Downloaded from on May 27, 2020 by guest · 10-01-2019 · 4 Richa Misra 1, Dilip Menon 2, Gunjan Arora 1, Richa Virmani 1, Mohita Gaur 3, Saba Naz 4, 5 Neetika Jaisinghani 2, Asani

Multimode SigF regulation in M. tuberculosis

1

Tuning the Mycobacterium tuberculosis alternative sigma factor SigF through the 1

multidomain regulator Rv1364c and osmosensory kinase, protein kinase D 2

3

Richa Misra1, Dilip Menon

2, Gunjan Arora

1, Richa Virmani

1, Mohita Gaur

3, Saba Naz

4, 4

Neetika Jaisinghani2, Asani Bhaduri

1, Ankur Bothra

2, Abhijit Maji

1, Anshika Singhal

1, Preeti 5

Karwal1, Christian Hentschker

5, Dörte Becher

5, Vivek Rao

2, Vinay K. Nandicoori

4, Sheetal 6

Gandotra2#

, Yogendra Singh

1,3# 7

8

1Allergy and Infectious Disease Unit, CSIR-Institute of Genomics and Integrative Biology, 9

Mall Road, Delhi-110007 10

2Chemical and Systems Biology Division, CSIR-Institute of Genomics and Integrative 11

Biology, Mathura Road, New Delhi-110020 12

3Department of Zoology, University of Delhi, Delhi 110007 13

4National Institute of Immunology, Delhi- 110067 14

5Institute of Microbiology, Ernst-Moritz-Arndt-University Greifswald, D-17487 Greifswald, 15

Germany. 16

17

Running Head: Multimode SigF regulation in M. tuberculosis 18

19

#Address correspondence to Sheetal Gandotra ([email protected]) or Yogendra 20

Singh ([email protected]) 21

22

KEYWORDS: Mycobacterium tuberculosis; sigma factor; protein‐protein interaction; 23

serine/threonine protein kinase 24

25

JB Accepted Manuscript Posted Online 14 January 2019J. Bacteriol. doi:10.1128/JB.00725-18Copyright © 2019 American Society for Microbiology. All Rights Reserved.

on February 5, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


2

ABSTRACT 26

Bacterial alternative sigma factors are mostly regulated by a partner-switching mechanism. 27

Regulation of the virulence associated alternative sigma factor, SigF, of Mycobacterium 28

tuberculosis, has been an area of intrigue with more predicted regulators compared to other 29

sigma factors in this organism. Rv1364c is one such predicted regulator, the mechanism of which 30

is confounded by the presence of both anti-sigma and anti-sigma-antagonist functions in a single 31

polypeptide. Using protein binding and phosphorylation assays, we demonstrate that the anti-32

sigma factor domain of Rv1364c mediates autophosphorylation of its antagonist domain and 33

binds efficiently to SigF. Furthermore, we identified a direct role for the osmosensor 34

serine/threonine kinase PknD in regulating the SigF-Rv1364c interaction, adding to the current 35

understanding about intersection of these discrete signaling networks. Phosphorylation of SigF 36

also showed functional implications in its DNA binding ability, which may help in activation of 37

regulon. In M. tuberculosis, osmotic stress-dependent induction of espA, a SigF target involved 38

in maintaining cell wall integrity, is curtailed upon overexpression of Rv1364c, showing its role 39

as an anti-SigF factor. Overexpression of Rv1364c led to induction of another target, pks6, 40

involved in lipid metabolism. This induction is, however, curtailed in presence of osmotic stress 41

conditions, suggesting modulation of SigF target gene expression via Rv1364c. This data 42

provides evidence that Rv1364c acts an independent SigF regulator, sensitive to osmosensory 43

signal, mediating crosstalk of PknD with SigF regulon. 44

45

IMPORTANCE 120 words 46

Mycobacterium tuberculosis, capable of latently infecting the host and causing aggressive tissue 47

damage during active tuberculosis is endowed with a complex regulatory capacity built of 48


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


3

several sigma factors, protein kinases and phosphatases. These proteins regulate expression of 49

genes that allow the bacteria to adapt to various host-derived stresses like nutrient starvation, 50

acidic pH, and hypoxia The cross-talk between these systems is not well understood. SigF is one 51

such regulator of gene expression that helps M. tuberculosis to adapt to stresses and imparts 52

virulence. This work provides evidence for its inhibition by the multidomain regulator Rv1364c, 53

and activation by the kinase PknD. The co-existence of negative and positive regulators of SigF 54

in pathogenic bacteria reveals an underlying requirement for tight control of virulence factor 55

expression. 56

57

INTRODUCTION 58

Mycobacterium tuberculosis, responsible for highest mortality due to any single bacterial 59

infection worldwide, is endowed with a genome enriched in signal transduction and gene 60

regulatory modules (1, 2). Alternative sigma () factors provide bacteria with the means to 61

simultaneously regulate many genes in response to altered environmental or developmental 62

signals encountered during the infection process (3, 4). Sigma factor F, the general stress 63

response factor of M. tuberculosis is implicated in persistence (5, 6). A sigF deletion mutant of 64

M. tuberculosis is attenuated in the murine and guinea pig model of tuberculosis (7-9). Although 65

SigF regulon is characterized in several studies (7, 10-14) and includes many genes involved in 66

cell surface modification and virulence factor secretion (7, 14), there is a stark lack of uniformity 67

in phenotypic behavior of SigF mutant/overexpression strains in different studies, mostly 68

attributed to the differences in the M. tuberculosis strain used (CDC1551 versus H37Rv) (8, 10, 69

12). Furthermore, very little is understood in how signals perceived in the host enable switching 70

to the alternative factor. 71


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


4

Availability of most alternative σ factors is governed by a complex partner-switching 72

system controlled by phosphorylation-dependent regulation, best exemplified by the Bacillus 73

subtilis general stress response σ factor, SigB (15). Under unstressed conditions, SigB is 74

inactivated by the anti-σ factor, RsbW, which physically binds to it and thus prevents association 75

of SigB with RNA polymerase. The anti-σ factor antagonist, RsbV can bind and sequester RsbW 76

in an unphosphorylated form, but this is prevented by the kinase activity of RsbW. This system 77

is, in turn, regulated by two phosphatases, RsbP and RsbU, which on sensing different stress 78

signals dephosphorylate RsbV. Another set of anti-σ factor and anti-σ factor antagonist 79

homologs control the activity of RsbU. Upon dephosphorylation by either RsbP/RsbU, RsbV 80

binds RsbW, thus enabling the stress-dependent transcription by SigB containing holoenzyme 81

(15). However, the regulation of B. subtilis SigB homolog in M. tuberculosis, SigF, is not very 82

well understood. Co-transcribed with sigF, usfX encodes the cognate anti-σ factor for SigF (16). 83

Apart from this, other putative anti-σ factor regulators (Rv0516c, Rv1364c, Rv1365c, Rv1904, 84

Rv2638, Rv3687c) are present in the genome, some of which have been characterized as 85

antagonists (16-23); however, ambiguity remains about their role vis-à-vis SigF. Although 86

protein homology provides vital clues, it is difficult to extrapolate the function of these 87

regulators. A study by Hatzios et al revealed activation of SigF regulon upon disruption of 88

Rv0516c, questioning its role as an anti-σ factor antagonist (24). The existence of multiple 89

regulators for SigF suggests that the inhibition of the alternate factor must also be crucial to its 90

survival or pathogenesis. Rv1364c of M. tuberculosis is unique in its domain architecture, in that 91

it mimics a tandem array of domains [sensor - phosphatase - kinase -anti- antagonist] in a single 92

polypeptide where the kinase domain is predicted to work as the anti- factor domain (17, 19, 93


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


5

20, 22, 23). Its function vis-à-vis an antagonist or agonist of SigF remains elusive, since both 94

regulatory domains are present in a single protein. 95

In the present work, we demonstrate that Rv1364c functions primarily as a bonafide anti-96

SigF factor. We show that the kinase activity of Rv1364c is essential for its autophosphorylation 97

of the anti- antagonist domain and is capable of binding to SigF in the autophosphorylated 98

form. This may have significance in restraining SigF activity under normal growth conditions. 99

Through an independent mechanism, protein kinase D (PknD), a eukaryotic-like serine/threonine 100

protein kinase (STPK), induced phosphorylation of both proteins and mobilized SigF release 101

from Rv1364c. PknD overexpression in an earlier study has been shown to induce SigF regulon 102

indirectly (18), here we find evidence for a direct mechanistic link through phosphorylation-103

dependent dissociation with its anti- factor. 104

105

RESULTS 106

Autophosphorylation of recombinant Rv1364c and its effect on interaction with SigF 107

Previous studies on characterization of Rv1364c reported presence of an active phosphatase 108

domain in Rv1364c with D211 and D328 identified as the active site residues (19, 22). The 109

kinase activity has been questionable by two opposing reports, with both uncertain about the 110

activity of the full-length protein (19, 20). The kinase domain of Rv1364c (RsbW) is reported to 111

possess the characteristic Bergerat fold of the GHKL (gyrase, Hsp90, histidine kinase, MutL) 112

ATPase/kinase superfamily (19, 20, 23). Our earlier attempts at characterizing this protein had 113

demonstrated an inability of the protein to execute -32

P-ATP transfer to the C-terminal anti-σ 114

factor antagonist domain, belonging to the Sulfate Transporter and Anti-Sigma factor antagonist 115

(STAS) family (19). We reasoned that this could be due to the dominant activity of the 116


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


6

phosphatase in preventing retention of the transferred 32

P. To further assess the activity of the 117

anti-σ factor domain, we probed the ATPase activity of the full-length protein and found that it 118

can indeed hydrolyze ATP. The kinase conserved active site residues, E444 and N448, based on 119

sequence homology to B. subtilis proteins (19, 20, 23), were crucial for the ATPase activity 120

(Figure 1A). Surprisingly, the phosphomimetic mutant of the conserved phospho-acceptor 121

residue (Rv1364cS600E) showed comparable activity to the full-length wild-type protein (Figure 122

1A). So, we further probed if phosphorylation at the predicted S600 site was dependent on the 123

kinase activity of Rv1364c. Using the phosphoprotein stain- Pro-Q®

Diamond, we measured the 124

phosphorylation status of the purified full-length protein Rv1364c. We observed that Rv1364c 125

was efficiently phosphorylated under standard purification procedures (Figure 1B). To explore 126

the mechanism of autophosphorylation and to rule out phosphorylation due to any Escherichia 127

coli kinase, we also probed the phosphorylation status of Rv1364c variants. Mutations in the 128

kinase domain (N448A, E444A) and conserved phosphoacceptor site S600 in substrate domain 129

abolished the phosphorylation (Figure 1B). On the other hand, mutations in conserved active site 130

residues of phosphatase domain (D211A and D328A) had no effect on phosphorylation status of 131

the protein. Thus, our results indicate that Rv1364c is found in phosphorylated form when 132

expressed in E. coli and provides a plausible reason why previous attempts at detecting -32

P of 133

ATP being transferred at this site failed (19). The autophosphorylation at S600, however, does 134

not confer any additional advantage to the interaction of Rv1364c with SigF (Figure 1C). In view 135

of our previous study (19) and present results, we therefore establish that full length Rv1364c 136

possesses both phosphatase and kinase activities and can efficiently bind to SigF independent of 137

its autophosphorylation. Since PknD is known to influence SigF regulon (18), we explored the 138

crosstalk of this STPK with the SigF-Rv1364c protein pair. 139


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


7

140

Rv1364c and SigF are reversibly phosphorylated by PknD in vitro 141

STPK-mediated phosphorylation fine-tunes a variety of cellular processes in Mycobacterium 142

spp. to help these organisms rapidly adapt to host-derived stresses (25, 26). Studies have 143

suggested crosstalk of STPK-mediated signaling and σ factor regulatory systems, indicating 144

importance of multimode regulation of transcription (18, 24, 27). PknD helps M. tuberculosis to 145

adapt to osmotic stress by regulating SigF regulon, however, the exact mechanism of how SigF 146

is activated (released from its cognate anti- factors) is yet unknown (24). We performed in vitro 147

γ-32

P ATP transfer assay with PknD and His6-tagged Rv1364c and found efficient 148

phosphorylation of Rv1364c by PknD (Figure 2A). The kinase domain of PknD and Rv1364c are 149

approximately the same size; therefore, to authenticate phosphotransfer to Rv1364c rather than 150

autophosphorylation of PknD in this assay, the reaction end-products were treated with TEV 151

protease that cleaves the affinity tag from Rv1364c. Retention of radioactivity on the digested 152

product validates PknD mediated phosphorylation of Rv1364c (Figure 2A). Moreover, the 153

S600A mutant retained the ability to be phosphorylated by PknD, suggesting additional 154

phosphorylation sites on Rv1364c (Figure 2A). Independently, Rv1364c cloned with a bigger 155

MBP tag was also subjected to kinase assay in presence of wild-type PknD/PknDD138N kinase-156

dead mutant/WT PknD in presence of its specific inhibitor SP600125, to confirm PknD-mediated 157

phosphorylation of Rv1364c (Figure 2B). The complete loss of phosphorylation of Rv1364c in 158

presence of inhibitor and PknD kinase-dead mutant confirmed the specificity of the reaction. 159

Previously reported substrate of PknD, Rv0516c (18), was included as a positive control in these 160

assays. 161


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


8

To test if extrinsic signals received by STPKs can also affect SigF directly, we performed in 162

vitro γ-32

P ATP transfer assays with purified full-length/ kinase domains of PknA, PknB, PknD, 163

PknE, PknF, PknG, and PknH. The kinase domain of PknD performed the most efficient 164

phosphorylation of SigF (Figure 2C), although other STPKs were also capable of 165

phosphorylating it. The specificity of PknD-mediated phosphorylation of SigF was also 166

confirmed with PknD-kinase dead mutant (Figure 2D). The PknD-mediated phosphorylation of 167

Rv1364c and SigF is reversed by PstP (Figure 2E and 2F), the cognate phospho-Ser/Thr 168

phosphatase, denoting the reversible regulation of their effector functions. 169

170

PknD-phosphorylation attenuates interaction of SigF with its anti-σ factor, Rv1364c 171

PknD-mediated phosphorylation of Rv1364c and SigF was validated in vivo, using E. coli as a 172

surrogate host (Figure 3A). Rv1364c or SigF, co-expressed with PknD in vivo, were purified to 173

assess phosphorylation. Pro-Q®

Diamond staining of purified Rv1364c (His-tagged) and SigF 174

(GST-tagged) showed phosphorylation (Figure 3A). Two-dimensional-gel electrophoresis and 175

immunoblot analysis of native Rv1364c and Rv1364c co-expressed with PknD in E. coli was 176

also performed which indicated multiple acidic phospho-isoforms of Rv1364c generated by 177

PknD, as compared to the native Rv1364c confirming additional phosphorylation sites (Figure 178

3B). Through mass-spectrometry, we identified PknD mediated phosphorylation of Rv1364c on 179

multiple threonine and serine residues (Thr54, Thr81, Thr299, Thr390, Thr520, Thr568 and 180

Ser506) (Supplementary Figure S1). The results suggest that PknD directly phosphorylates the 181

alternative σ factor, SigF and its regulator Rv1364c. 182

To examine the effect of PknD-mediated phosphorylation on the SigF-Rv1364c 183

interaction in vitro, SigF and Rv1364c were co-expressed with and without PknD in the pACYC 184


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


9

three-way protein expression system to obtain the phosphorylated and unphosphorylated forms 185

of these proteins (Figure 3A). The protein-protein interaction was analyzed by sandwich ELISA. 186

Although the phosphorylation of only one of the interacting proteins (SigF or Rv1364) did not 187

lead to significant loss of interaction (Figure 3C), as shown in the figure inset, interaction 188

between SigF and Rv1364c reduces significantly upon in vivo phosphorylation of both proteins 189

by PknD. 190

191

PknD-phosphorylated SigF mediates tighter complex formation with RNA polymerase 192

We questioned whether PknD-phosphorylated SigF retains its ability to recruit RNA polymerase 193

to its cognate promoter. Purified SigF bound to the sigF promoter in a RNA core polymerase 194

dependent manner (Figure 4A). Using sigF promoter as the target sequence, we checked the 195

ability of SigF and PknD-phosphorylated SigF (pSigF) to recruit E. coli core RNA polymerase to 196

this DNA by electrophoretic mobility shift assay (EMSA). We found that purified SigF and 197

pSigF enable DNA-protein complex formation with RNA polymerase in a dose dependent 198

manner (Figure 4B). The phosphorylated protein reached saturation of binding at a lower protein 199

concentration (Figure 4B and 4C). Additional protein-DNA complexes of lower and higher 200

mobility were found with PknD phosphorylated SigF compared to that with SigF (asterix in 201

Figure 4B). Competition with non-radioactive probe confirmed specificity of the interaction in 202

both cases. However, release of only 50% of the radioactive probe from the pSigF-RNA 203

polymerase-DNA complex compared to 80% from the unphosphorylated SigF counterpart, at 204

even 40 times the competing probe concentration suggested tighter complex formation by pSigF 205

compared to SigF (Figure 4D and E). In view of the previous reports where PknD overexpression 206

led to activation of SigF regulon (18), our results show direct evidence of the effect of PknD-207


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


10

mediated phosphorylation of SigF on its DNA-binding ability and thereby its effect on the 208

regulon. Thus, phosphorylation of SigF by PknD is not only responsible for dissociation with its 209

anti- factor but also causes tight binding of pSigF-RNA polymerase to DNA. 210

211

Rv1364c overexpression quenches SigF target gene espA induction in osmotic stress 212

To understand how Rv1364c regulates SigF under stress, we looked at its role in the 213

osmosensory signaling pathway. Hatzios et al illustrated the PknD-mediated osmosensory 214

activation of the SigF regulon gene espA, which enables M. tuberculosis to adapt to osmotic 215

stress by cell wall remodeling and virulence factor production (24). We studied whether the 216

induction of this gene is affected by the action of Rv1364c as either anti-SigF or anti-SigF 217

antagonist. Approximately 25-fold overexpression of Rv1364c was achieved by the plasmid 218

pTC0X1Rv1364c in M. tuberculosis H37Rv (Figure 5A). As shown earlier (24), osmotic stress 219

led to a modest but statistically significant increase in expression of espA (Figure 5B). The 220

ability to increase espA expression in response to osmotic stress was curtailed in cultures 221

harboring the overexpression plasmid pTC0X1-Rv1364c (Figure 5B). This suggested Rv1364c 222

to function as an anti-SigF factor. We studied another probable SigF target gene, the expression 223

of which is not regulated by osmotic stress in wild type cells, pks6 (7, 24). Expression of pks6 224

was indeed not induced by osmotic stress in the empty vector containing strain (Figure 5C). Cells 225

overexpressing Rv1364c were found to express 50% higher levels of pks6 compared to the 226

control strain, probably due to an anti-SigF antagonist function in the basal state. Exposure to 227

osmotic stress under this scenario led to approximately 50% reduction in the expression of pks6, 228

proposing activation of anti-SigF property of Rv1364c by osmotic stress. Together, these data 229


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


11

verify the role of osmotic stress mediated control of SigF target genes via Rv1364c in M. 230

tuberculosis. 231

232

Distribution of Rv1364c-, SigF-, and PknD-like sequences in actinomycetes 233

Earlier reports of divergence in SigF orthologs in M. tuberculosis and M. smegmatis and in 234

general in pathogenic versus non-pathogenic mycobacteria suggests that divergent regulatory 235

circuits of SigF activation may play an important role in virulence associated features of this 236

alternative factor (28, 29). The phylogenetic analysis of Rv1364c orthologs revealed that 237

members from pathogenic mycobacteria form a distinct clade and appear phylogenetically closer 238

to some non-mycobacterial actinobacterial members (Supplementary Figure S2A). We observed 239

that the multidomain architecture is conserved in some actinobacterial species such as 240

Actinoplanes friuliensis, Nakamurella multipartita, Rhodococcus ruber, Modestobacter marinus, 241

Amycolatopsis vancoresmycina, Actinomadura madurae apart from the pathogenic 242

Mycobacterium. While A. madurae is an opportunistic human pathogen (30), R. ruber is a 243

species closely related to a known opportunistic human pathogen, Rhodococcus equi. A. 244

friuliensis and A. vancoresmycina are producers of friulimycin and vancoresmycin, respectively 245

(31, 32). Since these environmental organisms are relatively less studied, we suggest that such 246

unique multidomain-fusion event may endow these organisms with means to adapt to 247

environmental and host derived stresses. The non-pathogenic mycobacterial clade conspicuously 248

lacked the phosphatase-kinase-STAS occurrence. SigF orthologs formed three distinct clades of 249

pathogenic, non-pathogenic Mycobacterium and non-mycobacterial actinomycetes 250

(Supplementary Figure S2B). Interestingly, M. tuberculosis PknD sequence-specific features 251

(viz. kinase domain + NHL repeats) are mostly conserved in the pathogenic Mycobacterium sp. 252


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


12

only (Supplementary Figure S2C). This suggests presence of a co-regulatory mechanism for 253

SigF-Rv1364c-PknD in face of specific stresses faced by these pathogenic members. 254

255

DISCUSSION 256

M. tuberculosis SigF draws parallels with B. subtilis SigB, by virtue of sequence 257

homology. Compared to the paradigm of stressosome-dependent regulation of SigB in B. subtilis 258

(33-35), a stressosome-independent control mechanism exists in M. tuberculosis for its homolog, 259

SigF (Figure 6). Since Bacillus only possesses stand-alone proteins possessing regulatory 260

domains, M. tuberculosis probably evolved an alternate strategy to influence this interaction. 261

While phosphorylation-dephosphorylation mediated by GHKL family of kinases and PP2C 262

phosphatases, respectively, is known to govern the opposing activities of regulatory proteins of 263

SigB in B. subtilis (15), the regulation of M. tuberculosis SigF is not yet completely clear. 264

Interestingly, bioinformatics analyses revealed similar co-evolution pattern of SigF and its 265

regulator, Rv1364c among Mycobacterium genus (Supplementary Figure S2). Domain 266

architecture of Rv1364c possesses a unique arrangement of ‘sensor-PP2C phosphatase-GHKL 267

kinase-STAS’ domains conserved only among the pathogenic mycobacterial members (19, 20, 268

23), suggesting additional ways to control virulence-associated SigF in face of stresses (Figure 6 269

and Supplementary Figure S2). While Rv1364c possesses both phosphatase and kinase activities, 270

it primarily acts as a SigF anti-σ factor, with dominant autophosphorylation at the conserved 271

serine residue of STAS domain (Figure 1). The signal required for the switch to phosphatase 272

activity is not known yet. The eukaryotic-like STPK, PknD, has been implicated in activation of 273

SigF regulon in osmotic stress, albeit indirectly (18, 24). Here we describe a direct cross-talk 274

between PknD with SigF and its regulator, Rv1364c (Figure 2 and 3). The PknD mediated 275


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


13

phosphorylation sites in Rv1364c identified in this work map to the different domains of the 276

protein. These findings provide new directions towards understanding regulation of SigF 277

function. 278

While STPKs have been described to target other mycobacterial σ factor regulators (27, 279

36), the role of phosphorylation of a σ factor has never been described in bacteria. In the plant 280

Arabidopsis thaliana, SIG1 phosphorylation leads to inhibition of RNA polymerase recruitment 281

to photosystem-I (PS-I) promoter, thereby helping in the switch to PSII in response to redox 282

stress (37). Phosphorylation dependent relief from antagonists and simultaneous activation of 283

RNA polymerase recruitment would form a positive feed forward loop for activation of the target 284

σ factor regulon. Our work provides evidence for such a positive feed forward activation 285

mechanism of SigF by an extracellular sensor kinase, PknD, by not only destabilization of its 286

interaction with its anti-σ factor, Rv1364c, but simultaneous activation of its RNA polymerase 287

recruitment function (Figure 3 and 4). One of the possible consequences may be to initiate more 288

frequent pulses of transcription initiation events, a phenomenon associated with amplification of 289

output in response to stress (38). Phosphorylated SigF may variably occupy certain targets of 290

SigF regulon, depending on the affinity of promoter, leading to differential gene expression at 291

various time points in stress conditions. It remains to be deciphered what signals modulate 292

activation of the Ser/Thr phosphatase PstP that will drive the bacterial transcriptional regulation 293

in the opposite direction. 294

A high density of SigF targets are involved in lipid metabolism and cell surface changes 295

(11, 14). PknD activation by osmotic stress was shown to regulate espA via Rv0516c in 296

CDC1551 strain of M. tuberculosis (24). espA, an essential component of the ESX-1 secretion 297

system, is involved in maintaining integrity of the cell wall (24, 39). The lack of evidence for 298


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


14

direct interaction between Rv0516c and SigF left the pathway unlinked between phosphorylation 299

of Rv0516c by PknD and induction of SigF target espA. Our data reveals osmotic induction of 300

espA in M. tuberculosis H37Rv and inhibition of this induction upon overexpression of Rv1364c, 301

indicating its role as anti-SigF factor under osmotic stress conditions (Figure 5 and 6). Rv1364c 302

mediated repression of pks6, gene involved in cell wall lipid synthesis (40), by osmotic stress 303

also points towards its role as anti-SigF factor under osmotic stress. Interestingly, the induction 304

of pks6 upon overexpression of Rv1364c points towards an anti-sigF antagonist function which 305

could be mediated through interaction with other SigF regulators. These results put forward 306

another example of the intersection of signaling pathways mediated by eukaryotic-like STPKs 307

and alternative sigma factors, highlighting the tight regulation of signal transduction mechanism 308

in M. tuberculosis. 309

310

EXPERIMENTAL PROCEDURES 311

Bacterial strains and growth conditions 312

E. coli DH5α (Novagen) was used as a host strain for cloning purposes, and BL21 (DE3) 313

(Stratagene) was used as a host strain for the expression of recombinant proteins. E. coli cells 314

were grown at 37°C in Luria Bertani broth/LB agar (DIFCO) plates, supplemented with 100 315

μg/ml of ampicillin and/or 25μg/ml of kanamycin, when needed. M. tuberculosis H37Rv was 316

grown in Middlebrook 7H9 broth (DIFCO) supplemented with 0.2% glycerol, 0.05% Tween80 317

and ADC (DIFCO), at 37°C with shaking (150 rpm). 318

319

Constructs and gene manipulation 320


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


15

pTC-mcs and pTC0X1L were kind gifts from Dirk Schnappinger, Weill Cornell Medical College 321

(Addgene # 20317, 20315) (41). The clones for GST or His6-tagged STPKs and PstPcat were used 322

from previous studies (42-44). The plasmid coding for M. tuberculosis SigF, pLCD1, was kindly 323

provided by Dr. W. R. Bishai (Johns Hopkins School of Medicine, Baltimore, USA). For the co-324

expression studies, the dual expression vector pET-Duet1 (Novagen) and pACYCDuet-1 325

(Novagen) was used (45, 46). pETDuet-PknD construct was used from a previous study (45). 326

SigF was subsequently cloned in the MCS-1 region of the vector at HindIII-NotI sites. PknD 327

kinase domain amplicon was digested with NdeI and XhoI and cloned into corresponding sites in 328

MCS2 of pACYCDuet-1. Rv1364c was cloned into MCS1 of pACYCDuet-1 and pACYC-PknD 329

construct at BamHI/HindIII sites. Rv1364c was also cloned in pMAL vector to obtain MBP-330

Rv1364c. Rv0516c was cloned in pGEX-5X3 vector. All the DNA manipulations were carried 331

out according to the standard protocols. The gene segment encoding Rv1364c cloned in 332

pProExHTc and Rv1364cphosphatase domain, Rv1364ckinase domain, Rv1364csubstrate domain, Rv3287c (usfx) 333

cloned in pGEX-5X3 vector were used from a previous study (19). Mutagenesis of active site 334

residues of Rv1364c (D211A, D328A, E444A, N448A, S600A, S600E) and PknD kinase active 335

site residue (D138N) was carried out using HTc-Rv1364c construct and pGEX-PknD1-378 as 336

templates, respectively by QuikChange®

XL Site-Directed Mutagenesis Kit (Stratagene) as 337

described previously (19). The sequences of all clones were confirmed by DNA sequencing. The 338

primers and constructs used in this study are described in Table 1 and Table 2, respectively. 339

340

Purification of recombinant proteins 341

All the recombinant constructs were expressed and purified with Ni-NTA or Glutathione 342

Sepharose or Amylose resin affinity columns (Qiagen/NEB) as His6/GST/MBP-tagged fusion 343


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


16

proteins from E. coli as per manufacturer’s instructions and as described previously (42, 45). The 344

purified proteins were assessed by SDS-PAGE and all the pure fractions were pooled and 345

dialyzed with buffer (20mM Tris-HCl, pH 7.4, 10mM NaCl, and 10% glycerol). The protein 346

concentrations were estimated by BioRad protein assay kit and fractions were aliquoted and 347

stored at -80°C until further use. To get phosphorylated and unphosphorylated forms of SigF, 348

pETDuet construct co-expressing His6-SigF and MBP-PknD/His6-SigF and MBP alone were 349

transformed into E. coli BL21 (DE3) Codon Plus cells (Stratagene). Cultures were induced with 350

IPTG and further grown for 12–16 h at 18 °C. Cells were harvested and His6-tagged SigF and 351

His6-tagged phospho-SigF was purified using the procedure mentioned above. The three-way co-352

expression of SigF, Rv1364c with PknD was obtained by co-transforming pGEX-SigF plasmid 353

with pACYC-MBP-PknD-1364c/ pACYC-MBPalone-1364c plasmids in E. coli to get 354

phosphorylated and unphosphorylated forms of the proteins. The His6-tagged Rv1364c and GST-355

tagged SigF proteins were obtained from the overexpressed cultures by the purification 356

procedure mentioned above. 357

358

ATPase activity assay 359

The assay was essentially performed as described previously (47) with slight modifications. The 360

ATPase activity was determined in a reaction mixture containing 50 mM Tris-HCl pH 7.4, 1 mM 361

MgCl2, 1 mM dithiothreitol, 1.0Ci of α32

P-ATP (20Ci/mmol, BRIT, Hyderabad, India) and 362

3μg purified protein of Rv1364c, Rv1364cD211A, Rv1364cD328A, Rv1364cN444A, Rv1364cN448A, 363

Rv1364cS600A, Rv1364cS600E, Rv1747 (positive control, (48)). After 0 and 60 min incubation at 364

25°C, the products were separated by thin layer chromatography on polyethyleneimine cellulose 365

sheets (Merck) using 0.75M potassium phosphate buffer, pH 3.75, as solvent. The radioactive 366


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


17

signal on the dried sheets was visualized with PhosphorImager FLA 2000 (Fujifilm) and ATPase 367

activity was assayed by measuring the relative intensity of the product, ADP by Image Quant 368

software. 369

370

Phosphorylation state detection by fluorescent staining 371

For detection of phosphorylation state of Rv1364c, Pro-Q® Diamond phosphoprotein staining 372

(Invitrogen) was performed as per manufacturer’s instructions. Briefly, equal amounts of the 373

wild-type and mutant proteins were electrophoresed by SDS-PAGE and gels were fixed twice in 374

a solution of 50% v/v methanol and 10% v/v acetic acid and subsequently washed four times 375

with MilliQ water. The gels were stained with Pro-Q®

Diamond stain for 1.5h. To remove 376

nonspecific background, the gels were destained three times with 20% acetonitrile, 50 mM 377

sodium acetate (pH 4), followed by two additional washing steps. The gels were scanned using 378

the Typhoon Trio+ (GE Biosciences) (Excitation source: 532 nm laser, longpass emission filter: 379

560 nm). The same gels were then stained by SYPRO®

Ruby for total protein detection. To 380

differentiate between phosphorylated and unphosphorylated proteins, the ratio of Pro-Q®

381

Diamond dye to SYPRO®

Ruby dye signal intensities for each band were determined by imaging 382

software. The molecular weight marker run in parallel with the proteins also served as a control. 383

384

In vitro kinase assay 385

The in vitro kinase assays were performed by incubating 3μg of Rv1364c or SigF and 0.5–3μg of 386

STPKs to obtain for each specific kinase their optimal autophosphorylation activity in a 25μl 387

reaction mixture containing 20mM PIPES (pH 7.2), 5 mM MnCl2, 5 mM MgCl2 and 1μCi 388

γ32

P-ATP (BRIT, Hyderabad, India) for 30min at 25°C. PknD inhibitor, SP600125 was 389


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


18

dissolved in DMSO/water and added at a concentration of 20μM to the reaction (whenever 390

required), as described previously (18). Reactions were terminated by adding Laemmli sample 391

loading buffer followed by boiling at 100°C for 5 minutes. The proteins were separated by 392

10% SDS-PAGE, stained with Coomassie blue, dried and visualized by PhosphorImager FLA 393

2000 (Fujifilm)/ GE Typhoon Trio Imager. For visualization of the phosphorylation signal on 394

cleaved proteins, removal of recombinant tags was achieved by addition of proteases 395

(Thrombin (Novagen) for recombinant SigF and TEV for recombinant Rv1364c or its 396

mutants) after the kinase reaction according to manufacturer’s ins tructions. The reactions 397

were stopped using SDS buffer and resolved on 8-10% SDS-PAGE. Likewise, for 398

dephosphorylation of phosphorylated SigF and Rv1364c, reactions were incubated with 399

PstPcat (1 μg) for an additional 0, 5, 30 and 60 min at 25 °C and resolved on 10% SDS-400

PAGE. The signals were visualized by autoradiography. 401

402

Analysis of protein isoforms by two-dimensional PAGE and Immunoblotting 403

To assess the phosphorylation status of native Rv1364c and PknD phosphorylated Rv1364c, 404

equal amount of proteins were subjected to 2D-PAGE followed by immunoblotting as described 405

earlier (27, 49). Briefly, each sample was rehydrated into 7cm-long immobilized pH gradient 406

(IPG) strips with a pH range of 4-7/3.9-5.1, as appropriate (Bio-Rad). Isoelectric focusing was 407

performed for 15,000 V-h in a PROTEAN IEF Cell (Bio-Rad). After equilibration, strips were 408

loaded and resolved in the second dimension through a 10% SDS-PAGE. The proteins were 409

electrotransferred and immunoblot analysis was performed using anti-Rv1364c polyclonal sera 410

(customized antibody from Bangalore Genei India Pvt. Ltd.). The blots were developed using 411


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


19

ImmobilonTM

western chemiluminescent HRP substrate kit (Millipore) according to 412

manufacturer’s instructions. 413

414

Enzyme linked immunosorbent assay (ELISA) 415

ELISA was done using the method described by Lu et al. (50) with some modifications. Briefly, 416

the His6-tagged proteins were dissolved in coating buffer (0.1 M NaHCO3, pH 9.2) at a 417

concentration of 5 μg/ml and adsorbed (100μl/well) on the surface of a 96-well ELISA plate 418

(Maxisorb, Nunc) overnight at 4 °C. After rinsing the wells five times with wash buffer 419

(phosphate-buffered saline, pH 7.4, 0.05% Tween 20), the reactive sites were blocked with 420

blocking buffer (2% bovine serum albumin in wash buffer) for 2 h at room temperature. After 421

five washes, the adsorbed proteins were challenged with varying concentrations of GST-tagged 422

interacting proteins (100μl/well) dissolved in binding buffer (50 mM Tris pH 7.4, 200 mM NaCl, 423

0.02 % NP-40, 10 % glycerol) for 1 h at room temperature. Followed by five washes, the wells 424

were treated with horseradish peroxidase-conjugated GST antibody (Abcam, ab3416) at 425

1:10,000-fold dilution for 1 h at room temperature. After five washes with wash buffer and an 426

additional wash with phosphate-buffered saline, pH 7.4, the chromogenic substrate OPD 427

(0.4mg/ml o-phenylenediamine dihydrochloride in 0.1 M phosphate/citrate buffer, pH 5) and 428

H2O2 were added to visualize the interaction. After addition of stop solution (2.5 M H2SO4) the 429

absorbance was read at 490 nm. 430

431

Electrophoretic mobility shift assay (EMSA) 432

The DNA-σ factor binding by EMSA was carried out as described previously (51). DNA 433

fragment derived from the upstream region of usfX containing the predicted SigF-specific 434


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


20

promoter sequence (11, 16) was amplified from the M. tuberculosis H37Rv genome using 435

specific primers (Table 1). After purification, the 118-bp PCR product (1μg) was labeled with T4 436

polynucleotide kinase (Roche Applied Science) and [γ-32

P] ATP (BRIT, India), as per 437

manufacturer’s instructions. Radiolabeled PCR fragment was purified free of [γ-32

P] ATP and 438

PNK using nucleotide removal kit (Qiagen). EMSAs were performed by incubation of 0.2U E. 439

coli core polymerase enzyme (Epicentre Technologies) (11, 12) with varying concentrations of 440

purified SigF and pSigF in binding buffer (50 mM Tris–HCl, pH 8.0, 50 mM KCl 10 mM 441

MgCl2, 0.1 mM EDTA, 0.1 mM dithiothreitol, 5% v/v Glycerol) at 37°C for 10 min followed by 442

addition of 0.03pmol labeled DNA probe. After incubation for additional 30 minutes, 6X DNA 443

loading buffer (Fermentas) was added and the reactions were electrophoresed at 4°C on 5% 444

nondenaturing polyacrylamide gels in 0.5X TBE buffer for 2 hr at 200V and visualized by 445

autoradiography (Personal Molecular Imager system, Biorad). To quantify the amount of DNA 446

bound, ImageQuant data analysis software was used. 447

448

Gene expression analysis 449

M. tuberculosis strains containing pTC-mcs, pTC0X1-Rv1364c and pTC0X1-Rv1364c-S600A 450

were grown in Sauton’s media. Osmotic stress treatment was performed as described in (24). 451

Cultures were subcultured at OD 0.05 in Sauton’s media, grown to 0.6 OD and then NaCl added 452

to a final concentration of 140 mM or an equal volume of water followed by incubation in a 453

shaker incubator for 1h at 37C. Cultures were harvested by addition of equal volumes of 4M 454

GITC followed by centrifugation. The culture pellet was resupended in Trizol LS and RNA 455

extracted as reported previously (52). cDNA synthesis was performed using random hexamers 456

and qRT-PCR was performed using gene specific primers listed in Table 1. 457


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


21

458

Acknowledgments: We would like to thank Rakesh Sharma, Bhupesh Taneja, and Rajesh S 459

Gokhale for useful discussions during the course of this work and Ulf Gerth for helping with the 460

mass spectrometry analysis. This work was funded by CSIR Task Force Projects BSC0403, 461

BSC0123, DST Purse Grant and JC Bose Fellowship (SERB) to YS.462

The authors declare no conflict of interest with the contents of this article. 463

Author contributions: SG and YS guided the study. RM and SG wrote the manuscript. RM 464

performed all experiments in E. coli and with recombinant proteins with contributions from GA, 465

RV, MG, SN, ABo, AM, AS; DM and NJ performed experiments in M. tuberculosis; CH and 466

DB performed the mass spectrometry analysis; RM and ABh performed phylogenetic analysis; 467

VR and VKN provided strains and reagents; VR, PK and VKN provided inputs in discussion. 468

469

REFERENCES 470

1. WHO. 2014. Global tuberculosis report. World Health Organization, Geneva; 2014. 471

2. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier 472

K, Gas S, Barry CE, 3rd, Tekaia F, Badcock K, Basham D, Brown D, Chillingworth T, 473

Connor R, Davies R, Devlin K, Feltwell T, Gentles S, Hamlin N, Holroyd S, Hornsby T, 474

Jagels K, Krogh A, McLean J, Moule S, Murphy L, Oliver K, Osborne J, Quail MA, 475

Rajandream MA, Rogers J, Rutter S, Seeger K, Skelton J, Squares R, Squares S, Sulston 476

JE, Taylor K, Whitehead S, Barrell BG. 1998. Deciphering the biology of 477

Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-44. 478

3. Rodrigue S, Provvedi R, Jacques PE, Gaudreau L, Manganelli R. 2006. The sigma factors 479

of Mycobacterium tuberculosis. FEMS Microbiol Rev 30:926-41. 480


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


22

4. Sachdeva P, Misra R, Tyagi AK, Singh Y. 2010. The sigma factors of Mycobacterium 481

tuberculosis: regulation of the regulators. FEBS J 277:605-26. 482

5. DeMaio J, Zhang Y, Ko C, Young DB, Bishai WR. 1996. A stationary-phase stress-483

response sigma factor from Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 484

93:2790-4. 485

6. Keren I, Minami S, Rubin E, Lewis K. 2011. Characterization and transcriptome analysis 486

of Mycobacterium tuberculosis persisters. MBio 2:e00100-11. 487

7. Geiman DE, Kaushal D, Ko C, Tyagi S, Manabe YC, Schroeder BG, Fleischmann RD, 488

Morrison NE, Converse PJ, Chen P, Bishai WR. 2004. Attenuation of late-stage disease 489

in mice infected by the Mycobacterium tuberculosis mutant lacking the SigF alternate 490

sigma factor and identification of SigF-dependent genes by microarray analysis. Infect 491

Immun 72:1733-45. 492

8. Chen P, Ruiz RE, Li Q, Silver RF, Bishai WR. 2000. Construction and characterization 493

of a Mycobacterium tuberculosis mutant lacking the alternate sigma factor gene, sigF. 494

Infect Immun 68:5575-80. 495

9. Karls RK, Guarner J, McMurray DN, Birkness KA, Quinn FD. 2006. Examination of 496

Mycobacterium tuberculosis sigma factor mutants using low-dose aerosol infection of 497

guinea pigs suggests a role for SigC in pathogenesis. Microbiology 152:1591-600. 498

10. Hartkoorn RC, Sala C, Uplekar S, Busso P, Rougemont J, Cole ST. 2012. Genome-wide 499

definition of the SigF regulon in Mycobacterium tuberculosis. J Bacteriol 194:2001-9. 500


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


23

11. Rodrigue S, Brodeur J, Jacques PE, Gervais AL, Brzezinski R, Gaudreau L. 2007. 501

Identification of mycobacterial sigma factor binding sites by chromatin 502

immunoprecipitation assays. J Bacteriol 189:1505-13. 503

12. Williams EP, Lee JH, Bishai WR, Colantuoni C, Karakousis PC. 2007. Mycobacterium 504

tuberculosis SigF regulates genes encoding cell wall-associated proteins and directly 505

regulates the transcriptional regulatory gene phoY1. J Bacteriol 189:4234-42. 506

13. Galagan JE, Minch K, Peterson M, Lyubetskaya A, Azizi E, Sweet L, Gomes A, Rustad 507

T, Dolganov G, Glotova I, Abeel T, Mahwinney C, Kennedy AD, Allard R, Brabant W, 508

Krueger A, Jaini S, Honda B, Yu WH, Hickey MJ, Zucker J, Garay C, Weiner B, Sisk P, 509

Stolte C, Winkler JK, Van de Peer Y, Iazzetti P, Camacho D, Dreyfuss J, Liu Y, Dorhoi 510

A, Mollenkopf HJ, Drogaris P, Lamontagne J, Zhou Y, Piquenot J, Park ST, Raman S, 511

Kaufmann SH, Mohney RP, Chelsky D, Moody DB, Sherman DR, Schoolnik GK. 2013. 512

The Mycobacterium tuberculosis regulatory network and hypoxia. Nature 499:178-83. 513

14. Minch KJ, Rustad TR, Peterson EJ, Winkler J, Reiss DJ, Ma S, Hickey M, Brabant W, 514

Morrison B, Turkarslan S, Mawhinney C, Galagan JE, Price ND, Baliga NS, Sherman 515

DR. 2015. The DNA-binding network of Mycobacterium tuberculosis. Nat Commun 516

6:5829. 517

15. Hecker M, Pane-Farre J, Volker U. 2007. SigB-dependent general stress response in 518

Bacillus subtilis and related gram-positive bacteria. Annu Rev Microbiol 61:215-36. 519


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


24

16. Beaucher J, Rodrigue S, Jacques PE, Smith I, Brzezinski R, Gaudreau L. 2002. Novel 520

Mycobacterium tuberculosis anti-sigma factor antagonists control sigmaF activity by 521

distinct mechanisms. Mol Microbiol 45:1527-40. 522

17. Parida BK, Douglas T, Nino C, Dhandayuthapani S. 2005. Interactions of anti-sigma 523

factor antagonists of Mycobacterium tuberculosis in the yeast two-hybrid system. 524

Tuberculosis 85:347-55. 525

18. Greenstein AE, MacGurn JA, Baer CE, Falick AM, Cox JS, Alber T. 2007. M. 526

tuberculosis Ser/Thr protein kinase D phosphorylates an anti-anti-sigma factor homolog. 527

PLoS Pathog 3:e49. 528

19. Sachdeva P, Narayan A, Misra R, Brahmachari V, Singh Y. 2008. Loss of kinase activity 529

in Mycobacterium tuberculosis multidomain protein Rv1364c. FEBS J 275:6295-308. 530

20. Greenstein AE, Hammel M, Cavazos A, Alber T. 2009. Interdomain communication in 531

the Mycobacterium tuberculosis environmental phosphatase Rv1364c. J Biol Chem 532

284:29828-35. 533

21. Malik SS, Luthra A, Ramachandran R. 2009. Interactions of the M. tuberculosis UsfX 534

with the cognate sigma factor SigF and the anti-anti sigma factor RsfA. Biochim Biophys 535

Acta 1794:541-53. 536

22. Jaiswal RK, Manjeera G, Gopal B. 2010. Role of a PAS sensor domain in the 537

Mycobacterium tuberculosis transcription regulator Rv1364c. Biochem Biophys Res 538

Commun 398:342-9. 539


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


25

23. King-Scott J, Konarev PV, Panjikar S, Jordanova R, Svergun DI, Tucker PA. 2011. 540

Structural characterization of the multidomain regulatory protein Rv1364c from 541

Mycobacterium tuberculosis. Structure 19:56-69. 542

24. Hatzios SK, Baer CE, Rustad TR, Siegrist MS, Pang JM, Ortega C, Alber T, Grundner C, 543

Sherman DR, Bertozzi CR. 2013. Osmosensory signaling in Mycobacterium tuberculosis 544

mediated by a eukaryotic-like Ser/Thr protein kinase. Proc Natl Acad Sci U S A 545

110:E5069-77. 546

25. Chakraborti PK, Matange N, Nandicoori VK, Singh Y, Tyagi JS, Visweswariah SS. 547

2011. Signalling mechanisms in Mycobacteria. Tuberculosis 91:432-40. 548

26. Chao J, Wong D, Zheng X, Poirier V, Bach H, Hmama Z, Av-Gay Y. 2010. Protein 549

kinase and phosphatase signaling in Mycobacterium tuberculosis physiology and 550

pathogenesis. Biochim Biophys Acta 1804:620-7. 551

27. Park ST, Kang CM, Husson RN. 2008. Regulation of the SigH stress response regulon by 552

an essential protein kinase in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 553

105:13105-10. 554

28. Humpel A, Gebhard S, Cook GM, Berney M. 2010. The SigF regulon in Mycobacterium 555

smegmatis reveals roles in adaptation to stationary phase, heat, and oxidative stress. J 556

Bacteriol 192:2491-502. 557

29. Singh AK, Singh BN. 2008. Conservation of sigma F in mycobacteria and its expression 558

in Mycobacterium smegmatis. Curr Microbiol 56:574-80. 559


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


26

30. McNeil MM, Brown JM, Scalise G, Piersimoni C. 1992. Nonmycetomic Actinomadura 560

madurae infection in a patient with AIDS. J Clin Microbiol 30:1008-10. 561

31. Vertesy L, Ehlers E, Kogler H, Kurz M, Meiwes J, Seibert G, Vogel M, Hammann P. 562

2000. Friulimicins: novel lipopeptide antibiotics with peptidoglycan synthesis inhibiting 563

activity from Actinoplanes friuliensis sp. nov. II. Isolation and structural characterization. 564

J Antibiot (Tokyo) 53:816-27. 565

32. Wink JM, Kroppenstedt RM, Ganguli BN, Nadkarni SR, Schumann P, Seibert G, 566

Stackebrandt E. 2003. Three new antibiotic producing species of the genus 567

Amycolatopsis, Amycolatopsis balhimycina sp. nov., A. tolypomycina sp. nov., A. 568

vancoresmycina sp. nov., and description of Amycolatopsis keratiniphila subsp. 569

keratiniphila subsp. nov. and A. keratiniphila subsp. nogabecina subsp. nov. Syst Appl 570

Microbiol 26:38-46. 571

33. Marles-Wright J, Grant T, Delumeau O, van Duinen G, Firbank SJ, Lewis PJ, Murray 572

JW, Newman JA, Quin MB, Race PR, Rohou A, Tichelaar W, van Heel M, Lewis RJ. 573

2008. Molecular architecture of the "stressosome," a signal integration and transduction 574

hub. Science 322:92-6. 575

34. Reeves A, Martinez L, Haldenwang W. 2010. Expression of, and in vivo stressosome 576

formation by, single members of the RsbR protein family in Bacillus subtilis. 577

Microbiology 156:990-8. 578

35. Kim TJ, Gaidenko TA, Price CW. 2004. A multicomponent protein complex mediates 579

environmental stress signaling in Bacillus subtilis. J Mol Biol 341:135-50. 580


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


27

36. Barik S, Sureka K, Mukherjee P, Basu J, Kundu M. 2010. RseA, the SigE specific anti-581

sigma factor of Mycobacterium tuberculosis, is inactivated by phosphorylation-dependent 582

ClpC1P2 proteolysis. Mol Microbiol 75:592-606. 583

37. Shimizu M, Kato H, Ogawa T, Kurachi A, Nakagawa Y, Kobayashi H. 2010. Sigma 584

factor phosphorylation in the photosynthetic control of photosystem stoichiometry. Proc 585

Natl Acad Sci U S A 107:10760-4. 586

38. Locke JC, Young JW, Fontes M, Hernandez Jimenez MJ, Elowitz MB. 2011. Stochastic 587

pulse regulation in bacterial stress response. Science 334:366-9. 588

39. Garces A, Atmakuri K, Chase MR, Woodworth JS, Krastins B, Rothchild AC, Ramsdell 589

TL, Lopez MF, Behar SM, Sarracino DA, Fortune SM. 2010. EspA acts as a critical 590

mediator of ESX1-dependent virulence in Mycobacterium tuberculosis by affecting 591

bacterial cell wall integrity. PLoS Pathog 6:e1000957. 592

40. Waddell SJ, Chung GA, Gibson KJ, Everett MJ, Minnikin DE, Besra GS, Butcher PD. 593

2005. Inactivation of polyketide synthase and related genes results in the loss of complex 594

lipids in Mycobacterium tuberculosis H37Rv. Lett Appl Microbiol 40:201-6. 595

41. Klotzsche M, Ehrt S, Schnappinger D. 2009. Improved tetracycline repressors for gene 596

silencing in mycobacteria. Nucleic Acids Res 37:1778-88. 597

42. Gupta M, Sajid A, Arora G, Tandon V, Singh Y. 2009. Forkhead-associated domain-598

containing protein Rv0019c and polyketide-associated protein PapA5, from substrates of 599

serine/threonine protein kinase PknB to interacting proteins of Mycobacterium 600

tuberculosis. J Biol Chem 284:34723-34. 601


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


28

43. Sajid A, Arora G, Gupta M, Singhal A, Chakraborty K, Nandicoori VK, Singh Y. 2011. 602

Interaction of Mycobacterium tuberculosis elongation factor Tu with GTP is regulated by 603

phosphorylation. J Bacteriol 193:5347-58. 604

44. Koul A, Choidas A, Tyagi AK, Drlica K, Singh Y, Ullrich A. 2001. Serine/threonine 605

protein kinases PknF and PknG of Mycobacterium tuberculosis: characterization and 606

localization. Microbiology 147:2307-14. 607

45. Khan S, Nagarajan SN, Parikh A, Samantaray S, Singh A, Kumar D, Roy RP, Bhatt A, 608

Nandicoori VK. 2010. Phosphorylation of enoyl-acyl carrier protein reductase InhA 609

impacts mycobacterial growth and survival. J Biol Chem 285:37860-71. 610

46. Molle V, Leiba J, Zanella-Cleon I, Becchi M, Kremer L. 2010. An improved method to 611

unravel phosphoacceptors in Ser/Thr protein kinase-phosphorylated substrates. 612

Proteomics 10:3910-5. 613

47. Chopra P, Singh A, Koul A, Ramachandran S, Drlica K, Tyagi AK, Singh Y. 2003. 614

Cytotoxic activity of nucleoside diphosphate kinase secreted from Mycobacterium 615

tuberculosis. Eur J Biochem 270:625-34. 616

48. Molle V, Soulat D, Jault JM, Grangeasse C, Cozzone AJ, Prost JF. 2004. Two FHA 617

domains on an ABC transporter, Rv1747, mediate its phosphorylation by PknF, a Ser/Thr 618

protein kinase from Mycobacterium tuberculosis. FEMS Microbiol Lett 234:215-23. 619

49. Singhal A, Arora G, Sajid A, Maji A, Bhat A, Virmani R, Upadhyay S, Nandicoori VK, 620

Sengupta S, Singh Y. 2013. Regulation of homocysteine metabolism by Mycobacterium 621

tuberculosis S-adenosylhomocysteine hydrolase. Sci Rep 3:2264. 622


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


29

50. Lu YB, Ratnakar PV, Mohanty BK, Bastia D. 1996. Direct physical interaction between 623

DnaG primase and DnaB helicase of Escherichia coli is necessary for optimal synthesis 624

of primer RNA. Proc Natl Acad Sci U S A 93:12902-7. 625

51. Huang X, Lopez de Saro FJ, Helmann JD. 1997. Sigma factor mutations affecting the 626

sequence-selective interaction of RNA polymerase with -10 region single-stranded DNA. 627

Nucleic Acids Res 25:2603-9. 628

52. Gandotra S, Schnappinger D, Monteleone M, Hillen W, Ehrt S. 2007. In vivo gene 629

silencing identifies the Mycobacterium tuberculosis proteasome as essential for the 630

bacteria to persist in mice. Nat Med 13:1515-20. 631

632

Tables 633

Table 1: Primers used in this study 634

Primer Name Primer Sequence (5׳3

׳) **

Rv1364c N448A F.P TCCGAATTCGTCGAGGCCGCGGTCGAACACGGATAC

Rv1364c N448A R.P GTATCCGTGTTCGACCGCGGCCTCGACGAATTCGGA

Rv1364c E444A F.P CGTGCACGCGATCTCCGCATTCGTCGAGAACGCG

Rv1364c E444A R.P CGCGTTCTCGACGAATGCGGAGATCGCGTGCACG

Rv1364c S600A F.P GTCACCCACCTTGGTGCGGCCGGCGTCGGCGCC

Rv1364c S600A R.P GGCGCCGACGCCGGCCGCACCAAGGTGGGTGAC

Rv1364c S600E F.P GTCACCCACCTTGGTGAGGCCGGCGTCGGCGCC

Rv1364c S600E R.P GGCGCCGACGCCGGCCTCACCAAGGTGGGTGAC

PknD D138N F.P GGCGTAACGCACCGCAACGTAAAACCGG


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


30

PknD D138N R.P CCGGTTTTACGTTGCGGTGCGTTACGCC

pETDuet_SigF_F.P CGACGGGCGGCATCAAGCTTGTGACGGCGCGCGC

pETDuet_SigF_R.P CTCGCCGAGATCAAGTAGGCGGCCGCCTACTCCAACTGAT

CCCG

pGEX_SigF_F.P GCCCGACGGGCGGGATCCAGCAGGTGACGG

pGEX_SigF_R.P CTCGCCGAGATCAAGTAAGGCGGCCGCCTACTCCAACTGA

TCCCG

pGEX_Rv0516c_F.P CGACGGAGAACGAGGATCCTGATGACTACCACGATCCC

pGEX_Rv0516c_R.P CACAACGACGACCCGCGGCCGCTTTAGGCTGACC

pMAL_1364_F.P GGTCCGTAGGAGGGACGGATCCATGGCGGCCGAAATGG

pMAL_1364_R.P CGTGCAGGCTCGTTGAAGCTTCTACTCCTGGGCGAAGATG

pACDuet_PknD F.P GACCTAGTGAAGGGAATTCGCATATGAGCGATGCCGTTCC

G

pACDuet_PknD R.P GCCGACGACGGCCTCGAGCTTCCGTTTGTTGCCGGC

pACDuet_Rv1364c

F.P

GTCCGTAGGAGGGATCCCCAAATGGCGGCCGAAATGG

pACDuet_Rv1364c

R.P

CCGTGCAGGCTCGTTGAAGCTTCTACTCCTGGGCGAAG

Promoter_SigF F.P GCGGCTGGAAATCCCGGCATCGCGGG

Promoter_SigF R.P GGTCGGACCTGCTGGTAGTGGGGATCTAACGC

Rv1364c_RTF TCGGTGCGGCCGAGGATGTACG

Rv1364c_RTR TAGACCTCCCGAGCGGGCTGTC


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


31

16S rRNA_RTF TACGTTCCCGGGCCTTGT

16S rRNA_RTR AATCGCCGATCCCACCTT

espA_RTF TCCGGGTGATGGCTGGTTAG

espA_RTR GGTCGTGGATCAGGCTGATG

pks6_RTF CGTAGTGCTGACTCGTTAAG

pks6_RTR TCGGTCAGAAAGTCCCATAG

635

Table2: Plasmids used in this study 636

Strain/Plasmid

construct Description Source

Escherichia coli DH5α E. coli strain used for cloning Novagen, USA

Escherichia coli BL21

(DE3) E. coli strain used for protein expression Stratagene, USA

pProEx-HTc E. coli Expression vector with N-terminal

His6-tag Invitrogen

pProEx-HTc-Rv1364c

(Rv1364c) His6-Rv1364c1-653 (full length) (19)

pProEx-HTc-Rv1364c

D211A (Rv1364c

D211A)

His6- Rv1364c1-653 carrying mutation in

phosphatase domain at 211 residue Asp

to Ala

(19)

pProEx-HTc-Rv1364c

D328A (Rv1364c

D328A)


phosphatase domain at 328 residue Asp

to Ala

(19)

pProEx-HTc-Rv1364c

E444A (Rv1364c

E444A)


kinase domain at 444 residue Glu to Ala This study

pProEx-HTc-Rv1364c

N448A (Rv1364c

N448A)


kinase domain at 448 residue Asn to Ala This study

pProEx-HTc-Rv1364c

S600A (Rv1364c

S600A)


substrate domain at 600 residue Ser to

Ala

This study

pProEx-HTc-Rv1364c

S600E (Rv1364c S600E)


substrate domain at 600 residue Ser to

Glu

This study

pProEx-HTc-PknAcat His6-PknA1-337 (cytosolic domain) (43)

pProEx-HTc-Pstpc His6-Pstp1-300 (cytosolic domain) (42)


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


32

pLCD1-SigF His6-SigF Kind gift from

Dr. W.R. Bishai

pGEX-5X-3 E. coli Expression vector with N-

terminal Glutathione S-Transferase tag GE Healthcare

pGEX-5X-3-Rv1365c

(Rv1365c)

GST-Rv1365c1- 128 (full length) cloned

into BamHI/XhoI This study

pGEX-5X-3-Rv1904

(Rv1904)

GST-Rv19041-143 (full length) cloned

into BamHI/XhoI This study

pGEX-5X-3-Rv2638

(Rv2638) GST-Rv26381-148 (full length) (19)

pGEX-5X-3-Rv3687c

(Rv3687c) GST-Rv3687c1-122 (full length) (19)

pGEX-5X-3-

Rv1364cKD (G-

Rv1364cKD)

GST-Rv1364cc398-544 (kinase domain of

Rv1364c)

(19)

pGEX-5X-3-Rv3287c

(G-UsfX)

GST-Rv3287c1-145 (full length) cloned

into BamHI/NotI (19)

pGEX-5X-3-Rv3286c

(G-SigF) GST-Rv3286c1-261 (full length) This study

pGEX-5X-3-PknBc

(PknB) GST-PknB1-331 (cytosolic domain) (42)

pGEX-5X-3-PknDc

(PknD) GST-PknD1-378 (cytosolic domain) (43)

pGEX-5X-3-PknDc

D138N (PknDD138N)

GST-PknD1-378 carrying mutation in

kinase domain at 138 residue This study

pGEX-5X-3-PknE

(PknE) GST-PknE1-566 (full length protein) (43)

pGEX-5X-3-PknF

(PknF) GST-PknF1-476 (full length protein) (44)

pGEX-5X-3-PknG

(PknG) GST-PknG1-750 (full length protein) (44)

pGEX-5X-3-PknHc

(PknH) GST-PknH1-403 (cytosolic domain) (43)

pGEX-5X-3-Rv0516c GST- Rv0516c1-158 (full length) This study

pMAL-c2x E.coli expression vector with MBP tag NEB

pMAL-Rv1364c Rv1364c cloned into BamHi/HindIII This study

pETDuet-1™

E. coli dual expression vector, Two

multiple cloning sites (MCS1 and

MCS2), each preceded by an

independent T7 promoter

Novagen

pETDuet-MBP MBP tag cloned into Nde/EcoRV of

MCS2 (45)

pETDuet-MBP-

PknDKD

MBP-PknD Kinase domain cloned into

Nde/EcoRV of MCS2 (45)


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


33

pETDuet-MBP-SigF SigF cloned into HindIII/NotI of MCS1

of pETDuet-MBP This study

pETDuet-MBP-

PknDKD-SigF

SigF cloned into HindIII/NotI of MCS1

of pETDuet-MBP-PknDKD This study

pACYC Duet-1™

E. coli dual expression vector, Two

multiple cloning sites (MCS1 and

MCS2), each preceded by an

independent T7 promoter, ChlR

Novagen

pACDuet-PknDKD PknD Kinase domain cloned into

Nde/XhoI of MCS2 This study

pACDuet-Rv1364c His6-Rv1364c cloned into

BamHI/HindIII of MCS1

This study

pACDuet- PknDKD-

Rv1364c

PknD Kinase domain cloned into

Nde/XhoI of MCS2 and His6-Rv1364c

cloned into BamHI/HindIII of MCS1

This study

pCR-blunt E. coli blunt cloning vector. Invitrogen

pTC0X1L Mycobacterial integrative expression

vector, containing UV15tetO promoter,

kanr.

Addgene (41)

pTC-mcs Mycobacterial integrative vector, kanr. Addgene (41)

pTC0X1-Rv1364c Rv1364c was cloned at NdeI-PsiI site of

pTC0X1L plasmid.

This study

637

638

Figure Legends 639

Figure 1: Conserved ATPase and autophosphorylation activity in Rv1364c and effect on 640

interaction with SigF (A) Thin layer chromatography and autoradiography based ATPase 641

activity of purified Rv1364c, its indicated variants or the positive control, Rv1747 possessing the 642

ATPase domain, at 0 min and 60 min post incubation with [α-32

P] ATP. Buffer alone acted as 643

negative control, SD=substrate domain of Rv1364c, PD=phosphatase domain of Rv1364c. Graph 644

in the lower panel indicates relative ADP formation, measured using densitometry and expressed 645

as a percentage of activity of the wild type protein. The results from three independent 646

experiments are presented here as mean ± SEM. (B) Pro-Q®

diamond staining of recombinant 647

Rv1364c and its variants. Pro-Q®

diamond staining indicates phosphorylation level while 648


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


34

SYPRO Ruby stains total protein. Graph in the lower panel indicates ratio of the two densities 649

normalized for each protein variant to that of wild type protein. Data are mean of three 650

independent experiments, each in triplicate (mean ± SEM). ANOVA and Dunnette’s post test 651

was used to compare all groups to wild type Rv1364c (***p<0.001, **p<0.01, *p<0.05, ns=not 652

significant). (C) His6-tagged Rv1364c and its phosphoablative variant Rv1364c S600A were 653

immobilized (500 ng/well) on the surface of the microtiter plate and challenged with increasing 654

concentrations (0–1000 ng) of GST-tagged fusion proteins, SigF and GST alone (negative 655

control) in solution. The error bars indicate mean ± SD of triplicate readings. 656

657

Figure 2: PknD phosphorylates both Rv1364c and SigF (A) In vitro kinase assay of Rv1364c 658

with STPK, PknD. Digestion of the reaction products with TEV protease resolves 659

phosphorylation of Rv1364c WT/S600A and PknD. Phosphorylation of Rv1364cS600A by 660

PknD reveals a site distinct from the conserved autophosphorylation site. (B) In vitro kinase 661

assay of Rv1364c with WT PknD, WT PknD in presence of inhibitor, SP600125 and kinase-dead 662

mutant PknDD138N. Loss of phosphorylation by the PknD inhibitor and kinase-dead PknD shows 663

that PknD specifically phosphorylates Rv1364c. Rv0516c was included as a positive control. (C) 664

In vitro kinase assay of M. tuberculosis STPKs (labeled on top) to check phosphorylation of SigF 665

in presence of [γ-32

P]-ATP. Arrow indicates SigF. (D) In vitro kinase assay of SigF with WT 666

PknD and its kinase-dead mutant PknDD138N also shows specificity of PknD-mediated 667

phosphorylation of SigF. Autoradiograph (lower panel) of PknD phosphorylated Rv1364c (E) 668

and SigF (F) after incubation with purified M. tuberculosis phosphatase PstP for indicated times 669

at 25C shows reversibility of the PknD mediated phosphorylation. Top panel indicates equal 670

amount of protein in all lanes based on Coomassie brilliant blue (CBB) staining. Lower panels 671


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


35

are the autoradiograph images of the same dried protein gel visualized by PhosphorImager FLA 672

2000/ GE Typhoon Trio Imager. 673

674

Figure 3: PknD-mediated phosphorylation leads to decreased Rv1364c-SigF binding in vitro 675

Rv1364c (His6-tagged) and SigF (GST tagged) purified from cultures co-expressing MBP alone 676

and MBP-PknD were evaluated for their phosphorylation by (A) Pro-Q®

diamond staining, (B) 677

two-dimensional gel electrophoresis and interaction by (C) ELISA. (A) Top panel is the Pro-Q®

678

diamond stained gel and lower panel is coomassie brilliant blue staining of same gel. pG-SigF 679

and pRv1364c refer to the phosphorylated form of the proteins obtained from cultures co-680

expressing PknD. (B) Two-dimensional gels of Rv1364c protein purified from E. coli 681

overexpressing pACYC-PknD-Rv1364c (upper panel) or pACYC-Rv1364c (lower panel). 682

Approximately 500pg of precipitated proteins were resolved on a 7-cm pH 4–7 linear gradient 683

followed by second dimension on 10% SDS-polyacrylamide gels and subjected to 684

immunoblotting with anti-Rv1364c antibody. Rv1364c co-expressed with PknD in E. coli gets 685

phosphorylated in vivo and shows additional acidic phospho-isoforms compared to the PknD-686

naïve condition. (C) His6-tagged Rv1364c/pRv1364c was immobilized (500 ng/well) on the 687

surface of the microtiter plate and challenged with increasing concentrations (0–1000 ng) of 688

GST-tagged SigF/pG-SigF in solution. GST alone acted as negative control. The values were 689

normalized with the negative control, GST. Inset shows the same experiment with only the 690

phosphorylated forms of interacting proteins, pRv1364c and pG-SigF. The error bars indicate 691

mean±SD of three independent experiments each with three technical replicates. Student’s t-test 692

was applied for comparing means across groups (*p<0.05, **p<0.01). 693

694


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


36

Figure 4: Phosphorylated SigF binds tightly to target gene promoter A, Binding of SigF to 695

sigF promoter in presence of E. coli core RNA polymerase measured using EMSA. B and C, E. 696

coli core RNA polymerase recruitment by SigF or pSigF to sigF promoter measured using 697

EMSA. The percentage of DNA in complex was calculated using the formula: [100*bound 698

probe/total probe]. Bar graph represents mean± SD from three independent experiments (C). D 699

and E, Strength and specificity of DNA binding by SigF-RNA polymerase versus pSigF-RNA 700

polymerase complexes measured by EMSA. The percentage of released DNA was calculated 701

using the formula: 100*[1-{(free probe-SigF-free probe+SigF0

)/ (free probe-SigF-free probe+SigFx

)}timec] 702

where 0 refers to no competing probe and x refers to a particular amount of competing probe. 703

Bar graph represents mean± SD from four independent experiments (E). T-test was used for 704

comparing means between SigF and pSigF for each DNA concentration (*p<0.05, **p<0.01, 705

***p<0.001). 706

707

Figure 5: Rv1364c regulates virulence factor espA under osmotic stress. 708

Relative expression of Rv1364c, espA, and pks6 as measured by qRT-PCR in M. tuberculosis 709

cultures harboring pTC0X1-Rv1364c versus pTC-mcs, in presence or absence of osmotic stress. 710

Cultures were exposed to 140mM NaCl for 1h to induce osmotic stress. Gene expression is 711

normalized to 16S rRNA expression. Values are mean±SEM from six independent cultures. T-712

test was used for comparing means between indicated groups (ns=not significant, *p<0.05, 713

**p<0.01). 714

715

Figure 6: Schematic representation of regulation of SigF in M. tuberculosis (A) Domain 716

architecture of Rv1364c indicating each of its domains. (B) Model of SigF regulation based on 717


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


37

previous studies (16, 18, 19, 24) and results from the current study. Two anti- factors, the 718

cognate UsfX and the multidomain regulator Rv1364c, bind to and negatively regulate SigF, the 719

M. tuberculosis homolog of B. subtilis SigB. Osmotic stress stimulated activation of PknD may 720

lead to phosphorylation of Rv1364c and SigF, thereby affecting their ability to interact with each 721

other and releasing SigF. Both the native unphosphorylated and phosphorylated SigF can recruit 722

RNA polymerase and may possibly control different genes of its regulon in response to osmotic 723

stress. Overexpression of Rv1364c may either increase expression of some genes such as pks6 or 724

negatively influence expression of others such as espA, suggesting influence of other SigF 725

regulators that can directly interact with Rv1364c and influence SigF regulon. 726


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Documents

Downloaded from on May 27, 2020 by guest · 10-01-2019 · 4 Richa Misra 1, Dilip Menon 2, Gunjan Arora 1, Richa Virmani 1, Mohita Gaur 3, Saba Naz 4, 5 Neetika Jaisinghani 2, Asani