저 시-비 리- 경 지 2.0 한민

는 아래 조건 르는 경 에 한하여 게

l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.

다 과 같 조건 라야 합니다:

l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.

l 저 터 허가를 면 러한 조건들 적 되지 않습니다.

저 에 른 리는 내 에 하여 향 지 않습니다.

것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.

Disclaimer

저 시. 하는 원저 를 시하여야 합니다.

비 리. 하는 저 물 리 목적 할 수 없습니다.

경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.

i

- ABSTRACT -

The Role of Annexin A6

in Osteoporosis

Osteoporosis is a common calcium and metabolic skeletal disease which is

characterized by decreased bone mass, microarchitectural deterioration of bone tissue and

impaired bone strength, thereby leading to enhanced risk of bone fragility.

In this study, we aimed to discover a novel herbal therapeutic drug for effective

osteoporosis treatment and to further clarify its molecular mechanism of action. At first,

ethanol or methanol extracts of 68 edible Korean native plants were screened and Poncirus

trifoliata (PT) was selected as a final candidate because of its high inhibitory activity on

glucocorticoid (GC)-induced apoptosis plus its novelty. The hexane extract of PT (PT-H)

inhibited apoptotic cell death of osteoblastic cell lines, C3H10T1/2 and MC3T3-E1 induced

by synthetic GC, dexamethasone (Dex). In vivo mouse results indicated that PT-H not only

had an inhibitory effect on the bone loss caused by GC, but also promoted bone formation.

We further clarified the molecular mechanisms behind the effect of PT-H on GC-

induced osteoporosis (GIO) by screening of differentially-expressed genes (DEGs) between

Dex-induced osteoblastic cells with or without PT-H treatment. Finally, we found that the

expression level of AnxA6 in Dex-induced osteoblastic cells and prednisolone-treated GIO-

model mice was significantly decreased by PT-H treatment. These findings suggest that PT-

H has a strong in vitro and in vivo inhibitory effect on GIO, and decreased expression of

ii

AnxA6 may play a key role in this inhibition. As the next step, we aimed to determine

whether ANXA6 gene was associated with the susceptibility to osteoporosis and further

identify novel genes for susceptibility to osteoporosis. At first, we performed a whole-

genome comparative expression analysis. Ten genes were identified as the DEGs in the Dex-

treated MC3T3-E1 cells. To validate and evaluate the identified DEGs, we performed

quantitative real-time RT-PCR using the gene-specific primers and compared the expression

levels of these genes between the Dex-treated and untreated MC3T3-E1 cells, and between

the ovariectomized (OVX) and sham mice and found that the expression levels of 7 genes,

Anxa6, Col5a1, Col6a2, Eno1, Myof, Nfib and Scara5, were significantly altered in the in

vitro and in vivo osteoporosis models.

Lastly, to determine whether the genetic variations of these 7 genes were associated

with bone density and osteoporosis phenotypes in humans, we performed the quantitative

bone density analysis and osteoporosis case-control analysis of 116 ingle nucleotide

polymorphism (SNPs) in these 7 genes in the Korean Women’s Cohort (3570 subjects).

There was a significant association between the SNPs in the 5 genes, ANXA6, COL5A1,

ENO1, MYOF and SCARA5, and bone density and/or osteoporosis. Especially, the SNPs in

the ANXA6 gene showed a highly significant association with bone density and their p-values

satisfied the Bonferroni-corrected significance level. These results indicate that genetic

variation in the ANXA6 gene is significantly associated with bone density and osteoporosis.

This study may provide insight into the genetic basis of osteoporosis.

Key words: osteoporosis, Poncirus trifoliata, glucocorticoids, Annexin A6 (ANXA6), osteoblast, bone mineral density (BMD), differentially expressed genes (DEGs), single nucleotide polymorphism (SNP), association, mouse, human

iii

TABLE OF CONTENTS

ABSTRACT ················································································································ ⅰ

TABLE OF CONTENTS ······························································································ iii

LIST OF FIGURES ······································································································ vi

LIST OF TABLES ···································································································· viii

. Ⅰ INTRODUCTION ···································································································· 1

A. In vitro and in vivo inhibition of glucocorticoid-induced osteoporosis by the

hexane extract of Poncirus trifoliata ································································· 1

B. Genetic association between single nucleotide polymorphisms in the ANXA6 gene

and bone density/osteoporosis ············································································· 3

. Ⅱ MATERIALS AND METHODS ············································································ 6

1. Chemicals ·········································································································· 6

2. Plant materials and preparation of hexane extracts ··········································· 6

3. Cell culture ········································································································ 7

4. Cell viability assay ···························································································· 8

5. Terminal deoxynucleotidyl Transferase (TdT)-mediated dUTP nick end

labeling (TUNEL) staining ················································································ 8

6. GIO mouse model experiment ··········································································· 9

7. Measurement of bone mineral density for density ············································ 10

8. Tissue sample preparation ················································································· 10

iv

9. Annealing control primer (ACP)-based differential display reverse-transcriptase

polymerase chain reaction (RT-PCR) ······························································· 10

10. Cloning and sequence analysis ······································································ 12

11. Gene-specific quantitative real-time RT-PCR ··············································· 12

12. Protein extraction and western blot analysis ················································· 14

13. Ovariectomized (OVX) mouse model ····························································· 15

14. Human subjects ······························································································· 15

15. Genotyping and selection of SNPs ·································································· 17

16. Statistical analysis ························································································· 17

. Ⅲ RESULTS ·············································································································· 19

A. In vitro and in vivo inhibition of glucocorticoid-induced osteoporosis by the

hexane extract of Poncirus trifoliata ······························································· 19

1. Screening of the novel, effective natural sources on GIO ······························· 19

2. In vitro inhibition of PT-H on Dex-induced apoptosis ···································· 23

3. Inhibitory effect of PT-H on an in vivo GIO model ········································ 26

4. Screening and identification of DEGs in Dex-induced osteoblastic cells with

and without PT-H treatment ············································································ 28

5. Validation of the identified DEGs by real-time RT-PCR and western blot

analysis ············································································································ 31

6. Effect of PT-H on the expression of AnxA6 in GIO-mice ································ 34

B. Genetic association between single nucleotide polymorphisms in the ANXA6

gene and bone density/osteoporosis ···································································· 36

v

1. Study design ······································································································ 36

2. Screening and identification of the DEGs in Dex-treated osteoblastic cell line

model ················································································································· 38

3. Validation of the identified DEGs in the cell line model by quantitative

real-time RT-PCR ······························································································ 43

4. Evaluation of the identified DEGs in the ovariectomized mouse model by

quantitative real-time RT-PCR ·········································································· 45

5. Association analysis of the genetic variation in the identified DEGs with bone

density and osteoporosis in humans ·································································· 47

. Ⅳ DISCUSSION ······································································································· 60

A. In vitro and in vivo inhibition of glucocorticoid-induced osteoporosis by the

hexane extract of Poncirus trifoliata ······························································· 60

B. Genetic association between single nucleotide polymorphisms in the ANXA6

gene and bone density/osteoporosis ·································································· 65

Ⅴ. CONCLUSION ····································································································· 71

REFERENCES ············································································································ 72

국문요약 ····················································································································· 85

vi

LIST OF FIGURES

Fig. 1. Effect of Poncirus trifoliata hexane extract (PT-H) on Dex-induced apoptosis

of osteoblastic cells ··························································································· 24

Fig. 2. Effect of Poncirus trifoliata hexane extract (PT-H) on the bone mineral

density (BMD) of mice treated with glucocorticoid ······································· 27

Fig. 3. Differential banding patterns of the 8 identified differentially-expressed

genes (DEGs) ···································································································· 29

Fig. 4. Validation of 8 identified differentially-expressed gene (DEG) mRNAs

by quantitative real-time RT-PCR analysis ······················································· 32

Fig. 5. Validation of 2 representative differentially-expressed genes (DEGs),

AnxA6 and Col6a2, at the protein level by Western blot analysis ···················· 33

Fig. 6. Effect of Poncirus trifoliata hexane extract (PT-H) on the expression of

AnxA6 in GIO-mice ·························································································· 35

Fig. 7. The flow chart of the study ················································································ 37

vii

Fig. 8. Effect of dexamethasone on apoptosis in mouse osteoblastic MC3T3-E1 cell line ·

··························································································································· 40

Fig. 9. Differential banding patterns of the 10 identified differentially expressed

genes (DEGs). ··································································································· 41

Fig. 10. Validation of the mRNA expression level of the 10 DEGs in the Dex-

treated MC3T3-E1 cells by quantitative real-time RT-PCR ····························· 44

Fig. 11. Comparison of the bone mineral density and the mRNA expression level of

the 10 DEGs between the sham and ovariectomized mice ······························ 46

Fig. 12. Location and basic linkage disequilibrium (LD) of the analyzed SNPs

in the ANXA6 (A), COL5A1 (B), MYOF (C) and SCARA5 (D) genes ·············· 57

viii

LIST OF TABLES

Table 1. Inhibitory effects of the extracts from 68 Korean plants against dexamethasone

(Dex)-induced apoptosis of osteoblastic C3H10T1/2 cell line ····················· 20

Table 2. Inhibition of dexamethasone-induced apoptosis of osteoblastic cells by the

extracts from the selected Korean plants ···················································· 22

Table 3. List of significantly differentially-expressed genes (DEGs) in osteoblastic

cells with and without Poncirus trifoliata hexane extract (PT-H) treatment

························································································································ 30

Table 4. List of the significantly differentially expressed genes (DEGs)

in the dexamethasone-treated mouse MC3T3-E1 cells ··································· 42

Table 5. Basic characteristics of the women subjects in the KARE study cohort

························································································································ 49

Table 6. Information on the SNPs in the seven analyzed genes ···································· 50

Table 7. The results of association analysis between the SNPs in the seven genes

and bone density in the KARE women subjects ············································· 54

ix

Table 8. The results of case-control association analysis between the SNPs in the

seven genes and osteoporosis in the KARE women subjects ························· 56

Table 9. The summary of the results from each step of the experiments in the cell

line, mouse model and humans ······································································· 67

- 1 -

I. INTRODUCTION

A. In vitro and in vivo inhibition of glucocorticoid-induced

osteoporosis by the hexane extract of Poncirus trifoliata

Osteoporosis is a calcium and metabolic disorder characterized by decreased bone

mass, enhanced risk of bone fragility and susceptibility to fracture (Raisz, 2005; Sambrook

and Cooper, 2006) caused by a failure of bone homeostasis, which is due to both an

increase in osteoclastic bone resorption and a decrease in osteoblastic bone formation

(Teitelbaum, 2000; Khosla et al., 2008). Osteoporotic fractures are an important cause of

morbidity and mortality, particularly in elderly women and men (Johnell and Kanis, 2005).

Glucocorticoids (GCs) have strong anti-inflammatory effects and are used

extensively for the treatment of a wide variety of disorders, including autoimmune,

pulmonary and gastrointestinal diseases, as well as inflammatory diseases (Gudbjornsson

et al., 2002). One of the most serious complications brought about by long-term GC

therapy is rapid bone loss and increased risk of fracture (Gudbjornsson et al., 2002; Angeli

et al., 2006; Canalis et al., 2007). The therapeutic use of GCs has contributed to the

increase of the most prevalent form of secondary osteoporosis, glucocorticoid-induced

osteoporosis (GIO), which is observed in patients chronically exposed to GCs (Alesci et

al., 2005; Mazziotti et al., 2006). It is now clear that long-term use of GCs modifies the

proliferative and metabolic activity of the bone cells, osteoblasts/osteocytes and

osteoclasts. GCs can cause excessive bone loss by decreasing bone formation and

increasing bone resorption (Canalis and Delany, 2002; Alesci et al., 2005; Olney, 2009).

- 2 -

For the pharmacological therapy of osteoporosis, two main classes of medications are

available; antiresorptive agents such as bisphosphonates, estrogen/sex hormones, the

estrogen agonist/antagonist raloxifene, and calcitonin, in addition to anabolic agents such as

parathyroid hormone, sodium fluoride, vitamin D metabolites, growth factors, statins and

anabolic steroids (Sambrook and Cooper, 2006; Bonura, 2009; Lewiecki, 2009). However,

some of these medications have side effects, including increased risk of endometrial and

breast cancers (Bonura, 2009). So far, several botanicals such as Carthamus tinctorius,

Drynaria fortunei, Gardenia jasminoides, Schizandra chinensis and Ulmus davidiana, which

are used in folk medicine, have been reported to be potential alternative treatments for

osteoporosis (Ha et al., 2003; Jeong et al., 2005; Suh et al., 2007; Kim et al., 2008;

Caichompoo et al., 2009), but there have been only two reports on the in vivo activity against

GIO by these botanicals (Kim et al., 2002; Wong and Rabie, 2006).

In this study, 68 Korean native plants were screened to search for novel, effective

botanical-based treatments for GIO. The dried immature fruit of Poncirus trifoliata (L.)

(Rutaceae, PT) (Kim et al., 1999; Lee et al., 2005; Shim et al., 2009), which is widely used

in eastern Asia as a traditional medicine, was selected as a potential natural-source candidate

for the treatment of GIO. The effects of a hexane extract of PT (PT-H) on GIO were

examined in vitro and in vivo. In order to clarify the molecular mechanisms behind the effect

of PT-H on GIO, a whole genome gene expression comparison study was performed in

dexamethasone (Dex)-induced osteoblastic cells with and without PT-H, and several

differentially expressed genes (DEGs) were found. The DEGs were further evaluated in

osteoblasts and bones of GIO-mice. The results suggested that PT-H may inhibit GIO both in

vitro and in vivo.

- 3 -

B. Genetic association between single nucleotide polymorphisms in

the ANXA6 gene and bone density/osteoporosis

Osteoporosis is involved in the interactions of multiple genetic and environmental risk

factors (Torgerson et al., 1996; Sigurdsson et al., 2008). Recently, genetic factors have

attracted much attention of many investigators due to their high importance in the

pathogenesis of osteoporosis. Severe osteoporosis may be related to mutation in a single

gene, otherwise, BMD or bone mineral mass can be accounted for by the common genetic

variations in multiple genes with relatively small effects or by the rare genetic variations in

specific genes with relatively large effects (Hosoi, 2010; Ralston, 2010; Ralston and

Uitterlinden, 2010). Heritability studies in twins and families have demonstrated that

between 50% and 85% of the variance in peak BMD is genetically determined (Pocock et al.,

1987; Gueguen et al., 1995; Ralston and Uitterlinden, 2010).

The identification of genetic variants that contribute to osteoporosis and BMD

phenotypes can be helpful not only for elucidation of the molecular mechanisms of

osteoporosis, but also for the development of effective treatment for osteoporosis. So far,

many osteoporosis susceptibility loci and genes have been identified by genome-wide

linkage analysis (Styrkarsdottir et al., 2003; Xiao et al., 2006; Hsu et al., 2007; Kaufman et

al., 2008), candidate gene association studies (Richards et al., 2009) and genome-wide

association studies (GWAS) (Karasik et al., 2008; Richards et al., 2008; Cho et al., 2009;

Styrkarsdottir et al., 2009; Xiong et al., 2009), and recent important and representative

findings through molecular genetic studies of gene identification for osteoporosis have been

- 4 -

well summarized (Xu et al., 2010). However, the vast majority of the monogenic and

polygenic genetic factors in osteoporosis still remain to be discovered.

In this study, we aimed to identify the novel genes for susceptibility to osteoporosis

that influence the pathogenesis of osteoporosis in humans in a particular way, by using the in

vitro and in vivo models for osteoporosis. As an in vitro model for osteoporosis, we used the

glucocorticoid (GC)-treated mouse osteoblastic MC3T3-E1 cell line in this study. GC causes

osteoporosis-like bone loss due to decreasing bone formation and increasing bone resorption

(Alesci et al., 2005; Canalis et al., 2007; Olney, 2009). GC-induced apoptosis in osteoblastic

cells has been reported (Yun et al., 2009). The mouse MC3T3-E1 cell line has been

demonstrated to be a suitable in vitro model of osteoblast development due to typical

osteoblast differentiation and formation of a bone-like mineralized extracellular matrix

(Quarles et al., 1992; Choi et al., 1996). Therefore, GC-treated osteoblastic MC3T3-E1 cells

may provide a useful in vitro system for the first screening step of the differentially

expressed genes (DEGs) between controls and osteoporosis models.

In case of the in vivo models for osteoporosis, many animal models have been

established for osteoporosis research (Turner et al., 2001; Lelovas et al., 2008). Although, the

ovariectomized (OVX) rat exhibits most of the characteristics of human postmenopausal

osteoporosis, mouse is also very useful laboratory animal model for osteoporosis due to easy

management. Among the mouse models for osteoporosis, OVX mice and GC-induced mice

represent a reliable in vivo model to investigate bone loss in osteoporosis (Jee and Yao, 2001).

We used OVX mice as an in vivo model for osteoporosis in this study.

We first screened and selected the candidate genes that have a higher possibility to be

- 5 -

linked with osteoporosis by comparative analysis of gene expression between controls and in

vitro osteoporosis model. Subsequently, we carried out evaluation of the candidate genes

using the in vivo osteoporosis model. Finally, we performed an association analysis between

the genetic variants in the selected genes and bone density and osteoporosis in human

subjects. This approach may provide an accurate identification of novel genes for

susceptibility to osteoporosis.

- 6 -

II. MATERIALS AND METHODS

1. Chemicals

Cell culture media (DMEM and α-MEM), antibiotics (penicillin and streptomycin) and

fetal bovine serum (FBS) were purchased from Invitrogen (Carlsbad, USA). Dex, DMSO,

MTT assay kits, protease inhibitors (phenylmethylsulphonyl fluoride [PMSF], leupeptin and

aprotinin) and strontium chloride (SrCl2) were purchased from Sigma-Aldrich Co. (St Louis,

USA). Ethanol and hexane were purchased from Duksan Pure Chemicals (Ansan, Korea).

2. Plant materials and preparation of hexane extracts

Ethanol or methanol extracts of 68 Korean native plants were gifts from the

pharmaceutical company, HL Genomics Co., Ltd (Yongin, Korea), and were originally

provided from the Korean Plant Extract Bank in the Korea Research Institute of Bioscience

and Biotechnology (KRIBB) (http://extract.pdrc.re.kr). The preparation procedure of

botanical extracts is described briefly as follows. Plant materials were collected from various

locations in Republic of Korea or purchased from local Korean herb drug markets and

identified taxonomically by a botanist, Dr H. K. Lee at the KRIBB. The voucher specimens

are deposited at the herbarium of KRIBB. One hundred grams of air-dried botanical

materials was extracted with 500 mL of methanol or ethanol at room temperature for 5 days.

The methanol or ethanol extracts were passed through Whatman filter paper (No. 2) in order

- 7 -

to remove debris and concentrated using a rotary evaporator under vacuum and then

lyophilized. The extract yields of 68 plants were approximately 5–20% (w/w). The dried

extracts were reconstituted to concentrations of 1 mg/mL with deionized water containing

5% (v/v) DMSO, and subsequently used for screening.

Hexane extracts of Poncirus trifoliata (PT-H) were prepared as follows. The dried

fruits of PT (1.6 kg) were extracted three times with ethanol (3×1.2 L) at 100 °C for 3 h. The

PT ethanol extract (292.12 g) was suspended in water and then sequentially partitioned with

equal volumes of n-hexane and ethyl acetate. Each fraction was evaporated under vacuum to

yield residues from the n-hexane (30.50 g) and water (29.13 g) extracts. The PT-H extract

was further assessed both in vitro and in vivo for its inhibitory activity against GIO.

3. Cell culture

Mouse osteoblastic MC3T3-E1 cells were purchased from the RIKEN cell bank

(Tsukuba, Japan) and grown in α-MEM medium supplemented with 10% FBS, penicillin

(100 U/mL) and streptomycin (100 μg/mL). Mouse embryonic mesenchymal C3H10T1/2

cells were purchased from the Korean Cell Line Bank (Seoul, Korea) and grown in DMEM

medium supplemented with 10% FBS, penicillin (100 U/mL) and streptomycin (100 μg/mL).

All cultured cells were incubated at 37 °C in a humidified atmosphere containing 5% CO2.

- 8 -

4. Cell viability assay

Cells (3×103 cells/well) were seeded in a 96-well plate, incubated overnight, and

cotreated with Dex (1 μM) and different concentrations of PT-H (10, 50 or 100 μg/mL) in

the medium for 48 h. MTT (20 μL, 5 mg/mL in PBS) was added per well, cells were

incubated for another 4 h, and the media were carefully removed. The formazan crystals

were dissolved in acidified isopropyl alcohol (40 mM HCl in isopropanol) and absorbances

were measured at 570 nm using a microplate reader (BioTek, Winooski, USA).

5. Terminal deoxynucleotidyl Transferase (TdT)-mediated dUTP

nick end labeling (TUNEL) staining

Cells were seeded on glass in a 6-well plate, incubated overnight, and cotreated with

Dex (1 μM) and different concentrations of PT-H (10, 50 or 100 μg/mL) in the medium for

48 h. The assay was performed using a commercial In Situ Cell Death Detection kit (Roche

Applied Science, Indianapolis, USA) according to the manufacturer’s protocol. The cells

were then mounted with VectaShield reagent (Vector Laboratories, Burlingame, CA) and

analysed using a fluorescence microscope excited at a wavelength of 480 nm for fluorescein

and 360 nm for 4′, 6-diamidino-2-phenylindole (DAPI). Quantification of TUNEL staining

was performed by counting positive cells in three random regions of the slide at a

magnification of × 200.

- 9 -

6. GIO mouse model experiment

Twenty-eight 6-month-old male ICR mice were obtained from Central Laboratory

Animal Inc. (Seoul, Korea). Mice were maintained on a diet (5.0 g/day) of Formula-M07

(Feedlab Co., Ltd, Hanam, Korea) and tap water (15 mL/day). All mice were housed

individually in clear plastic cages under controlled temperature (23±2°C), humidity (55±5%)

and illumination (12 h light/dark cycle). Mice were acclimated for 10 days prior to

experimentation. Except for the sham‐operated group of seven mice, slow release pellets (5

mg, 60‐day slow-release) of prednisolone (PD) (Innovative Research of America, Sarasota,

USA) were implanted subcutaneously in the lateral neck region of 21 mice. Four weeks after

PD implantation, three groups of seven mice each were fed different experimental diets and

water with or without supplementation for another 4 weeks. In the PD+PT‐H group, the mice

were fed a custom‐made pellet diet of Formula-M07 mixture containing PT-H (100

mg/kg/day) (Feedlab Co., Ltd, Hanam, Korea) and normal distilled water and in the

PD+SrCl2 groups, the mice were fed a normal diet and distilled water supplemented with

SrCl2 (positive control) (1800 mg/kg/day). In the PD group, the mice were fed a normal diet

and allowed normal distilled water. The animal research protocol was approved by the

Animal Care and Use Committee of the Ajou University School of Medicine, and all

experiments were conducted in accordance with the institutional guidelines established by

the Committee.

- 10 -

7. Measurement of bone mineral density

Bone mineral density (BMD) was measured using a PIXI-mus bone densitometer (GE

Lunar, Madison, USA). After anesthetization using tiletamine/zolazepam (Zoletil; Virbac

Laboratories, Carros, France), the mice were placed on the specimen tray for measurements.

All mice were placed carefully in the same position. Whole body BMD was measured using

on-board PIXI-mus software for small animals, and adjusted in relation to body weight.

8. Tissue sample preparation

After measurement of BMD, the mice were killed by CO2 asphyxiation and cervical

dislocation. Mice femurs were excised, and the isolated femur bones and skeletal muscles

were then frozen by liquid nitrogen and deep-freeze, respectively. The frozen samples were

homogenized using a porcelain mortar and pestle and then lysed using RIPA lysis buffer and

used for Western blot analysis.

9. Annealing control primer (ACP)-based differential display

reverse-transcriptase polymerase chain reaction (RT-PCR)

Cells were treated with DMSO alone (control), 1 μM of Dex alone or 1 μM of Dex

plus 50 μg/mL PT-H for 2 days. Total RNA was extracted from cells using TRIzol reagent

(Invitrogen, Carlsbad, USA), following the manufacturer’s instructions. Extracted RNA was

- 11 -

quantified by a spectrophotometer (Beckman Coulter, Brea, USA). First-strand cDNA was

synthesized from 3 μg of RNA using the Revert Aid First Strand cDNA Synthesis Kit

(Fermentas, Burlington, Canada). Then ACP-based differential display RT-PCR was carried

out using the predesigned arbitrary annealing control primer (Seegene, Seoul, Korea) (Kim

et al., 2004). First-strand cDNA synthesis was performed for 1.5 h at 42°C in a final reaction

volume of 20 μL containing purified total RNA, 3 μg; 4 μL of 5× reaction buffer; 5 μL of

dNTPs (each 2 mM); 2 μL of 10 mM cDNA synthesis primer dT-ACT1 (5′-

CTGTGAATGCTGCGACTACGATIIIII(T)18-3′, inosine [I]); 0.5 μL of Ribolock

ribonuclease inhibitor (40 U/μL) (Fermentas) and 1 μL of M-MLV reverse transcriptase (200

U/μL) (Fermentas). Synthesized first-strand cDNA samples were diluted by the addition of

80 μL of ultra-purified water. Polymerase chain reaction (PCR) amplification was conducted

using GeneFishing DEG kit (Seegene) in 20 μL reaction volumes containing 10 μL of 2×

SeeAmp ACP Master Mix; 2 μL of 5 μM each arbitrary ACP; 1 μL of 10 μM dT-ACP2 (5′-

CTGTGAATGCTGCGACTACGATIIIII(T)15-3′,); and 3 μL of diluted first-strand cDNA;

using a PTC-200 thermal cycler (Bio-Rad Laboratories, Hercules, USA). Each kit comprises

120 different arbitrary annealing control primers. PCR was carried out using the following

parameters: 1 cycle at 94°C for 5 min, 50°C for 3 min and 72°C for 1 min; 40 cycles at 94°C

for 40 s, 65°C for 40 s, 72°C for 40 s and 72°C for 5 min. The amplified PCR products were

separated in a 2% agarose gel and stained with ethidium bromide.

- 12 -

10. Cloning and sequence analysis

RT-PCR bands of interest were extracted and reamplified with each ACP used for

ACP-based differential display RT-PCR and an adapter primer (5′-

CTGTGAATGCTGCGACTACGAT- 3′). The reamplified PCR products were cloned into a

TA-cloning plasmid vector, pGEM-T Easy Vector (Promega, Madison, USA), according to

the manufacturer’s instructions. The cloned vectors were sequenced using an automatic

sequencer, ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, USA). Complete

sequences were analysed by similarity searching using the BLASTN and BLASTX programs

from the National Center for Biotechnology Information (NCBI) Web page

(http://www.ncbi.nlm.nih.gov/blast/).

11. Gene-specific quantitative real-time RT-PCR

To validate the results of ACP-based differential display and to determine the mRNA

expression level of target genes, quantitative real-time PCR was performed. Total RNAs

from cells were treated with RNase-free DNase I (Invitrogen) at room temperature for 15

min to avoid amplification of genomic DNA; denatured at 70°C for 10 min; and

subsequently reverse transcribed by Superscript II reverse transcriptase (Invitrogen) with 0.5

µg of oligo (dT)15-18 primer in a volume of 20 µl according to manufacturer instructions.

Primers for real-time PCR of the target genes were designed using Primer Express Software

(Applied Biosystems) and confirmed to be unique sequences against target genes. The

- 13 -

specific primers used were as follows: 5′-CACAGGGTGCCATGTACCG-3′ and 5′-

GAGGTCCTTGCCATACAGGG-3′ for mouse AnxA6; 5′-

GCTCTCCGCCGAAGTTAAGAA-3′ and 5′-TTCGCACAATATGATGCCGTC-3′ for

mouse Cnn3; 5′-CAATTTGCCCTCAGGGGTAAC-3′ and 5′-

TCCTCGGGAAAACCAGACTCA-3′ for mouse Col5a1; 5′-

GCTCCTGATTGGGGGACTCT-3′ and 5′-CCAACACGAAATACACGTTGAC-3′ for

mouse Col6a2; 5′-ACACTGGGCTTCATCATGCC-3′ and 5′-

ACTGCGAAGATCATCCTCAGG-3′ for mouse Gper; 5′-

CCCTGAAGACTCGGGCCTA-3′ and 5′-CAATTACAAGCGAAATGAGAGCC-3′ for

mouse Kitl; 5′-TGATCGAGGGCCGTCAGTTAT-3′ and 5′-

CTGTCACTCACCTTAAATTCCCC-3′ for mouse Myof; 5′-

AGCACCATCATCCCGGAATAC-3′ and 5′-GTACCAGGACTGGCTCGTTTG-3′ for

mouse Nfib; 5′-ACCGGACAGCTCGTTTTGG-3′ and 5′-

AGGGGACAGTACAAGTCACCC-3′ for mouse Scara5; 5′-

TGGAAACCATGATGCTTACGTT-3′ and 5′-GAAGCCCACTTTGCCATCTC-3′ for

mouse S100a10; 5′-GCTGCCTCCGAGTTCTACAG-3′ and 5′-

GCAGGGATTCGGTCACAGAG-3′ for mouse Eno1. To normalize the efficiency of real-

time RT-PCR reactions, the mouse Gadph gene was used as an internal standard with the

following primers: 5′-TGACCACAGTCCATGCCATC-3′ and 5′-

GACGGACACATTGGGGGTAG-3′. Real-time RT-PCR was performed using SYBR

Green PCR premix (Applied Biosystems). PCR reactions were performed in 20 µl of

reaction buffer containing 10 µl, 2× SYBR Green premix, 1 µl of forward and reverse

- 14 -

primers (5 pmole/µl), and 1µl of cDNA. The following amplification parameters were used:

15 min preincubation for hot start polymerase activation at 95°C, followed by 45

amplification cycles at 95°C for 20 sec, 62°C for 20 sec, and 72°C for 40 sec. After the end

of the last cycle, the melting curve was generated by starting fluorescence acquisition at

60°C, and taking measurements every 0.2°C until 95°C. All measurements were performed

in triplicate. All real-time measurements were performed using the ABI Prism 7500

Sequence Detection System (Applied Biosystems) and melting curve analysis performed for

each gene.

12. Protein extraction and Western blot analysis

Cells were lysed in cell lysis buffer (10 mM HEPES, pH 7.4, 150 mM NaCl)

supplemented with protease inhibitors (25 mg/mL PMSF, 2 mg/mL leupeptin and 5 mg/mL

aprotinin). Protein concentrations were measured using a commercial reagent (Bio-Rad

Laboratories), and 20~80 μg of each sample was separated in an 8% sodium dodecyl sulfate-

polyacrylamide gel. The gels were electroblotted onto a polyvinylidene difluoride membrane.

The membrane was blocked for 1 h with 5% (w/v) bovine serum albumin (BSA). Blots were

incubated with primary antibodies for 2 h and then for 1 h with horseradish peroxidase

(HRP)-conjugated secondary antibody, prior to development using an ECL western blotting

chemiluminescence detection system (iNtRON, Seoul, Korea). Antibodies used for

immunoblotting analysis were: rabbit anti-Annexin A6 (AnxA6) antibody (Abcam,

Cambridge, UK; 1:500 dilution), rabbit anti-collagen type VI alpha 2 (Col6a2) antibody

- 15 -

(Abcam, 1:500 dilution), rabbit anti-cleaved caspase-3 antibody (Cell Signaling, Boston,

USA; 1:500 dilution), rabbit anti-actin antibody (Santa Cruz Biotechnology, Santa Cruz,

USA; 1:5000 dilution) and HRP-conjugated goat anti-rabbit antibody (Santa Cruz

Biotechnology, 1:5000 dilution).

13. Ovariectomized (OVX) mouse model

The ovariectomized (OVX, n=10) and sham-operated (Sham, n=10) 8-weeks-old

female ddY mice were purchased from Shizuoka Laboratory Center Inc. (Hamamatsu,

Japan). Mice were maintained on a diet (5.0 g/day) of Formula-M07 (Feedlab Co., Ltd.,

Hanam, Korea) and tap water (15 ml/day). All mice were housed individually in clear plastic

cages under controlled temperature (23 ± 2°C), humidity (55 ± 5%), and illumination (12-

hour light/dark cycle). After 8 weeks of feeding, the bone mineral density (BMD) between

the two groups of mice was measured. The animal research protocol was approved by the

Animal Care and Use Committee of the Ajou University School of Medicine, and all

experiments were conducted in accordance with the institutional guidelines established by

the Committee.

14. Human subjects

The subjects from the Korean Association Resource (KARE) study which were used in

this study have been described in the previous report (Cho et al., 2009). Briefly, the

- 16 -

participants were recruited from two community-based epidemiological cohorts, the rural

community of Ansung and the urban community of Ansan cities. A total of 8842 participants

(4183 men and 4659 women) aged from 40 to 69 years were recruited. Among the women

participants, 855 subjects who had been treated with any kind of drugs and 234 subjects who

did not participate in the measurement of bone density were excluded, and the remaining

3570 women subjects were finally investigated in this study. The basic characteristics of the

study subjects are described in Table 5.

The bone density is used as a proxy measure for bone strength, resistance to fracture,

and is widely used to screen bones for osteoporosis. Bone density was estimated by T-score

by dividing the difference of measured speed of sound (SOS) from mean SOS in healthy

young adult population by the standard deviation of SOS in young adult population. Bone

SOS was measured by quantitative ultrasound at the distal radius and mid-shaft tibia, using

the Omnisense 7000P QUS (Sunlight Medical Ltd, Tel-Aviv, Israel). For the case-control

analysis of osteoporosis, the subjects whose bone density T-scores at either the distal radius

or mid-shaft tibia were less than -2.5 SD were allocated to case and the subjects whose bone

densities T-scores at both the distal radius and mid-shaft tibia were more than -1 SD were

allocated to control, according to the general diagnostic categories to be established for adult

women (Kanis et al., 1994). This study was approved by the institutional review board of the

Korean National Institute of Health. Written informed consent was obtained from all subjects.

- 17 -

15. Genotyping and selection of SNPs

The genotype data were provided by the Center for Genome Science, the Korea

National Institute of Health. The detailed genotyping and quality control processes have been

described in the previous report (Cho et al., 2009). Briefly, most DNA samples were isolated

from the peripheral blood of participants and genotyped using the Affymetix Genome-Wide

Human SNP array 5.0 (Affymetrix, Santa Clara, USA). The accuracy of the genotyping was

calculated by Bayesian Robust Linear Modeling using the Mahalanobis Distance (BRLMM)

genotyping algorithm (Rabbee and Speed, 2006). Samples that had lower genotyping

accuracies (≤ 98%), high missing genotype call rates (≥ 4%), high heterozygosity (> 30%) or

gender biases were excluded from this study. The SNPs in the seven genes that we analyzed

were selected based on their locations within the gene boundary (5 kb upstream and

downstream of the first and last exons, respectively) according to NCBI human genome

build 36 (Table 6). The locations of the SNPs were validated with the Ensemble BioMart

database (http://www.ensembl.org/biomart).

16. Statistical analysis

In the quantitative real-time RT-PCR analysis, all experiments were repeated at least 3

times unless stated otherwise and results were presented as the means ± SD as indicated.

Statistical significance between groups was calculated by a two-tailed Student’s t-test.

Probability values less than 0.05 (p < 0.05) were considered statistically significant.

- 18 -

Most statistical analyses for association analysis were performed using the PLINK

version 1.07 (http://pngu.mgh.harvard.edu/~purcell/plink) and PASW Statistics version 17.0

(SPSS Inc., Chicago, USA). In the association analysis, linear regression was used to analyze

BD-RT (bone density estimated by T-score at distal radius) and BD-TT (bone density

estimated by T-score at midshaft tibia) as quantitative traits in the final 3570 women subjects,

controlling for cohort and age as covariates. The SNPs selected were also analyzed in the

osteoporosis case-control (n=651 vs. 1711) study using logistic regression analysis. All

association tests were performed under the additive, dominant and recessive models, and p-

values were adjusted for multiple tests by using the Bonferroni-corrected significance level

(p < 0.00185). Standard statistical significance (p < 0.05) was determined by the two-tailed

Student’s t-test. The Haploview version 4.2 program (Whitehead Institute for Biomedical

Research, Cambridge, USA) was used to examine the structure of the linkage disequilibrium

(LD) block (Barrett et al., 2005) using the KARE genotype data and the HapMap database

(International HapMap Project, http://www.hapmap.org/). We examined the LD coefficient r2

between all pairs of biallelic loci (Hedrick, 1987).

- 19 -

III. RESULTS

A. In vitro and in vivo inhibition of glucocorticoid-induced

osteoporosis by the hexane extract of Poncirus trifoliata 1. Screening of the novel, effective natural sources on GIO

In order to discover novel natural sources effective against GIO, 68 edible Korean

native plants were screened. The Dex-induced apoptosis of osteoblastic cells through the

pathways involved in GC receptor and caspase activation were reported previously (Yun et

al., 2009). The inhibitory abilities of tested plants on Dex-induced apoptosis were compared

in osteoblastic cell line. Each of the plant extracts (50 μg/mL) was used to treat the

osteoblastic C3H10T1/2 cells, cotreated with 1 μM of Dex. The cells were cultured for 2

days and then the cell viability was determined by MTT assay (Table 1). Four plants that had

a protective effect against apoptosis were selected, and their activities in two osteoblastic cell

lines, C3H10T1/2 and MC3T3-E1, were further investigated. The inhibitory activities of the

extracts of the plants on Dex-induced apoptosis are summarized in Table 2. Three plants,

Poncirus trifoliata (L.), Schizandra chinensis and Ulmus davidiana, exhibited statistically

significant inhibitory effects on Dex-induced apoptosis in both cell lines, while Gardenia

jasminoides showed an inhibitory effect against apoptosis only in the MC3T3-E1 cell line.

Since three plants, except for Poncirus trifoliata (PT), have already been reported potentially

to inhibit osteoporosis in vitro (Ha et al., 2003; Suh et al., 2007; Caichompoo et al., 2009),

PT was selected as a final candidate and our study was focused on PT.

- 20 -

Table 1. Inhibitory effects of the extracts from 68 Korean plants against

dexamethasone (Dex)-induced apoptosis of osteoblastic C3H10T1/2 cell line

No. Plant name Viability (%) No. p name Viability (%)

Control 100.0

Dex 68.0

1 Achyranthes japonica a 62.2 35 Ginkgo biloba b 61.1

2 Actinidia arguta b 70.2 36 Glycyrrhiza uralensis a 71.6

3 Agaricus bisporus a 64.0 37 Juglans sinensis b 60.7

4 Allium cepa b 54.8 38 Lenttinula edodes a 55.3

5 Allium fistulosum b 65.6 39 Leonurus sibiricus b 62.8

6 Allium sativum b 62.2 40 Lindera strychnifolia b 68.7

7 Allium tuberosum b 61.8 41 Lithospemum erythorhizon b 60.6

8 Angelica gigas b 71.3 42 Lycium chinense a 55.3

9 Angelica keiskei a 72.9 43 Maackia amurensis b 48.0

10 Aralia cordata a 66.0 44 Morus bombycis a 68.6

11 Artemisa capillaris b 62.3 45 Osmanthus heterophylla b 62.2

12 Atractylodes japonica b 67.8 46 Panax ginseng b 68.2

13 Atractylodes macrocephala a 67.1 47 Phyllostachys bamusoides a 64.8

14 Capsella bursa-pastoris b 66.3 48 Perilla frutescens a 71.9

15 Caragana sinica b 58.8 49 Phaseolus radiatus a 70.5

16 Celastrus orbiculatus b 61.1 50 Phellinus linteus a 62.3

17 Cercidiphyllum japonicum b 71.4 51 Phlomis umbrosa b 56.3

18 Chaenomeles sinensis b 69.2 52 Pinus densiflora b 50.7

19 Clematis mandshurica a 69.2 53 Pinus koraiensis b 67.5

20 Cnidium officinale a 58.8 54 Poncirus trifoliata a 75.3

21 Coix lachryma-jobi b 55.0 55 Pueraria thunbergiana b 56.8

22 Cordyceps militaris a 60.5 56 Pyrus pyrifolia b 68.0

23 Coriolus versicolor a 68.5 57 Quercus mongolica b 62.9

24 Cornus officinalis b 70.6 58 Rehmannia glutinosa b 64.5

25 Curcuma longa a 67.2 59 Rubus coreanus b 67.1

- 21 -

26 Cuscuta chinensis a 66.2 60 Rumex crispus b 53.5

27 Daucus carota b 63.3 61 Schizandra chinensis a 84.9

28 Dictamnus dasycarpus b 64.2 62 Sorbus commixta b 58.8

29 Dioscorea quinqueloba b 69.4 63 Thea sinensis b 64.2

30 Diospyros kaki b 61.9 64 Trichosanthes kirilowii a 71.5

31 Elaeagnus macrophylla b 52.7 65 Ulmus davidiana b 89.7

32 Fraxinus rhychophylla a 60.5 66 Viscum album var. coloratum b 58.9

33 Ganoderma lucidum a 60.0 67 Zingiber officinale b 71.3

34 Gardenia jasminoides a 79.5 68 Zizyphus jujuba b 47.7

aEthanol or bmethanol extracts of 68 Korean native plants were gifts from the pharmaceutical

company, HL Genomics Co., Ltd (Yongin, Korea), and that were originally provided from the Korean

Plant Extract Bank (http://extract.pdrc.re.kr). Each of the 68 ethanol or methanol plant extracts (50

μg/ml) was used to treat the osteoblastic cell line, C3H10T1/2, cotreated with 1 μM of Dex. The cells

were cultured for 2 days and then cell viability was determined by MTT assay.

- 22 -

Table 2. Inhibition of dexamethasone-induced apoptosis of osteoblastic cells by the

extracts from the selected Korean plants

Plant name Viability (%)

C3H10T1/2 MC3T3-E1

Control 100.0 100.0

Dex (1 μM) 64.9 ± 6.1** 70.0 ± 0.6**

Gardenia jasminoides a 71.9 ± 9.3 100.2 ± 8.4##

Poncirus trifoliata a 77.4 ± 4.9# 80.9 ± 1.9##

Schizandra chinensis a 89.1 ± 13.8# 91.4 ± 4.2##

Ulmus davidiana b 104.2 ± 5.3## 92.2 ± 3.0##

The values are means ± SD. The concentration of each plant ethanol extract was 50 μg/ml. aEthanol

extract, b Methanol extract. ** p < 0.01: significantly different from the control. # p < 0.05, ## p < 0.01:

significantly different from Dex-only treatment.

- 23 -

2. In vitro inhibition of PT-H on Dex-induced apoptosis

The ethanol extract of PT was sequentially fractionated by n-hexane and water. The

inhibitory effect of each fraction was examined using the Dex-induced apoptosis model in

the osteoblastic C3H10T1/2 cell line. PT-H showed significant inhibitory effects, but not the

aqueous extract. For further detailed examination of the PT-H fraction, both C3H10T1/2 and

MC3T3-E1 were cotreated with each of three different concentrations of PT-H (10, 50 and

100 μg/mL) plus 1 μM of Dex, and after 48 h, the cell viabilities were determined by MTT

assay, TUNEL staining and caspase 3 cleavage test (Fig. 1). Dex significantly induced

apoptosis in both osteoblastic cell lines. PT-H protected against apoptotic cell death in both

cell lines; the significantly effective concentration of PT-H was 50 μg/mL. PT-H itself (50

μg/mL of PT-H in non-Dex-treated cells) did not influence cell viability in both cell lines

(Fig. 1A). These results indicate that increased osteoblastic cell viability by PT-H

cotreatment in Dex-treated cells resulted from inhibition of apoptosis rather than stimulation

of cell proliferation.

- 24 -

- 25 -

Fig. 1. Effect of Poncirus trifoliata hexane extract (PT-H) on Dex-induced apoptosis of

osteoblastic cells. (A) Two osteoblastic cell lines, C3H10T1/2 and MC3T3-E1, were treated

with 1 μM dexamethasone (Dex), cotreated with 1 μM Dex and the indicated concentration

of PT-H, or treated with 50 μg/ml of PT-H, cultured for 2 days, and then tested for effect of

PT-H on Dex-induced apoptosis by MTT assay (A), TUNEL staining (B) and Caspase-3

cleavage test (C). For the Caspase-3 cleavage test, cells were lysed in cell lysis buffer and

protein samples (80 µg) were used for Western blot analysis. Actin was used as the internal

control. The values shown are the means ± SD from 3 independent experiments. ** p < 0.01

vs. control, # p < 0.05 vs. Dex.

- 26 -

3. Inhibitory effect of PT-H on an in vivo GIO model

Next, the effects of PT-H were examined in vivo. To avoid the confounding effects of

female sex hormones, only male mice were used. The GIO-model mice were generated by

subcutaneous implantation of slow-release PD pellets (5 mg) for 4 weeks. The sham group of

seven mice was not treated with PD. Three groups of seven implanted mice each either

received daily PT-H extracts, SrCl2 (positive control), or nothing additional for an another 4

weeks, and then whole-body BMDs of the mice were determined using a PIXI-mus bone

densitometer (Fig. 2). All mice had similar initial body weights, and after 8 weeks, the rates

of mouse weight gain were not significantly different between the three groups. Furthermore,

throughout the 8-week experiment, no other abnormal clinical findings except osteoporosis

were seen in any of the mice. The mouse group treated with PD treatment (PD group)

revealed a significant reduction in BMD (approximately 3.8-fold) compared with the non-PD

treated mice group (sham). The positive controls treated with SrCl2 after PD treatment

(PD+SrCl2 group) showed an approximately 4.6-fold increase in BMD compared with the

PD group.

Surprisingly, the group treated with PT-H after PD treatment (PD+PT-H group)

exhibited significantly increased BMD (approximately 6.8-fold) compared with the PD

group. In addition, the BMD of the PD+PT-H group was approximately 4.8-fold higher than

the BMD of the sham group, indicating that PT-H may function not only to prevent BMD

reduction induced by PD, but also stimulates bone formation. The in vivo results suggest that

PT-H is more effective (approximately 2.2-fold) in GIO-mice than SrCl2.

- 27 -

Fig. 2. Effect of Poncirus trifoliata hexane extract (PT-H) on the bone mineral density

(BMD) of mice treated with glucocorticoid. After 4 weeks of subcutaneous prednisolone

(PD) implantation, mice (7 mice/group) were fed either an experimental diet containing PT-

H extracts (100 mg/kg/day) (PD+PT-H), water containing strontium chloride (1,800

mg/kg/day) (PD+ SrCl2) or neither of them (PD) for 4 weeks. Sham represents mice with no

PD treatment. Whole-body BMD was measured using on-board PIXI-mus software for small

animals, and adjusted for mouse body weight. Results are expressed as percentage of change

of whole-body BMD adjusted for body weight. ** p < 0.01 vs. Sham, ## p < 0.01 vs. PD, ++ p

< 0.01 vs. PD+SrCl2.

- 28 -

4. Screening and identification of DEGs in Dex-induced

osteoblastic cells with and without PT-H treatment

In order to clarify the molecular mechanisms behind the effect of PT-H on GIO, a

whole genome expression comparison study was performed. Differentially expressed genes

(DEGs) were screened and identified in Dex-induced osteoblastic cells with and without PT-

H treatment, using a gene expression differential display, the ACP-based PCR GeneFishing

DEG screening method (Kim et al., 2004). Two cell lines, C3H10T1/2 and MC3T3-E1, were

treated with dimethyl sulfoxide (DMSO) alone (control), 1 μM of Dex alone, or 1 μM of Dex

plus 50 μg/mL PT-H for 2 days. Total RNAs were isolated from the cells and used for first-

strand cDNA synthesis. The first-strand cDNAs were subjected to gene expression analysis.

Using 120 arbitrary ACP primers, GeneFishing DEG screening was performed and a total of

eight DEGs were found with clear differences in the three treatment groups. Figure 3 shows

the gel images for the eight DEGs, four DEGs in C3H10T1/2 cells and four DEGs in

MC3T3-E1 cells. All eight DEGs had increased mRNA expression levels in the Dex-treated

cells compared with the controls, and the levels decreased in cells cotreated with PT-H,

suggesting that mRNA expression of the DEGs may be controlled by PT-H.

To identify the DEGs, the RT-PCR bands were extracted, reamplified and PCR

fragments were isolated from gels and cloned and sequenced. BLASTN and BLASTX

searches in the NCBI GenBank revealed that all eight DEGs were known genes as listed in

Table 3. Interestingly, two DEGs screened from two different cell lines, DEGs 2 and 6 and

DEGs 3 and 7, were the same genes, AnxA6 and Col6a2, respectively.

- 29 -

Fig. 3. Differential banding patterns of the 8 identified differentially-expressed genes

(DEGs). Two osteoblastic cell lines, C3H10T1/2 (A) and MC3T3-E1 (B), were treated with

1 μM DMSO (C), 1 μM dexamethasone (Dex) (D) or 1 μM Dex plus 50 μg/ml of Poncirus

trifoliata hexane extract (D+PT-H), and then cultured for 2 days. Annealing control primer

(ACP)-based RT-PCR was performed on the total RNAs isolated from the treated cells, and

RT-PCR products were resolved on 2% agarose gels and visualized by staining with

ethidium bromide. The ACP primer numbers are indicated at the bottom of the image of each

gel. The arrows with a number indicate DEGs.

- 30 -

Table 3. List of significantly differentially-expressed genes (DEGs) in osteoblastic cells

with and without Poncirus trifoliata hexane extract (PT-H) treatment

DEG Expression level Gene GenBank Gene definition

No. C D D+PT-H symbol Accession No.

(A) C3H10T1/2 Cell line

1 + ++ + Gper NM_029771 G protein-coupled estrogen receptor 1

2 + ++ + AnxA6 NM_013472 Annexin A6

3 + ++ + Col6a2 NM_146007 Collagen type VI alpha 2

4 + ++ + Cnn3 NM_028044 Calponin 3

(B) MC3T3-E1 Cell line

5 + ++ + Scara5 NM_028903 Scavenger receptor class A member 5

6 + ++ + AnxA6 NM_013472 Annexin A6

7 + ++ + Col6a2 NM_146007 Collagen type VI alpha 2

8 + ++ + Kitl NM_013598 Stem cell growth factor, kit ligand

C, control; D, dexamethasone; D+PT-H, dexamethasone plus hexane extract of Poncirus trifoliata

- 31 -

5. Validation of the identified DEGs by real-time RT-PCR and

Western blot analysis

To confirm the efficacy and accuracy of screening by ACP-based differential display

RT-PCR, fluorescence monitored quantitative real-time RT-PCR analysis was employed.

Gene-specific primers were designed to amplify RT-PCR products ranging from 100 to 250

bp. Quantitative real-time RT-PCR results of the eight DEGs are shown in Fig. 4, and

presented as relative ratios compared with the mouse Gapdh gene control with a value of 1.0.

The mRNA expression levels of six genes, Gper, AnxA6, Col6a2, Cnn3, Scara5 and Kitl,

were increased significantly in the Dex-treated cells compared with the controls, but the

mRNA levels were decreased in the Dex-plus-PT-H treated cells. These results are consistent

with the results of ACP-based differential-display RT-PCR, demonstrating the efficacy and

accuracy of GeneFishing DEG screening.

Two genes, AnxA6 and Col6a2, were selected for further study because they were both

identified in the two cell lines and their mRNA expression levels were highly influenced by

PT-H treatment. To further confirm AnxA6 and Col6a2 expression levels at the protein level,

western blot analysis was performed using specific antibodies (Fig. 5). In both cell lines, the

expression levels of annexin A6 (AnxA6) and collagen type VI alpha 2 (Col6a2) were

significantly increased in Dex-treated cells, but significantly decreased almost to the control

level in Dex-plus-PT-H-cotreated cells. Together with real-time RT-PCR results, western

blot analysis demonstrated that at least two genes, AnxA6 and Col6a2, are involved in PT-H

inhibition of Dex-induced apoptosis in osteoblastic C3H10T1/2 cells.

- 32 -

Fig. 4. Validation of 8 identified differentially-expressed gene (DEG) mRNAs by

quantitative real-time RT-PCR analysis. Real-time RT-PCR was performed using the

same total RNAs as in Fig. 3. The mRNA expression level for each gene was quantified and

the data represent the relative ratio of dexamethasone-treated samples (Dex) and Dex-plus-

Poncirus trifoliata hexane extract-(PT-H)-cotreated samples (Dex+PT-H) compared to

DMSO-only-treated samples (control) in C3H10T1/2 (A) and MC3T3-E1 (B) cell lines. The

Dex-insensitive housekeeping gene, Gapdh, was used for plotting the relative standard curve

(internal control). Each experiment was repeated 3 times.

*p < 0.05, **p < 0.01 vs. control; # p < 0.05, ## p < 0.01 vs. Dex.

- 33 -

(A)

(B)

Fig. 5. Validation of 2 representative differentially-expressed genes (DEGs), AnxA6 and

Col6a2, at the protein level by Western blot analysis. Two osteoblastic cell lines,

C3H10T1/2 (A) and MC3T3-E1 (B), were treated with 1 μM DMSO (Control), 1 μM

dexamethasone (Dex), 1 μM Dex plus 50 μg/ml of Poncirus trifoliata hexane extract

(Dex+PT-H), or 50 μg/ml PT-H (PT-H), and then cultured for 2 days. Cells were lysed in

cell lysis buffer and protein samples (20 µg) were used for Western blot analysis. Actin was

used as the internal control. Western blots of 3 independent experiments were quantified and

normalized to actin. * p < 0.05 vs. control, # p < 0.05 vs. Dex.

- 34 -

6. Effect of PT-H on the expression of AnxA6 in GIO-mice

The study investigated whether PT-H changed the in vivo expression levels of two

gene proteins, AnxA6 and Col6a2, using western blot analysis. After BMD was measured,

the mice were killed and the bones and skeletal muscles of the lower limbs were isolated and

used for western blot analysis (Fig. 6). In bones, the expression level of AnxA6 was

significantly increased in the PD group compared with the sham group, but the expression of

AnxA6 was dramatically decreased in the PD + PT-H group compared with the PD group.

Col6a2 was not detected in bones for unknown reasons. In contrast, in skeletal muscles, the

expression levels of AnxA6 were similar among the three treatment groups. These results

indicate that PT-H influences the change in AnxA6 expression level in bones, but not in

skeletal muscles of PD-induced GIO-mice, suggesting that AnxA6 plays a key role in the in

vivo inhibition of GIO by PT-H.

- 35 -

(A)

(B)

Fig. 6. Effect of Poncirus trifoliata hexane extract (PT-H) on the expression of AnxA6 in

GIO-mice. Western blotting of AnxA6 and Col6a2 was performed using protein samples (80

µg) isolated from bone (A) and skeletal muscle (B) of the same mice used in Fig. 2. Mean

band intensities of 3 representative mice from each group were calculated. Actin was used as

an internal control. * p < 0.05 vs. Sham, # p < 0.05 vs. PD.

- 36 -

B. Genetic association between single nucleotide polymorphisms in

the ANXA6 gene and bone density/osteoporosis

1. Study design

The flow chart of the study design is shown in Fig. 7. We carried out a series of

experiments on cell line model, mouse model and humans step-by-step for identifying novel

genes for susceptibility to osteoporosis. The first experiment was the screening and

identification of the differentially expressed genes (DEGs) in dexamethasone (Dex)-treated

osteoblastic MC3T3-E1 cell line, using a RT-PCR-based gene expression differential display

approach, the ACP-based PCR GeneFishing DEG screening method. Next, the identified

DEGs were validated by quantitative real-time PCR with the gene-specific primers in the

Dex-treated cells. In the next step, we tried to evaluate the accuracy of the identified DEGs

in vivo, and carried out quantitative real-time PCR with the gene-specific primers in the

ovariectomized mice. Lastly, in order to determine whether the genetic variations of the

selected DEGs were associated with bone density and osteoporosis, we performed

association analysis in a large Korean Women’s Cohort (n= 3570).

- 37 -

Fig. 7. The flow chart of the study.

- 38 -

2. Screening and identification of the DEGs in Dex-treated

osteoblastic cell line model

To identify the differentially expressed genes (DEGs) in the in vitro osteoporosis

model, we performed a whole-genome comparative expression study using a RT-PCR based

gene expression differential display, the Annealing control primer (ACP)-based PCR

GeneFishing DEG screening method (Kim et al., 2004). To establish an in vitro osteoporosis

model, mouse osteoblastic cell line, MC3T3-E1, was treated with 1 μM of synthetic

glucocorticoid, dexamethasone (Dex) for 2 days. The cells were cultured for 2 days and then

cell viability and cell apoptosis were analyzed by the MTT assay and TUNEL assay,

respectively (Fig. 8). Dex-induced apoptosis in MC3T3-E1 cells was confirmed. Total RNAs

were isolated from the cells and used for first-strand cDNA synthesis. The first-strand

cDNAs were subjected to gene expression differential display.

Using 120 arbitrary ACP primers, GeneFishing DEG screening was performed and a

total of 10 DEGs that showed clear differences between the two treatment groups were found.

Fig. 9 shows the gel images for the 10 DEGs; 9 DEGs had increased mRNA expression

levels in the Dex-treated cells compared with the controls and 1 DEG showed decreased

mRNA expression level in the Dex-treated cells.

To identify the DEGs, the RT-PCR bands were extracted, re-amplified, and PCR

fragments were isolated from gels, cloned and sequenced. BLASTN and BLASTX searches

in the NCBI GenBank revealed that all the 10 DEGs were known genes as listed in Table 4.

The expression levels of Annexin A6 (AnxA6), Calponin 3 (Cnn3), Collagen type V alpha 1

- 39 -

(Col5a1), Collagen type VI alpha 2 (Col6a2), Kit ligand (Kitl), Myoferlin (Myof), Nuclear

factor I/B (Nfib), Scavenger receptor class A member 5 (Scara5), and S100 calcium binding

protein A10 (S100a10), were increased in the Dex-treated cells, however the expression

level of Enolase 1 (Eno1) was decreased in the Dex-treated cells.

- 40 -

Fig. 8. Effect of dexamethasone on apoptosis in mouse osteoblastic MC3T3-E1 cell line.

MC3T3-E1 cells were treated with 1 μM dexamethasone (Dex) or 1×PBS (control), cultured

for 2 days, and then tested for the effect of Dex on apoptosis by the MTT assay (A) and

TUNEL staining (B). The values shown are the means ± SD from three independent

experiments. ** p < 0.01 vs. control.

- 41 -

Fig. 9. Differential banding patterns of the 10 identified differentially expressed genes

(DEGs). The arrows with the gene name indicate the up-regulated (A) or down-regulated (B)

DEGs in the Dex-treated cells compared to untreated control cells. Osteoblastic MC3T3-E1

cell line was treated with 1×PBS (Con) or 1 μM dexamethasone (Dex), and then cultured for

2 days. Annealing control primer (ACP)-based RT-PCR was performed on the total RNAs

isolated from the treated cells, and RT-PCR products were resolved on 2% agarose gels and

visualized by staining with ethidium bromide.

- 42 -

Table 4. List of the significantly differentially expressed genes (DEGs) in the

dexamethasone-treated mouse MC3T3-E1 cells

DEG Expression level Gene

symbol

GenBank

Accession No. Gene definition

No. Con Dex

(A) Up-regulation

1 + ++ AnxA6 NM_013472 Annexin A6

2 + ++ Cnn3 NM_028044 Calponin 3

3 + ++ Col5a1 NM_015734 Collagen, type V, alpha 1

4 ++ +++ Col6a2 NM_146007 Collagen, type VI, alpha 2

5 + ++ Kitl NM_013598 Kit ligand

6 + +++ Myof NM_177035 Myoferlin

7 + ++ Nfib NM_008687 Nuclear factor I/B

8 + +++ Scara5 NM_028903 Scavenger receptor class A, member 5

9 + +++ S100a10 NM_009112 S100 calcium binding protein A10

(B) Down-regulation

10 +++ ++ Eno1 NM_023119 Enolase 1

Abbreviations: Con, Control; Dex, dexamethasone

- 43 -

3. Validation of the identified DEGs in the cell line model by

quantitative real-time RT-PCR

To confirm the efficacy and accuracy of screening by the ACP-based differential

display RT-PCR, fluorescence-monitored quantitative real-time RT-PCR analysis was

employed for the 10 genes. Gene-specific primers were designed to amplify RT-PCR

products ranging from 100 to 250 bp. Quantitative real-time RT-PCR results of the 10 genes

are shown in Fig. 10, and are presented as relative ratios compared with the mouse Gapdh

gene (internal control) with a value of 1.0. The mRNA expression levels of 8 genes, AnxA6,

Col5a1, Col6a2, Kitl, Myof, Nfib, Scara5 and S100a10, were increased significantly in the

Dex-treated cells compared with the controls, and Eno1 gene expression was decreased

significantly, thereby indicating that these results are consistent with the results of ACP-

based differential display shown in Fig. 9. The expression level of the Cnn3 gene, however,

was not different between the Dex-treated and untreated cells.

- 44 -

Fig. 10. Validation of the mRNA expression levels of the 10 DEGs in the Dex-treated

MC3T3-E1 cells by quantitative real‐time RT‐PCR. Real-time RT-PCR was performed

using the same total RNAs as in Fig. 9. The mRNA expression level for each gene was

quantified and the data represents the relative ratio of dexamethasone-treated samples (Dex)

compared to 1× PBS-treated samples (Con) in MC3T3-E1 cells. The Dex-insensitive

housekeeping gene, Gapdh, was used for plotting the relative standard curve (internal

control). Each experiment was repeated three times. *p < 0.05, **p < 0.01 vs. control.

- 45 -

4. Evaluation of the identified DEGs in the ovariectomized mouse

model by quantitative real-time RT-PCR

To evaluate the accuracy of the identified DEGs in vivo, we carried out comparative

analysis of gene expression levels in the identified DEGs between the ovariectomized

(OVX) mice group and sham-operated (Sham) control mice group. Each of the ten 8-week-

old female OVX and sham ddY mice was purchased and maintained in our laboratory for 4

weeks. Five OVX mice died during maintenance. At 16 weeks after ovariectomy, whole-

body BMD of the 10 sham mice and 5 OVX mice was calculated using a PIXI-mus bone

densitometer (Fig. 11). The OVX mice group demonstrated a significant reduction in BMD

(approximately 1.5 fold) compared with the sham-operated mice group. Then the mice were

sacrificed, and the femur bones were excised and frozen in liquid nitrogen. Total RNAs were

isolated from the frozen samples.

The mRNA expression levels of the identified DEGs were examined using the in vivo

samples by fluorescence-monitored quantitative real-time RT-PCR analysis. The expression

levels of 7 genes, AnxA6, Col5a1, Col6a2, Eno1, Kitl, Myof, and Scara5, among the 10

identified DEGs were significantly altered in the OVX group compared with the sham group,

but the expression level of Nfib and S100a10 genes were not significantly different between

the groups. These results suggested that these 7 genes may be involved in the development

of osteoporosis in the OVX mice model.

- 46 -

Fig. 11. Comparison of the bone mineral density and the mRNA expression levels of the

10 DEGs between the sham and ovariectomized mice. (A) Whole-body BMD was

measured in the ovariectomized (OVX) or sham-operated control (Sham) mice (10 mice per

group) using on-board PIXI-mus software for small animals, and adjusted for the mouse

body weight. Results are expressed as a percentage change of whole-body BMD adjusted for

body weight (mean ± SD). **p < 0.01 vs. Sham mouse group. (B) Real-time RT-PCR was

performed using the total RNAs from the two mouse groups. The mRNA expression level

for each gene was quantified and the data represents the relative ratio of OVX mice

compared to Sham mice. The housekeeping gene, Gapdh, was used for plotting the relative

standard curve (internal control). Each experiment was repeated three times. *p < 0.05, ** p <

0.01 vs. Sham mouse group.

- 47 -

5. Association analysis of the genetic variation in the identified

DEGs with bone density and osteoporosis in humans

We finally selected the 7 genes, AnxA6, Col5a1, Col6a2, Eno1, Kitl, Myof, and Scara5

that were evaluated both in the in vitro and in vivo osteoporosis models, as the target genes

for further study in human subjects. To investigate whether the genetic variations in these 7

selected genes influenced the bone density and susceptibility to osteoporosis, we performed

the quantitative trait analysis for bone density and osteoporosis case-control analysis for the

SNPs of the 7 genes in the Korean Association Resource (KARE) Women’s Study Cohort

(3570 subjects). The basic characteristics of the study subjects are shown in Table 5. The

mean age of the women subjects was 51.02 years, the mean BD-RT (bone density estimated

by T-score at the distal radius) was 0.20±1.55, and the mean BD-TT (bone density estimated

by T-score at the midshaft tibia) was -0.81±1.55 (Table 5). Linear regression analysis was

used to associate the genotypes with bone density traits, controlling for age and cohort as

covariates. The 116 single nucleotide polymorphisms (SNPs) were genotyped in the 7 genes

(Table 6). The genotyped 116 SNPs of the 7 genes were partitioned into a total 27 linkage

disequilibrium (LD) blocks, which was demonstrated by the Haplotype and PLINK program

using the KARE data. Therefore, the Bonferroni-corrected significance p-value threshold

was calculated as 0.00185 (0.05/27 LD blocks).

The results of association analysis between the 116 SNPs in the 7 genes and bone

density in the 3570 KARE women subjects are summarized in Table 7. Total 12 SNPs in the

4 genes (2 SNPs in ANXA6, 3 SNPs in COL5A1, 6 SNPs in MYOF and 1 SNP in SCARA5)

- 48 -

were significantly associated with BD-RT trait, and total 28 SNPs in the 5 genes (4 SNPs in

ANXA6, 6 SNPs in COL5A1, 3 SNPs in ENO1, 9 SNPs in MYOF and 6 SNPs in SCARA5)

were significantly associated with BD-TT trait. Particularly, 1 SNP, rs868641 in the ANXA6

gene and 2 SNPs, rs7875570 and rs6537942 in the COL5A1 gene showed a highly

significant association with BD-TT trait and their p-values satisfied the Bonferroni-corrected

significance level (p < 0.001852).

For osteoporosis case-control association analysis, the control subjects (n=1711) and

osteoporosis case subjects (n=651) were analyzed. The results of case-control association

analysis between the 116 SNPs in the 7 genes and osteoporosis in the KARE women subjects

are summarized in Table 8. Total 14 SNPs in 5 genes (1 SNP in ANXA6, 6 SNPs in COL5A1,

1 SNP in ENO1, 4 SNPs in MYOF and 2 SNPs in SCARA5) were significantly associated

with osteoporosis.

Notably, 8 SNPs in the 5 genes (1 SNP in ANXA6, 1 SNP in COL5A1, 1 SNP in ENO1,

4 SNPs in MYOF and 1 SNP in SCARA5) were significantly associated with both the bone

density and osteoporosis traits (Tables 7 and 8). In all the 8 SNPs, their β-values in BD-RT

and BD-TT traits were in the same direction and showed consistent trends with the odds

ratios of osteoporosis. The location and basic LD of the analyzed SNPs in the ANXA6,

COL5A1, MYOF and SCARA5 genes are shown in Fig. 12. The SNPs that were significantly

associated with bone density and/or osteoporosis in the KARE women subjects are also

indicated. Interestingly, the 4 SNPs in the MYOF gene showing a significant association with

both bone density and osteoporosis were located in the same LD block of the gene (Fig. 12C).

- 49 -

Table 5. Basic characteristics of the women subjects in the KARE study cohort

Characteristics Quantitative analysis

for bone density

Case-control analysis for osteoporosis

Control Case p value*

no. 3570 1711 651

Age (year) 51.02 ± 8.76 47.20 ± 6.57 59.46 ± 7.34 < 0.0001

BMI (kg/m2) 24.65 ± 3.19 24.20 ± 2.96 25.37 ± 3.51 < 0.0001

Distal Radius T score 0.20 ± 1.55 0.99 ± 1.14 -1.26 ± 1.64 < 0.0001

Midshaft Tibia T score -0.81 ± 1.55 0.31 ± 0.93 -3.11 ± 0.99 < 0.0001

Osteoporosis was defined as any bone density T score of -2.5 SD or below and control was defined as

both bone densities T-score of -1 SD over. *Significant differences in characteristics between the

control and case were determined by the two-tailed Student’s t-test. Abbreviation: BMI, body mass

index; KARE, Korean Association REsource.

- 50 -

Table 6. Information on the SNPs in the seven analyzed genes

Gene Symbol

(gene name,

location)

No. SNP Position, bp Minor allele MAF Position within the gene

ANXA6 (Annexin A6, 5q32-q34)

1 rs7707871 150458487 A 0.142 DOWNSTREAM

2 rs17728338 150458511 T 0.095 DOWNSTREAM

3 rs868641 150465434 T 0.283 INTRONIC

4 rs4958893 150467184 A 0.283 INTRONIC

5 rs4958895 150467388 T 0.331 INTRONIC

6 rs7716383 150481440 T 0.098 INTRONIC

7 rs3792774 150483570 G 0.450 INTRONIC

8 rs10037814 150485709 A 0.240 INTRONIC

9 rs17659056 150485866 A 0.062 INTRONIC

10 rs9324676 150493483 T 0.085 INTRONIC

11 rs3815725 150498725 T 0.189 INTRONIC

12 rs2228458 150499181 G 0.485 SYNONYMOUS_CODING

13 rs13185827 150502813 C 0.087 INTRONIC

14 rs883887 150503356 G 0.310 INTRONIC

15 rs6871624 150505343 C 0.091 INTRONIC

16 rs4958899 150508292 G 0.091 INTRONIC

17 rs6859236 150515837 A 0.220 INTRONIC

18 rs1030199 150517822 A 0.083 UPSTREAM

COL5A1 (Collagen, type V, alpha 1, 9q34.2-q34.3)

1 rs7875570 136678649 A 0.054 INTRONIC

2 rs10858265 136683695 C 0.055 INTRONIC

3 rs4335205 136692219 G 0.430 INTRONIC

4 rs6537942 136699377 G 0.089 INTRONIC

5 rs10858270 136726337 A 0.493 INTRONIC

6 rs3922982 136726816 C 0.071 INTRONIC

7 rs6537946 136734315 A 0.082 INTRONIC

8 rs4319175 136736092 G 0.369 INTRONIC

- 51 -

9 rs7848938 136736205 A 0.286 INTRONIC

10 rs11103479 136750244 A 0.411 INTRONIC

11 rs3109684 136751707 A 0.460 INTRONIC

12 rs12004951 136752105 G 0.399 INTRONIC

13 rs9409917 136755895 G 0.065 INTRONIC

14 rs10115005 136771257 T 0.360 INTRONIC

15 rs12684637 136773364 A 0.361 INTRONIC

16 rs7849193 136790645 C 0.320 INTRONIC

17 rs11103505 136793446 G 0.292 INTRONIC

18 rs11103507 136793484 A 0.292 INTRONIC

19 rs10858278 136793557 T 0.291 INTRONIC

20 rs12005720 136817841 G 0.127 INTRONIC

21 rs10776906 136831910 A 0.230 INTRONIC

22 rs11103535 136840820 T 0.144 INTRONIC

23 rs7874142 136844603 A 0.471 INTRONIC

24 rs3811149 136848624 C 0.470 INTRONIC

25 rs10858284 136853470 A 0.148 INTRONIC

26 rs9308278 136856967 G 0.254 INTRONIC

27 rs4842173 136857934 C 0.253 INTRONIC

28 rs4504708 136876365 C 0.389 3PRIME_UTR

29 rs3124937 136877931 G 0.387 DOWNSTREAM

COL6A2 (Collagen, type VI, alpha 2, 21q22.3)

1 rs4819202 46351697 A 0.047 INTRONIC

2 rs4819203 46351936 G 0.131 INTRONIC

3 rs2839109 46360608 T 0.353 INTRONIC

ENO1 (Enolase 1, alpha, 1p36.2)

1 rs10864368 8840900 A 0.115 DOWNSTREAM

2 rs11121247 8841382 T 0.067 DOWNSTREAM

3 rs6660137 8855829 G 0.067 INTRONIC

KITLG (Kit ligand, 12q22)

1 rs1472899 87475616 C 0.339 INTRONIC

2 rs3782179 87477457 G 0.339 INTRONIC

3 rs3782180 87477530 C 0.339 INTRONIC

- 52 -

4 rs3782181 87477692 G 0.339 INTRONIC

5 rs4474514 87478090 G 0.339 INTRONIC

6 rs11104952 87480531 A 0.339 INTRONIC

7 rs1798011 87480756 A 0.020 INTRONIC

8 rs1352947 87484858 G 0.339 INTRONIC

9 rs10777129 87485844 T 0.338 INTRONIC

MYOF (Myoferlin, 10q24)

1 rs2797581 95060070 C 0.108 INTRONIC

2 rs787665 95062526 G 0.109 INTRONIC

3 rs787667 95063036 T 0.109 INTRONIC

4 rs787668 95063249 A 0.109 INTRONIC

5 rs1614065 95087527 A 0.052 INTRONIC

6 rs1891565 95088484 C 0.052 INTRONIC

7 rs4917747 95092192 T 0.164 INTRONIC

8 rs787695 95092211 T 0.052 INTRONIC

9 rs11187389 95092649 C 0.163 INTRONIC

10 rs787633 95109238 T 0.037 INTRONIC

11 rs787622 95126940 A 0.146 INTRONIC

12 rs10882229 95129516 A 0.186 INTRONIC

13 rs701863 95152238 G 0.350 INTRONIC

14 rs1617402 95157731 C 0.318 INTRONIC

15 rs10430653 95159046 G 0.331 INTRONIC

16 rs17108637 95161527 A 0.332 INTRONIC

17 rs701878 95162878 T 0.331 INTRONIC

18 rs788086 95168236 T 0.310 INTRONIC

19 rs7909892 95187051 C 0.071 INTRONIC

20 rs766083 95193394 T 0.220 INTRONIC

21 rs788104 95199686 A 0.226 INTRONIC

22 rs17108718 95211770 G 0.259 INTRONIC

23 rs17108751 95219488 A 0.254 INTRONIC

24 rs7911195 95221170 A 0.261 INTRONIC

25 rs7913298 95223365 G 0.026 INTRONIC

26 rs871427 95223383 C 0.499 INTRONIC

- 53 -

27 rs2004558 95224472 C 0.478 INTRONIC

28 rs17108780 95224963 C 0.236 INTRONIC

29 rs7921092 95233798 T 0.262 UPSTREAM

SCARA5 (Scavenger receptor class A, member 5 (putative), 8p21.1)

1 rs10090925 27781432 G 0.374 DOWNSTREAM

2 rs6558023 27787698 G 0.272 INTRONIC

3 rs11778759 27796156 T 0.347 INTRONIC

4 rs11774576 27796336 G 0.425 INTRONIC

5 rs10092001 27796794 G 0.347 INTRONIC

6 rs4276642 27797075 G 0.355 INTRONIC

7 rs10090871 27800283 C 0.078 INTRONIC

8 rs2726959 27805263 T 0.298 INTRONIC

9 rs7002829 27814295 A 0.122 INTRONIC

10 rs7002838 27814310 G 0.077 INTRONIC

11 rs2726985 27818521 G 0.430 INTRONIC

12 rs2859667 27832922 C 0.386 INTRONIC

13 rs11136019 27837517 C 0.378 INTRONIC

14 rs4732792 27843228 A 0.381 INTRONIC

15 rs2685313 27848981 C 0.383 INTRONIC

16 rs4496925 27853141 C 0.422 INTRONIC

17 rs2726955 27853293 C 0.400 INTRONIC

18 rs2726948 27865306 A 0.194 INTRONIC

19 rs2726943 27873403 A 0.193 INTRONIC

20 rs2726941 27878513 A 0.398 INTRONIC

21 rs2726940 27879787 T 0.195 INTRONIC

22 rs2685399 27880817 C 0.386 INTRONIC

23 rs17393091 27881479 G 0.011 INTRONIC

24 rs2726934 27882821 T 0.395 INTRONIC

25 rs2727006 27888085 A 0.394 INTRONIC

Abbreviations: MAF, minor allele frequency.

- 54 -

Table 7. The results of association analysis between the SNPs in the seven genes and

bone density in the KARE women subjects

Gene

SNP Minor MAF Women (n=3,570)

allele beta±s.e.m. Add p beta±s.e.m. Dom p beta±s.e.m. Rec p

BD-RT ( T-score at distal radius)

ANXA6 rs3815725 T 0.189 0.005 ± 0.04 0.895 0.043 ± 0.05 0.360 -0.244 ± 0.12 0.048

rs883887 G 0.310 0.038 ± 0.03 0.267 0.091 ± 0.05 0.044 -0.076 ± 0.08 0.326

COL5A1 rs6537946 A 0.082 0.120 ± 0.06 0.041 0.125 ± 0.06 0.043 0.196 ± 0.29 0.505

rs7874142 A 0.471 0.041 ± 0.03 0.194 -0.039 ± 0.05 0.439 0.162 ± 0.05 2.5E-03

rs3811149 C 0.470 0.032 ± 0.03 0.313 -0.042 ± 0.05 0.406 0.140 ± 0.05 9.4E-03

MYOF rs1614065 A 0.052 -0.007 ± 0.07 0.925 -0.021 ± 0.07 0.775 1.553 ± 0.77 0.045

rs1891565 C 0.052 -0.006 ± 0.07 0.931 -0.021 ± 0.07 0.780 1.553 ± 0.77 0.045

rs787695 T 0.052 -0.007 ± 0.07 0.923 -0.021 ± 0.07 0.772 1.553 ± 0.77 0.045

rs787633 T 0.037 0.013 ± 0.08 0.875 -0.005 ± 0.09 0.951 1.553 ± 0.77 0.045

rs17108751 A 0.254 -0.067 ± 0.04 0.079 -0.091 ± 0.05 0.046 -0.024 ± 0.10 0.811

rs871427 C 0.499 0.056 ± 0.03 0.086 0.038 ± 0.05 0.475 0.109 ± 0.05 0.038

SCARA5 rs11778759 T 0.347 0.067 ± 0.03 0.044 0.089 ± 0.05 0.051 0.083 ± 0.07 0.224

BD-TT (T-score at midshaft tibia)

ANXA6 rs17728338 T 0.095 -0.146 ± 0.06 8.6E-03 -0.128 ± 0.06 0.032 -0.707 ± 0.25 4.6E-03

rs868641 T 0.283 0.112 ± 0.04 1.6E-03 0.141 ± 0.05 2.0E-03 0.142 ± 0.08 0.086

rs4958893 A 0.283 0.104 ± 0.04 3.5E-03 0.136 ± 0.05 2.7E-03 0.112 ± 0.08 0.177

rs4958895 T 0.331 0.073 ± 0.03 0.033 0.081 ± 0.05 0.079 0.126 ± 0.07 0.082

COL5A1 rs7875570 A 0.054 0.095 ± 0.07 0.187 0.058 ± 0.08 0.444 1.272 ± 0.39 1.2E-03

rs10858265 C 0.055 0.096 ± 0.07 0.178 0.063 ± 0.08 0.405 1.113 ± 0.38 3.2E-03

rs6537942 G 0.089 0.076 ± 0.06 0.187 0.036 ± 0.06 0.558 0.892 ± 0.26 5.3E-04

- 55 -

rs4319175 G 0.369 0.054 ± 0.03 0.106 0.109 ± 0.05 0.020 -0.005 ± 0.07 0.934

rs9308278 G 0.254 0.083 ± 0.04 0.025 0.090 ± 0.05 0.049 0.155 ± 0.09 0.100

rs4842173 C 0.253 0.084 ± 0.04 0.025 0.093 ± 0.05 0.043 0.145 ± 0.09 0.128

ENO1 rs10864368 A 0.115 -0.090 ± 0.05 0.077 -0.077 ± 0.05 0.161 -0.450 ± 0.22 0.043

rs11121247 T 0.067 -0.175 ± 0.06 6.3E-03 -0.184 ± 0.07 6.5E-03 -0.268 ± 0.32 0.405

rs6660137 G 0.067 -0.160 ± 0.06 0.012 -0.176 ± 0.07 9.2E-03 -0.108 ± 0.31 0.730

MYOF rs2797581 C 0.108 0.064 ± 0.05 0.209 0.046 ± 0.06 0.414 0.393 ± 0.20 0.047

rs787665 G 0.109 0.063 ± 0.05 0.221 0.042 ± 0.06 0.457 0.461 ± 0.21 0.027

rs787667 T 0.109 0.058 ± 0.05 0.256 0.035 ± 0.06 0.527 0.447 ± 0.20 0.027

rs787668 A 0.109 0.059 ± 0.05 0.248 0.034 ± 0.06 0.543 0.489 ± 0.20 0.017

rs1614065 A 0.052 -0.017 ± 0.07 0.817 -0.032 ± 0.07 0.666 1.626 ± 0.79 0.039

rs1891565 C 0.052 0.002 ± 0.07 0.980 -0.013 ± 0.07 0.863 1.625 ± 0.78 0.038

rs787695 T 0.052 -0.015 ± 0.07 0.841 -0.030 ± 0.07 0.689 1.626 ± 0.79 0.039

rs787633 T 0.037 0.073 ± 0.09 0.395 0.055 ± 0.09 0.525 1.626 ± 0.79 0.039

rs7913298 G 0.026 -0.225 ± 0.10 0.025 -0.234 ± 0.10 0.024 -0.243 ± 0.68 0.721

SCARA5 rs7002829 A 0.122 -0.033 ± 0.05 0.500 -0.007 ± 0.05 0.895 -0.360 ± 0.18 0.043

rs2859667 C 0.386 0.046 ± 0.03 0.154 0.092 ± 0.05 0.048 0.008 ± 0.06 0.903

rs2726941 A 0.398 -0.079 ± 0.03 0.015 -0.082 ± 0.05 0.085 -0.145 ± 0.06 0.018

rs2685399 C 0.386 -0.086 ± 0.03 8.4E-03 -0.089 ± 0.05 0.058 -0.158 ± 0.06 0.012

rs2726934 T 0.395 -0.083 ± 0.03 0.011 -0.096 ± 0.05 0.042 -0.133 ± 0.06 0.032

rs2727006 A 0.394 -0.089 ± 0.03 6.4E-03 -0.102 ± 0.05 0.031 -0.144 ± 0.06 0.020

The p-values below the Bonferroni-corrected significance level (p < 0.001852) are indicated in bold and

underlined, and the p-values below the standard significance level (p < 0.05) are indicated in bold.

Abbreviations: Add p, additive genetic model p-value; BD-RT, bone density estimated by T-score at distal

radius; BD-TT, bone density estimated by T-score at midshaft tibia; Dom p, dominant genetic model p-value;

KARE, Korean Association REsource; MAF, minor allele frequency; Rec p, recessive genetic model p-value;

s.e.m, standard error.

- 56 -

Table 8. The results of case-control association analysis between the SNPs in the seven

genes and osteoporosis in the KARE women subjects

Gene SNP Minor MAF Women (1711 controls, 651 cases)

allele OR (95% CI) Add p OR (95% CI) Dom p OR (95% CI) Rec p

ANXA6 rs17728338 T 0.095 1.39 (1.06-1.83) 0.018 1.36 (1.01-1.82) 0.041 3.53 (1.07-11.62) 0.038

COL5A1 rs4335205 G 0.430 1.20 (1.02-1.43) 0.031 1.40 (1.08-1.81) 0.010 1.13 (0.83-1.53) 0.434

rs4319175 G 0.369 0.88 (0.74-1.05) 0.154 0.78 (0.61-0.99) 0.039 1.02 (0.72-1.43) 0.931

rs9409917 G 0.065 1.16 (0.83-1.61) 0.377 1.23 (0.87-1.74) 0.243 NA 0.998

rs12005720 G 0.127 0.85 (0.67-1.10) 0.214 0.90 (0.68-1.19) 0.448 0.39 (0.15-0.99) 0.048

rs11103535 T 0.144 1.21 (0.96-1.53) 0.106 1.16 (0.89-1.52) 0.264 2.17 (1.04-4.51) 0.039

rs10858284 A 0.148 0.73 (0.58-0.93) 0.012 0.72 (0.55-0.95) 0.022 0.49 (0.22-1.11) 0.087

ENO1 rs11121247 T 0.067 1.41 (1.02-1.97) 0.041 1.44 (1.01-2.04) 0.042 1.68 (0.28-10.07) 0.573

MYOF rs2797581 C 0.108 0.81 (0.61-1.06) 0.121 0.86 (0.63-1.15) 0.307 0.20 (0.05-0.80) 0.022

rs787665 G 0.109 0.83 (0.63-1.09) 0.186 0.87 (0.65-1.18) 0.374 0.25 (0.06-0.99) 0.048

rs787667 T 0.109 0.84 (0.64-1.10) 0.202 0.89 (0.67-1.20) 0.461 0.21 (0.05-0.81) 0.024

rs787668 A 0.109 0.84 (0.64-1.10) 0.192 0.89 (0.66-1.20) 0.442 0.21 (0.05-0.81) 0.024

SCARA5 rs2726959 T 0.298 1.19 (0.99-1.43) 0.064 1.11 (0.88-1.41) 0.390 1.79 (1.18-2.71) 6.1E-03

rs7002829 A 0.122 1.18 (0.92-1.52) 0.185 1.09 (0.82-1.45) 0.534 2.93 (1.32-6.50) 8.2E-03

The p-values below the standard significance level (p < 0.05) are indicated in bold. Abbreviations: Add p, additive

genetic model p-value; CI, confidence interval; Dom p, dominant genetic model p-value; KARE, Korean

Association REsource; MAF, minor allele frequency; OR, odds ratio; Rec p, recessive genetic model p-value; NA,

not applicable.

- 57 -

- 58 -

- 59 -

Fig. 12. Location and basic linkage disequilibrium (LD) of the analyzed SNPs in the

ANXA6 (A), COL5A1 (B), MYOF (C) and SCARA5 (D) genes. Gene structure of each gene

is depicted at the top of the figure with coding exons. The locations of the SNPs genotyped

in this study are indicated. The basic LD plot of the studied SNPs across each gene that are

generated by using the Haploview program from the KARE data of Korean population is

shown. The SNPs indicated by closed circles (●) in the bottom panel are the SNPs that were

significantly associated with bone density in the KARE women subjects. The SNPs indicated

by reverse triangles (▼) in the bottom panel are the SNPs that were significantly associated

with osteoporosis in the KARE women subjects.

- 60 -

IV. DISCUSSION

A. In vitro and in vivo inhibition of glucocorticoid-induced

osteoporosis by the hexane extract of Poncirus trifoliata

Pharmacological therapies for preventing or treating GIO should be continued as long

as the patient is receiving glucocorticoids. Recently, as an alternative long-term therapeutic

option against GIO, herbal medicine has come to our attention because of the potential for

fewer side effects, making it suitable for long-term use. Extensive screening of natural

botanical sources for effective osteoporosis treatment has been performed mainly in Asian

countries. Two screened plants, Carthamus tinctorius and Drynaria fortunei, were tested in

vivo, and their effects were demonstrated in mice or rats with osteoporosis (Kim et al., 2002;

Wong and Rabie, 2006).

In this study, 68 Korean native plants were screened to find novel, effective botanical

sources for in vivo as well as in vitro treatment of GIO, and Poncirus trifoliata (L.) was

selected as the final botanical candidate. PT has been widely used in folk medicine as a

remedy for gastritis, dysentery, inflammation, digestive tract ulcers, uterine contraction,

relaxation and cardiovascular diseases (Kim et al., 1999; Lee et al., 2005; Shim et al., 2009).

Pharmacological studies have revealed that PT extracts (primarily water extracts) have

several biological activities, including antibacterial, anti-anaphylactic, anti-inflammatory and

anti-cancer activity (Yi et al., 2004; Park et al., 2005; Shin et al., 2006; Jayaprakasha et al.,

2007; Lee et al., 2008; Lee et al., 2009). Several compounds, such as auraptine, coumarins,

- 61 -

hesperidin, naringin, neohesperidin, poncirin and 21-methymelianodiols have been identified

from PT (Park et al., 2005; Lee et al., 2008; Lee et al., 2009). Although there have not been

any published data associating PT or its extracts with bone metabolism, previous data

suggested that PT has a protective effect against tissue injury (Lee et al., 2009). Components

isolated from PT, neohesperidin and poncirin, were reported to have a strong protective

effect against HCl/ethanol-induced gastric mucosal lesions, in addition to anti-oxidative

activity (Lee et al., 2009).

This is the first report demonstrating that PT has an inhibitory effect on osteoporosis in

vitro and in vivo. Water and acetone extracts of PT were reported previously to induce

apoptosis in cancer cells (Yi et al., 2004; Jayaprakasha et al., 2007). By contrast, this study

demonstrated that the hexane extract of PT (PT-H) inhibited the apoptosis of osteoblastic

cells. It has been shown recently that the decreased bone formation seen in GIO is mainly

attributed to the apoptosis of bone cells (Spreafico et al., 2008). Glucocorticoids induce

apoptosis of both osteoblasts and osteocytes, resulting in the impairment of bone formation

(Alesci et al., 2005; Spreafico et al., 2008; Yun et al., 2009). Our in vitro results demonstrate

that PT-H inhibits apoptotic cell death of Dex-induced osteoblastic cells (Fig. 1).

Furthermore, our in vivo results provide strong evidence that PT-H has not only an inhibitory

effect on bone loss caused by prednisolone (PD), but also promotes bone formation (Fig. 2),

suggesting that the extract may be involved in cell differentiation as well as apoptosis

inhibition in osteoblastic cells. In addition, the animal results suggest that PT-H may be more

effective than SrCl2, which is known to prevent calcium loss and osteoporosis (Cabrera et al.,

1999). In comparison with in vivo data on Carthamus tinctorius and Drynaria fortunei (Kim

- 62 -

et al., 2002; Wong and Rabie, 2006), PT-H appears to have a bone-protecting effect against

GC to a similar degree as those two plants.

To investigate the molecular mechanisms behind the inhibitory effect of PT-H against

GIO, DEGs were screened and identified in Dex-induced osteoblastic cells with or without

PT-H, using ACP-based differential display RT-PCR (GeneFishing DEG screening

technology) (Kim et al., 2004). This method has substantially improved the specificity and

sensitivity of PCR by eliminating the false-positives and poor reproducibility of previous

DEG discovery methods such as cDNA microarray, and has provided new insights into the

efficacious analysis of differential gene expression in tissues and cell lines, thereby allowing

accurate products to be amplified (Kim et al., 2004). In fact, validation of the identified

genes by quantitative real-time RT-PCR using gene-specific primers and Western blot

analysis demonstrated the efficacy and accuracy of this tool. Interestingly, the products of all

six identified DEGs are closely associated with bone homeostasis: Gper is a factor involved

in the regulation of bone mass (Heino et al., 2008); Cnn3 is known to be involved in the

regulation of bone morphogenetic protein (BMP)-dependent cellular responses (Haag and

Aigner, 2007); Scara5 promotes osteoclast differentiation (Takemura et al., 2009); Kitl is

known to play a role in the regulation of peak bone mass (Lotinun et al., 2005); Col6a2 is a

component of type VI collagen, a fibril-forming collagen (Leclerc et al., 2004); and AnxA6 is

in a family of Ca2+- and phospholipid binding proteins and involved in matrix vesicle

calcification (Chen et al., 2008).

It was previously reported that the expression level of annexin A6 (AnxA6) was

significantly increased in response to Dex treatment in human marrow stromal cells, a result

- 63 -

similar to our data (Dieudonne et al., 1999). In addition, Dex treatment of osteoblastic cells

increased the expression of collagen type VI alpha 1 (Col6a1), another component of

collagen type VI, more than 2.5-fold (Leclerc et al., 2004). These results confirm the

accuracy of the ACP-based differential display RT-PCR in this study. Taken together with

these results, since AnxA6 and Col6a2 were identified in two different osteoblastic cell lines

(C3H10T1/2 and MC3T3-E1) by the DEG screening experiment, it is highly possible that

these two genes are closely associated with the bone-protecting effect of PT-H in GIO.

Furthermore, since the expression levels of AnxA6 were significantly changed by PT-H

treatment in the PD-treated GIO-model mice, AnxA6 is thought to be a key gene playing a

major role in the inhibitory effects of PT-H on GIO both in vivo and in vitro. Although the

molecular mechanism of PT-H-mediated change in AnxA6 expression remains unclear, the

relationships between AnxA6 and bone homeostasis have been demonstrated. A previous

study reported that polymorphisms in the AnxA6 gene were significantly associated with a

high risk for osteonecrosis of the femoral head in the Korean population (Kim et al., 2009),

and another demonstrated that AnxA6 is involved in the matrix vesicle calcification

necessary for the mineralization of bone and cartilage (Chen et al., 2008).

Osteoporosis is a common disease with a strong genetic component. Although several

genetic factors have been identified that contribute to the pathogenesis of osteoporosis by

influencing bone mineral density, bone mass, bone strength and bone turnover (Ralston and

de Crombrugghe, 2006), most causal genes remain to be discovered. Our results, together

with the results of a previous study (Kim et al., 2009), indicate that AnxA6 may be one of the

genetic regulators of bone mass and susceptibility to osteoporosis. Previous reports have

- 64 -

provided strong evidence that the AnxA6 gene regulates cell survival and the death of bone

cells, including proliferation, growth, necrosis and apoptosis (Theobald et al., 1994; Kim et

al., 2009; Vila de Muga et al., 2009). Overexpression of AnxA6 suppresses proliferation, and

knockdown of AnxA6 increases Ras activity and cell proliferation in cancer cells (Theobald

et al., 1994; Vila de Muga et al., 2009). Our data support the previously identified functions

of AnxA6 in bone cells; the increased AnxA6 expression caused by Dex treatment induced

apoptosis of osteoblastic cells, and decreased AnxA6 expression caused by PT-H treatment

suppressed apoptosis of osteoblastic cells both in vitro and in vivo. Recently, the AnxA6-

related molecular mechanisms involved in Ras signaling have been clarified. Annexin A6

inhibits Ras signaling through the formation of a complex with the GTPase-activating

proteins, p120GAP and H-Ras (Vila de Muga et al., 2009). Further investigation is necessary

to elucidate the role of AnxA6 in Ras signaling in bone cells.

In summary, it was demonstrated that PT-H exhibited marked inhibition of

glucocorticoid-induced osteoporosis in vitro and in vivo, and AnxA6 may play a key role in

this effect. Further studies of the components isolated from PT-H may lead to the

identification of the active substance(s) that inhibit GIO, and provide invaluable information

toward elucidating the therapeutic properties of PT for the treatment of GIO.

- 65 -

B. Genetic association between single nucleotide polymorphisms in

the ANXA6 gene and bone density/osteoporosis

Many approaches for identifying the genetic factors contributing to the pathogenesis of

osteoporosis have been studied and have contributed to the detection of numerous genes for

susceptibility to osteoporosis (Ralston and Uitterlinden, 2010). Among them, GWAS has

been extensively executed for identifying the loci and genes that are significantly associated

with bone density and osteoporosis. A major advantage of GWAS is that it offers the ranking

for significance in multiple association signals across the genome. Since the statistical

significance thresholds are very stringent due to the analysis of a large number of SNPs,

many polymorphisms having a true association with osteoporosis but with a relatively small

effect size can be missed (Ralston and Uitterlinden, 2010). This may lead to missing an

opportunity to identify the novel osteoporosis susceptibility genes. In this study, to identify

the novel genes more accurately as well as more effectively, we combined two methods, i.e

whole genome expression profiling for screening of candidate genes and candidate gene

association study.

In the series of experiments in the in vitro and in vivo osteoporosis models and

eventually in human subjects, we identified 5 novel osteoporosis susceptibility genes,

ANXA6, COL5A1, ENO1, MYOF and SCARA5. The results from each step of the

experiments in the cell line model, mouse model and humans are summarized in Table 5. In

the screening step of the DEGs in the cell line model, 10 candidate genes were screened.

During the validation and evaluation steps in the cell line and mouse models, respectively,

- 66 -

the 5 genes showing false positive results were ruled out, and the 5 genes that passed all the

steps of the experiment were finally selected.

The ANXA6 gene encodes Annexin A6 which belongs to a family of calcium-

dependent membrane and phospholipid binding proteins, and is involved in matrix vesicle

calcification (Thomas et al., 2002; Gerke et al., 2005; Chen et al., 2008). Annexin A6 binds

to phospholipids in cellular membranes in a dynamic and reversible fashion and is implicated

in membrane-related events along the exocytotic and endocytotic pathways (Enrich et al.,

2011). Previous reports have documented that Annexin A6 is involved in cell proliferation,

growth and apoptosis (Theobald et al., 1994; Kim et al., 2011). Annexin A6 participates in

the regulation of EGFR/Ras signaling pathway and cholesterol homeostasis (Vila de Muga et

al., 2009; Grewal et al., 2010; Enrich et al., 2011). The SNPs in the ANXA6 gene have been

reported to be associated with osteonecrosis of the femoral head in the Korean population

(Kim et al., 2009). Although the phenotypes in this disease differ from those in osteoporosis,

since the polymorphisms in this gene are associated with the phenotypes related with bone

loss, it is very likely that the ANXA6 gene plays an important role in the pathogenesis of

osteoporosis.

- 67 -

Table 9. The summary of the results from each step of the experiments in the cell line,

mouse model and humans

Mouse DD qRT-PCR (mean ± SD) Humans Number Number of associated SNPs (lowest p-value)

Gene Cell line Cell model Mouse model Gene of tested Human (women)

symbol Con Dex Con Dex Sham OVX symbol SNPs BD-RT BD-TT Osteoporosis

AnxA6 + ++ 1.0 2.8 ± 0.1** 1.0 1.5 ± 0.2# ANXA6 18 2 (0.044) 4 (1.6ⅹ10-3)† 1 (0.018)

Cnn3 + ++ 1.0 1.3 ± 0.2 1.0 1.1 ± 0.1 CNN3 - - - -

Col5a1 + ++ 1.0 2.1 ± 0.5* 1.0 1.9 ± 0.5# COL5A1 29 3 (2.5ⅹ10-3) 6 (5.3ⅹ10-4)† 6 (0.010)

Col6a2 ++ +++ 1.0 2.8 ± 0.2* 1.0 2.2 ± 0.6# COL6A2 3 0 0 0

Eno1 +++ ++ 1.0 0.8 ± 0.1* 1.0 0.7 ± 0.1# ENO1 3 0 3 (6.3ⅹ10-3) 1 (0.041)

Kitl + ++ 1.0 2.6 ± 0.6* 1.0 1.9 ± 0.5# KITLG 9 0 0 0

Myof + +++ 1.0 3.2 ± 0.2** 1.0 2.3 ± 0.4## MYOF 29 6 (0.038) 9 (0.017) 4 (0.022)

Nfib + ++ 1.0 2.6 ± 0.3* 1.0 1.1 ± 0.4 NFIB - - - -

Scara5 + +++ 1.0 3.0 ± 0.2** 1.0 2.2 ± 0.3## SCARA5 25 1 (0.044) 6 (6.4ⅹ10-3) 2 (6.1ⅹ10-3)

S100a10 +++ ++ 1.0 2.4 ± 0.4** 1.0 1.2 ± 0.1 S100A10 - - - -

Abbreviations: BD-RT, bone density estimated by T-score at the distal radius; BD-TT, bone density estimated

by T-score at the midshaft tibia; Con, control; DD, differential display; Dex, dexamethasone; OVX,

ovariectomy; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction; - , not tested; * p < 0.05

vs. control; ** p < 0.01 vs. control; # p < 0.05 vs. sham; ## p < 0.01 vs. sham; †, the lowest p-value satisfying

the Bonferroni-corrected significance level (p < 0.00185).

- 68 -

The COL5A1 gene encodes the alpha 1 chain of type V collagen, one of the low abundance

fibrillar collagens. The COL1A1 gene encoding the alpha 1 chain of type I collagen has long

been implicated in the pathogenesis of osteoporosis because type I collagen is the main

protein in bone. Many studies on the association between polymorphisms in the COL1A1

gene and osteoporosis have been published (Jin et al., 2009; Jin et al., 2011), however, none

of association results between the COL5A1 gene and osteoporosis have been reported. In the

meantime, it has been reported that the COL5A1 gene is associated with various diseases

including chronic Achilles tendinopathy (Collins et al., 2009), Achilles tendon injuries

(Mokone et al., 2006; Posthumus et al., 2009b) and anterior cruciate ligament rupture in

female participants (Posthumus et al., 2009a). In addition, mutations within the COL5A1

gene have been implicated in Ehlers-Danlos syndrome which is a multisystemic disorder that

primarily affects the soft connective tissues (Malfait and De Paepe, 2005). These results

suggested the COL5A1 gene can be a candidate high risk factor for osteoporosis and we

found a significant association between the SNPs in the COL5A1 gene and bone density and

osteoporosis phenotypes.

The ENO1 gene encodes a key glycolytic enzyme alpha-enolase that acts as a 2-

phospho-D-glycerate hydrolase. It is also involved in various processes such as growth

control, hypoxia tolerance and autoimmune responses (Pancholi, 2001; Kim and Dang, 2005;

Terrier et al., 2007). Previous report showed that the ENO1 gene was significantly down-

regulated in postmenopausal women compared with premenopausal women (Kosa et al.,

2009). Our results also showed that the expression level of the ENO1 gene was decreased in

both the cell line and mouse models for osteoporosis (Fig. 9-11). Based on the fact that

- 69 -

deficiency of estrogen level due to menopause is closely related with an increase in

osteoclast life span and a concomitant decrease in osteoblast life span and further

osteoporosis (Sipos et al., 2009; Khosla, 2010), these results suggest that the ENO1 gene

may be involved in bone metabolism.

The MYOF gene encodes Myoferlin which is a member of the ferlin family of proteins

that promotes endomembrane fusion with the plasma membrane in muscle cells and

endothelial cells (Bernatchez et al., 2009). Since Myoferlin was identified as a protein highly

homologous to Dysferlin, the gene product of the limb girdle muscular dystrophy (LGMD)

2B locus, MYOF has been suggested as a candidate gene and potential modifier for muscular

dystrophy (Davis et al., 2000). The SCARA5 gene encodes scavenger receptor class A

member 5 which is involved in the host defense properties of populations of human

epithelial cells (Jiang et al., 2006). Scara5 is also known to be a ferritin receptor mediating

non-transferrin iron delivery (Li et al., 2009). Class A scavenger receptor promotes

osteoclast differentiation (Takemura et al., 2009).

By in silico analysis of transcription factor binding of the significant SNPs using the

TRANSFAC database (http://www.cbrc.jp/research/db/TFSEARCH.html), we found the

binding sites of transcription factors in several SNPs. The sequence region in the minor allele

of the SNP, rs12005720 in the COL5A1 gene contained the binding site for ETS1 (93.1

scoring point). ETS1 has been reported to be associated with systemic lupus erythematosus

(SLE) (Han et al., 2009). SLE often accompanies osteoporosis. The sequence region in the

minor allele of the SNP, rs787667 in the MYOF gene contained the binding site for GATA1

(93.0 scoring point). In addition, POU2F could bind to the sequence regions of the SNP,

- 70 -

rs6660137 in the ENO1 gene (90.0 scoring point) and the SNP, rs2726941 in the SCARA5

gene (94.5 scoring point).

In conclusion, we identified 5 novel osteoporosis susceptibility genes through

candidate gene selection, evaluation and association analysis. Among them, SNPs in the

ANXA6 gene showed a highly significant association with bone density and osteoporosis-

related traits. Together with the previous study, our study suggests that these two genes may

play a key role in regulation of bone metabolism including bone formation and resorption.

Replication studies in other ethnic populations and future functional studies on these five

genes are needed. Our systematic approach with careful design and interpretation using the

cell line model, mice model and human subjects may be a useful tool for the identification of

susceptibility genes of other complex diseases in humans.

- 71 -

V. CONCLUSION

We performed this study to discover a novel herbal therapeutic drug for effective

osteoporosis treatment and to further clarify its molecular mechanism of action. The dried

immature fruit of Poncirus trifoliata (PT) was selected as a potential natural-source

candidate for the treatment of glucocorticoid-induced osteoporosis (GIO). The hexane

extract of PT (PT-H) inhibited apoptotic cell death in dexamethasone-induced osteoblastic

cell lines. In vivo mouse results indicated that PT-H had an inhibitory effect on the bone loss

caused by glucocorticoid. The expression level of AnxA6 in dexamethasone-induced

osteoblastic cells and prednisolone (PD)-treated GIO-model mice was significantly

decreased by PT-H treatment.

Next, to determine whether ANXA6 gene is associated with the susceptibility to

osteoporosis and to identify novel genes for susceptibility to osteoporosis, we performed a

whole-genome comparative expression analysis. The expression levels of 7 genes, AnxA6,

Col5a1, Col6a2, Eno1, Myof, Nfib, and Scara5 were significantly altered in the in vitro and

in vivo osteoporosis models. Subsequently, we performed the quantitative bone density

association analysis and osteoporosis case-control association analysis of 116 SNPs in these

7 genes in the Korean Women’s Cohort (3570 subjects). There was a significant association

between the SNPs in the 5 genes, ANXA6, COL5A1, ENO1, MYOF and SCARA5, and bone

density and/or osteoporosis. Especially, the SNPs in the ANXA6 gene showed a highly

significant association with both bone density and osteoporosis phenotypes.

These results indicate that the ANXA6 gene may play an important role in regulation of

bone metabolism and further the pathogenesis of osteoporosis.

- 72 -

REFERENCES

1. Alesci S, De Martino MU, Ilias I, Gold PW, Chrousos GP: Glucocorticoid-induced

osteoporosis: from basic mechanisms to clinical aspects. Neuroimmunomodulation

12: 1-19, 2005

2. Angeli A, Guglielmi G, Dovio A, Capelli G, de Feo D, Giannini S, Giorgino R, Moro

L, Giustina A: High prevalence of asymptomatic vertebral fractures in post-

menopausal women receiving chronic glucocorticoid therapy: a cross-sectional

outpatient study. Bone 39: 253-259, 2006

3. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD

and haplotype maps. Bioinformatics 21: 263-265, 2005

4. Bernatchez PN, Sharma A, Kodaman P, Sessa WC: Myoferlin is critical for

endocytosis in endothelial cells. Am J Physiol Cell Physiol 297: C484-492, 2009

5. Bonura F: Prevention, screening, and management of osteoporosis: an overview of

the current strategies. Postgrad Med 121: 5-17, 2009

6. Cabrera WE, Schrooten I, De Broe ME, D'Haese PC: Strontium and bone. J Bone

Miner Res 14: 661-668, 1999

7. Caichompoo W, Zhang QY, Hou TT, Gao HJ, Qin LP, Zhou XJ: Optimization of

extraction and purification of active fractions from Schisandra chinensis (Turcz.) and

its osteoblastic proliferation stimulating activity. Phytother Res 23: 289-292, 2009

8. Canalis E, Delany AM: Mechanisms of glucocorticoid action in bone. Ann N Y Acad

Sci 966: 73-81, 2002

- 73 -

9. Canalis E, Mazziotti G, Giustina A, Bilezikian JP: Glucocorticoid-induced

osteoporosis: pathophysiology and therapy. Osteoporos Int 18: 1319-1328, 2007

10. Chen NX, O'Neill KD, Chen X, Moe SM: Annexin-mediated matrix vesicle

calcification in vascular smooth muscle cells. J Bone Miner Res 23: 1798-1805,

2008

11. Cho YS, Go MJ, Kim YJ, Heo JY, Oh JH, Ban HJ, Yoon D, Lee MH, Kim DJ, Park

M, Cha SH, Kim JW, Han BG, Min H, Ahn Y, Park MS, Han HR, Jang HY, Cho EY,

Lee JE, Cho NH, Shin C, Park T, Park JW, Lee JK, Cardon L, Clarke G, McCarthy

MI, Lee JY, Oh B, Kim HL: A large-scale genome-wide association study of Asian

populations uncovers genetic factors influencing eight quantitative traits. Nat Genet

41: 527-534, 2009

12. Choi JY, Lee BH, Song KB, Park RW, Kim IS, Sohn KY, Jo JS, Ryoo HM:

Expression patterns of bone-related proteins during osteoblastic differentiation in

MC3T3-E1 cells. J Cell Biochem 61: 609-618, 1996

13. Collins M, Mokone GG, September AV, van der Merwe L, Schwellnus MP: The

COL5A1 genotype is associated with range of motion measurements. Scand J Med

Sci Sports 19: 803-810, 2009

14. Davis DB, Delmonte AJ, Ly CT, McNally EM: Myoferlin, a candidate gene and

potential modifier of muscular dystrophy. Hum Mol Genet 9: 217-226, 2000

15. Dieudonne SC, Kerr JM, Xu T, Sommer B, DeRubeis AR, Kuznetsov SA, Kim IS,

Gehron Robey P, Young MF: Differential display of human marrow stromal cells

reveals unique mRNA expression patterns in response to dexamethasone. J Cell

- 74 -

Biochem 76: 231-243, 1999

16. Enrich C, Rentero C, de Muga SV, Reverter M, Mulay V, Wood P, Koese M, Grewal

T: Annexin A6-Linking Ca(2+) signaling with cholesterol transport. Biochim

Biophys Acta 1813: 935-947, 2011

17. Gerke V, Creutz CE, Moss SE: Annexins: linking Ca2+ signalling to membrane

dynamics. Nat Rev Mol Cell Biol 6: 449-461, 2005

18. Grewal T, Koese M, Rentero C, Enrich C: Annexin A6-regulator of the EGFR/Ras

signalling pathway and cholesterol homeostasis. Int J Biochem Cell Biol 42: 580-584,

2010

19. Gudbjornsson B, Juliusson UI, Gudjonsson FV: Prevalence of long term steroid

treatment and the frequency of decision making to prevent steroid induced

osteoporosis in daily clinical practice. Ann Rheum Dis 61: 32-36, 2002

20. Gueguen R, Jouanny P, Guillemin F, Kuntz C, Pourel J, Siest G: Segregation

analysis and variance components analysis of bone mineral density in healthy

families. J Bone Miner Res 10: 2017-2022, 1995

21. Ha H, Ho J, Shin S, Kim H, Koo S, Kim IH, Kim C: Effects of Eucommiae Cortex

on osteoblast-like cell proliferation and osteoclast inhibition. Arch Pharm Res 26:

929-936, 2003

22. Haag J, Aigner T: Identification of calponin 3 as a novel Smad-binding modulator of

BMP signaling expressed in cartilage. Exp Cell Res 313: 3386-3394, 2007

23. Han JW, Zheng HF, Cui Y, Sun LD, Ye DQ, Hu Z, Xu JH, Cai ZM, Huang W, Zhao

GP, Xie HF, Fang H, Lu QJ, Li XP, Pan YF, Deng DQ, Zeng FQ, Ye ZZ, Zhang XY,

- 75 -

Wang QW, Hao F, Ma L, Zuo XB, Zhou FS, Du WH, Cheng YL, Yang JQ, Shen SK,

Li J, Sheng YJ, Zuo XX, Zhu WF, Gao F, Zhang PL, Guo Q, Li B, Gao M, Xiao FL,

Quan C, Zhang C, Zhang Z, Zhu KJ, Li Y, Hu DY, Lu WS, Huang JL, Liu SX, Li H,

Ren YQ, Wang ZX, Yang CJ, Wang PG, Zhou WM, Lv YM, Zhang AP, Zhang SQ,

Lin D, Low HQ, Shen M, Zhai ZF, Wang Y, Zhang FY, Yang S, Liu JJ, Zhang XJ:

Genome-wide association study in a Chinese Han population identifies nine new

susceptibility loci for systemic lupus erythematosus. Nat Genet 41: 1234-1237, 2009

24. Hedrick PW: Gametic disequilibrium measures: proceed with caution. Genetics 117:

331-341, 1987

25. Heino TJ, Chagin AS, Savendahl L: The novel estrogen receptor G-protein-coupled

receptor 30 is expressed in human bone. J Endocrinol 197: R1-6, 2008

26. Hosoi T: Genetic aspects of osteoporosis. J Bone Miner Metab 28: 601-607, 2010

27. Hsu YH, Xu X, Terwedow HA, Niu T, Hong X, Wu D, Wang L, Brain JD, Bouxsein

ML, Cummings SR, Rosen CJ: Large-scale genome-wide linkage analysis for loci

linked to BMD at different skeletal sites in extreme selected sibships. J Bone Miner

Res 22: 184-194, 2007

28. Jayaprakasha GK, Mandadi KK, Poulose SM, Jadegoud Y, Nagana Gowda GA, Patil

BS: Inhibition of colon cancer cell growth and antioxidant activity of bioactive

compounds from Poncirus trifoliata (L.) Raf. Bioorg Med Chem 15: 4923-4932,

2007

29. Jee WS, Yao W: Overview: animal models of osteopenia and osteoporosis. J

Musculoskelet Neuronal Interact 1: 193-207, 2001

- 76 -

30. Jeong JC, Lee JW, Yoon CH, Lee YC, Chung KH, Kim MG, Kim CH: Stimulative

effects of Drynariae Rhizoma extracts on the proliferation and differentiation of

osteoblastic MC3T3-E1 cells. J Ethnopharmacol 96: 489-495, 2005

31. Jiang Y, Oliver P, Davies KE, Platt N: Identification and characterization of murine

SCARA5, a novel class A scavenger receptor that is expressed by populations of

epithelial cells. J Biol Chem 281: 11834-11845, 2006

32. Jin H, Evangelou E, Ioannidis JP, Ralston SH: Polymorphisms in the 5' flank of

COL1A1 gene and osteoporosis: meta-analysis of published studies. Osteoporos Int

22: 911-921, 2011

33. Jin H, van't Hof RJ, Albagha OM, Ralston SH: Promoter and intron 1

polymorphisms of COL1A1 interact to regulate transcription and susceptibility to

osteoporosis. Hum Mol Genet 18: 2729-2738, 2009

34. Johnell O, Kanis J: Epidemiology of osteoporotic fractures. Osteoporos Int 16 Suppl

2: S3-7, 2005

35. Kanis JA, Melton LJ, 3rd, Christiansen C, Johnston CC, Khaltaev N: The diagnosis

of osteoporosis. J Bone Miner Res 9: 1137-1141, 1994

36. Karasik D, Shimabuku NA, Zhou Y, Zhang Y, Cupples LA, Kiel DP, Demissie S: A

genome wide linkage scan of metacarpal size and geometry in the Framingham

Study. Am J Hum Biol 20: 663-670, 2008

37. Kaufman JM, Ostertag A, Saint-Pierre A, Cohen-Solal M, Boland A, Van Pottelbergh

I, Toye K, de Vernejoul MC, Martinez M: Genome-wide linkage screen of bone

mineral density (BMD) in European pedigrees ascertained through a male relative

- 77 -

with low BMD values: evidence for quantitative trait loci on 17q21-23, 11q12-13,

13q12-14, and 22q11. J Clin Endocrinol Metab 93: 3755-3762, 2008

38. Khosla S: Update on estrogens and the skeleton. J Clin Endocrinol Metab 95: 3569-

3577, 2010

39. Khosla S, Westendorf JJ, Oursler MJ: Building bone to reverse osteoporosis and

repair fractures. J Clin Invest 118: 421-428, 2008

40. Kim BY, Yoon HY, Yun SI, Woo ER, Song NK, Kim HG, Jeong SY, Chung YS: In

Vitro and In Vivo Inhibition of Glucocorticoid-induced Osteoporosis by the Hexane

Extract of Poncirus trifoliata. Phytother Res, 2011

41. Kim HJ, Bae YC, Park RW, Choi SW, Cho SH, Choi YS, Lee WJ: Bone-protecting

effect of safflower seeds in ovariectomized rats. Calcif Tissue Int 71: 88-94, 2002

42. Kim HM, Kim HJ, Park ST: Inhibition of immunoglobulin E production by Poncirus

trifoliata fruit extract. J Ethnopharmacol 66: 283-288, 1999

43. Kim JW, Dang CV: Multifaceted roles of glycolytic enzymes. Trends Biochem Sci

30: 142-150, 2005

44. Kim KW, Suh SJ, Lee TK, Ha KT, Kim JK, Kim KH, Kim DI, Jeon JH, Moon TC,

Kim CH: Effect of safflower seeds supplementation on stimulation of the

proliferation, differentiation and mineralization of osteoblastic MC3T3-E1 cells. J

Ethnopharmacol 115: 42-49, 2008

45. Kim TH, Hong JM, Shin ES, Kim HJ, Cho YS, Lee JY, Lee SH, Park EK, Kim SY:

Polymorphisms in the Annexin gene family and the risk of osteonecrosis of the

femoral head in the Korean population. Bone 45: 125-131, 2009

- 78 -

46. Kim YJ, Kwak CI, Gu YY, Hwang IT, Chun JY: Annealing control primer system for

identification of differentially expressed genes on agarose gels. Biotechniques 36:

424-426, 428, 430 passim, 2004

47. Kosa JP, Balla B, Speer G, Kiss J, Borsy A, Podani J, Takacs I, Lazary A, Nagy Z,

Bacsi K, Orosz L, Lakatos P: Effect of menopause on gene expression pattern in

bone tissue of nonosteoporotic women. Menopause 16: 367-377, 2009

48. Leclerc N, Luppen CA, Ho VV, Nagpal S, Hacia JG, Smith E, Frenkel B: Gene

expression profiling of glucocorticoid-inhibited osteoblasts. J Mol Endocrinol 33:

175-193, 2004

49. Lee HT, Seo EK, Chung SJ, Shim CK: Prokinetic activity of an aqueous extract from

dried immature fruit of Poncirus trifoliata (L.) Raf. J Ethnopharmacol 102: 131-136,

2005

50. Lee IJ, Xu GH, Ju JH, Kim JA, Kwon SW, Lee SH, Han SB, Kim Y: 21-

Methylmelianodiols from Poncirus trifoliata as inhibitors of interleukin-5 bioactivity

in Pro-B cells. Planta Med 74: 396-400, 2008

51. Lee JH, Lee SH, Kim YS, Jeong CS: Protective effects of neohesperidin and

poncirin isolated from the fruits of Poncirus trifoliata on potential gastric disease.

Phytother Res 23: 1748-1753, 2009

52. Lelovas PP, Xanthos TT, Thoma SE, Lyritis GP, Dontas IA: The laboratory rat as an

animal model for osteoporosis research. Comp Med 58: 424-430, 2008

53. Lewiecki EM: Emerging drugs for postmenopausal osteoporosis. Expert Opin Emerg

Drugs 14: 129-144, 2009

- 79 -

54. Li JY, Paragas N, Ned RM, Qiu A, Viltard M, Leete T, Drexler IR, Chen X, Sanna-

Cherchi S, Mohammed F, Williams D, Lin CS, Schmidt-Ott KM, Andrews NC,

Barasch J: Scara5 is a ferritin receptor mediating non-transferrin iron delivery. Dev

Cell 16: 35-46, 2009

55. Lotinun S, Evans GL, Turner RT, Oursler MJ: Deletion of membrane-bound steel

factor results in osteopenia in mice. J Bone Miner Res 20: 644-652, 2005

56. Malfait F, De Paepe A: Molecular genetics in classic Ehlers-Danlos syndrome. Am J

Med Genet C Semin Med Genet 139C: 17-23, 2005

57. Mazziotti G, Angeli A, Bilezikian JP, Canalis E, Giustina A: Glucocorticoid-induced

osteoporosis: an update. Trends Endocrinol Metab 17: 144-149, 2006

58. Mokone GG, Schwellnus MP, Noakes TD, Collins M: The COL5A1 gene and

Achilles tendon pathology. Scand J Med Sci Sports 16: 19-26, 2006

59. Olney RC: Mechanisms of impaired growth: effect of steroids on bone and cartilage.

Horm Res 72 Suppl 1: 30-35, 2009

60. Pancholi V: Multifunctional alpha-enolase: its role in diseases. Cell Mol Life Sci 58:

902-920, 2001

61. Park SH, Park EK, Kim DH: Passive cutaneous anaphylaxis-inhibitory activity of

flavanones from Citrus unshiu and Poncirus trifoliata. Planta Med 71: 24-27, 2005

62. Pocock NA, Eisman JA, Hopper JL, Yeates MG, Sambrook PN, Eberl S: Genetic

determinants of bone mass in adults. A twin study. J Clin Invest 80: 706-710, 1987

63. Posthumus M, September AV, O'Cuinneagain D, van der Merwe W, Schwellnus MP,

Collins M: The COL5A1 gene is associated with increased risk of anterior cruciate

- 80 -

ligament ruptures in female participants. Am J Sports Med 37: 2234-2240, 2009a

64. Posthumus M, September AV, Schwellnus MP, Collins M: Investigation of the Sp1-

binding site polymorphism within the COL1A1 gene in participants with Achilles

tendon injuries and controls. J Sci Med Sport 12: 184-189, 2009b

65. Quarles LD, Yohay DA, Lever LW, Caton R, Wenstrup RJ: Distinct proliferative and

differentiated stages of murine MC3T3-E1 cells in culture: an in vitro model of

osteoblast development. J Bone Miner Res 7: 683-692, 1992

66. Rabbee N, Speed TP: A genotype calling algorithm for affymetrix SNP arrays.

Bioinformatics 22: 7-12, 2006

67. Raisz LG: Pathogenesis of osteoporosis: concepts, conflicts, and prospects. J Clin

Invest 115: 3318-3325, 2005

68. Ralston SH: Genetics of osteoporosis. Ann N Y Acad Sci 1192: 181-189, 2010

69. Ralston SH, de Crombrugghe B: Genetic regulation of bone mass and susceptibility

to osteoporosis. Genes Dev 20: 2492-2506, 2006

70. Ralston SH, Uitterlinden AG: Genetics of osteoporosis. Endocr Rev 31: 629-662,

2010

71. Richards JB, Kavvoura FK, Rivadeneira F, Styrkarsdottir U, Estrada K, Halldorsson

BV, Hsu YH, Zillikens MC, Wilson SG, Mullin BH, Amin N, Aulchenko YS,

Cupples LA, Deloukas P, Demissie S, Hofman A, Kong A, Karasik D, van Meurs JB,

Oostra BA, Pols HA, Sigurdsson G, Thorsteinsdottir U, Soranzo N, Williams FM,

Zhou Y, Ralston SH, Thorleifsson G, van Duijn CM, Kiel DP, Stefansson K,

Uitterlinden AG, Ioannidis JP, Spector TD: Collaborative meta-analysis: associations

- 81 -

of 150 candidate genes with osteoporosis and osteoporotic fracture. Ann Intern Med

151: 528-537, 2009

72. Richards JB, Rivadeneira F, Inouye M, Pastinen TM, Soranzo N, Wilson SG,

Andrew T, Falchi M, Gwilliam R, Ahmadi KR, Valdes AM, Arp P, Whittaker P,

Verlaan DJ, Jhamai M, Kumanduri V, Moorhouse M, van Meurs JB, Hofman A, Pols

HA, Hart D, Zhai G, Kato BS, Mullin BH, Zhang F, Deloukas P, Uitterlinden AG,

Spector TD: Bone mineral density, osteoporosis, and osteoporotic fractures: a

genome-wide association study. Lancet 371: 1505-1512, 2008

73. Sambrook P, Cooper C: Osteoporosis. Lancet 367: 2010-2018, 2006

74. Shim WS, Back H, Seo EK, Lee HT, Shim CK: Long-term administration of an

aqueous extract of dried, immature fruit of Poncirus trifoliata (L.) Raf. suppresses

body weight gain in rats. J Ethnopharmacol 126: 294-299, 2009

75. Shin TY, Oh JM, Choi BJ, Park WH, Kim CH, Jun CD, Kim SH: Anti-inflammatory

effect of Poncirus trifoliata fruit through inhibition of NF-kappaB activation in mast

cells. Toxicol In Vitro 20: 1071-1076, 2006

76. Sigurdsson G, Halldorsson BV, Styrkarsdottir U, Kristjansson K, Stefansson K:

Impact of genetics on low bone mass in adults. J Bone Miner Res 23: 1584-1590,

2008

77. Sipos W, Pietschmann P, Rauner M, Kerschan-Schindl K, Patsch J: Pathophysiology

of osteoporosis. Wien Med Wochenschr 159: 230-234, 2009

78. Spreafico A, Frediani B, Francucci CM, Capperucci C, Chellini F, Galeazzi M: Role

of apoptosis in osteoporosis induced by glucocorticoids. J Endocrinol Invest 31: 22-

- 82 -

27, 2008

79. Styrkarsdottir U, Cazier JB, Kong A, Rolfsson O, Larsen H, Bjarnadottir E,

Johannsdottir VD, Sigurdardottir MS, Bagger Y, Christiansen C, Reynisdottir I,

Grant SF, Jonasson K, Frigge ML, Gulcher JR, Sigurdsson G, Stefansson K: Linkage

of osteoporosis to chromosome 20p12 and association to BMP2. PLoS Biol 1: E69,

2003

80. Styrkarsdottir U, Halldorsson BV, Gretarsdottir S, Gudbjartsson DF, Walters GB,

Ingvarsson T, Jonsdottir T, Saemundsdottir J, Snorradottir S, Center JR, Nguyen TV,

Alexandersen P, Gulcher JR, Eisman JA, Christiansen C, Sigurdsson G, Kong A,

Thorsteinsdottir U, Stefansson K: New sequence variants associated with bone

mineral density. Nat Genet 41: 15-17, 2009

81. Suh SJ, Yun WS, Kim KS, Jin UH, Kim JK, Kim MS, Kwon DY, Kim CH:

Stimulative effects of Ulmus davidiana Planch (Ulmaceae) on osteoblastic MC3T3-

E1 cells. J Ethnopharmacol 109: 480-485, 2007

82. Takemura K, Sakashita N, Fujiwara Y, Komohara Y, Lei X, Ohnishi K, Suzuki H,

Kodama T, Mizuta H, Takeya M: Class A scavenger receptor promotes osteoclast

differentiation via the enhanced expression of receptor activator of NF-kappaB

(RANK). Biochem Biophys Res Commun, 2009

83. Teitelbaum SL: Bone resorption by osteoclasts. Science 289: 1504-1508, 2000

84. Terrier B, Degand N, Guilpain P, Servettaz A, Guillevin L, Mouthon L: Alpha-

enolase: a target of antibodies in infectious and autoimmune diseases. Autoimmun

Rev 6: 176-182, 2007

- 83 -

85. Theobald J, Smith PD, Jacob SM, Moss SE: Expression of annexin VI in A431

carcinoma cells suppresses proliferation: a possible role for annexin VI in cell

growth regulation. Biochim Biophys Acta 1223: 383-390, 1994

86. Thomas DD, Kaspar KM, Taft WB, Weng N, Rodenkirch LA, Groblewski GE:

Identification of annexin VI as a Ca2+-sensitive CRHSP-28-binding protein in

pancreatic acinar cells. J Biol Chem 277: 35496-35502, 2002

87. Torgerson DJ, Campbell MK, Thomas RE, Reid DM: Prediction of perimenopausal

fractures by bone mineral density and other risk factors. J Bone Miner Res 11: 293-

297, 1996

88. Turner RT, Maran A, Lotinun S, Hefferan T, Evans GL, Zhang M, Sibonga JD:

Animal models for osteoporosis. Rev Endocr Metab Disord 2: 117-127, 2001

89. Vila de Muga S, Timpson P, Cubells L, Evans R, Hayes TE, Rentero C, Hegemann A,

Reverter M, Leschner J, Pol A, Tebar F, Daly RJ, Enrich C, Grewal T: Annexin A6

inhibits Ras signalling in breast cancer cells. Oncogene 28: 363-377, 2009

90. Wong RW, Rabie AB: Systemic effect of crude extract from rhizome of Drynaria

fortunei on bone formation in mice. Phytotherapy Research 20: 313-315, 2006

91. Xiao P, Shen H, Guo YF, Xiong DH, Liu YZ, Liu YJ, Zhao LJ, Long JR, Guo Y,

Recker RR, Deng HW: Genomic regions identified for BMD in a large sample

including epistatic interactions and gender-specific effects. J Bone Miner Res 21:

1536-1544, 2006

92. Xiong DH, Liu XG, Guo YF, Tan LJ, Wang L, Sha BY, Tang ZH, Pan F, Yang TL,

Chen XD, Lei SF, Yerges LM, Zhu XZ, Wheeler VW, Patrick AL, Bunker CH, Guo

- 84 -

Y, Yan H, Pei YF, Zhang YP, Levy S, Papasian CJ, Xiao P, Lundberg YW, Recker

RR, Liu YZ, Liu YJ, Zmuda JM, Deng HW: Genome-wide association and follow-

up replication studies identified ADAMTS18 and TGFBR3 as bone mass candidate

genes in different ethnic groups. Am J Hum Genet 84: 388-398, 2009

93. Xu XH, Dong SS, Guo Y, Yang TL, Lei SF, Papasian CJ, Zhao M, Deng HW:

Molecular genetic studies of gene identification for osteoporosis: the 2009 update.

Endocr Rev 31: 447-505, 2010

94. Yi JM, Kim MS, Koo HN, Song BK, Yoo YH, Kim HM: Poncirus trifoliata fruit

induces apoptosis in human promyelocytic leukemia cells. Clin Chim Acta 340: 179-

185, 2004

95. Yun SI, Yoon HY, Jeong SY, Chung YS: Glucocorticoid induces apoptosis of

osteoblast cells through the activation of glycogen synthase kinase 3beta. J Bone

Miner Metab 27: 140-148, 2009

- 85 -

- 국문요약-

골다공증에서의

Annexin A6 의 역할

아주대학교 대학원 의생명과학과

김 보 영

(지도교수: 정 선 용)

골다공증은 골량의 감소와 뼈조직의 미세구조의 이상으로 뼈의 강도가

약해져서 가벼운 충격에도 쉽게 골절이 발생되는 질환이다. 골량은 조골세포에

의한 뼈형성과 파골세포에 의한 뼈의 재흡수 상호작용에 의해서 조절되며,

다양한 인자들이 조골세포와 파골세포의 작용에 관여함으로써 골의 형성, 성장

및 골 재형성의 과정에 영향을 미치게 된다. 골다공증은 다수의 유전적 요인과

환경적 요인이 복합적으로 관여하는 다인자성 질환으로 알려져 있으며, 그

발병원인에 따라 원발성인 폐경후 골다공증, 노인성 골다공증과 속발성인

당질코르티코이드 약제로 인한 골다공증으로 분류된다. 최근 고령화로 인한

골다공증 발병률이 크게 증가되고 있어 중요한 연구 주제로 대두되고 있다.

본 연구에서는 부작용이 적고 효과적인 당질코르티코이드-유도성 골다공증

치료제의 개발과 질병 작용기전 규명을 목적으로, 다양한 국내 자생식물로부터

유래된 천연추출물에서 조골세포사멸 억제 효과를 탐색하고, 선정된 추출물의

조골세포사멸 억제 기전을 유전자 수준에서 규명하고자 하였다.

당질코르티코이드-유도성 골다공증 세포 모델에서 국내 자생식물 68 종의

천연추출물을 대상으로 조골세포 사멸 억제 효과를 스크리닝 한 결과, 4 종류의

- 86 -

천연물에서 효과를 확인하였다. 그 중, 아직까지 골다공증과의 관련성에 대한

보고가 없는 지실(Poncirus trifoliata)을 본 연구의 연구재료로 선정하였다.

유효물질 추출과정에서 지실의 헥산추출물 (hexane extract)에서

당질코르티코이드-유도 조골세포의 세포사멸 억제 효과를 확인하였다. 또한,

마우스 실험에서 지실 헥산추출물이 당질코르티코이드-유도 골다공증 유발

마우스의 골밀도 감소 억제에 큰 효과가 있음을 확인 하였다.

다음 연구로, 지실 헥산추출물의 작용 기전을 분자 수준에서 밝히기 위해,

당질코르티코이드-유도 조골세포에서 지실 헥산추출물의 첨가에 따라 발현량이

변화되는 유전자(differentially expressed gene, DEG)를 annealing control

primer 를 이용한 RT-PCR differential display 방법으로 스크리닝 하였다. 그

결과, C3H10T1/2 조골모세포와 MC3T3-E1 조골세포에서 당질코르티코이드

일종인 dexamethasone(Dex)처리에 의해 발현량이 증가되었으나 지실

헥산추출물의 동시 처리에 의해 증가된 발현량이 다시 감소된 AnxA6 유전자를

동정하였다. 이 결과를 in vitro 및 in vivo 에서 검정하기 위하여, gene specific

primer 를 이용한 real time RT-PCR 과 항체를 이용한 Western blotting 을

실시하였으며, 결과적으로 골다공증 유도 조골세포와 골다공증 유도 마우스에서

지실 헥산추출물에 의한 AnxA6 발현량의 변화를 확인하였다. 이러한

결과로부터, 지실 헥산추출물에 의한 골다공증 효과는 AnxA6 유전자의

발현량과 밀접한 관련이 있음을 알 수 있다.

다음으로 AnxA6 를 비롯하여 당질코르티코이드가 유도된 조골세포에서

발현량이 크게 변화되는 유전자들에 대한 단일 염기서열 다형성(single

nucleotide polymorphism, SNP)과 골다공증과의 상관성을 확인하여

골다공증에 관여하는 새로운 유전적 소인을 찾고자 하였다. 먼저,

당질코르티코이드 유도 조골세포와 난소 절제법으로 골다공증이 유발된

마우스에서 대조군과 비교하여 유전자의 발현양상에 변화가 확인된 7 종의

유전자, AnxA6, Col5a1, Col6a2, Eno1, Myof, Nfib, Scara5 를 선정하였다.

이들 유전자들의 다형성과 골밀도/골다공증 형질과의 상관관계를 사람에서

확인하기 위하여, 3570 명의 한국인 여성 코호트에서 SNP-질환 형질의

- 87 -

상관관계 분석을 실시하였다. 최종적으로 5 종의 유전자들 (ANXA6, COL5A1,

ENO1, MYOF, SCARA5) 의 유전적 다형성이 골밀도/골다공증과 유의하게 연관

되어 있음이 밝혀졌다. 특히, ANXA6 유전자의 경우는 Bonferroni –correction

유의 수준을 만족하였다.

결론적으로, 당질코르티코이드로 유도된 골다공증의 예방 및 치료에

효과적인 천연물로서 지실 헥산추출물이 동정되었으며, ANXA6 유전자의 발현

정도가 이러한 효과에 밀접하게 연관되어 있음을 밝혔다. 또한, ANXA6

유전자의 다형성과 여성의 골밀도/골다공증 형질간에 매우 유의한 상관관계가

있음을 밝혔다. 이러한 결과로부터, ANXA6 유전자가 골다공증의 유전적 소인일

가능성이 시사된다. 본 연구 결과는, 당질코르티코이드로 유도된 골다공증의

기전을 이해하고 예방 및 부작용이 적은 치료제 개발에 유용하게 활용 될

것으로 기대된다.

________________________________________________________________________

핵심어: 골다공증, 지실, 당질코르티코이드, Annexin A6(ANXA6), 조골세포,

골밀도, differentially expressed gene (DEG), 단일 유전자 다형성(SNP),

상관관계, 마우스, 사람