DNA Sequencing. CS273a Lecture 3, Spring 07, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT

DNA Sequencing

CS273a Lecture 3, Spring 07, Batzoglou

DNA sequencing

How we obtain the sequence of nucleotides of a species

…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…


Which representative of the species?

Which human?

Answer one:

Answer two: it doesn’t matter

Polymorphism rate: number of letter changes between two different members of a species

Humans: ~1/1,000

Other organisms have much higher polymorphism rates Population size!


Why humans are so similar

A small population that interbred reduced the genetic variation

Out of Africa ~ 40,000 years ago

Out of Africa

Heterozygosity: H

H = 4Nu/(1 + 4Nu)

u ~ 10-8, N ~ 104

H ~ 410-4

N


Human population migrations

• Out of Africa, Replacement “Grandma” of all humans (Eve) ~150,000yr

• Ancestor of all mtDNA

“Grandpa” of all humans (Adam) ~100,000yr• Ancestor of all Y-chromosomes

• Multiregional Evolution Fossil records show a continuous change of

morphological features Proponents of the theory doubt mtDNA and

other genetic evidence

• New fossil records bury “multirigionalists” Nice article in Economist on thathttp://www.economist.com/science/displaystory.cfm?story_id=9507453


DNA Sequencing – Overview

• Gel electrophoresis Predominant, old technology by F. Sanger

• Whole genome strategies Physical mapping Walking Shotgun sequencing

• Computational fragment assembly

• The future—new sequencing technologies Pyrosequencing, single molecule methods, … Assembly techniques

• Future variants of sequencing Resequencing of humans Microbial and environmental sequencing Cancer genome sequencing

1975

2015


DNA Sequencing

Goal:

Find the complete sequence of A, C, G, T’s in DNA

Challenge:

There is no machine that takes long DNA as an input, and gives the complete sequence as output

Can only sequence ~900 letters at a time


DNA Sequencing – vectors

+ =

DNA

Shake

DNA fragments

VectorCircular genome(bacterium, plasmid)

Knownlocation

(restrictionsite)


Different types of vectors

VECTOR Size of insert

Plasmid2,000-10,000

Can control the size

Cosmid 40,000

BAC (Bacterial Artificial Chromosome)

70,000-300,000

YAC (Yeast Artificial Chromosome)

> 300,000

Not used much recently


DNA Sequencing – gel electrophoresis

1. Start at primer(restriction site)

2. Grow DNA chain

3. Include dideoxynucleoside (modified a, c, g, t)

4. Stops reaction at all possible points

5. Separate products with length, using gel electrophoresis


Electrophoresis diagrams


Reading an electropherogram

1. Filtering

2. Smoothening

3. Correction for length compressions

4. A method for calling the letters – PHRED

PHRED – PHil’s Read EDitor (by Phil Green)

Almost 15 years old method

Newer methods may be better, but labs are reluctant to change


Output of PHRED: a read

A Sanger read: 500-1000 bp

A C G A A T C A G …A

16 18 21 23 25 15 28 30 32 …21

Quality scores: -10log10Prob(Error)

Reads can be obtained from leftmost, rightmost ends of the insert

Double-barreled sequencing: (1990)

Both leftmost & rightmost ends are sequenced, reads are paired


Method to sequence longer regions

cut many times at random (Shotgun)

genomic segment

Get one or two reads from each segment

~900 bp ~900 bp


Reconstructing the Sequence (Fragment Assembly)

Cover region with high redundancy

Overlap & extend reads to reconstruct the original genomic region

reads


Definition of Coverage

Length of genomic segment: GNumber of reads: NLength of each read: L

Definition: Coverage C = N L / G

How much coverage is enough?

Lander-Waterman model: Prob[ not covered bp ] = e-C

Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotides

C


Repeats

Bacterial genomes: 5%Mammals: 50%

Repeat types:

• Low-Complexity DNA (e.g. ATATATATACATA…)

• Microsatellite repeats (a1…ak)N where k ~ 3-6(e.g. CAGCAGTAGCAGCACCAG)

• Transposons SINE (Short Interspersed Nuclear Elements)

e.g., ALU: ~300-long, 106 copies LINE (Long Interspersed Nuclear Elements)

~4000-long, 200,000 copies LTR retroposons (Long Terminal Repeats (~700 bp) at each end)

cousins of HIV

• Gene Families genes duplicate & then diverge (paralogs)

• Recent duplications ~100,000-long, very similar copies


Sequencing and Fragment Assembly

AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT

3x109 nucleotides

50% of human DNA is composed of repeats

Error!Glued together two distant regions


What can we do about repeats?

Two main approaches:• Cluster the reads

• Link the reads




• Link the reads




• Link the reads




3x109 nucleotides

C R D

ARB, CRD

or

ARD, CRB ?

A R B




3x109 nucleotides


Strategies for whole-genome sequencing

1. Hierarchical – Clone-by-clonei. Break genome into many long piecesii. Map each long piece onto the genomeiii. Sequence each piece with shotgun

Example: Yeast, Worm, Human, Rat

2. Online version of (1) – Walkingi. Break genome into many long piecesii. Start sequencing each piece with shotguniii. Construct map as you go

Example: Rice genome

3. Whole genome shotgun

One large shotgun pass on the whole genome

Example: Drosophila, Human (Celera), Neurospora, Mouse, Rat, Dog


Hierarchical Sequencing


Hierarchical Sequencing Strategy

1. Obtain a large collection of BAC clones2. Map them onto the genome (Physical Mapping)3. Select a minimum tiling path4. Sequence each clone in the path with shotgun5. Assemble6. Put everything together

a BAC clone

mapgenome

Documents

DNA Sequencing. CS273a Lecture 3, Spring 07, Batzoglou DNA sequencing How we obtain the sequence of nucleotides of a species …ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT