5466B 8KC?4AGF (.i?@F 4A7 *4FF8A 1987). T;8 @4jBEiGL B9

68??F E8@4iA 4FFB6i4G87 JiG; G;8iE BEi:iA4GiA: ?4L8E, ;BJ8I8E

FB@8 @iKiA: 64A B66HE FB G;4G B664FiBA4??L G;8E8 64A 58

6BAGEi5HGiBA B9 G;8 L1 GB G;8 :8E@ 68??F. P8Ei6?iA4? 7iIiFiBA

B9 G;8 6BECHF BE ?4L8E G;E88 (L3) E8FH?GF iA @iKiA: JiG; L2,

6E84GiA: FGEH6GHE4? iAG8:EiGL 4@BA: ?4G8E4? 4CC8A74:8F 4A7

G;8 FG8@ (*4GiA4 8G 4?. 1940; Ti?A8L-B4FF8GG 1986).

T;8 NLL F;BBG 4C8K 4?FB F;BJF 6BA6BE74A68 JiG; G;8

6LGB;iFGB?B:i64? MBA8 6BA68CG G;4G G;8 F;BBG 4C8K iF BE:4-

AiM87 iAGB G;E88 7iFGiA6G MBA8F B9 7i998E8AGi4GiBA 4A7 9HA6-

GiBA. C1 68??F 7iIi78 4AGi6?iA4??L, CEB7H6iA: G;8 iAiGi4? 68??F

9BE G;8 P1 4A7 )1, J;i?FG 68??F iA G;8 P1 4A7 )1 6B@5iA8

C8Ei6?iA4?, 4AGi6?iA4? 4A7 B5?iDH8 7iIiFiBAF (Fi:. 16). P1 4A7

)1 7iIiFiBAF ;8?C GB 9BE@ G;8 @4iA FG8@. CBEG8K 4A7 CEB-

64@5iH@ BEi:iA4G8 9EB@ G;8 P1, J;i?8 )1 :iI8F EiF8 GB CiG;

E87H68 6;i@8EiF@ B9 NLL 4A7 BG;8E ?8:H@8F J8E8 iAiGi4G87

9B??BJiA: B5F8EI4GiBAF 5L .ij4L4AGB (2007) G;4G B664FiBA-

4??L, 9B??BJiA: 84E?L ABA-GE4AF:8Ai6 F;BBG :EBJG;, 4A 4CC4E-

8AG?L ABA-6;i@8Ei6 4Ki??4EL 5H7 6BH?7 58 46;i8I87 9EB@ G;8

6HEE8AG @8G;B7B?B:L. AiGi4??L 4GG8AGiBA J4F 9B6HF87 BA G;8

JBHA7iA: @8G;B7. T;8 B5F8EI4GiBA G;4G 8K68FFiI8 74@4:8

78FGEBL87 G;8 *AM ?87 HF GB E87H68 G;8 8KG8AG 4A7 78CG;

B9 *AM FG455iA:. HBJ8I8E G;iF iAiGi4GiI8 7i7 ABG i@CEBI8

GE4AF9BE@4GiBA 9E8DH8A6L 8iG;8E JiG; G;8 BEi:iA4? bar :8A8

F8?86GiBA (HACH5?iF;87 E8FH?GF) BE JiG; :?LC;BF4G8 4F 4 ABI8?

F8?86GiBA @8G;B7B?B:L (B4Ek8E 8G 4?. 2016). AI8FGi:4GiBA B9

BG;8E 946GBEF 49986GiA: GE4AF9BE@4GiBA HFiA: ;L:EB@L6iA 4F

4 F8?86G45?8 @4Ek8E 4A7 8GFP 4F 4 ;i:;?L F8AFiGiI8 E8CBEG8E

:8A8 J8E8 6B@CBA8AGF B9 4A ;LCBG;8FiF-7EiI8A 4CCEB46; GB

G46k?8 E8:8A8E4GiBA E864?6iGE4A68 B9 NLL. DHEiA: G;4G FGH7L

iG J4F 9BHA7 G;4G F;BBGF J8E8 78I8?BCiA: 9EB@ 788C8E GiF-

FH8F G;4A CE8IiBHF?L HA78EFGBB7 (N:HL8A 8G 4?. 2016) J;i6;

?87 GB G;8 CE8F8AG 466B@C4ALiA: FGH7L.

NLL sh,,t a-ical me.istem st.1ct1.e

TE4AF9BE@4GiBA E864?6iGE4A68 J4F iAI8FGi:4G87 iAiGi4??L 5L

78G8E@iA4GiBA B9 G;8 FGEH6GHE8 B9 G;8 NLL *AM (Fi:. 1) GB

7iF6BI8E 9EB@ J;i6; MBA8 A8J F;BBG 78I8?BC@8AG B66HEE87

9B??BJiA: JBHA7iA:. T;8 78I8?BC@8AG B9 C?4AGF iF @4iA?L

7iIi787 iAGB GJB FG4:8F: 8@5ELBAi6 4A7 CBFG-8@5ELBAi6.

E@5ELB:8A8FiF iA C?4AGF CEBIi78F 4 54Fi6 5B7L C?4A 9BE G;8

6.8%

18.0%

33.6%

47.9%

69.4%

75.0%

0.0%

10.0%

20.0%

30.0%

40.0%

50.0%

60.0%

70.0%

80.0%

D4 D10 D13 D16 D18

Fig. 5 EKC?4AG FHEIiI4? 1 J88k 49G8E ;L:EB@L6iA 7EBC?8G F8?86GiBA

JiG; G;8 GJB JBHA7iA: @8G;B7F. Dar bars 4E8 74G4 9BE G;8 BEi:iA4?

(*AM BA?L) JBHA7iA: @8G;B7. Light bars 4E8 74G4 9BE G;8 A8J (5EB47

4A7 788C) JBHA7iA: @8G;B7

1 3


Appendices

119

iA NLL @8EiFG8@ GiFFH8 :8A8E4G87 4AL A8J F;BBGF. AFG847,

G;8F8 E8FH?GF J8E8 6BAFiFG8AG JiG; G;8 E84FF8FF@8AG B9 C?4AG

E8:8A8E4GiBA CEBCBF87 5L *H:i@BGB 8G 4?. (2011), G;8 BEi:i-

A4? B5F8EI4GiBAF B9 Pi:84iE8 8G 4?. (1997) G;4G GE4AF9BE@4AGF

J8E8 :8A8E4G87 9EB@ 4Ki??4EL 5H7F, G;8 E8CBEG 5L B454B:?H

8G 4?. (2000) G;4G :8A8Gi6 @4AiCH?4GiBA JiG;BHG 4Ci64? ?4L-

8EF B9 L. mutabilis J4F @BE8 ?ik8?L GB :8A8E4G8 GE4AF:8Ai6

F;BBGF 4A7 G;8 FGH7L B9 *8A4 8G 4?. (2009) F;BJiA: G;4G

E8:8A8E4GiBA B9 A8J BE:4AF 7B8F ABG E8DHiE8 4 9HA6GiBA4?

4Ci64? @8EiFG8@. A?? G;8 B5F8EI4GiBAF 45BHG 4Ki??4EL F;BBG

78I8?BC@8AG 9B??BJiA: *AM JBHA7iA: 4E8 6BAFiFG8AG JiG;

G;8 6BA68CG G;4G 74@4:8 GB G;8 4Ci64? @8EiFG8@ 64HF8F ?BFF

B9 4Ci64? 7B@iA4A68. T;8 A8J 788C 4A7 5EB47 JBHA7iA:

@8G;B7 iA 477iGiBA GB G;4G BHG6B@8 6E84G8F G;8 BCCBEGHAiGL

9BE 68??F 4EBHA7 G;8 I4F6H?4E GiFFH8 GB 58 GE4AF9BE@87, J;i6;

4F FH@@4EiF87 5L *H:i@BGB 8G 4?. (2011) iF G;8 BEi:iA B9

68??F G;4G 4E8 6B@C8G8AG GB E8:8A8E4G8.

Also of significance to the aims of this research is the contribution of the distinct layers identified from research

@8EiFG8@. AAGi6?iA4? 7iIiFiBA 8?BA:4G8F G;8 5H7, J;i?8 C8Ei-

6?iA4? 7iIiFiBA 8KC4A7F G;8 7i4@8G8E B9 G;8 F;BBG. L84I8F 4A7

4Ki??4EL 5H7F 4EiF8 9EB@ G;8 P1 4?G;BH:; ?4G8E4? 5H7F HFH4??L

BEi:iA4G8 9EB@ 788C8E ?4L8EF 4A7 G;HF F?i:;G?L 788C8E iAiGi4?F

iA G;8 6BECHF, G;4A G;8 ?84I8F (Ti?A8L-B4FF8GG 1986; *G88I8F

4A7 *HFF8K 1989; BBJ@4A 4A7 EF;87 2000; EI8EG 2006).

B.,ad and dee-e. 3,1nding and chime.ism

in transgenic shoots expressing eGFP

The use of eGFP as a marker gene proved a significant source B9 E8?8I4AG iA9BE@4GiBA GB 4FFiFG G8FGiA: B9 G;8 8KC8Ei@8A-

G4? ;LCBG;8F8F, 4F JBH?7 58 8KC86G87 9EB@ G;8 Ji78 E4A:8

B9 FH668FF9H? 4CC?i64GiBAF G;4G ;4I8 588A E8CBEG87 (-BFF 8G

4?. 2013). TE4AF9BE@4GiBA JiG; Agrobacterium J4F 6?84E?L

B5F8EI87 8FF8AGi4??L 9BE 4?? 8KCBF87 68??F iA 8I8EL FC86i8F

G;4G J8 8K4@iA87 (Fi:F. 3, 7), confirming and extend-

iA: G;8 HA8KC86G87 B5F8EI4GiBAF B9 N:HL8A 8G 4?. (2016).

HBJ8I8E, G;8E8 J4F AB 8Ii78A68 G;4G G;8 6B@C8G8AG 68??F

Fig. 6 *H56H?GHE8 CEBC4:4GiBA GB E87H68 6;i@8EiF@ B9 F;BBGF. aRc

P?4G8 6H?GHE8F. a In vivo imaging of GFP fluorescence in transgenic F;BBGF IiFH4?iM87 HFiA: M48FGEB. *;BBGF J8E8 78EiI87 9EB@ F8I8E4?

8KC?4AGF 9B??BJiA: BA8 EBHA7 B9 @87i4 F8?86GiBA. TLCi64? F;BBG

6?H@CF G;4G 78I8?BC 9B??BJiA: 2 J88kF B9 FH56H?GHE8 BA C63, c C?4G8

B9 7iFGiA6G F;BBGF F8C4E4G87 49G8E @i6EBCEBC4:4GiBA B9 4 FiA:?8 BEi:iA4?

4Ki??4EL F;BBG FH6; 4F G;BF8 F;BJA iA a, JiG; 7i998E8AG 8GFP 45HA74A68

4CC4E8AG iA 7i998E8AG FH56H?GHE87 F;BBGF 4A7 iA F86GBEF B9 F;BBG 6?H@CF.

d TE4AFI8EF8 6ELBFG4G F86GiBA B9 G;8 54F8 B9 4 FH56H?GHE87 F;BBG, JiG;

8GFP 8KCE8FFiBA 78G86G87 5L 6BA9B64? @i6EBF6BCL. Scale bar 500 X@

1 3


120

4Ki??4EL F;BBGF E8:8A8E4GiA: 9EB@ 58?BJ G;8 74@4:87 F86-

GiBA B9 G;8 *AM, JiG; GE4AF:8Ai6 68??F 58iA: E86EHiG87 7HE-

iA: 84E?L F;BBG 78I8?BC@8AG iA G;8 8KC?4AGF, E8FH?GiA: iA

G;8 B5F8EI87 C4GG8EA B9 GE4AF:8Ai6 68??F iA CE87B@iA4AG?L

ABA-GE4AF:8Ai6 F;BBG GiFFH8F. A 6BAGE4FG, G;8 5EB47 4A7 788C

JBHA7iA: @8G;B7 E8FH?GF iA GE4AF9BE@4GiBA B9 68??F G;4G 4E8

6B@C8G8AG GB 78I8?BC iAGB F;BBGF FH6; G;4G G;8 @4jBEiGL B9

shoots that are generated contain significant proportions of GE4AF:8Ai6 GiFFH8 (Fi:F. 4, 6, 7).

BA 6;i@8Ei6 C?4AGF GB G;8 78I8?BC@8AG B9 4Ki??4EL 5H7F 4A7,

FH5F8DH8AG?L GB G;8 :4@8G8F (Ti?A8L-B4FF8GG 1986). *H6-

68FF9H? F8?86GiBA B9 T0 GE4AF:8Ai6 F;BBGF E8DHiE8F 4 6B@-

5iA4GiBA B9 E8FiFG4A68 46EBFF ?4L8EF. *;BBGF G;4G 78I8?BC87

9EB@ G;8 BEi:iA4? JBHA7iA: @8G;B7 4A7 84E?L F8?86GiBA,

J8E8 6B@@BA?L B5F8EI87 GB ;4I8 @H?GiC?8 F@4?? F86GBEF

B9 GE4AF:8Ai6 68??F 4A7 4 I8EL ?BJ FHEIiI4? E4G8 (.ij4L4AGB

2007; N:HL8A 8G 4?. 2016; N:HL8A HACH5?iF;87 E8FH?GF). .8

CEBCBF8 G;4G FH6; F;BBGF BEi:iA4G87 9EB@ ABA-GE4AF:8Ai6

Fig. 7 GFP 8KCE8FFiBA i@4:87 5L 6BA9B64? @i6EBF6BCL iA 8KC?4AGF

B9 I4EiBHF ?8:H@8F 11 74LF (aRf) BE 13 74LF (gRi) 9B??BJiA: G;8 788C

4A7 5EB47 JBHA7iA: GE4AF9BE@4GiBA @8G;B7. aRf *4@C?8F J8E8 ;4A7

sectioned. GFP fluorescence is green, whilst chlorophyll fluorescence iF red. gRi *4@C?8F J8E8 6ELBFG4G F86GiBA87. A?? scale bars 4E8 500 X@.

aRc White ?HCiA. Boxed region iA a iF 4A 4Ki??4EL 5H7 8A?4E:87 iA

4A7 c. 4A7 c 4E8 M F86GiBAF G;EBH:; G;8 4Ki??4EL 5H7 F;BJiA: 8GFP

fluorescence in different layers. White arrow iF GFP 8KCE8FFiBA iA

8Ci78E@iF (L1). cWhite arrow CBiAGF GB I4F6H?4E GiFFH8 (L3) 8KCE8FFiA:

8GFP, 7BH5?8 8A787 white arrow CBiAGF GB P1 GiFFH8 4A7 8KCE8FFiBA

iA )1 iF 6iE6?87. d P84E? ?HCiA F;BJiA: 8GFP 8KCE8FFiBA 4?BA: G;8

JBHA787 4E84F eRf L. pilosus 8 iF F86GiBA G;EBH:; G;8 68AGE8 B9 G;8

*AM. f iF 4 F86GiBA G;EBH:; 4A 4Ki??4EL 5H7 F;BJiA: 8KCE8FFiBA B9

8GFP iA G;8 8Ci78E@iF 4A7 788C8E GiFFH8F. g F454 584A F86GiBA F;BJ-

iA: 8 GFP 8KCE8FFiBA BA JBHA787 4E84F. hRi Fi8?7 C84. AKi??4EL F;BBG

78I8?BC@8AG (boxed region 9EB@ h) iF 8A?4E:87 iA i, F;BJiA: 8KG8AFiI8

GFP 8KCE8FFiBA 4F J4F B5F8EI87 9BE 4Ki??4EL F;BBGF B9 NLL

1 3


Appendices

121

7iFGiA6G) 4E8 FG45?L @4iAG4iA87 7HEiA: CEBC4:4GiBA, 4A7 4

@8Ei6?iA4? 6;i@8E4 (F86GBE4? G;EBH:; ?4L8EF) 64A 58 FG45i-

?iF87 4F 4 C8Ei6?iA4? 6;i@8E4 5L CEBC4:4GiBA 9EB@ 4Ki??4EL

5H7F (*ML@kBJi4k 4A7 *HFF8K 1996). TJB GB G;E88 EBHA7F

B9 E8:8A8E4GiBAF J8E8 E86B@@8A787 GB E87H68 6;i@8E4F

iA GB5466B (M4?i:4 4A7 NiKBA 1998) 4A7 iA FGE4J58EEL

(M4G;8JF 8G 4?. 1995).

T.ansf,.mati,n ,f ,the. -1lse leg1me s-ecies

T;8 E8FH?GF E8CBEG87 ;8E8 78@BAFGE4G8 G;4G 4 ;i:; 9E8DH8A6L

B9 GE4AF:8Ai6 F;BBGF 64A 58 CEB7H687 JiG; ?8FF 899BEG 46EBFF

CH?F8 ?8:H@8 FC86i8F 5L 9B??BJiA: G;8 @8G;B7B?B:L 4F

78F6Ei587, 6B@C4E87 GB G;8 84E?i8E CEBGB6B?. &HE E8FH?GF 4A7

B5F8EI4GiBAF 4E8 6?BF8?L 4?i:A87 JiG; G;BF8 78F6Ei587 9BE

68E84? F887?iA: F;BBG 4Ci64? @8EiFG8@ GE4AF9BE@4GiBA, J;i6;

;4F 588A 4CC?i87 JiG; FH668FF 46EBFF 4 E4A:8 B9 68E84? 6EBC

FC86i8F. A G;8 64F8 B9 68E84?F, GE4AF9BE@45i?iGL B9 4Ci64? 68??F

4?FB ;4F CEBI8A ABG GB 58 G;8 E4G8 ?i@iGiA: iFFH8 4F iAiGi4??L

E8CBEG87, 5HG 4F JiG; CH?F8 6EBCF, F8?86G45?8 @4Ek8E HF8 ;4F

proven difficult and chimerism of primary transformants has been reduced significantly by producing and multiplying F;BBGF JiG;BHG F8?86GiBA 9BE F8I8E4? J88kF CEiBE GB GE4AF98E GB

F8?86GiBA @87i4 (*Gi6k?8A 4A7 &E45L 2005). .8 CEBCBF8 9EB@

BHE 8KC8Ei8A68F, G;4G G;8 F4@8 FH668FF9H? BHG6B@8 5L 4CC?i64-

GiBA B9 G;iF :8A8E4? @8G;B7B?B:L iF 4?FB ?ik8?L 9BE BG;8E 7i6BG

species where transformation has proven difficult to achieve.T;8 9E8DH8A6L B9 8I8AGF B5F8EI87 iA BHE E8F84E6; @84AF

G;4G 4CCEB46;8F GB GM 6EBC 78I8?BC@8AG G;4G 4IBi7 G;8

E8G8AGiBA B9 9BE8i:A DNA, FH6; 4F G;8 C) *P)-C4F9 @8G;-

B7B?B:L ((H[Gi8E 2016) 6BH?7 58 4CC?i87 GB 46;i8I8 G4i?BE87

:8A8Gi6 8I8AGF G;4G @88G G;8 E8:H?4GBEL E8DHiE8@8AGF B9

G;8 iAG8EA4GiBA4? 6B@@HAiGL, BC8AiA: G;8 J4L 9BE 4 E4A:8

B9 ?8:H@8 6EBC i@CEBI8@8AGF G;4G 6HEE8AG?L 4E8 ABG 58iA:

4GG8@CG87. A 6BA6?HFiBA, i9 6B@5iA87 JiG; 9HEG;8E CEBC4:4-

GiBA 4A7 F8?86GiBA, iG iF 984Fi5?8 G;4G G;iF 4CCEB46; GB GE4AF-

:8Ai6 F;BBG E8:8A8E4GiBA 64A CEBIi78 4A 499BE745?8 @84AF

B9 ;i:; G;EBH:;CHG :8A8Gi6 GE4AF9BE@4GiBA G;4G iF JiG;iA G;8

64C45i?iGi8F B9 C8EFBAA8? iA 4AL CH?F8 E8F84E6; BE i@CEBI8-

@8AG CEB:E4@.

Ackn,3ledgments The first author acknowledges with deep grati-GH78 G;8 AHFGE4?i4A AJ4E7 *6;B?4EF;iC 9HA787 5L G;8 AHFGE4?i4A GBI-

8EA@8AG. T;8 4HG;BEF 46kABJ?87:8 G;8 946i?iGi8F B9 CELLC8AGE4?,

*6;BB? B9 AA4GB@L P;LFiB?B:L & HH@4A BiB?B:L, T;8 ,AiI8EFiGL B9

Western Australia and the facilities, scientific and technical assistance B9 G;8 AHFGE4?i4A Mi6EBF6BCL & Mi6EB4A4?LFiF )8F84E6; F46i?iGL 4G

G;8 C8AGE8 9BE Mi6EBF6BCL, C;4E46G8EiF4GiBA & AA4?LFiF (CMCA), T;8

,AiI8EFiGL B9 .8FG8EA AHFGE4?i4, 4 946i?iGL 9HA787 5L G;8 ,AiI8EFiGL,

*G4G8 4A7 CB@@BAJ84?G; GBI8EA@8AGF.

A1th,. c,nt.i 1ti,ns PEBj86G 78Fi:A 4A7 74G4 4A4?LFiF AHN, *JB

4A7 .E, GE4AF9BE@4GiBAF AHN 4A7 LH, C?4AG GiFFH8 6H?GHE8 AHN,

microscopy AHN, figure preparation AHN and SJB, manuscript prepa-E4GiBA AHN, *JB, .E 4A7 LH.

TE4AF98E B9 4 GE4AF:8A8 G;EBH:; NLL 4A7 BG;8E ?8:H@8

:4@8G8F HFH4??L E8DHiE8F L2 GB 58 GE4AF:8Ai6 (Ti?A8L-B4F-

F8GG 1986). N:HL8A 8G 4?. (2016) identified that vascular GiFFH8 74@4:8 4F J8?? 4F *AM 78FGEH6GiBA E8FH?G87 9EB@

;L:EB@L6iA GE84G@8AG B9 8KC?4AGF; JiG; G;iF F8?86GiBA

G;8E89BE8 L3 GB?8E4A68 iF 4?FB 8FF8AGi4?. T;8BE8Gi64??L, ?4G-

8E4? BE:4AF BEi:iA4G8 9EB@ CEB64@5iH@ iA P1 B9 *AM 4A7

I4F6H?4E 64@5iH@ iA FG8@ B9 C?4AGF (EI8EG 2006). -iFH4?iF-

iA: G;8 6EBFF F86GiBA B9 NLL F;BJ87 G;4G G;8 4Ki??4EL 5H7F

BEi:iA4G87 9EB@ 4 :EBHC B9 68??F iA I4F6H?4E GiFFH8 (Fi:. 17,

8). T;8 Ji78 4A7 788C JBHA7iA: @8G;B7 (Fi:. 2) 46;i8I87

G;8F8 B5j86GiI8F.

Delayed selection improved transformation efficiency

E4E?L F8?86GiBA iA 6B@5iA4GiBA JiG; G;8 BEi:iA4? JBHA7-

iA: @8G;B7 J4F G;8 ?84FG FH668FF9H? 4CCEB46;; 788C 4A7

5EB47 FG455iA: 6B@5iA87 JiG; 78?4L87 ;L:EB@L6iA 7EBC-

?8G F8?86GiBA J4F G;8 @BFG 89986GiI8 @8G;B7 B9 46;i8IiA:

significantly transgenic shoot materials (Fig. 5; T45?8 1).

T;iF E8FH?G FHCCBEGF G;8 B5F8EI87 89986G B9 78?4L87 F8?86-

GiBA iA G;8 466B@C4ALiA: C4C8E (N:HL8A 8G 4?. 2016), J;8E8

i@CEBI87 FHEIiI4? B9 8KC?4AGF J4F B5F8EI87 JiG; PPT F8?86-

GiBA 4F J8?? 4F ;L:EB@L6iA, J;8A F8?86GiBA J4F 78?4L87.

A @B78E4G8?L 8A;4A687 9E8DH8A6L B9 ;8EiG45?8 GE4AF:8Ai6

F;BBGF J4F 46;i8I87 HFiA: G;8 BEi:iA4? JBHA7iA: 4A7 F8?86-

GiBA @8G;B7 5L .ij4L4AGB 8G 4?. (2009). A G;4G E8F84E6;,

GE4AF:8Ai6 NLL G;4G ;47 ?8FF FHF68CGi5i?iGL GB 9HA:4? C4G;B-

:8A 7H8 GB 8KCE8FFiBA B9 G;8 4AGi-4CBCGBGi6 546H?BIiEHF :8A8

P35 J4F :8A8E4G87. G J4F ABG CBFFi5?8 GB F8C4E4G8 BC8E4GBE

9EB@ GE4AF:8A8 89986G iA G;4G CEBj86G. HBJ8I8E G;8F8 A8J

E8FH?GF 4E8 6BAFiFG8AG JiG; G;8 FH::8FGiBA G;4G E87H687 C?4AG

68?? FGE8FF 7H8 GB iA;i5iGiBA B9 4CBCGBFiF @4L ;4I8 8A;4A687

G;8 9E8DH8A6L B9 GE4AF:8Ai6 F;BBG FHEIiI4? iA G;4G 8K4@C?8.

Selecti,n meth,d,l,g4 and -.,-agati,n t, .ed1ce

chime.ism

A?G;BH:; GFP-8KCE8FFiA: F;BBGF J8E8 45HA74AG, 7i998E8AG

8KG8AGF B9 6;i@8EiF@ 4@BA:FG G;8 GE4AF:8Ai6 F;BBGF iAI8F-

Gi:4G87 J8E8 FGi?? B5F8EI87 (Fi:F. 4, 6). A7887, iA G8E@F B9

:8A8E4GiA: GE4AF:8Ai6 F;BBG @4G8Ei4?, G;8 BHG6B@8 B9 G;iF

E8F84E6; ;4F 588A 4 :BB7 8K4@C?8 B9 @BIiA: O9EB@ E4:F

GB 4A 8@54EE4FF@8AG B9 Ei6;8FQ. A 9HEG;8E FG8C iA G;8 CEBC4-

:4GiBA B9 GE4AF:8Ai6 F;BBGF J4F GEi4?87 GB E87H68 @H?GiC?8

GE4AF:8Ai6 68?? 6;i@8EiF@. Fi:HE8 6 F;BJF IiFH4? 8Ii78A68

G;4G G;iF 64A 58 46;i8I87. G iF 6?84E G;4G G;8E8 Ji?? 58 45HA-

74AG GE4AF:8Ai6 L2 68??F iA G;8 NLL F;BBGF G;4G ;4I8 588A

:8A8E4G87 9B??BJiA: 6H?GHE8 F8?86GiBA. FHGHE8 JBEk JiG; T1

@4G8Ei4?F GB 8K4@iA8 ;8EiG45i?iGL 4A7 DNA FGEH6GHE8 Ji??

however be necessary to finalise this aspect of the trans-9BE@4GiBA @8G;B7B?B:L. &A68 :8A8E4G87, C8Ei6?iA4? 6;i@8-

E4F (J;8E8 BA8 BE @BE8 ?4L8EF 4E8 HAi9BE@?L :8A8Gi64??L

1 3


122

AHGEiGiI8 I4?H8 B9 F887F B9 GE4AF:8Ai6 ?HCiAF (Lupinus angustifo-

lius L.) expressing a sunflower seed albumin gene. Proc Nat Acad *6i ,*A 94:8393R8398

MHEE4L JAH, JBA8F A, GB7iA C, TE44F J (2012) *LFG8@F 4A4?LFiF B9

F;BBG 4Ci64? @8EiFG8@ :EBJG; 4A7 78I8?BC@8AG: iAG8:E4GiA: ;BE-

@BA4? 4A7 @86;4Ai64? Fi:A4?iA:. P?4AG C8?? 24:3907R3919

N:HL8A AH, .ij4L4AGB T, EEFkiA8 ., B4Ek8E *J (2016) ,FiA: GE88A

F?HBE8F68AG PEBG8iA F;87F ?i:;G BA Lupinus angustifolius L. GE4AF-

:8Ai6 F;BBG 78I8?BC@8AG. P?4AG C8?? TiFFH8 &E: CH?G (4668CG87)

Pi:84iE8 A, A58EA8G; D, *@iG; PMC, *i@CFBA K, F?8G6;8E N, LH C-0,

AGkiAF CA, CBEAiF; E (1997) TE4AF9BE@4GiBA B9 4 :E4iA ?8:H@8

6EBC (Lupinus angustifolius L.) Ii4 Agrobacterium tumefaciens

@87i4G87 :8A8 GE4AF98E GB F;BBG 4Ci68F. MB? BE887 3:341R349

(H[Gi8E F (2016) T;8 C) *P)-C4F9 G86;AB?B:L: 6?BF8E GB G;8 H?Gi@4G8

GBB?kiG 9BE G4E:8G87 :8AB@8 87iGiA:. P?4AG *6i 242:65R76

*4GiA4 *, B?4k8F?88 AF, AI8EL AG (1940) D8@BAFGE4GiBA B9 G;8 G;E88

:8E@ ?4L8EF iA G;8 F;BBG 4C8K B9 Datura 5L @84AF B9 iA7H687

CB?LC?Bi7L iA C8Ei6?iA4? 6;i@8E4F. A@ J BBG 27:895R905

*8A4 G, .4A: /, LiH H-0, HB9;HiF H, BiEA54H@ KD (2009) &E:4A

E8:8A8E4GiBA 7B8F ABG E8DHiE8 4 9HA6GiBA4? FG8@ 68?? Ai6;8 iA

C?4AGF. N4GHE8 457:1150R1154

*B@8EF DA, *4@46 DA, &?;B9G PM (2003) )868AG A7I4A68F iA

?8:H@8 GE4AF9BE@4GiBA. P?4AG P;LFiB? 131:892R899

*G88I8F TA, *HFF8K M (1989) P4GG8EAF iA C?4AG 78I8?BC@8AG. C4@-

5Ei7:8 ,AiI8EFiGL PE8FF, C4@5Ei7:8

*Gi6k?8A MB, &E45L HF (2005) *;BBG 4Ci64? @8EiFG8@: 4 FHFG4iA45?8

8KC?4AG 9BE :8A8Gi6 GE4AF9BE@4GiBA B9 68E84? 6EBCF. A -iGEB C8??

D8I BiB? 41:187R200

*H:i@BGB K, GBE7BA *P, M8L8EBJiGM EM (2011) )8:8A8E4GiBA iA

C?4AGF 4A7 4Ai@4?F: 787i998E8AGi4GiBA, GE4AF7i998E8AGi4GiBA BE jHFG

7i998E8AGiBA? TE8A7F C8?? BiB? 21:212R218

*ML@kBJi4k EJ, *HFF8K M (1996) .;4G 6;i@8E4F 64A G8?? HF 45BHG

C?4AG 78I8?BC@8AG. AAA )8I P?4AG P;LFiB? P?4AG MB? BiB?

47:351R376

Ti?A8L-B4FF8GG )AC (1986) P?4AG 6;i@8E4F. E7J4E7 AEAB?7 LG7,

LBA7BA

Tirichine L, Andrey P, Biot E, Maurin Y, Gaudin V (2009) 3D fluores-68AG in situ ;L5Ei7iM4GiBA HFiA: Arabidopsis ?849 6ELBF86GiBAF 4A7

iFB?4G87 AH6?8i. P?4AG M8G;B7F 5:11

Voss U, Larrieu A, Wells DM (2013) From jellyfish to biosensors: the use of fluorescent proteins in plants. Int J Dev Biol 57:525–533

.ij4L4AGB T (2007) G8A8Gi6 @4AiCH?4GiBA B9 CEB:E4@@87 68?? 784G;

(PCD) 9BE E87H687 FHF68CGi5i?iGL GB A86EBGEBC;i6 9HA:i iA A4EEBJ-

?84987 ?HCiA (Lupinus angustifolius). P;D T;8FiF, T;8 ,AiI8EFiGL

B9 .8FG8EA AHFGE4?i4

.ij4L4AGB T, B4Ek8E *J, .L?i8 *J, Gi?6;EiFG DG, CBJ?iA: .A (2009)

Significant reduction of fungal disease symptoms in transgenic ?HCiA (Lupinus angustifolius) 8KCE8FFiA: t;8 4AGi-4CBCGBGi6 546H-

?BIiEHF :8A8 p35. P?4AG BiBG86;AB? J 7:778R790

Wilms FHA, Sassen MMA (1987) Origin and development of floral 5H7F iA GB5466B 8KC?4AGF. N8J P;LGB? 105:57R65

08HA: ECT, *G4FB??4 C, *H@A8E MJ, HH4A: B( (87F) (2015) P?4AG

@i6EBG86;AiDH8F 4A7 CEBGB6B?F. *CEiA:8E AG8EA4GiBA4? PH5?iF;-

iA:, C;4@

Refe.ences

AGi9 )M, P4G4G-&6;4GG EM, *I45BI4 L, &A7E8j -, K?8ABGi6BI4 H,

J464F L, GEi:4 M, &6;4GG *J (2013) G8A8 GE4AF98E iA ?8:H@8F. A:

L]GG:8 ,, B8LF6;?4: ., FE4A6iF D, CHF;@4A J (87F) PEB:E8FF iA

BBG4AL. *CEiA:8E, B8E?iA, CC 37R100

AGkiAF CA, E@8EL )JN, *@iG; PMC (2011) CBAF8DH8A68F B9 GE4AF-

9BE@iA: A4EEBJ ?84987 ?HCiA (Lupinus angustifolius 2L.3) JiG; 4A

ipt gene under control of a flower-specific promoter. Transgenic )8F 20:1321R1332

B454B:?H M, M6C458 M*, PBJ8E JB, D4I8L M) (2000) Agrobac-

terium-@87i4G87 GE4AF9BE@4GiBA B9 Lupinus mutabilis L. HFiA:

F;BBG 4Ci64? 8KC?4AGF. A6G4 P;LFiB? P?4AG 22:111R119

B4Ek8E *J, *i P, HB7:FBA L, F8E:HFBA-HHAG M, K;8AGEL 0, KEiF;-

A4@HEG;L P, AI8EiF *, M85HF K, &NLBA8 C, D4?H:B74 D, KBF;-

kHFBA N, F4iG;9H?? T, J46kFBA J, EEFkiA8 . (2016) )8:8A8E4GiBA

selection improves transformation efficiency in narrow-leaf lupin. P?4AG C8?? TiFFH8 &E: CH?G. 7Bi:10.1007/F11240-016-0992-7

B4EGBA MK, PB8G;i: )* (1993) FBE@4GiBA B9 G;8 F;BBG 4Ci64? @8Ei-

FG8@ iA Arabidopsis thaliana: 4A 4A4?LFiF B9 78I8?BC@8AG iA G;8

Ji?7 GLC8 4A7 iA G;8 F;BBG @8EiFG8@?8FF @HG4AG. D8I8?BC@8AG

119:823R831

BBJ@4A JL, EF;87 0 (2000) FBE@4GiBA 4A7 @4iAG8A4A68 B9 G;8 F;BBG

4Ci64? @8EiFG8@. TE8A7F P?4AG *6i 5:110R115

C;i8A CT, C;8A *0, TF4i CC, B4FkiA JM, B4FkiA CC, KHB-HH4A: LL

(2011) D88C Fi@C?8 8Ci6BGL? @BEC;BC;LFiB?B:i64? 7BE@4A6L iA

F887F B9 GJB Viburnum FC86i8F, JiG; FC86i4? E898E8A68 GB F;BBG

:EBJG; 4A7 78I8?BC@8AG iAFi78 G;8 F887. AAA BBG 108:13R22

EI8EG )F (2006) EF4HNF C?4AG 4A4GB@L. .i?8L, HB5Bk8A

FiF6;8E AH, J46B5FBA KA, )BF8 J, 18??8E ) (2008) PE8C4E4GiBA B9

F?i78F 4A7 6BI8EF?iCF 9BE @i6EBF6BCL. C*H PEBGB6. 7Bi:10.1101/

C75.CEBG4988

4AG6;8I4 A, MLFBE8 K*, )4G8G P (2013) TE4AF9BE@4GiBA B9 ?8:H@iABHF

C?4AGF GB FGH7L FL@5iBGi6 iAG8E46GiBAF. AG J D8I BiB? 57:577R586

J4@8F C (2015) *AAA )8CBEG BA G?B54? *G4GHF B9 BiBG86;/GM CEBCF.

*AAA BEi89 51-2015, AG8EA4GiBA4? *8EIi68 9BE G;8 A6DHiFiGiBA

B9 A:Ei-5iBG86; ACC?i64GiBAF ( *AAA), ,*A

K4E4@i &, EFA4-AF;4Ei M, K4Ei@i KHE7iFG4Ai G, A:;4I4iFi B (2009)

Agrobacterium-@87i4G87 :8A8Gi6 GE4AF9BE@4GiBA B9 C?4AGF: G;8

EB?8 B9 ;BFG. BiB? P?4AG 53:201R212

L4MB G), *G8iA PA, LH7Ji: )A (1991) A DNA GE4AF9BE@4GiBA-6B@C8-

G8AG Arabidopsis :8AB@i6 ?i5E4EL iA Agrobacterium. BiBG86;AB?-

B:L 9:963R967

L8A;4E7 M, J]E:8AF G, L4HK T (2002) T;8 .,*CHEL 4A7 *H&&T-

MERISTEMLESS genes fulfil complementary roles in Arabidop-

sis F;BBG @8EiFG8@ E8:H?4GiBA. D8I8?BC@8AG 129:3195R3206

Li H, .L?i8 *J, JBA8F MGK (2000) TE4AF:8Ai6 L8??BJ ?HCiA (Lupinus

luteus). P?4AG C8?? )8C 19:634R637

M4?i:4 P, NiKBA PJ (1998) JH7:iA: G;8 ;B@BC?4FGB@i6 FG4G8 B9 C?4FGi7

GE4AF9BE@4AGF. TE8A7F P?4AG *6i 3:376R377

M4G;8JF H, .4:BA8E ., K8??B:: J, B8FGJi6k ) (1995) G8A8Gi6 GE4AF-

9BE@4GiBA B9 FGE4J58EEL: FG45?8 iAG8:E4GiBA B9 4 :8A8 GB 6BAGEB?

5iBFLAG;8FiF B9 8G;L?8A8. A -iGEB C8?? D8I BiB? P?4AG 31:36R43

MB?Ii: L, T458 LM, E::H@ B&, MBBE8 AE, CE4i: *, *C8A68E D,

Hi::iAF TJ- (1997) EA;4A687 @8G;iBAiA8 ?8I8?F 4A7 iA6E84F87

1 3


Documents

Developmental analysis of transformation in legumes Nguyen ......Developmental analysis of transformation in legumes Nguyen, Hoai An ... except where due reference has been made in